Clone Information

BLAST Search Result

Clone Name	rbags24h23
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	gb\|DQ175860.1\| Hordeum vulgare clone DsC33 Ds insertion site fla...	262	7e-67
2	gb\|AY103621.1\| Zea mays PCO154872 mRNA sequence	145	1e-31
3	gb\|BT017327.1\| Zea mays clone EL01N0320F05.c mRNA sequence	137	3e-29
4	gb\|AY103768.1\| Zea mays PCO155588 mRNA sequence	137	3e-29
5	gb\|AC124143.2\| Oryza sativa (japonica cultivar-group) chromosome...	115	1e-22
6	dbj\|AP008211.1\| Oryza sativa (japonica cultivar-group) genomic D...	115	1e-22
7	dbj\|D21301.1\|RICSS128 Oryza sativa SS128 mRNA for ribosomal prot...	115	1e-22
8	dbj\|AK102673.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	115	1e-22
9	gb\|BT016199.1\| Zea mays clone Contig32 mRNA sequence	113	4e-22
10	ref\|NM_191921.1\| Oryza sativa (japonica cultivar-group), predic...	92	1e-15
11	dbj\|AP008207.1\| Oryza sativa (japonica cultivar-group) genomic D...	92	1e-15
12	dbj\|AP003760.4\| Oryza sativa (japonica cultivar-group) genomic D...	92	1e-15
13	gb\|BT017504.1\| Zea mays clone EL01N0414H05.c mRNA sequence	80	5e-12
14	ref\|NM_191253.1\| Oryza sativa (japonica cultivar-group), predic...	74	3e-10
15	dbj\|AP003249.3\| Oryza sativa (japonica cultivar-group) genomic D...	74	3e-10
16	dbj\|AP003237.2\| Oryza sativa (japonica cultivar-group) genomic D...	74	3e-10
17	dbj\|AK121755.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	74	3e-10
18	gb\|DQ200390.1\| Solanum tuberosum clone 067G06 unknown mRNA	68	2e-08
19	gb\|BT016634.1\| Zea mays clone Contig467 mRNA sequence	64	3e-07
20	gb\|AC146330.33\| Medicago truncatula clone mth2-7g7, complete seq...	62	1e-06
21	gb\|BT014521.1\| Lycopersicon esculentum clone 133914F, mRNA sequence	60	5e-06
22	gb\|DQ235168.1\| Solanum tuberosum clone 154B10 unknown mRNA	54	3e-04
23	ref\|NM_112321.2\| Arabidopsis thaliana structural constituent of ...	52	0.001
24	ref\|NM_179398.1\| Arabidopsis thaliana structural constituent of ...	52	0.001
25	gb\|DQ235171.1\| Solanum tuberosum clone 155B02 unknown mRNA	52	0.001
26	ref\|XM_524153.1\| PREDICTED: Pan troglodytes similar to ribosomal...	52	0.001
27	ref\|NM_000980.2\| Homo sapiens ribosomal protein L18a (RPL18A), mRNA	52	0.001
28	gb\|U52111.3\| Homo sapiens chromosome X clone Qc-7G6, QLL-F1720, ...	52	0.001
29	gb\|AC089983.23\| Homo sapiens 12 BAC RP11-818F20 (Roswell Park Ca...	52	0.001
30	gb\|BC098413.1\| Homo sapiens cDNA clone IMAGE:6208834, **** WARNI...	52	0.001
31	gb\|BC062307.1\| Homo sapiens cDNA clone IMAGE:3504574, **** WARNI...	52	0.001
32	gb\|BC071836.1\| Homo sapiens cDNA clone IMAGE:6210072, **** WARNI...	52	0.001
33	gb\|AF334839.1\| Castanea sativa ribosomal protein L18a mRNA, comp...	52	0.001
34	gb\|BT000059.1\| Arabidopsis thaliana 60S ribosomal protein L18A, ...	52	0.001
35	gb\|BC066319.1\| Homo sapiens ribosomal protein L18a, mRNA (cDNA c...	52	0.001
36	gb\|BC007512.2\| Homo sapiens ribosomal protein L18a, mRNA (cDNA c...	52	0.001
37	gb\|AY128411.1\| Arabidopsis thaliana 60S ribosomal protein L18A, ...	52	0.001
38	emb\|CR615832.1\| full-length cDNA clone CS0DL001YB06 of B cells (...	52	0.001
39	emb\|CR624588.1\| full-length cDNA clone CS0DI021YD01 of Placenta ...	52	0.001
40	emb\|CR619918.1\| full-length cDNA clone CS0DM013YP23 of Fetal liv...	52	0.001
41	emb\|CR619120.1\| full-length cDNA clone CS0DI077YH09 of Placenta ...	52	0.001
42	emb\|CR617184.1\| full-length cDNA clone CS0DJ005YO06 of T cells (...	52	0.001
43	emb\|CR606905.1\| full-length cDNA clone CS0DC025YL04 of Neuroblas...	52	0.001
44	emb\|CR603612.1\| full-length cDNA clone CS0DB009YJ04 of Neuroblas...	52	0.001
45	emb\|CR600519.1\| full-length cDNA clone CS0DC003YF24 of Neuroblas...	52	0.001
46	emb\|CR600845.1\| full-length cDNA clone CS0DA007YA19 of Neuroblas...	52	0.001
47	emb\|CR594005.1\| full-length cDNA clone CL0BB004ZF10 of Neuroblas...	52	0.001
48	emb\|CR592115.1\| full-length cDNA clone CS0DI063YB22 of Placenta ...	52	0.001
49	gb\|AY097377.1\| Arabidopsis thaliana AT3g14600/MIE1_10 mRNA, comp...	52	0.001
50	ref\|NR_001593.1\| Homo sapiens similar to ribosomal protein L18a;...	52	0.001
51	gb\|AY072540.1\| Arabidopsis thaliana AT3g14600/MIE1_10 mRNA, comp...	52	0.001
52	ref\|XM_938382.1\| PREDICTED: Homo sapiens similar to ribosomal pr...	52	0.001
53	ref\|XM_293412.3\| PREDICTED: Homo sapiens similar to ribosomal pr...	52	0.001
54	ref\|XM_945469.1\| PREDICTED: Homo sapiens similar to ribosomal pr...	52	0.001
55	ref\|XM_945465.1\| PREDICTED: Homo sapiens similar to ribosomal pr...	52	0.001
56	ref\|XM_941835.1\| PREDICTED: Homo sapiens similar to ribosomal pr...	52	0.001
57	ref\|XM_934020.1\| PREDICTED: Homo sapiens similar to ribosomal pr...	52	0.001
58	ref\|XM_934018.1\| PREDICTED: Homo sapiens similar to ribosomal pr...	52	0.001
59	ref\|XM_208281.6\| PREDICTED: Homo sapiens similar to ribosomal pr...	52	0.001
60	emb\|BX816320.1\|CNS0AD9L Arabidopsis thaliana Full-length cDNA Co...	52	0.001
61	dbj\|AK222647.1\| Homo sapiens mRNA for ribosomal protein L18a var...	52	0.001
62	gb\|AC022455.5\|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P...	52	0.001
63	gb\|AY088351.1\| Arabidopsis thaliana clone 5961 mRNA, complete se...	52	0.001
64	gb\|AC079250.7\| Homo sapiens BAC clone RP11-62I18 from 2, complet...	52	0.001
65	gb\|L05093.1\|HUMRIBPROD Homo sapiens ribosomal protein L18a mRNA,...	52	0.001
66	dbj\|AB023038.1\| Arabidopsis thaliana genomic DNA, chromosome 3, ...	52	0.001
67	dbj\|AK110262.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	52	0.001
68	gb\|BC071920.1\| Homo sapiens ribosomal protein L18a, mRNA (cDNA c...	52	0.001
69	emb\|X80822.1\|HSPLORF H.sapiens mRNA for ORF	52	0.001
70	gb\|AY231805.1\| Drosophila yakuba clone yak-em_RpL18A mRNA sequence	50	0.005
71	gb\|AC121781.3\| Mus musculus BAC clone RP23-363D24 from chromosom...	48	0.019
72	emb\|BX005240.7\| Mouse DNA sequence from clone RP23-185M16 on chr...	48	0.019
73	ref\|NM_129000.2\| Arabidopsis thaliana structural constituent of ...	46	0.076
74	gb\|BT000076.1\| Arabidopsis thaliana 60S ribosomal protein L18A (...	46	0.076
75	gb\|AY120778.1\| Arabidopsis thaliana 60S ribosomal protein L18A (...	46	0.076
76	gb\|AC004481.3\| Arabidopsis thaliana chromosome 2 clone F13P17 ma...	46	0.076
77	gb\|AC004077.3\| Arabidopsis thaliana chromosome 2 clone T31E10 ma...	46	0.076
78	gb\|AC016180.14\| Homo sapiens chromosome , clone RP11-553E24, com...	46	0.076
79	ref\|XM_938219.1\| PREDICTED: Homo sapiens similar to ribosomal pr...	46	0.076
80	ref\|XM_926392.1\| PREDICTED: Homo sapiens similar to ribosomal pr...	46	0.076
81	gb\|BT006559.1\| Arabidopsis thaliana At2g34480 gene, complete cds	46	0.076
82	gb\|AY042803.1\| Arabidopsis thaliana Unknown protein mRNA, comple...	46	0.076
83	emb\|BX818972.1\|CNS0A9U8 Arabidopsis thaliana Full-length cDNA Co...	46	0.076
84	emb\|BX818907.1\|CNS0A9RI Arabidopsis thaliana Full-length cDNA Co...	46	0.076
85	emb\|AL929182.4\| Zebrafish DNA sequence from clone CH211-195E3 in...	46	0.076
86	ref\|XM_520487.1\| PREDICTED: Pan troglodytes similar to ribosomal...	44	0.30
87	ref\|XM_515461.1\| PREDICTED: Pan troglodytes LOC459217 (LOC459217...	44	0.30
88	ref\|NM_001016690.2\| Xenopus tropicalis hypothetical protein LOC5...	44	0.30
89	gb\|AY190708.1\| Pagrus major ribosomal protein L18a mRNA, partial...	44	0.30
90	ref\|XM_881581.1\| PREDICTED: Bos taurus similar to ribosomal prot...	44	0.30
91	ref\|XM_881547.1\| PREDICTED: Bos taurus similar to ribosomal prot...	44	0.30
92	ref\|XM_581579.2\| PREDICTED: Bos taurus similar to ribosomal prot...	44	0.30
93	ref\|XM_881521.1\| PREDICTED: Bos taurus similar to ribosomal prot...	44	0.30
94	ref\|XM_864838.1\| PREDICTED: Bos taurus similar to ribosomal prot...	44	0.30
95	ref\|NM_001033619.1\| Bos taurus similar to ribosomal protein L18a...	44	0.30
96	gb\|BC042256.1\| Xenopus laevis similar to ribosomal protein L18a,...	44	0.30
97	ref\|XM_860467.1\| PREDICTED: Canis familiaris similar to ribosoma...	44	0.30
98	ref\|XM_533877.2\| PREDICTED: Canis familiaris similar to ribosoma...	44	0.30
99	ref\|XM_533842.2\| PREDICTED: Canis familiaris similar to ribosoma...	44	0.30
100	gb\|AC125229.3\| Mus musculus BAC clone RP23-45P1 from 5, complete...	44	0.30
101	emb\|CR734984.2\|CNS0GTW7 Tetraodon nigroviridis full-length cDNA	44	0.30
102	emb\|CR734787.2\|CNS0GTQQ Tetraodon nigroviridis full-length cDNA	44	0.30
103	emb\|CR734404.2\|CNS0GTG3 Tetraodon nigroviridis full-length cDNA	44	0.30
104	emb\|CR733930.2\|CNS0GT2X Tetraodon nigroviridis full-length cDNA	44	0.30
105	emb\|CR733929.2\|CNS0GT2W Tetraodon nigroviridis full-length cDNA	44	0.30
106	emb\|CR733735.2\|CNS0GSXI Tetraodon nigroviridis full-length cDNA	44	0.30
107	emb\|CR733734.2\|CNS0GSXH Tetraodon nigroviridis full-length cDNA	44	0.30
108	emb\|CR733720.2\|CNS0GSX3 Tetraodon nigroviridis full-length cDNA	44	0.30
109	emb\|CR733692.2\|CNS0GSWB Tetraodon nigroviridis full-length cDNA	44	0.30
110	emb\|CR732797.2\|CNS0GSD2 Tetraodon nigroviridis full-length cDNA	44	0.30
111	emb\|CR730027.2\|CNS0GQ8H Tetraodon nigroviridis full-length cDNA	44	0.30
112	emb\|CR724944.3\|CNS0GMBA Tetraodon nigroviridis full-length cDNA	44	0.30
113	emb\|CR724423.2\|CNS0GLWT Tetraodon nigroviridis full-length cDNA	44	0.30
114	emb\|CR723073.2\|CNS0GKVB Tetraodon nigroviridis full-length cDNA	44	0.30
115	emb\|CR720538.2\|CNS0GIWW Tetraodon nigroviridis full-length cDNA	44	0.30
116	emb\|CR719126.2\|CNS0GHTO Tetraodon nigroviridis full-length cDNA	44	0.30
117	emb\|CR718016.2\|CNS0GGYU Tetraodon nigroviridis full-length cDNA	44	0.30
118	emb\|CR717902.2\|CNS0GGVO Tetraodon nigroviridis full-length cDNA	44	0.30
119	emb\|CR707962.2\|CNS0G97Q Tetraodon nigroviridis full-length cDNA	44	0.30
120	emb\|CR706795.2\|CNS0G8BB Tetraodon nigroviridis full-length cDNA	44	0.30
121	emb\|CR706096.2\|CNS0G7RW Tetraodon nigroviridis full-length cDNA	44	0.30
122	emb\|CR703601.2\|CNS0G5UL Tetraodon nigroviridis full-length cDNA	44	0.30
123	emb\|CR697423.2\|CNS0G12Z Tetraodon nigroviridis full-length cDNA	44	0.30
124	emb\|CR696636.2\|CNS0G0H4 Tetraodon nigroviridis full-length cDNA	44	0.30
125	emb\|CR695615.2\|CNS0FZOR Tetraodon nigroviridis full-length cDNA	44	0.30
126	emb\|CR685828.2\|CNS0FS4W Tetraodon nigroviridis full-length cDNA	44	0.30
127	emb\|CR688470.2\|CNS0FU6A Tetraodon nigroviridis full-length cDNA	44	0.30
128	emb\|CR687228.2\|CNS0FT7S Tetraodon nigroviridis full-length cDNA	44	0.30
129	emb\|CR684968.2\|CNS0FRH0 Tetraodon nigroviridis full-length cDNA	44	0.30
130	emb\|CR683572.2\|CNS0FQE8 Tetraodon nigroviridis full-length cDNA	44	0.30
131	emb\|CR680258.2\|CNS0FNU6 Tetraodon nigroviridis full-length cDNA	44	0.30
132	emb\|CR677039.2\|CNS0FLD7 Tetraodon nigroviridis full-length cDNA	44	0.30
133	emb\|CR672902.2\|CNS0FI6K Tetraodon nigroviridis full-length cDNA	44	0.30
134	emb\|CR671291.2\|CNS0FGXT Tetraodon nigroviridis full-length cDNA	44	0.30
135	emb\|CR666969.2\|CNS0FDLR Tetraodon nigroviridis full-length cDNA	44	0.30
136	emb\|CR660236.2\|CNS0F8EQ Tetraodon nigroviridis full-length cDNA	44	0.30
137	emb\|CR655020.2\|CNS0F4DU Tetraodon nigroviridis full-length cDNA	44	0.30
138	emb\|CR653062.2\|CNS0F2VG Tetraodon nigroviridis full-length cDNA	44	0.30
139	emb\|CR652436.2\|CNS0F2E2 Tetraodon nigroviridis full-length cDNA	44	0.30
140	emb\|CR650724.2\|CNS0F12I Tetraodon nigroviridis full-length cDNA	44	0.30
141	emb\|CR649137.2\|CNS0EZUF Tetraodon nigroviridis full-length cDNA	44	0.30
142	emb\|CR648353.2\|CNS0EZ8N Tetraodon nigroviridis full-length cDNA	44	0.30
143	emb\|CR646910.2\|CNS0EY4K Tetraodon nigroviridis full-length cDNA	44	0.30
144	emb\|CR644204.2\|CNS0EW1E Tetraodon nigroviridis full-length cDNA	44	0.30
145	emb\|CR644108.2\|CNS0EVYQ Tetraodon nigroviridis full-length cDNA	44	0.30
146	emb\|CR642680.2\|CNS0EUV2 Tetraodon nigroviridis full-length cDNA	44	0.30
147	emb\|CR642616.2\|CNS0EUTA Tetraodon nigroviridis full-length cDNA	44	0.30
148	emb\|CR642452.2\|CNS0EUOQ Tetraodon nigroviridis full-length cDNA	44	0.30
149	emb\|CR638692.2\|CNS0ERSA Tetraodon nigroviridis full-length cDNA	44	0.30
150	emb\|CR638181.2\|CNS0ERE3 Tetraodon nigroviridis full-length cDNA	44	0.30
151	emb\|CR637544.2\|CNS0EQWE Tetraodon nigroviridis full-length cDNA	44	0.30
152	emb\|CR633797.2\|CNS0EO0B Tetraodon nigroviridis full-length cDNA	44	0.30
153	emb\|AL583805.7\| Human DNA sequence from clone RP11-134K1 on chro...	44	0.30
154	emb\|AL096764.11\|HSJ298J18 Human DNA sequence from clone RP1-298J...	44	0.30
155	ref\|NM_212510.1\| Rattus norvegicus similar to 60S ribosomal prot...	44	0.30
156	gb\|BC058498.1\| Rattus norvegicus similar to 60S ribosomal protei...	44	0.30
157	gb\|AC008481.9\| Homo sapiens chromosome 19 clone CTC-398G3, compl...	44	0.30
158	gb\|AY779046.1\| Homo sapiens ribosomal protein L18a-like protein ...	44	0.30
159	gb\|AC097638.2\| Homo sapiens chromosome 3 clone RP11-353H3, compl...	44	0.30
160	gb\|BC102624.1\| Bos taurus similar to ribosomal protein L18a, mRN...	44	0.30
161	gb\|AC008079.24\| Homo sapiens chromosome 22 clone bac519d21 map 2...	44	0.30
162	gb\|AC016830.5\| Homo sapiens chromosome 22 clone b81b3 map 22q11,...	44	0.30
163	gb\|AC008101.16\| Homo sapiens chromosome 22 clone b677f7 map 22q1...	44	0.30
164	gb\|AC016027.15\| Homo sapiens chromosome 22 clone b476c20 map 22q...	44	0.30
165	emb\|BX819594.1\|CNS0A9TR Arabidopsis thaliana Full-length cDNA Co...	44	0.30
166	gb\|AC121887.4\| Mus musculus BAC clone RP24-142B15 from 5, comple...	44	0.30
167	emb\|AJ718289.1\| Nicotiana tabacum cDNA-AFLP-fragment BSTT4-43-38...	44	0.30
168	emb\|X14181.1\|RRRPL18A Rat mRNA for ribosomal protein L18a	44	0.30
169	emb\|CR760185.2\| Xenopus tropicalis finished cDNA, clone TNeu035i09	44	0.30
170	dbj\|AB098916.1\| Bos taurus mRNA for similar to ribosomal protein...	44	0.30
171	gb\|AF045188.1\|AF045188 Salmo salar ribosomal protein L18a mRNA, ...	44	0.30
172	emb\|AL772378.8\| Mouse DNA sequence from clone RP23-106C4 on chro...	44	0.30
173	emb\|AJ421480.1\| Mus musculus X-inactivation center region; segme...	44	0.30
174	gb\|AY678266.1\| Synthetic construct monomeric red-orange fluoresc...	42	1.2
175	gb\|AY678265.1\| Synthetic construct monomeric orange fluorescent ...	42	1.2
176	gb\|AY678264.1\| Synthetic construct monomeric red fluorescent pro...	42	1.2
177	emb\|Z77131.1\|CEC54C6 Caenorhabditis elegans Cosmid C54C6, comple...	42	1.2
178	emb\|Z36237.1\|CEC48D5 Caenorhabditis elegans Cosmid C48D5, comple...	42	1.2
179	gb\|AY232187.1\| Drosophila yakuba clone yak-ad_RpL18A mRNA sequence	42	1.2
180	emb\|AL590640.19\| Human DNA sequence from clone RP11-40H20 on chr...	42	1.2
181	emb\|BX053393.1\|CNS09DD1 Single read from an extremity of a full-...	42	1.2
182	emb\|BX072011.1\|CNS09RQ7 Single read from an extremity of a full-...	42	1.2
183	emb\|BX072010.1\|CNS09RQ6 Single read from an extremity of a full-...	42	1.2
184	emb\|BX071935.1\|CNS09RO3 Single read from an extremity of a full-...	42	1.2
185	emb\|BX071934.1\|CNS09RO2 Single read from an extremity of a full-...	42	1.2
186	emb\|BX071198.1\|CNS09R3M Single read from an extremity of a full-...	42	1.2
187	emb\|BX071197.1\|CNS09R3L Single read from an extremity of a full-...	42	1.2
188	emb\|BX071326.1\|CNS09R76 Single read from an extremity of a full-...	42	1.2
189	emb\|BX071022.1\|CNS09QYQ Single read from an extremity of a full-...	42	1.2
190	emb\|BX071021.1\|CNS09QYP Single read from an extremity of a full-...	42	1.2
191	emb\|BX070958.1\|CNS09QWY Single read from an extremity of a full-...	42	1.2
192	emb\|BX070094.1\|CNS09Q8Y Single read from an extremity of a full-...	42	1.2
193	emb\|BX069977.1\|CNS09Q5P Single read from an extremity of a full-...	42	1.2
194	emb\|BX069941.1\|CNS09Q4P Single read from an extremity of a full-...	42	1.2
195	emb\|BX069940.1\|CNS09Q4O Single read from an extremity of a full-...	42	1.2
196	emb\|BX069703.1\|CNS09PY3 Single read from an extremity of a full-...	42	1.2
197	emb\|BX069702.1\|CNS09PY2 Single read from an extremity of a full-...	42	1.2
198	emb\|BX060940.1\|CNS09J6O Single read from an extremity of a full-...	42	1.2
199	emb\|BX060939.1\|CNS09J6N Single read from an extremity of a full-...	42	1.2
200	emb\|BX069369.1\|CNS09POT Single read from an extremity of a full-...	42	1.2
201	emb\|BX069368.1\|CNS09POS Single read from an extremity of a full-...	42	1.2
202	emb\|BX069214.1\|CNS09PKI Single read from an extremity of a full-...	42	1.2
203	emb\|BX069213.1\|CNS09PKH Single read from an extremity of a full-...	42	1.2
204	emb\|BX068918.1\|CNS09PCA Single read from an extremity of a full-...	42	1.2
205	emb\|BX068917.1\|CNS09PC9 Single read from an extremity of a full-...	42	1.2
206	emb\|BX068781.1\|CNS09P8H Single read from an extremity of a full-...	42	1.2
207	emb\|BX068780.1\|CNS09P8G Single read from an extremity of a full-...	42	1.2
208	emb\|BX068699.1\|CNS09P67 Single read from an extremity of a full-...	42	1.2
209	emb\|BX068698.1\|CNS09P66 Single read from an extremity of a full-...	42	1.2
210	emb\|BX068685.1\|CNS09P5T Single read from an extremity of a full-...	42	1.2
211	emb\|BX068632.1\|CNS09P4C Single read from an extremity of a full-...	42	1.2
212	emb\|BX068631.1\|CNS09P4B Single read from an extremity of a full-...	42	1.2
213	emb\|BX068389.1\|CNS09OXL Single read from an extremity of a full-...	42	1.2
214	emb\|BX068343.1\|CNS09OWB Single read from an extremity of a full-...	42	1.2
215	emb\|BX068342.1\|CNS09OWA Single read from an extremity of a full-...	42	1.2
216	emb\|BX068334.1\|CNS09OW2 Single read from an extremity of a full-...	42	1.2
217	emb\|BX068304.1\|CNS09OV8 Single read from an extremity of a full-...	42	1.2
218	emb\|BX068271.1\|CNS09OUB Single read from an extremity of a full-...	42	1.2
219	emb\|BX068270.1\|CNS09OUA Single read from an extremity of a full-...	42	1.2
220	emb\|BX068265.1\|CNS09OU5 Single read from an extremity of a full-...	42	1.2
221	emb\|BX068264.1\|CNS09OU4 Single read from an extremity of a full-...	42	1.2
222	emb\|BX068004.1\|CNS09OMW Single read from an extremity of a full-...	42	1.2
223	emb\|BX068003.1\|CNS09OMV Single read from an extremity of a full-...	42	1.2
224	emb\|BX067731.1\|CNS09OFB Single read from an extremity of a full-...	42	1.2
225	emb\|BX067730.1\|CNS09OFA Single read from an extremity of a full-...	42	1.2
226	emb\|BX067102.1\|CNS09NXU Single read from an extremity of a full-...	42	1.2
227	emb\|BX067101.1\|CNS09NXT Single read from an extremity of a full-...	42	1.2
228	emb\|BX066999.1\|CNS09NUZ Single read from an extremity of a full-...	42	1.2
229	emb\|BX066998.1\|CNS09NUY Single read from an extremity of a full-...	42	1.2
230	emb\|BX066931.1\|CNS09NT3 Single read from an extremity of a full-...	42	1.2
231	emb\|BX066843.1\|CNS09NQN Single read from an extremity of a full-...	42	1.2
232	emb\|BX066842.1\|CNS09NQM Single read from an extremity of a full-...	42	1.2
233	emb\|BX066697.1\|CNS09NML Single read from an extremity of a full-...	42	1.2
234	emb\|BX066444.1\|CNS09NFK Single read from an extremity of a full-...	42	1.2
235	emb\|BX065926.1\|CNS09N16 Single read from an extremity of a full-...	42	1.2
236	emb\|BX065925.1\|CNS09N15 Single read from an extremity of a full-...	42	1.2
237	emb\|BX065769.1\|CNS09MWT Single read from an extremity of a full-...	42	1.2
238	emb\|BX065768.1\|CNS09MWS Single read from an extremity of a full-...	42	1.2
239	emb\|BX065563.1\|CNS09MR3 Single read from an extremity of a full-...	42	1.2
240	emb\|BX065562.1\|CNS09MR2 Single read from an extremity of a full-...	42	1.2
241	emb\|BX065379.1\|CNS09MLZ Single read from an extremity of a full-...	42	1.2
242	emb\|BX065287.1\|CNS09MJF Single read from an extremity of a full-...	42	1.2
243	emb\|BX065286.1\|CNS09MJE Single read from an extremity of a full-...	42	1.2
244	emb\|BX065104.1\|CNS09MEC Single read from an extremity of a full-...	42	1.2
245	emb\|BX065103.1\|CNS09MEB Single read from an extremity of a full-...	42	1.2
246	emb\|BX065085.1\|CNS09MDT Single read from an extremity of a full-...	42	1.2
247	emb\|BX065080.1\|CNS09MDO Single read from an extremity of a full-...	42	1.2
248	emb\|BX065079.1\|CNS09MDN Single read from an extremity of a full-...	42	1.2
249	emb\|BX065033.1\|CNS09MCD Single read from an extremity of a full-...	42	1.2
250	emb\|BX065032.1\|CNS09MCC Single read from an extremity of a full-...	42	1.2
251	emb\|BX064042.1\|CNS09LKU Single read from an extremity of a full-...	42	1.2
252	emb\|BX064041.1\|CNS09LKT Single read from an extremity of a full-...	42	1.2
253	emb\|BX063680.1\|CNS09LAS Single read from an extremity of a full-...	42	1.2
254	emb\|BX063679.1\|CNS09LAR Single read from an extremity of a full-...	42	1.2
255	emb\|BX063678.1\|CNS09LAQ Single read from an extremity of a full-...	42	1.2
256	emb\|BX063630.1\|CNS09L9E Single read from an extremity of a full-...	42	1.2
257	emb\|BX063629.1\|CNS09L9D Single read from an extremity of a full-...	42	1.2
258	emb\|BX063028.1\|CNS09KSO Single read from an extremity of a full-...	42	1.2
259	emb\|BX063027.1\|CNS09KSN Single read from an extremity of a full-...	42	1.2
260	emb\|BX062931.1\|CNS09KPZ Single read from an extremity of a full-...	42	1.2
261	emb\|BX062913.1\|CNS09KPH Single read from an extremity of a full-...	42	1.2
262	emb\|BX062912.1\|CNS09KPG Single read from an extremity of a full-...	42	1.2
263	emb\|BX062805.1\|CNS09KMH Single read from an extremity of a full-...	42	1.2
264	emb\|BX062755.1\|CNS09KL3 Single read from an extremity of a full-...	42	1.2
265	emb\|BX062625.1\|CNS09KHH Single read from an extremity of a full-...	42	1.2
266	emb\|BX062624.1\|CNS09KHG Single read from an extremity of a full-...	42	1.2
267	emb\|BX062166.1\|CNS09K4Q Single read from an extremity of a full-...	42	1.2
268	emb\|BX062165.1\|CNS09K4P Single read from an extremity of a full-...	42	1.2
269	emb\|BX062118.1\|CNS09K3E Single read from an extremity of a full-...	42	1.2
270	emb\|BX062090.1\|CNS09K2M Single read from an extremity of a full-...	42	1.2
271	emb\|BX061845.1\|CNS09JVT Single read from an extremity of a full-...	42	1.2
272	emb\|BX061844.1\|CNS09JVS Single read from an extremity of a full-...	42	1.2
273	emb\|BX061453.1\|CNS09JKX Single read from an extremity of a full-...	42	1.2
274	emb\|BX061452.1\|CNS09JKW Single read from an extremity of a full-...	42	1.2
275	emb\|BX061383.1\|CNS09JIZ Single read from an extremity of a full-...	42	1.2
276	emb\|BX061292.1\|CNS09JGG Single read from an extremity of a full-...	42	1.2
277	emb\|BX061291.1\|CNS09JGF Single read from an extremity of a full-...	42	1.2
278	emb\|BX061184.1\|CNS09JDG Single read from an extremity of a full-...	42	1.2
279	emb\|BX060474.1\|CNS09ITQ Single read from an extremity of a full-...	42	1.2
280	emb\|BX060315.1\|CNS09IPB Single read from an extremity of a full-...	42	1.2
281	emb\|BX060314.1\|CNS09IPA Single read from an extremity of a full-...	42	1.2
282	emb\|BX060072.1\|CNS09IIK Single read from an extremity of a full-...	42	1.2
283	emb\|BX059980.1\|CNS09IG0 Single read from an extremity of a full-...	42	1.2
284	emb\|BX059979.1\|CNS09IFZ Single read from an extremity of a full-...	42	1.2
285	emb\|BX059598.1\|CNS09I5E Single read from an extremity of a full-...	42	1.2
286	emb\|BX059597.1\|CNS09I5D Single read from an extremity of a full-...	42	1.2
287	emb\|BX059276.1\|CNS09HWG Single read from an extremity of a full-...	42	1.2
288	emb\|BX059262.1\|CNS09HW2 Single read from an extremity of a full-...	42	1.2
289	emb\|BX059231.1\|CNS09HV7 Single read from an extremity of a full-...	42	1.2
290	emb\|BX059230.1\|CNS09HV6 Single read from an extremity of a full-...	42	1.2
291	emb\|BX058872.1\|CNS09HL8 Single read from an extremity of a full-...	42	1.2
292	emb\|BX058871.1\|CNS09HL7 Single read from an extremity of a full-...	42	1.2
293	emb\|BX058808.1\|CNS09HJG Single read from an extremity of a full-...	42	1.2
294	emb\|BX058807.1\|CNS09HJF Single read from an extremity of a full-...	42	1.2
295	emb\|BX058560.1\|CNS09HCK Single read from an extremity of a full-...	42	1.2
296	emb\|BX058559.1\|CNS09HCJ Single read from an extremity of a full-...	42	1.2
297	emb\|BX058281.1\|CNS09H4T Single read from an extremity of a full-...	42	1.2
298	emb\|BX058280.1\|CNS09H4S Single read from an extremity of a full-...	42	1.2
299	emb\|BX058269.1\|CNS09H4H Single read from an extremity of a full-...	42	1.2
300	emb\|BX056753.1\|CNS09FYD Single read from an extremity of a full-...	42	1.2
301	emb\|BX056602.1\|CNS09FU6 Single read from an extremity of a full-...	42	1.2
302	emb\|BX056601.1\|CNS09FU5 Single read from an extremity of a full-...	42	1.2
303	emb\|BX057958.1\|CNS09GVU Single read from an extremity of a full-...	42	1.2
304	emb\|BX056891.1\|CNS09G27 Single read from an extremity of a full-...	42	1.2
305	emb\|BX056571.1\|CNS09FTB Single read from an extremity of a full-...	42	1.2
306	emb\|BX056553.1\|CNS09FST Single read from an extremity of a full-...	42	1.2
307	emb\|BX056552.1\|CNS09FSS Single read from an extremity of a full-...	42	1.2
308	emb\|BX056479.1\|CNS09FQR Single read from an extremity of a full-...	42	1.2
309	emb\|BX056478.1\|CNS09FQQ Single read from an extremity of a full-...	42	1.2
310	emb\|BX056309.1\|CNS09FM1 Single read from an extremity of a full-...	42	1.2
311	emb\|BX056040.1\|CNS09FEK Single read from an extremity of a full-...	42	1.2
312	emb\|BX056039.1\|CNS09FEJ Single read from an extremity of a full-...	42	1.2
313	emb\|BX055724.1\|CNS09F5S Single read from an extremity of a full-...	42	1.2
314	emb\|BX055723.1\|CNS09F5R Single read from an extremity of a full-...	42	1.2
315	emb\|BX055717.1\|CNS09F5L Single read from an extremity of a full-...	42	1.2
316	emb\|BX055643.1\|CNS09F3J Single read from an extremity of a full-...	42	1.2
317	emb\|BX055642.1\|CNS09F3I Single read from an extremity of a full-...	42	1.2
318	emb\|BX055566.1\|CNS09F1E Single read from an extremity of a full-...	42	1.2
319	emb\|BX055565.1\|CNS09F1D Single read from an extremity of a full-...	42	1.2
320	emb\|BX055542.1\|CNS09F0Q Single read from an extremity of a full-...	42	1.2
321	emb\|BX055541.1\|CNS09F0P Single read from an extremity of a full-...	42	1.2
322	emb\|BX055478.1\|CNS09EYY Single read from an extremity of a full-...	42	1.2
323	emb\|BX055405.1\|CNS09EWX Single read from an extremity of a full-...	42	1.2
324	emb\|BX055404.1\|CNS09EWW Single read from an extremity of a full-...	42	1.2
325	emb\|BX055221.1\|CNS09ERT Single read from an extremity of a full-...	42	1.2
326	emb\|BX053165.1\|CNS09D6P Single read from an extremity of a full-...	42	1.2
327	emb\|BX055118.1\|CNS09EOY Single read from an extremity of a full-...	42	1.2
328	emb\|BX054551.1\|CNS09E97 Single read from an extremity of a full-...	42	1.2
329	emb\|BX054550.1\|CNS09E96 Single read from an extremity of a full-...	42	1.2
330	emb\|BX054490.1\|CNS09E7I Single read from an extremity of a full-...	42	1.2
331	emb\|BX054489.1\|CNS09E7H Single read from an extremity of a full-...	42	1.2
332	emb\|BX054096.1\|CNS09DWK Single read from an extremity of a full-...	42	1.2
333	emb\|BX054095.1\|CNS09DWJ Single read from an extremity of a full-...	42	1.2
334	emb\|BX053786.1\|CNS09DNY Single read from an extremity of a full-...	42	1.2
335	emb\|BX052786.1\|CNS09CW6 Single read from an extremity of a full-...	42	1.2
336	emb\|BX052785.1\|CNS09CW5 Single read from an extremity of a full-...	42	1.2
337	emb\|BX052679.1\|CNS09CT7 Single read from an extremity of a full-...	42	1.2
338	emb\|BX052678.1\|CNS09CT6 Single read from an extremity of a full-...	42	1.2
339	emb\|BX052629.1\|CNS09CRT Single read from an extremity of a full-...	42	1.2
340	emb\|BX052628.1\|CNS09CRS Single read from an extremity of a full-...	42	1.2
341	emb\|BX052573.1\|CNS09CQ9 Single read from an extremity of a full-...	42	1.2
342	emb\|BX052572.1\|CNS09CQ8 Single read from an extremity of a full-...	42	1.2
343	emb\|BX052510.1\|CNS09COI Single read from an extremity of a full-...	42	1.2
344	emb\|BX052509.1\|CNS09COH Single read from an extremity of a full-...	42	1.2
345	emb\|BX052467.1\|CNS09CNB Single read from an extremity of a full-...	42	1.2
346	emb\|BX052466.1\|CNS09CNA Single read from an extremity of a full-...	42	1.2
347	emb\|BX052004.1\|CNS09CAG Single read from an extremity of a full-...	42	1.2
348	emb\|BX051855.1\|CNS09C6B Single read from an extremity of a full-...	42	1.2
349	emb\|BX051854.1\|CNS09C6A Single read from an extremity of a full-...	42	1.2
350	emb\|BX050971.1\|CNS09BHR Single read from an extremity of a full-...	42	1.2
351	emb\|BX050970.1\|CNS09BHQ Single read from an extremity of a full-...	42	1.2
352	emb\|BX050606.1\|CNS09B7M Single read from an extremity of a full-...	42	1.2
353	emb\|BX050495.1\|CNS09B4J Single read from an extremity of a full-...	42	1.2
354	emb\|BX050494.1\|CNS09B4I Single read from an extremity of a full-...	42	1.2
355	emb\|BX049990.1\|CNS09AQI Single read from an extremity of a full-...	42	1.2
356	emb\|BX049989.1\|CNS09AQH Single read from an extremity of a full-...	42	1.2
357	emb\|BX049718.1\|CNS09AIY Single read from an extremity of a full-...	42	1.2
358	emb\|BX049717.1\|CNS09AIX Single read from an extremity of a full-...	42	1.2
359	emb\|BX031004.1\|CNS08W34 Single read from an extremity of a full-...	42	1.2
360	emb\|BX031003.1\|CNS08W33 Single read from an extremity of a full-...	42	1.2
361	emb\|BX049059.1\|CNS09A0N Single read from an extremity of a full-...	42	1.2
362	emb\|BX049058.1\|CNS09A0M Single read from an extremity of a full-...	42	1.2
363	emb\|BX048922.1\|CNS099WU Single read from an extremity of a full-...	42	1.2
364	emb\|BX048811.1\|CNS099TR Single read from an extremity of a full-...	42	1.2
365	emb\|BX048769.1\|CNS099SL Single read from an extremity of a full-...	42	1.2
366	emb\|BX048695.1\|CNS099QJ Single read from an extremity of a full-...	42	1.2
367	emb\|BX048134.1\|CNS099AY Single read from an extremity of a full-...	42	1.2
368	emb\|BX048132.1\|CNS099AW Single read from an extremity of a full-...	42	1.2
369	emb\|BX048121.1\|CNS099AL Single read from an extremity of a full-...	42	1.2
370	emb\|BX048120.1\|CNS099AK Single read from an extremity of a full-...	42	1.2
371	emb\|BX047754.1\|CNS0990E Single read from an extremity of a full-...	42	1.2
372	emb\|BX047478.1\|CNS098SQ Single read from an extremity of a full-...	42	1.2
373	emb\|BX047279.1\|CNS098N7 Single read from an extremity of a full-...	42	1.2
374	emb\|BX047217.1\|CNS098LH Single read from an extremity of a full-...	42	1.2
375	emb\|BX047216.1\|CNS098LG Single read from an extremity of a full-...	42	1.2
376	emb\|BX047156.1\|CNS098JS Single read from an extremity of a full-...	42	1.2
377	emb\|BX047155.1\|CNS098JR Single read from an extremity of a full-...	42	1.2
378	emb\|BX047001.1\|CNS098FH Single read from an extremity of a full-...	42	1.2
379	emb\|BX047000.1\|CNS098FG Single read from an extremity of a full-...	42	1.2
380	emb\|BX046876.1\|CNS098C0 Single read from an extremity of a full-...	42	1.2
381	emb\|BX046875.1\|CNS098BZ Single read from an extremity of a full-...	42	1.2
382	emb\|BX046690.1\|CNS0986U Single read from an extremity of a full-...	42	1.2
383	emb\|BX046325.1\|CNS097WP Single read from an extremity of a full-...	42	1.2
384	emb\|BX046324.1\|CNS097WO Single read from an extremity of a full-...	42	1.2
385	emb\|BX045863.1\|CNS097JV Single read from an extremity of a full-...	42	1.2
386	emb\|BX045862.1\|CNS097JU Single read from an extremity of a full-...	42	1.2
387	emb\|BX045772.1\|CNS097HC Single read from an extremity of a full-...	42	1.2
388	emb\|BX045771.1\|CNS097HB Single read from an extremity of a full-...	42	1.2
389	emb\|BX045647.1\|CNS097DV Single read from an extremity of a full-...	42	1.2
390	emb\|BX045057.1\|CNS096XH Single read from an extremity of a full-...	42	1.2
391	emb\|BX045056.1\|CNS096XG Single read from an extremity of a full-...	42	1.2
392	emb\|BX045304.1\|CNS0974C Single read from an extremity of a full-...	42	1.2
393	emb\|BX043086.1\|CNS095EQ Single read from an extremity of a full-...	42	1.2
394	emb\|BX042914.1\|CNS0959Y Single read from an extremity of a full-...	42	1.2
395	emb\|BX042913.1\|CNS0959X Single read from an extremity of a full-...	42	1.2
396	emb\|BX044674.1\|CNS096MU Single read from an extremity of a full-...	42	1.2
397	emb\|BX044233.1\|CNS096AL Single read from an extremity of a full-...	42	1.2
398	emb\|BX044205.1\|CNS0969T Single read from an extremity of a full-...	42	1.2
399	emb\|BX044023.1\|CNS0964R Single read from an extremity of a full-...	42	1.2
400	emb\|BX044022.1\|CNS0964Q Single read from an extremity of a full-...	42	1.2
401	emb\|BX043402.1\|CNS095NI Single read from an extremity of a full-...	42	1.2
402	emb\|BX043401.1\|CNS095NH Single read from an extremity of a full-...	42	1.2
403	emb\|BX043362.1\|CNS095ME Single read from an extremity of a full-...	42	1.2
404	emb\|BX043361.1\|CNS095MD Single read from an extremity of a full-...	42	1.2
405	emb\|BX043340.1\|CNS095LS Single read from an extremity of a full-...	42	1.2
406	emb\|BX043586.1\|CNS095SM Single read from an extremity of a full-...	42	1.2
407	emb\|BX043158.1\|CNS095GQ Single read from an extremity of a full-...	42	1.2
408	emb\|BX042813.1\|CNS09575 Single read from an extremity of a full-...	42	1.2
409	emb\|BX042812.1\|CNS09574 Single read from an extremity of a full-...	42	1.2
410	emb\|BX042751.1\|CNS0955F Single read from an extremity of a full-...	42	1.2
411	emb\|BX042750.1\|CNS0955E Single read from an extremity of a full-...	42	1.2
412	emb\|BX042566.1\|CNS0950A Single read from an extremity of a full-...	42	1.2
413	emb\|BX042373.1\|CNS094UX Single read from an extremity of a full-...	42	1.2
414	emb\|BX042372.1\|CNS094UW Single read from an extremity of a full-...	42	1.2
415	emb\|BX042192.1\|CNS094PW Single read from an extremity of a full-...	42	1.2
416	emb\|BX042191.1\|CNS094PV Single read from an extremity of a full-...	42	1.2
417	emb\|BX042165.1\|CNS094P5 Single read from an extremity of a full-...	42	1.2
418	emb\|BX041829.1\|CNS094FT Single read from an extremity of a full-...	42	1.2
419	emb\|BX041828.1\|CNS094FS Single read from an extremity of a full-...	42	1.2
420	emb\|BX041998.1\|CNS094KI Single read from an extremity of a full-...	42	1.2
421	emb\|BX041997.1\|CNS094KH Single read from an extremity of a full-...	42	1.2
422	emb\|BX041981.1\|CNS094K1 Single read from an extremity of a full-...	42	1.2
423	emb\|BX041980.1\|CNS094K0 Single read from an extremity of a full-...	42	1.2
424	emb\|BX041897.1\|CNS094HP Single read from an extremity of a full-...	42	1.2
425	emb\|BX041495.1\|CNS0946J Single read from an extremity of a full-...	42	1.2
426	emb\|BX041494.1\|CNS0946I Single read from an extremity of a full-...	42	1.2
427	emb\|BX041371.1\|CNS09433 Single read from an extremity of a full-...	42	1.2
428	emb\|BX041184.1\|CNS093XW Single read from an extremity of a full-...	42	1.2
429	emb\|BX041092.1\|CNS093VC Single read from an extremity of a full-...	42	1.2
430	emb\|BX041066.1\|CNS093UM Single read from an extremity of a full-...	42	1.2
431	emb\|BX041065.1\|CNS093UL Single read from an extremity of a full-...	42	1.2
432	emb\|BX040893.1\|CNS093PT Single read from an extremity of a full-...	42	1.2
433	emb\|BX040892.1\|CNS093PS Single read from an extremity of a full-...	42	1.2
434	emb\|BX040441.1\|CNS093D9 Single read from an extremity of a full-...	42	1.2
435	emb\|BX040440.1\|CNS093D8 Single read from an extremity of a full-...	42	1.2
436	emb\|BX040328.1\|CNS093A4 Single read from an extremity of a full-...	42	1.2
437	emb\|BX040164.1\|CNS0935K Single read from an extremity of a full-...	42	1.2
438	emb\|BX039306.1\|CNS092HQ Single read from an extremity of a full-...	42	1.2
439	emb\|BX039245.1\|CNS092G1 Single read from an extremity of a full-...	42	1.2
440	emb\|BX039244.1\|CNS092G0 Single read from an extremity of a full-...	42	1.2
441	emb\|BX037982.1\|CNS091GY Single read from an extremity of a full-...	42	1.2
442	emb\|BX037981.1\|CNS091GX Single read from an extremity of a full-...	42	1.2
443	emb\|BX037573.1\|CNS0915L Single read from an extremity of a full-...	42	1.2
444	emb\|BX037572.1\|CNS0915K Single read from an extremity of a full-...	42	1.2
445	emb\|BX037476.1\|CNS0912W Single read from an extremity of a full-...	42	1.2
446	emb\|BX037438.1\|CNS0911U Single read from an extremity of a full-...	42	1.2
447	emb\|BX037437.1\|CNS0911T Single read from an extremity of a full-...	42	1.2
448	emb\|BX036707.1\|CNS090HJ Single read from an extremity of a full-...	42	1.2
449	emb\|BX036706.1\|CNS090HI Single read from an extremity of a full-...	42	1.2
450	emb\|BX034834.1\|CNS08Z1I Single read from an extremity of a full-...	42	1.2
451	emb\|BX034833.1\|CNS08Z1H Single read from an extremity of a full-...	42	1.2
452	emb\|BX034965.1\|CNS08Z55 Single read from an extremity of a full-...	42	1.2
453	emb\|BX034964.1\|CNS08Z54 Single read from an extremity of a full-...	42	1.2
454	emb\|BX033572.1\|CNS08Y2G Single read from an extremity of a full-...	42	1.2
455	emb\|BX033571.1\|CNS08Y2F Single read from an extremity of a full-...	42	1.2
456	emb\|BX029790.1\|CNS08V5E Single read from an extremity of a full-...	42	1.2
457	emb\|BX029758.1\|CNS08V4I Single read from an extremity of a full-...	42	1.2
458	emb\|BX026727.1\|CNS08SSB Single read from an extremity of a full-...	42	1.2
459	emb\|BX026454.1\|CNS08SKQ Single read from an extremity of a full-...	42	1.2
460	emb\|BX026453.1\|CNS08SKP Single read from an extremity of a full-...	42	1.2
461	emb\|BX026346.1\|CNS08SHQ Single read from an extremity of a full-...	42	1.2
462	emb\|BX024700.1\|CNS08R80 Single read from an extremity of a full-...	42	1.2
463	emb\|BX022475.1\|CNS08PI7 Single read from an extremity of a full-...	42	1.2
464	emb\|BX022474.1\|CNS08PI6 Single read from an extremity of a full-...	42	1.2
465	emb\|BX019551.1\|CNS08N8Z Single read from an extremity of a full-...	42	1.2
466	emb\|BX019550.1\|CNS08N8Y Single read from an extremity of a full-...	42	1.2
467	emb\|BX021913.1\|CNS08P2L Single read from an extremity of a full-...	42	1.2
468	emb\|BX021912.1\|CNS08P2K Single read from an extremity of a full-...	42	1.2
469	emb\|BX016523.1\|CNS08KWV Single read from an extremity of a full-...	42	1.2
470	emb\|BX016522.1\|CNS08KWU Single read from an extremity of a full-...	42	1.2
471	emb\|BX015088.1\|CNS08JT0 Single read from an extremity of a full-...	42	1.2
472	emb\|BX015087.1\|CNS08JSZ Single read from an extremity of a full-...	42	1.2
473	emb\|BX014828.1\|CNS08JLS Single read from an extremity of a full-...	42	1.2
474	emb\|BX014827.1\|CNS08JLR Single read from an extremity of a full-...	42	1.2
475	emb\|BX013943.1\|CNS08IX7 Single read from an extremity of a full-...	42	1.2
476	emb\|BX013942.1\|CNS08IX6 Single read from an extremity of a full-...	42	1.2
477	emb\|BX013919.1\|CNS08IWJ Single read from an extremity of a full-...	42	1.2
478	emb\|BX013918.1\|CNS08IWI Single read from an extremity of a full-...	42	1.2
479	emb\|BX013895.1\|CNS08IVV Single read from an extremity of a full-...	42	1.2
480	emb\|BX012162.1\|CNS08HJQ Single read from an extremity of a full-...	42	1.2
481	emb\|BX012161.1\|CNS08HJP Single read from an extremity of a full-...	42	1.2
482	emb\|BX009966.1\|CNS08FUQ Single read from an extremity of a full-...	42	1.2
483	emb\|BX009965.1\|CNS08FUP Single read from an extremity of a full-...	42	1.2
484	emb\|BX006466.1\|CNS08D5I Single read from an extremity of a full-...	42	1.2
485	ref\|NM_079050.2\| Drosophila melanogaster Ribosomal protein L18A ...	42	1.2
486	gb\|AY071222.1\| Drosophila melanogaster RE26382 full length cDNA	42	1.2
487	gb\|AC008004.5\|AC008004 Drosophila melanogaster, chromosome 2R, r...	42	1.2
488	ref\|XM_320252.2\| Anopheles gambiae str. PEST ENSANGP00000016619 ...	42	1.2
489	gb\|DQ322635.1\| YFV replicon vector prME-def, complete sequence	42	1.2
490	gb\|AE003803.4\| Drosophila melanogaster chromosome 2R, section 47...	42	1.2
491	emb\|X75339.1\|DMRPL18A D.melanogaster mRNA for ribosomal protein ...	42	1.2
492	gb\|AC119863.9\| Mus musculus chromosome 3, clone RP23-293A4, comp...	40	4.7
493	gb\|AY678267.1\| Synthetic construct monomeric yellow-orange fluor...	40	4.7
494	gb\|AY389632.1\| Hyacinthus orientalis ribosomal protein L18A (RPL...	40	4.7
495	gb\|AC153600.8\| Mus musculus 6 BAC RP23-380C10 (Roswell Park Canc...	40	4.7
496	emb\|Z78414.1\|CEW09D12 Caenorhabditis elegans Cosmid W09D12, comp...	40	4.7
497	emb\|Z70224.2\|HSU144A10 Human DNA sequence from clone LL0XNC01-14...	40	4.7
498	emb\|BX055477.1\|CNS09EYX Single read from an extremity of a full-...	40	4.7
499	emb\|BX047755.1\|CNS0990F Single read from an extremity of a full-...	40	4.7
500	ref\|NM_169086.1\| Drosophila melanogaster MTA1-like CG2244-RA, tr...	40	4.7

>gb|DQ175860.1| Hordeum vulgare clone DsC33 Ds insertion site flanking region
           genomic sequence
          Length = 556

 Score =  262 bits (132), Expect = 7e-67
 Identities = 134/135 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgaaacaaagtcaagngttgcatcaacgcagcagcatcctcagtgccaactgaaaacatt 60
           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15  cgaaacaaagtcaagagttgcatcaacgcagcagcatcctcagtgccaactgaaaacatt 74

                                                                       
Query: 61  ctcaaagtgcataaccaaaacttccacatgcaaaacattcaaactcttacacacgctaaa 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 75  ctcaaagtgcataaccaaaacttccacatgcaaaacattcaaactcttacacacgctaaa 134

                          
Query: 121 acagtaggcagtggg 135
           |||||||||||||||
Sbjct: 135 acagtaggcagtggg 149

to top

>gb|AY103621.1| Zea mays PCO154872 mRNA sequence
          Length = 805

 Score =  145 bits (73), Expect = 1e-31
 Identities = 108/121 (89%)
 Strand = Plus / Minus

                                                                       
Query: 214 ggtacaccagcgggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgc 273
           ||||||| |||||||||||||| |  ||||||||||||||||| ||||||||||||||||
Sbjct: 533 ggtacacaagcgggaacttgatctcggagttgtggaactgcttggtgttgtccctcttgc 474

                                                                       
Query: 274 acagcttgaagtccaccgtcncagtcttgatgatctggatgcacggggaacncacgcggt 333
           ||||||||||||  |||||| | |||||||||||||| ||||| ||||| | ||||||||
Sbjct: 473 acagcttgaagtggaccgtcgctgtcttgatgatctgtatgcagggggacctcacgcggt 414

            
Query: 334 g 334
           |
Sbjct: 413 g 413

to top

>gb|BT017327.1| Zea mays clone EL01N0320F05.c mRNA sequence
          Length = 791

 Score =  137 bits (69), Expect = 3e-29
 Identities = 101/113 (89%)
 Strand = Plus / Minus

                                                                       
Query: 222 agcgggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgcacagcttg 281
           |||||||||||||| |    ||||||||||||||| ||||||||||||||||| ||||||
Sbjct: 503 agcgggaacttgatctcactgttgtggaactgcttagtgttgtccctcttgcagagcttg 444

                                                                
Query: 282 aagtccaccgtcncagtcttgatgatctggatgcacggggaacncacgcggtg 334
           |||| ||||||| |||||||||||||||||||||| ||||| | |||||||||
Sbjct: 443 aagtgcaccgtcgcagtcttgatgatctggatgcagggggacctcacgcggtg 391

to top

>gb|AY103768.1| Zea mays PCO155588 mRNA sequence
          Length = 818

 Score =  137 bits (69), Expect = 3e-29
 Identities = 107/121 (88%)
 Strand = Plus / Minus

                                                                       
Query: 214 ggtacaccagcgggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgc 273
           ||||||| || ||||||||||| |    ||||||||||||||| ||||||||||||||||
Sbjct: 529 ggtacacgagtgggaacttgatctcactgttgtggaactgcttagtgttgtccctcttgc 470

                                                                       
Query: 274 acagcttgaagtccaccgtcncagtcttgatgatctggatgcacggggaacncacgcggt 333
           | |||||||||| ||||||| |||||||||||||||||||||| ||||| | ||||||||
Sbjct: 469 agagcttgaagtgcaccgtcgcagtcttgatgatctggatgcagggggacctcacgcggt 410

            
Query: 334 g 334
           |
Sbjct: 409 g 409

to top

>gb|AC124143.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0053D02,
              complete sequence
          Length = 157106

 Score =  115 bits (58), Expect = 1e-22
 Identities = 91/103 (88%)
 Strand = Plus / Minus

                                                                          
Query: 214    ggtacaccagcgggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgc 273
              ||||||| |||||||||||||| || ||||||||||||||||| ||||||||||||||||
Sbjct: 130137 ggtacacgagcgggaacttgatattcgagttgtggaactgcttagtgttgtccctcttgc 130078

                                                         
Query: 274    acagcttgaagtccaccgtcncagtcttgatgatctggatgca 316
              | ||||||||||  || ||  | |||||||||||||| |||||
Sbjct: 130077 agagcttgaagtgaactgttgcggtcttgatgatctgaatgca 130035

to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  115 bits (58), Expect = 1e-22
 Identities = 91/103 (88%)
 Strand = Plus / Minus

                                                                            
Query: 214      ggtacaccagcgggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgc 273
                ||||||| |||||||||||||| || ||||||||||||||||| ||||||||||||||||
Sbjct: 27899720 ggtacacgagcgggaacttgatattcgagttgtggaactgcttagtgttgtccctcttgc 27899661

                                                           
Query: 274      acagcttgaagtccaccgtcncagtcttgatgatctggatgca 316
                | ||||||||||  || ||  | |||||||||||||| |||||
Sbjct: 27899660 agagcttgaagtgaactgttgcggtcttgatgatctgaatgca 27899618

to top

>dbj|D21301.1|RICSS128 Oryza sativa SS128 mRNA for ribosomal protein L18a, partial
           sequence
          Length = 380

 Score =  115 bits (58), Expect = 1e-22
 Identities = 91/103 (88%)
 Strand = Plus / Minus

                                                                       
Query: 214 ggtacaccagcgggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgc 273
           ||||||| |||||||||||||| || ||||||||||||||||| ||||||||||||||||
Sbjct: 262 ggtacacgagcgggaacttgatattcgagttgtggaactgcttagtgttgtccctcttgc 203

                                                      
Query: 274 acagcttgaagtccaccgtcncagtcttgatgatctggatgca 316
           | ||||||||||  || ||  | |||||||||||||| |||||
Sbjct: 202 agagcttgaagtgaactgttgcggtcttgatgatctgaatgca 160

to top

>dbj|AK102673.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033102C12, full
           insert sequence
          Length = 966

 Score =  115 bits (58), Expect = 1e-22
 Identities = 91/103 (88%)
 Strand = Plus / Minus

                                                                       
Query: 214 ggtacaccagcgggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgc 273
           ||||||| |||||||||||||| || ||||||||||||||||| ||||||||||||||||
Sbjct: 531 ggtacacgagcgggaacttgatattcgagttgtggaactgcttagtgttgtccctcttgc 472

                                                      
Query: 274 acagcttgaagtccaccgtcncagtcttgatgatctggatgca 316
           | ||||||||||  || ||  | |||||||||||||| |||||
Sbjct: 471 agagcttgaagtgaactgttgcggtcttgatgatctgaatgca 429

to top

>gb|BT016199.1| Zea mays clone Contig32 mRNA sequence
          Length = 732

 Score =  113 bits (57), Expect = 4e-22
 Identities = 104/121 (85%)
 Strand = Plus / Minus

                                                                       
Query: 214 ggtacaccagcgggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgc 273
           ||||||| || ||||||||||| |    |||||| |||||||| ||||||||||||||||
Sbjct: 536 ggtacacgagtgggaacttgatctcactgttgtgaaactgcttggtgttgtccctcttgc 477

                                                                       
Query: 274 acagcttgaagtccaccgtcncagtcttgatgatctggatgcacggggaacncacgcggt 333
           |||||||||||| ||| ||  | |||||||||||||||||||| ||||| | ||||||||
Sbjct: 476 acagcttgaagtgcactgtggcggtcttgatgatctggatgcatggggacctcacgcggt 417

            
Query: 334 g 334
           |
Sbjct: 416 g 416

to top

>ref|NM_191921.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 588

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 88/103 (85%)
 Strand = Plus / Minus

                                                                       
Query: 214 ggtacaccagcgggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgc 273
           ||||||| || |||||||||||  |   ||||||||||||||| ||||||||||||||||
Sbjct: 517 ggtacacaagggggaacttgatgctcccgttgtggaactgcttggtgttgtccctcttgc 458

                                                      
Query: 274 acagcttgaagtccaccgtcncagtcttgatgatctggatgca 316
           | ||||||||||  || ||  | ||||||||||||||||||||
Sbjct: 457 agagcttgaagtggacagtggcggtcttgatgatctggatgca 415

to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 88/103 (85%)
 Strand = Plus / Plus

                                                                            
Query: 214      ggtacaccagcgggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgc 273
                ||||||| || |||||||||||  |   ||||||||||||||| ||||||||||||||||
Sbjct: 27260170 ggtacacaagggggaacttgatgctcccgttgtggaactgcttggtgttgtccctcttgc 27260229

                                                           
Query: 274      acagcttgaagtccaccgtcncagtcttgatgatctggatgca 316
                | ||||||||||  || ||  | ||||||||||||||||||||
Sbjct: 27260230 agagcttgaagtggacagtggcggtcttgatgatctggatgca 27260272



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 85/102 (83%)
 Strand = Plus / Plus

                                                                            
Query: 215      gtacaccagcgggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgca 274
                ||||||||| ||||||||||| |  || |||||||||||||| |||||||| | ||||||
Sbjct: 31552819 gtacaccagtgggaacttgatatctgacttgtggaactgcttagtgttgtcacgcttgca 31552878

                                                          
Query: 275      cagcttgaagtccaccgtcncagtcttgatgatctggatgca 316
                 || || ||||  || ||  |||||||||||||||| |||||
Sbjct: 31552879 gagtttaaagtggacagtagcagtcttgatgatctgaatgca 31552920

to top

>dbj|AP003760.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBb0063G05
          Length = 182681

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 88/103 (85%)
 Strand = Plus / Plus

                                                                         
Query: 214   ggtacaccagcgggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgc 273
             ||||||| || |||||||||||  |   ||||||||||||||| ||||||||||||||||
Sbjct: 40687 ggtacacaagggggaacttgatgctcccgttgtggaactgcttggtgttgtccctcttgc 40746

                                                        
Query: 274   acagcttgaagtccaccgtcncagtcttgatgatctggatgca 316
             | ||||||||||  || ||  | ||||||||||||||||||||
Sbjct: 40747 agagcttgaagtggacagtggcggtcttgatgatctggatgca 40789

to top

>gb|BT017504.1| Zea mays clone EL01N0414H05.c mRNA sequence
          Length = 834

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 265 ccctcttgcacagcttgaagtccaccgtcncagtcttgatgatctggatgcacggggaac 324
           ||||||||||||||||||||| ||| ||  | |||||||||||||||||||| ||||| |
Sbjct: 465 ccctcttgcacagcttgaagtgcactgtggcggtcttgatgatctggatgcatggggacc 406

                     
Query: 325 ncacgcggtg 334
            |||||||||
Sbjct: 405 tcacgcggtg 396

to top

>ref|NM_191253.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 537

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 85/102 (83%)
 Strand = Plus / Minus

                                                                       
Query: 215 gtacaccagcgggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgca 274
           ||||||||| ||||||||||| |  || |||||||||||||| |||||||| | ||||||
Sbjct: 465 gtacaccagtgggaacttgatatctgacttgtggaactgcttagtgttgtcacgcttgca 406

                                                     
Query: 275 cagcttgaagtccaccgtcncagtcttgatgatctggatgca 316
            || || ||||  || ||  |||||||||||||||| |||||
Sbjct: 405 gagtttaaagtggacagtagcagtcttgatgatctgaatgca 364

to top

>dbj|AP003249.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0435B05
          Length = 150997

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 85/102 (83%)
 Strand = Plus / Plus

                                                                         
Query: 215   gtacaccagcgggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgca 274
             ||||||||| ||||||||||| |  || |||||||||||||| |||||||| | ||||||
Sbjct: 65842 gtacaccagtgggaacttgatatctgacttgtggaactgcttagtgttgtcacgcttgca 65901

                                                       
Query: 275   cagcttgaagtccaccgtcncagtcttgatgatctggatgca 316
              || || ||||  || ||  |||||||||||||||| |||||
Sbjct: 65902 gagtttaaagtggacagtagcagtcttgatgatctgaatgca 65943

to top

>dbj|AP003237.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0046E05
          Length = 162776

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 85/102 (83%)
 Strand = Plus / Plus

                                                                          
Query: 215    gtacaccagcgggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgca 274
              ||||||||| ||||||||||| |  || |||||||||||||| |||||||| | ||||||
Sbjct: 146883 gtacaccagtgggaacttgatatctgacttgtggaactgcttagtgttgtcacgcttgca 146942

                                                        
Query: 275    cagcttgaagtccaccgtcncagtcttgatgatctggatgca 316
               || || ||||  || ||  |||||||||||||||| |||||
Sbjct: 146943 gagtttaaagtggacagtagcagtcttgatgatctgaatgca 146984

to top

>dbj|AK121755.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033088C04, full
           insert sequence
          Length = 910

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 85/102 (83%)
 Strand = Plus / Minus

                                                                       
Query: 215 gtacaccagcgggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgca 274
           ||||||||| ||||||||||| |  || |||||||||||||| |||||||| | ||||||
Sbjct: 582 gtacaccagtgggaacttgatatctgacttgtggaactgcttagtgttgtcacgcttgca 523

                                                     
Query: 275 cagcttgaagtccaccgtcncagtcttgatgatctggatgca 316
            || || ||||  || ||  |||||||||||||||| |||||
Sbjct: 522 gagtttaaagtggacagtagcagtcttgatgatctgaatgca 481

to top

>gb|DQ200390.1| Solanum tuberosum clone 067G06 unknown mRNA
          Length = 779

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 56/64 (87%)
 Strand = Plus / Minus

                                                                       
Query: 217 acaccagcgggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgcaca 276
           |||||| |||||||||||| || ||||  ||||||||||| ||| | |||||||||||||
Sbjct: 481 acaccaacgggaacttgatcttggagtcatggaactgcttagtgctctccctcttgcaca 422

               
Query: 277 gctt 280
           ||||
Sbjct: 421 gctt 418

to top

>gb|BT016634.1| Zea mays clone Contig467 mRNA sequence
          Length = 859

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                     
Query: 228 aacttgatnttngagttgtggaactgcttcgtgttgtccctcttgcacagcttgaagt 285
           |||||||  || || |||||||||||||| ||||||||||||||||| ||||| ||||
Sbjct: 377 aacttgaactttgaattgtggaactgcttggtgttgtccctcttgcaaagcttaaagt 434

to top

>gb|AC146330.33| Medicago truncatula clone mth2-7g7, complete sequence
          Length = 117139

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 59/69 (85%)
 Strand = Plus / Plus

                                                                         
Query: 209   cttctggtacaccagcgggaacttgatnttngagttgtggaactgcttcgtgttgtccct 268
             ||||| ||||||||  ||||||||||| || || |||||||||||||| ||| | |||||
Sbjct: 19536 cttcttgtacaccaaggggaacttgattttggaattgtggaactgcttagtgctctccct 19595

                      
Query: 269   cttgcacag 277
              ||||||||
Sbjct: 19596 tttgcacag 19604

to top

>gb|BT014521.1| Lycopersicon esculentum clone 133914F, mRNA sequence
          Length = 810

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                       
Query: 217 acaccagcgggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgcaca 276
           |||||| |||||||||||| || |||| |||||||||||| ||| | |||| |||||| |
Sbjct: 499 acaccaacgggaacttgattttggagtcgtggaactgctttgtgctctcccgcttgcaga 440

               
Query: 277 gctt 280
           ||||
Sbjct: 439 gctt 436



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 297 gtcttgatgatctggatgca 316
           ||||||||||||||||||||
Sbjct: 419 gtcttgatgatctggatgca 400

to top

>gb|DQ235168.1| Solanum tuberosum clone 154B10 unknown mRNA
          Length = 904

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 225 gggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgcacag 277
           ||||||||||| || ||||  ||||||||||| ||| | ||||||||||||||
Sbjct: 500 gggaacttgattttggagtcatggaactgcttggtgctctccctcttgcacag 448

to top

>ref|NM_112321.2| Arabidopsis thaliana structural constituent of ribosome AT3G14600
           mRNA, complete cds
          Length = 853

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 225 gggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgcacagctt 280
           ||||||||||| || ||||| ||||||||||| ||| | || |||||||| |||||
Sbjct: 531 gggaacttgatcttcgagttatggaactgcttggtgatctctctcttgcaaagctt 476

to top

>ref|NM_179398.1| Arabidopsis thaliana structural constituent of ribosome AT1G29965
           mRNA, complete cds
          Length = 774

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 219 accagcgggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgca 274
           |||| |||||||||||| ||   |||||| |||||||||||| | |||||||||||
Sbjct: 550 accaacgggaacttgatcttgctgttgtgaaactgcttcgtgctttccctcttgca 495

to top

>gb|DQ235171.1| Solanum tuberosum clone 155B02 unknown mRNA
          Length = 722

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                       
Query: 217 acaccagcgggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgcaca 276
           |||||| |||||||||||| || ||||  ||||||||||| ||| | |||| |||||| |
Sbjct: 481 acaccaacgggaacttgattttggagtcatggaactgctttgtgctctcccgcttgcaga 422

               
Query: 277 gctt 280
           ||||
Sbjct: 421 gctt 418



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 297 gtcttgatgatctggatgca 316
           ||||||||||||||||||||
Sbjct: 401 gtcttgatgatctggatgca 382

to top

>ref|XM_524153.1| PREDICTED: Pan troglodytes similar to ribosomal protein L18a; 60S
           ribosomal protein L18a (LOC468766), mRNA
          Length = 390

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 221 cagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||||| || |||| ||||||||||||
Sbjct: 321 cagcgggaacttgatcttggagtcgtggaactgctt 286

to top

>ref|NM_000980.2| Homo sapiens ribosomal protein L18a (RPL18A), mRNA
          Length = 618

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 221 cagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||||| || |||| ||||||||||||
Sbjct: 497 cagcgggaacttgatcttggagtcgtggaactgctt 462

to top

>gb|U52111.3| Homo sapiens chromosome X clone Qc-7G6, QLL-F1720, QLL-C1335, Qc-8B7,
             Qc-11H12, Qc-7F6, QLL-E153, Qc-10E8, Qc-10B7 map q28,
             complete sequence
          Length = 247592

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                 
Query: 221   cagcgggaacttgatnttngagttgtggaactgctt 256
             ||||||||||||||| || |||| ||||||||||||
Sbjct: 45832 cagcgggaacttgatcttggagtcgtggaactgctt 45797

to top

>gb|AC089983.23| Homo sapiens 12 BAC RP11-818F20 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 204505

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                  
Query: 221    cagcgggaacttgatnttngagttgtggaactgctt 256
              ||||||||||||||| || |||| ||||||||||||
Sbjct: 168555 cagcgggaacttgatcttggagtcgtggaactgctt 168520

to top

>gb|BC098413.1| Homo sapiens cDNA clone IMAGE:6208834, **** WARNING: chimeric clone
            ****
          Length = 1360

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                
Query: 221  cagcgggaacttgatnttngagttgtggaactgctt 256
            ||||||||||||||| || |||| ||||||||||||
Sbjct: 1166 cagcgggaacttgatcttggagtcgtggaactgctt 1131

to top

>gb|BC062307.1| Homo sapiens cDNA clone IMAGE:3504574, **** WARNING: chimeric clone
            ****
          Length = 1785

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                
Query: 221  cagcgggaacttgatnttngagttgtggaactgctt 256
            ||||||||||||||| || |||| ||||||||||||
Sbjct: 1608 cagcgggaacttgatcttggagtcgtggaactgctt 1573

to top

>gb|BC071836.1| Homo sapiens cDNA clone IMAGE:6210072, **** WARNING: chimeric clone
            ****
          Length = 1360

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                
Query: 221  cagcgggaacttgatnttngagttgtggaactgctt 256
            ||||||||||||||| || |||| ||||||||||||
Sbjct: 1166 cagcgggaacttgatcttggagtcgtggaactgctt 1131

to top

>gb|AF334839.1| Castanea sativa ribosomal protein L18a mRNA, complete cds
          Length = 775

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 219 accagcgggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgca 274
           ||||| ||||||||||| || || |||||||||||||| | | | |||||||||||
Sbjct: 544 accagagggaacttgattttggaattgtggaactgcttagagctctccctcttgca 489

to top

>gb|BT000059.1| Arabidopsis thaliana 60S ribosomal protein L18A, putative
           (At1g29970) mRNA, complete cds
          Length = 633

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 219 accagcgggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgca 274
           |||| |||||||||||| ||   |||||| |||||||||||| | |||||||||||
Sbjct: 461 accaacgggaacttgatcttgctgttgtgaaactgcttcgtgctttccctcttgca 406

to top

>gb|BC066319.1| Homo sapiens ribosomal protein L18a, mRNA (cDNA clone MGC:87208
           IMAGE:5286436), complete cds
          Length = 632

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 221 cagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||||| || |||| ||||||||||||
Sbjct: 501 cagcgggaacttgatcttggagtcgtggaactgctt 466

to top

>gb|BC007512.2| Homo sapiens ribosomal protein L18a, mRNA (cDNA clone MGC:4476
           IMAGE:2961519), complete cds
          Length = 616

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 221 cagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||||| || |||| ||||||||||||
Sbjct: 481 cagcgggaacttgatcttggagtcgtggaactgctt 446

to top

>gb|AY128411.1| Arabidopsis thaliana 60S ribosomal protein L18A, putative
           (At1g29970) mRNA, complete cds
          Length = 758

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 219 accagcgggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgca 274
           |||| |||||||||||| ||   |||||| |||||||||||| | |||||||||||
Sbjct: 538 accaacgggaacttgatcttgctgttgtgaaactgcttcgtgctttccctcttgca 483

to top

>emb|CR615832.1| full-length cDNA clone CS0DL001YB06 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 602

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 221 cagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||||| || |||| ||||||||||||
Sbjct: 481 cagcgggaacttgatcttggagtcgtggaactgctt 446

to top

>emb|CR624588.1| full-length cDNA clone CS0DI021YD01 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 612

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 221 cagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||||| || |||| ||||||||||||
Sbjct: 491 cagcgggaacttgatcttggagtcgtggaactgctt 456

to top

>emb|CR619918.1| full-length cDNA clone CS0DM013YP23 of Fetal liver of Homo sapiens
            (human)
          Length = 1921

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                
Query: 221  cagcgggaacttgatnttngagttgtggaactgctt 256
            ||||||||||||||| || |||| ||||||||||||
Sbjct: 1802 cagcgggaacttgatcttggagtcgtggaactgctt 1767

to top

>emb|CR619120.1| full-length cDNA clone CS0DI077YH09 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1912

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                
Query: 221  cagcgggaacttgatnttngagttgtggaactgctt 256
            ||||||||||||||| || |||| ||||||||||||
Sbjct: 1802 cagcgggaacttgatcttggagtcgtggaactgctt 1767

to top

>emb|CR617184.1| full-length cDNA clone CS0DJ005YO06 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 606

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 221 cagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||||| || |||| ||||||||||||
Sbjct: 484 cagcgggaacttgatcttggagtcgtggaactgctt 449

to top

>emb|CR606905.1| full-length cDNA clone CS0DC025YL04 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 604

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 221 cagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||||| || |||| ||||||||||||
Sbjct: 483 cagcgggaacttgatcttggagtcgtggaactgctt 448

to top

>emb|CR603612.1| full-length cDNA clone CS0DB009YJ04 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 612

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 221 cagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||||| || |||| ||||||||||||
Sbjct: 491 cagcgggaacttgatcttggagtcgtggaactgctt 456

to top

>emb|CR600519.1| full-length cDNA clone CS0DC003YF24 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 605

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 221 cagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||||| || |||| ||||||||||||
Sbjct: 484 cagcgggaacttgatcttggagtcgtggaactgctt 449

to top

>emb|CR600845.1| full-length cDNA clone CS0DA007YA19 of Neuroblastoma of Homo
           sapiens (human)
          Length = 605

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 221 cagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||||| || |||| ||||||||||||
Sbjct: 484 cagcgggaacttgatcttggagtcgtggaactgctt 449

to top

>emb|CR594005.1| full-length cDNA clone CL0BB004ZF10 of Neuroblastoma of Homo
           sapiens (human)
          Length = 603

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 221 cagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||||| || |||| ||||||||||||
Sbjct: 483 cagcgggaacttgatcttggagtcgtggaactgctt 448

to top

>emb|CR592115.1| full-length cDNA clone CS0DI063YB22 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 601

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 221 cagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||||| || |||| ||||||||||||
Sbjct: 482 cagcgggaacttgatcttggagtcgtggaactgctt 447

to top

>gb|AY097377.1| Arabidopsis thaliana AT3g14600/MIE1_10 mRNA, complete cds
          Length = 537

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 225 gggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgcacagctt 280
           ||||||||||| || ||||| ||||||||||| ||| | || |||||||| |||||
Sbjct: 455 gggaacttgatcttcgagttatggaactgcttggtgatctctctcttgcaaagctt 400

to top

>ref|NR_001593.1| Homo sapiens similar to ribosomal protein L18a; 60S ribosomal
           protein L18a (LOC390354) on chromosome 12
          Length = 616

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 221 cagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||||| || |||| ||||||||||||
Sbjct: 501 cagcgggaacttgatcttggagtcgtggaactgctt 466

to top

>gb|AY072540.1| Arabidopsis thaliana AT3g14600/MIE1_10 mRNA, complete cds
          Length = 829

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 225 gggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgcacagctt 280
           ||||||||||| || ||||| ||||||||||| ||| | || |||||||| |||||
Sbjct: 506 gggaacttgatcttcgagttatggaactgcttggtgatctctctcttgcaaagctt 451

to top

>ref|XM_938382.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a
           (LOC347544), mRNA
          Length = 574

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 221 cagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||||| || |||| ||||||||||||
Sbjct: 462 cagcgggaacttgatcttggagtcgtggaactgctt 427

to top

>ref|XM_293412.3| PREDICTED: Homo sapiens similar to ribosomal protein L18a
           (LOC347544), mRNA
          Length = 574

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 221 cagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||||| || |||| ||||||||||||
Sbjct: 462 cagcgggaacttgatcttggagtcgtggaactgctt 427

to top

>ref|XM_945469.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a,
           transcript variant 6 (LOC285053), mRNA
          Length = 588

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 221 cagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||||| || |||| ||||||||||||
Sbjct: 465 cagcgggaacttgatcttggagtcgtggaactgctt 430

to top

>ref|XM_945465.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a,
           transcript variant 5 (LOC285053), mRNA
          Length = 557

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 221 cagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||||| || |||| ||||||||||||
Sbjct: 434 cagcgggaacttgatcttggagtcgtggaactgctt 399

to top

>ref|XM_941835.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a,
           transcript variant 4 (LOC285053), mRNA
          Length = 659

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 221 cagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||||| || |||| ||||||||||||
Sbjct: 511 cagcgggaacttgatcttggagtcgtggaactgctt 476

to top

>ref|XM_934020.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a,
           transcript variant 3 (LOC285053), mRNA
          Length = 588

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 221 cagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||||| || |||| ||||||||||||
Sbjct: 465 cagcgggaacttgatcttggagtcgtggaactgctt 430

to top

>ref|XM_934018.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a,
           transcript variant 2 (LOC285053), mRNA
          Length = 557

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 221 cagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||||| || |||| ||||||||||||
Sbjct: 434 cagcgggaacttgatcttggagtcgtggaactgctt 399

to top

>ref|XM_208281.6| PREDICTED: Homo sapiens similar to ribosomal protein L18a,
           transcript variant 1 (LOC285053), mRNA
          Length = 659

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 221 cagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||||| || |||| ||||||||||||
Sbjct: 511 cagcgggaacttgatcttggagtcgtggaactgctt 476

to top

>emb|BX816320.1|CNS0AD9L Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH40ZG05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1162

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 219 accagcgggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgca 274
           |||| |||||||||||| ||   |||||| |||||||||||| | |||||||||||
Sbjct: 979 accaacgggaacttgatcttgctgttgtgaaactgcttcgtgctttccctcttgca 924

to top

>dbj|AK222647.1| Homo sapiens mRNA for ribosomal protein L18a variant, clone:
           CBL08590
          Length = 594

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 221 cagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||||| || |||| ||||||||||||
Sbjct: 497 cagcgggaacttgatcttggagtcgtggaactgctt 462

to top

>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence, complete
             sequence
          Length = 82053

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                     
Query: 219   accagcgggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgca 274
             |||| |||||||||||| ||   |||||| |||||||||||| | |||||||||||
Sbjct: 20410 accaacgggaacttgatcttgctgttgtgaaactgcttcgtgctttccctcttgca 20465

to top

>gb|AY088351.1| Arabidopsis thaliana clone 5961 mRNA, complete sequence
          Length = 767

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 225 gggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgcacagctt 280
           ||||||||||| || ||||| ||||||||||| ||| | || |||||||| |||||
Sbjct: 531 gggaacttgatcttcgagttatggaactgcttggtgatctctctcttgcaaagctt 476

to top

>gb|AC079250.7| Homo sapiens BAC clone RP11-62I18 from 2, complete sequence
          Length = 82938

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                 
Query: 221   cagcgggaacttgatnttngagttgtggaactgctt 256
             ||||||||||||||| || |||| ||||||||||||
Sbjct: 78637 cagcgggaacttgatcttggagtcgtggaactgctt 78672

to top

>gb|L05093.1|HUMRIBPROD Homo sapiens ribosomal protein L18a mRNA, complete cds
          Length = 602

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 221 cagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||||| || |||| ||||||||||||
Sbjct: 481 cagcgggaacttgatcttggagtcgtggaactgctt 446

to top

>dbj|AB023038.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1
          Length = 84462

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                     
Query: 225   gggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgcacagctt 280
             ||||||||||| || ||||| ||||||||||| ||| | || |||||||| |||||
Sbjct: 39811 gggaacttgatcttcgagttatggaactgcttggtgatctctctcttgcaaagctt 39756

to top

>dbj|AK110262.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-163-B05, full
           insert sequence
          Length = 885

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 297 gtcttgatgatctggatgcacggggaacncacgcggtgccgtgacnccatct 348
           |||||||||||||||||||| ||| | | ||||||||| |||||  ||||||
Sbjct: 431 gtcttgatgatctggatgcaagggaagcgcacgcggtggcgtgatgccatct 380

to top

>gb|BC071920.1| Homo sapiens ribosomal protein L18a, mRNA (cDNA clone MGC:88602
           IMAGE:6293838), complete cds
          Length = 622

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 221 cagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||||| || |||| ||||||||||||
Sbjct: 481 cagcgggaacttgatcttggagtcgtggaactgctt 446

to top

>emb|X80822.1|HSPLORF H.sapiens mRNA for ORF
          Length = 657

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 221 cagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||||| || |||| ||||||||||||
Sbjct: 487 cagcgggaacttgatcttggagtcgtggaactgctt 452

to top

>gb|AY231805.1| Drosophila yakuba clone yak-em_RpL18A mRNA sequence
          Length = 528

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 219 accagcgggaacttgatnttngagttgtggaactgcttc 257
           ||||| ||||||||||| || |||| |||||||||||||
Sbjct: 461 accagagggaacttgatcttggagtcgtggaactgcttc 423

to top

>gb|AC121781.3| Mus musculus BAC clone RP23-363D24 from chromosome X, complete sequence
          Length = 174187

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 45    gccaactgaaaacattctcaaagt 68
             ||||||||||||||||||||||||
Sbjct: 92247 gccaactgaaaacattctcaaagt 92270

to top

>emb|BX005240.7| Mouse DNA sequence from clone RP23-185M16 on chromosome X, complete
             sequence
          Length = 197310

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 45    gccaactgaaaacattctcaaagt 68
             ||||||||||||||||||||||||
Sbjct: 44176 gccaactgaaaacattctcaaagt 44153

to top

>ref|NM_129000.2| Arabidopsis thaliana structural constituent of ribosome AT2G34480
           mRNA, complete cds
          Length = 785

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                    
Query: 225 gggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgcacagcttg 281
           ||||||||||| ||   |||||||||||| || ||| | || |||||||||||||||
Sbjct: 495 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttg 439

to top

>gb|BT000076.1| Arabidopsis thaliana 60S ribosomal protein L18A (At2g34480) mRNA,
           complete cds
          Length = 672

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                    
Query: 225 gggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgcacagcttg 281
           ||||||||||| ||   |||||||||||| || ||| | || |||||||||||||||
Sbjct: 455 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttg 399

to top

>gb|AY120778.1| Arabidopsis thaliana 60S ribosomal protein L18A (At2g34480) mRNA,
           complete cds
          Length = 734

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                    
Query: 225 gggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgcacagcttg 281
           ||||||||||| ||   |||||||||||| || ||| | || |||||||||||||||
Sbjct: 490 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttg 434

to top

>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete
              sequence
          Length = 112763

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                       
Query: 225    gggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgcacagcttg 281
              ||||||||||| ||   |||||||||||| || ||| | || |||||||||||||||
Sbjct: 103485 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttg 103541

to top

>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete
             sequence
          Length = 93060

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                      
Query: 225   gggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgcacagcttg 281
             ||||||||||| ||   |||||||||||| || ||| | || |||||||||||||||
Sbjct: 70717 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttg 70661

to top

>gb|AC016180.14| Homo sapiens chromosome , clone RP11-553E24, complete sequence
          Length = 184735

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                  
Query: 221   cagcgggaacttgatnttngagttgtggaactgcttc 257
             ||||||||||||| | || |||| |||||||||||||
Sbjct: 54130 cagcgggaacttgttcttggagtcgtggaactgcttc 54094

to top

>ref|XM_938219.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a
           (LOC649145), mRNA
          Length = 153

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 221 cagcgggaacttgatnttngagttgtggaactgcttc 257
           ||||||||||||| | || |||| |||||||||||||
Sbjct: 84  cagcgggaacttgttcttggagtcgtggaactgcttc 48

to top

>ref|XM_926392.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a
           (LOC643017), mRNA
          Length = 153

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 221 cagcgggaacttgatnttngagttgtggaactgcttc 257
           ||||||||||||| | || |||| |||||||||||||
Sbjct: 84  cagcgggaacttgttcttggagtcgtggaactgcttc 48

to top

>gb|BT006559.1| Arabidopsis thaliana At2g34480 gene, complete cds
          Length = 537

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                    
Query: 225 gggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgcacagcttg 281
           ||||||||||| ||   |||||||||||| || ||| | || |||||||||||||||
Sbjct: 455 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttg 399

to top

>gb|AY042803.1| Arabidopsis thaliana Unknown protein mRNA, complete cds
          Length = 755

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                    
Query: 225 gggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgcacagcttg 281
           ||||||||||| ||   |||||||||||| || ||| | || |||||||||||||||
Sbjct: 490 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttg 434

to top

>emb|BX818972.1|CNS0A9U8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB32ZE10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 752

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                    
Query: 225 gggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgcacagcttg 281
           ||||||||||| ||   |||||||||||| || ||| | || |||||||||||||||
Sbjct: 489 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttg 433

to top

>emb|BX818907.1|CNS0A9RI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB25ZH03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 704

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                    
Query: 225 gggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgcacagcttg 281
           ||||||||||| ||   |||||||||||| || ||| | || |||||||||||||||
Sbjct: 441 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttg 385

to top

>emb|AL929182.4| Zebrafish DNA sequence from clone CH211-195E3 in linkage group 20,
             complete sequence
          Length = 225515

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 55    aacattctcaaagtgcataacca 77
             |||||||||||||||||||||||
Sbjct: 54061 aacattctcaaagtgcataacca 54039

to top

>ref|XM_520487.1| PREDICTED: Pan troglodytes similar to ribosomal protein L18a; 60S
           ribosomal protein L18a (LOC464992), mRNA
          Length = 628

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 221 cagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||| | || |||| ||||||||||||
Sbjct: 497 cagcgggaacttggtcttggagtcgtggaactgctt 462

to top

>ref|XM_515461.1| PREDICTED: Pan troglodytes LOC459217 (LOC459217), mRNA
          Length = 693

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 221 cagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||||| || |||| ||| ||||||||
Sbjct: 498 cagcgggaacttgatcttggagtcgtgcaactgctt 463

to top

>ref|NM_001016690.2| Xenopus tropicalis hypothetical protein LOC549444 (LOC549444), mRNA
          Length = 607

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 462 gggaacttgatctttgagtcgtggaactgctt 431

to top

>gb|AY190708.1| Pagrus major ribosomal protein L18a mRNA, partial cds
          Length = 565

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 479 gggaacttgatcttggagtcgtggaactgctt 448

to top

>ref|XM_881581.1| PREDICTED: Bos taurus similar to ribosomal protein L18a, transcript
           variant 6 (RPL18A), mRNA
          Length = 594

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 501 gggaacttgatcttggagtcgtggaactgctt 470

to top

>ref|XM_881547.1| PREDICTED: Bos taurus similar to ribosomal protein L18a, transcript
           variant 3 (RPL18A), mRNA
          Length = 584

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 454 gggaacttgatcttggagtcgtggaactgctt 423

to top

>ref|XM_581579.2| PREDICTED: Bos taurus similar to ribosomal protein L18a, transcript
           variant 1 (RPL18A), mRNA
          Length = 643

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 511 gggaacttgatcttggagtcgtggaactgctt 480

to top

>ref|XM_881521.1| PREDICTED: Bos taurus similar to ribosomal protein L18a, transcript
           variant 2 (RPL18A), mRNA
          Length = 805

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 675 gggaacttgatcttggagtcgtggaactgctt 644

to top

>ref|XM_864838.1| PREDICTED: Bos taurus similar to ribosomal protein L18a
           (LOC613756), mRNA
          Length = 468

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 395 gggaacttgatcttggagtcgtggaactgctt 364

to top

>ref|NM_001033619.1| Bos taurus similar to ribosomal protein L18a (RPL18A), mRNA
          Length = 667

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 499 gggaacttgatcttggagtcgtggaactgctt 468

to top

>gb|BC042256.1| Xenopus laevis similar to ribosomal protein L18a, mRNA (cDNA clone
           IMAGE:5571479), partial cds
          Length = 680

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 464 gggaacttgatctttgagtcgtggaactgctt 433

to top

>ref|XM_860467.1| PREDICTED: Canis familiaris similar to ribosomal protein L18a,
           transcript variant 2 (LOC476672), mRNA
          Length = 543

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 410 gggaacttgatcttggagtcgtggaactgctt 379

to top

>ref|XM_533877.2| PREDICTED: Canis familiaris similar to ribosomal protein L18a,
           transcript variant 1 (LOC476672), mRNA
          Length = 650

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 491 gggaacttgatcttggagtcgtggaactgctt 460

to top

>ref|XM_533842.2| PREDICTED: Canis familiaris similar to ribosomal protein L18a
           (LOC476637), mRNA
          Length = 688

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 536 gggaacttgatcttggagtcgtggaactgctt 505

to top

>gb|AC125229.3| Mus musculus BAC clone RP23-45P1 from 5, complete sequence
          Length = 167771

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 85     cacatgcaaaacattcaaactc 106
              ||||||||||||||||||||||
Sbjct: 143671 cacatgcaaaacattcaaactc 143692

to top

>emb|CR734984.2|CNS0GTW7 Tetraodon nigroviridis full-length cDNA
          Length = 613

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 485 gggaacttgatctttgagtcgtggaactgctt 454

to top

>emb|CR734787.2|CNS0GTQQ Tetraodon nigroviridis full-length cDNA
          Length = 440

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 313 gggaacttgatctttgagtcgtggaactgctt 282

to top

>emb|CR734404.2|CNS0GTG3 Tetraodon nigroviridis full-length cDNA
          Length = 613

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 484 gggaacttgatctttgagtcgtggaactgctt 453

to top

>emb|CR733930.2|CNS0GT2X Tetraodon nigroviridis full-length cDNA
          Length = 303

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 176 gggaacttgatctttgagtcgtggaactgctt 145

to top

>emb|CR733929.2|CNS0GT2W Tetraodon nigroviridis full-length cDNA
          Length = 302

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 175 gggaacttgatctttgagtcgtggaactgctt 144

to top

>emb|CR733735.2|CNS0GSXI Tetraodon nigroviridis full-length cDNA
          Length = 613

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 485 gggaacttgatctttgagtcgtggaactgctt 454

to top

>emb|CR733734.2|CNS0GSXH Tetraodon nigroviridis full-length cDNA
          Length = 612

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 485 gggaacttgatctttgagtcgtggaactgctt 454

to top

>emb|CR733720.2|CNS0GSX3 Tetraodon nigroviridis full-length cDNA
          Length = 619

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 492 gggaacttgatctttgagtcgtggaactgctt 461

to top

>emb|CR733692.2|CNS0GSWB Tetraodon nigroviridis full-length cDNA
          Length = 612

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 485 gggaacttgatctttgagtcgtggaactgctt 454

to top

>emb|CR732797.2|CNS0GSD2 Tetraodon nigroviridis full-length cDNA
          Length = 613

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 485 gggaacttgatctttgagtcgtggaactgctt 454

to top

>emb|CR730027.2|CNS0GQ8H Tetraodon nigroviridis full-length cDNA
          Length = 538

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 412 gggaacttgatctttgagtcgtggaactgctt 381

to top

>emb|CR724944.3|CNS0GMBA Tetraodon nigroviridis full-length cDNA
          Length = 534

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 409 gggaacttgatctttgagtcgtggaactgctt 378

to top

>emb|CR724423.2|CNS0GLWT Tetraodon nigroviridis full-length cDNA
          Length = 538

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 412 gggaacttgatctttgagtcgtggaactgctt 381

to top

>emb|CR723073.2|CNS0GKVB Tetraodon nigroviridis full-length cDNA
          Length = 610

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 485 gggaacttgatctttgagtcgtggaactgctt 454

to top

>emb|CR720538.2|CNS0GIWW Tetraodon nigroviridis full-length cDNA
          Length = 613

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 488 gggaacttgatctttgagtcgtggaactgctt 457

to top

>emb|CR719126.2|CNS0GHTO Tetraodon nigroviridis full-length cDNA
          Length = 627

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 489 gggaacttgatctttgagtcgtggaactgctt 458

to top

>emb|CR718016.2|CNS0GGYU Tetraodon nigroviridis full-length cDNA
          Length = 615

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 489 gggaacttgatctttgagtcgtggaactgctt 458

to top

>emb|CR717902.2|CNS0GGVO Tetraodon nigroviridis full-length cDNA
          Length = 605

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 489 gggaacttgatctttgagtcgtggaactgctt 458

to top

>emb|CR707962.2|CNS0G97Q Tetraodon nigroviridis full-length cDNA
          Length = 623

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 485 gggaacttgatctttgagtcgtggaactgctt 454

to top

>emb|CR706795.2|CNS0G8BB Tetraodon nigroviridis full-length cDNA
          Length = 629

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 489 gggaacttgatctttgagtcgtggaactgctt 458

to top

>emb|CR706096.2|CNS0G7RW Tetraodon nigroviridis full-length cDNA
          Length = 623

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 485 gggaacttgatctttgagtcgtggaactgctt 454

to top

>emb|CR703601.2|CNS0G5UL Tetraodon nigroviridis full-length cDNA
          Length = 616

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 489 gggaacttgatctttgagtcgtggaactgctt 458

to top

>emb|CR697423.2|CNS0G12Z Tetraodon nigroviridis full-length cDNA
          Length = 612

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 484 gggaacttgatctttgagtcgtggaactgctt 453

to top

>emb|CR696636.2|CNS0G0H4 Tetraodon nigroviridis full-length cDNA
          Length = 612

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 485 gggaacttgatctttgagtcgtggaactgctt 454

to top

>emb|CR695615.2|CNS0FZOR Tetraodon nigroviridis full-length cDNA
          Length = 612

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 485 gggaacttgatctttgagtcgtggaactgctt 454

to top

>emb|CR685828.2|CNS0FS4W Tetraodon nigroviridis full-length cDNA
          Length = 610

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 485 gggaacttgatctttgagtcgtggaactgctt 454

to top

>emb|CR688470.2|CNS0FU6A Tetraodon nigroviridis full-length cDNA
          Length = 614

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 487 gggaacttgatctttgagtcgtggaactgctt 456

to top

>emb|CR687228.2|CNS0FT7S Tetraodon nigroviridis full-length cDNA
          Length = 612

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 485 gggaacttgatctttgagtcgtggaactgctt 454

to top

>emb|CR684968.2|CNS0FRH0 Tetraodon nigroviridis full-length cDNA
          Length = 610

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 485 gggaacttgatctttgagtcgtggaactgctt 454

to top

>emb|CR683572.2|CNS0FQE8 Tetraodon nigroviridis full-length cDNA
          Length = 608

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 489 gggaacttgatctttgagtcgtggaactgctt 458

to top

>emb|CR680258.2|CNS0FNU6 Tetraodon nigroviridis full-length cDNA
          Length = 608

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 484 gggaacttgatctttgagtcgtggaactgctt 453

to top

>emb|CR677039.2|CNS0FLD7 Tetraodon nigroviridis full-length cDNA
          Length = 612

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 485 gggaacttgatctttgagtcgtggaactgctt 454

to top

>emb|CR672902.2|CNS0FI6K Tetraodon nigroviridis full-length cDNA
          Length = 610

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 485 gggaacttgatctttgagtcgtggaactgctt 454

to top

>emb|CR671291.2|CNS0FGXT Tetraodon nigroviridis full-length cDNA
          Length = 613

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 485 gggaacttgatctttgagtcgtggaactgctt 454

to top

>emb|CR666969.2|CNS0FDLR Tetraodon nigroviridis full-length cDNA
          Length = 480

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 353 gggaacttgatctttgagtcgtggaactgctt 322

to top

>emb|CR660236.2|CNS0F8EQ Tetraodon nigroviridis full-length cDNA
          Length = 626

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 486 gggaacttgatctttgagtcgtggaactgctt 455

to top

>emb|CR655020.2|CNS0F4DU Tetraodon nigroviridis full-length cDNA
          Length = 612

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 485 gggaacttgatctttgagtcgtggaactgctt 454

to top

>emb|CR653062.2|CNS0F2VG Tetraodon nigroviridis full-length cDNA
          Length = 571

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 444 gggaacttgatctttgagtcgtggaactgctt 413

to top

>emb|CR652436.2|CNS0F2E2 Tetraodon nigroviridis full-length cDNA
          Length = 610

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 485 gggaacttgatctttgagtcgtggaactgctt 454

to top

>emb|CR650724.2|CNS0F12I Tetraodon nigroviridis full-length cDNA
          Length = 612

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 485 gggaacttgatctttgagtcgtggaactgctt 454

to top

>emb|CR649137.2|CNS0EZUF Tetraodon nigroviridis full-length cDNA
          Length = 615

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 490 gggaacttgatctttgagtcgtggaactgctt 459

to top

>emb|CR648353.2|CNS0EZ8N Tetraodon nigroviridis full-length cDNA
          Length = 604

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 485 gggaacttgatctttgagtcgtggaactgctt 454

to top

>emb|CR646910.2|CNS0EY4K Tetraodon nigroviridis full-length cDNA
          Length = 612

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 485 gggaacttgatctttgagtcgtggaactgctt 454

to top

>emb|CR644204.2|CNS0EW1E Tetraodon nigroviridis full-length cDNA
          Length = 610

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 485 gggaacttgatctttgagtcgtggaactgctt 454

to top

>emb|CR644108.2|CNS0EVYQ Tetraodon nigroviridis full-length cDNA
          Length = 612

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 485 gggaacttgatctttgagtcgtggaactgctt 454

to top

>emb|CR642680.2|CNS0EUV2 Tetraodon nigroviridis full-length cDNA
          Length = 610

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 485 gggaacttgatctttgagtcgtggaactgctt 454

to top

>emb|CR642616.2|CNS0EUTA Tetraodon nigroviridis full-length cDNA
          Length = 610

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 485 gggaacttgatctttgagtcgtggaactgctt 454

to top

>emb|CR642452.2|CNS0EUOQ Tetraodon nigroviridis full-length cDNA
          Length = 604

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 485 gggaacttgatctttgagtcgtggaactgctt 454

to top

>emb|CR638692.2|CNS0ERSA Tetraodon nigroviridis full-length cDNA
          Length = 610

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 485 gggaacttgatctttgagtcgtggaactgctt 454

to top

>emb|CR638181.2|CNS0ERE3 Tetraodon nigroviridis full-length cDNA
          Length = 610

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 485 gggaacttgatctttgagtcgtggaactgctt 454

to top

>emb|CR637544.2|CNS0EQWE Tetraodon nigroviridis full-length cDNA
          Length = 616

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 489 gggaacttgatctttgagtcgtggaactgctt 458

to top

>emb|CR633797.2|CNS0EO0B Tetraodon nigroviridis full-length cDNA
          Length = 610

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 485 gggaacttgatctttgagtcgtggaactgctt 454

to top

>emb|AL583805.7| Human DNA sequence from clone RP11-134K1 on chromosome 9 Contains a
             novel gene, a ribosomal protein 18 (RPL18) pseudogene, the
             5' end of the PTPRD gene for protein tyrosine phosphatase,
             receptor type, D (HPTP, PTPD, HPTPD) and a CpG island,
             complete sequence
          Length = 89728

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                 
Query: 221   cagcgggaacttgatnttngagttgtggaactgctt 256
             ||||||||||||||| ||  ||| ||||||||||||
Sbjct: 49298 cagcgggaacttgatcttgcagtcgtggaactgctt 49263

to top

>emb|AL096764.11|HSJ298J18 Human DNA sequence from clone RP1-298J18 on chromosome Xq22.3-24
           Contains a 60S ribosomal protein (RPL18A), the gene for
           an uncharacterized hematopoietic stem/progenitor cells
           protein MDS031, the 5' end of a novel gene and a CpG
           island, complete sequence
          Length = 99332

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 221 cagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||||  || |||| ||||||||||||
Sbjct: 454 cagcgggaacttgaccttagagtcgtggaactgctt 489

to top

>ref|NM_212510.1| Rattus norvegicus similar to 60S ribosomal protein L18a (MGC72957),
           mRNA
          Length = 645

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 499 gggaacttgatcttggagtcgtggaactgctt 468

to top

>gb|BC058498.1| Rattus norvegicus similar to 60S ribosomal protein L18a, mRNA (cDNA
           clone MGC:72957 IMAGE:6919102), complete cds
          Length = 645

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 499 gggaacttgatcttggagtcgtggaactgctt 468

to top

>gb|AC008481.9| Homo sapiens chromosome 19 clone CTC-398G3, complete sequence
          Length = 142645

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                  
Query: 221    cagcgggaacttgatnttngagttgtggaactgctt 256
              ||||||||||||||| || ||||  |||||||||||
Sbjct: 106429 cagcgggaacttgatcttggagtcttggaactgctt 106394

to top

>gb|AY779046.1| Homo sapiens ribosomal protein L18a-like protein mRNA, complete cds
          Length = 541

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 221 cagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||||| ||  ||| ||||||||||||
Sbjct: 462 cagcgggaacttgatcttgcagtcgtggaactgctt 427

to top

>gb|AC097638.2| Homo sapiens chromosome 3 clone RP11-353H3, complete sequence
          Length = 170330

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                 
Query: 221   cagcgggaacttgatnttngagttgtggaactgctt 256
             |||| |||||||||| || |||| ||||||||||||
Sbjct: 46277 cagcaggaacttgatcttggagtcgtggaactgctt 46242

to top

>gb|BC102624.1| Bos taurus similar to ribosomal protein L18a, mRNA (cDNA clone
           MGC:127693 IMAGE:7962947), complete cds
          Length = 667

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 499 gggaacttgatcttggagtcgtggaactgctt 468

to top

>gb|AC008079.24| Homo sapiens chromosome 22 clone bac519d21 map 22q11, complete sequence
          Length = 170102

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 221   cagcgggaacttgatnttngagttgtggaactgctt 256
             |||| |||||||||| || || ||||||||||||||
Sbjct: 12503 cagcaggaacttgatcttggaattgtggaactgctt 12538

to top

>gb|AC016830.5| Homo sapiens chromosome 22 clone b81b3 map 22q11, complete sequence
          Length = 192720

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                  
Query: 221    cagcgggaacttgatnttngagttgtggaactgctt 256
              |||| |||||||||| || || ||||||||||||||
Sbjct: 146690 cagcaggaacttgatcttggaattgtggaactgctt 146725

to top

>gb|AC008101.16| Homo sapiens chromosome 22 clone b677f7 map 22q11, complete sequence
          Length = 128118

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 221   cagcgggaacttgatnttngagttgtggaactgctt 256
             |||| |||||||||| || || ||||||||||||||
Sbjct: 45078 cagcaggaacttgatcttggaattgtggaactgctt 45113

to top

>gb|AC016027.15| Homo sapiens chromosome 22 clone b476c20 map 22q11, complete sequence
          Length = 174991

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                  
Query: 221    cagcgggaacttgatnttngagttgtggaactgctt 256
              |||| |||||||||| || || ||||||||||||||
Sbjct: 141981 cagcaggaacttgatcttggaattgtggaactgctt 142016

to top

>emb|BX819594.1|CNS0A9TR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB92ZG02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 711

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 226 ggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgcacagcttg 281
           |||||||||| ||   |||||||||||| || ||| | || |||||||||||||||
Sbjct: 490 ggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttg 435

to top

>gb|AC121887.4| Mus musculus BAC clone RP24-142B15 from 5, complete sequence
          Length = 234919

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 85     cacatgcaaaacattcaaactc 106
              ||||||||||||||||||||||
Sbjct: 222283 cacatgcaaaacattcaaactc 222262

to top

>emb|AJ718289.1| Nicotiana tabacum cDNA-AFLP-fragment BSTT4-43-380, cultivar Bright
           Yellow 2
          Length = 320

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 225 gggaacttgatnttngagttgtggaactgcttcgtgttgtccctcttgcacagctt 280
           ||||||||||| || ||||  ||||||||||| ||| | |||||||| || |||||
Sbjct: 226 gggaacttgattttggagtcatggaactgcttggtgctctccctcttacatagctt 171



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 297 gtcttgatgatctggatgca 316
           ||||||||||||||||||||
Sbjct: 154 gtcttgatgatctggatgca 135

to top

>emb|X14181.1|RRRPL18A Rat mRNA for ribosomal protein L18a
          Length = 591

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 493 gggaacttgatcttggagtcgtggaactgctt 462

to top

>emb|CR760185.2| Xenopus tropicalis finished cDNA, clone TNeu035i09
          Length = 607

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 462 gggaacttgatctttgagtcgtggaactgctt 431

to top

>dbj|AB098916.1| Bos taurus mRNA for similar to ribosomal protein L18a, partial cds,
           clone: ORCS10396
          Length = 597

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 473 gggaacttgatcttggagtcgtggaactgctt 442

to top

>gb|AF045188.1|AF045188 Salmo salar ribosomal protein L18a mRNA, complete cds
          Length = 607

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 225 gggaacttgatnttngagttgtggaactgctt 256
           ||||||||||| || |||| ||||||||||||
Sbjct: 474 gggaacttgatcttcgagtcgtggaactgctt 443

to top

>emb|AL772378.8| Mouse DNA sequence from clone RP23-106C4 on chromosome X, complete
             sequence
          Length = 109193

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 225   gggaacttgatnttngagttgtggaactgctt 256
             ||||| ||||| || |||||||||||||||||
Sbjct: 37916 gggaatttgatcttggagttgtggaactgctt 37885

to top

>emb|AJ421480.1| Mus musculus X-inactivation center region; segment 3/3
          Length = 214384

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 225    gggaacttgatnttngagttgtggaactgctt 256
              ||||| ||||| || |||||||||||||||||
Sbjct: 111853 gggaatttgatcttggagttgtggaactgctt 111884

to top

>gb|AY678266.1| Synthetic construct monomeric red-orange fluorescent protein gene,
           complete cds
          Length = 711

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 166 tggccttgtaggtggtcttga 186
           |||||||||||||||||||||
Sbjct: 565 tggccttgtaggtggtcttga 545

to top

>gb|AY678265.1| Synthetic construct monomeric orange fluorescent protein gene,
           complete cds
          Length = 711

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 166 tggccttgtaggtggtcttga 186
           |||||||||||||||||||||
Sbjct: 565 tggccttgtaggtggtcttga 545

to top

>gb|AY678264.1| Synthetic construct monomeric red fluorescent protein gene,
           complete cds
          Length = 711

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 166 tggccttgtaggtggtcttga 186
           |||||||||||||||||||||
Sbjct: 565 tggccttgtaggtggtcttga 545

to top

>emb|Z77131.1|CEC54C6 Caenorhabditis elegans Cosmid C54C6, complete sequence
          Length = 35500

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 155   gttgggccttgtggccttgta 175
             |||||||||||||||||||||
Sbjct: 35457 gttgggccttgtggccttgta 35437

to top

>emb|Z36237.1|CEC48D5 Caenorhabditis elegans Cosmid C48D5, complete sequence
          Length = 38370

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 155 gttgggccttgtggccttgta 175
           |||||||||||||||||||||
Sbjct: 59  gttgggccttgtggccttgta 39

to top

>gb|AY232187.1| Drosophila yakuba clone yak-ad_RpL18A mRNA sequence
          Length = 240

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 219 accagcgggaacttgatnttngagttgtggaactgcttc 257
           ||||| ||||||||||| || || | |||||||||||||
Sbjct: 173 accagagggaacttgatcttcgaatcgtggaactgcttc 135

to top

>emb|AL590640.19| Human DNA sequence from clone RP11-40H20 on chromosome 1 Contains the 5'
              end of the SLC9A1 gene for solute carrier family 9
              (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+/H+,
              amiloride sensitive), a ribosomal protein L18a (RPL18A)
              pseudogene, a novel pseudogene (FLJ20420), a nucleophosmin
              (nucleolar phosphoprotein B23, numatrin)(NPM1) pseudogene,
              a mall nuclear ribonucleoprotein polypeptide E (SNRPE)
              pseudogene, a novel gene, the 5' end of a novel gene
              (KIAA1037) and a CpG island, complete sequence
          Length = 147052

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 31/35 (88%)
 Strand = Plus / Plus

                                                 
Query: 222    agcgggaacttgatnttngagttgtggaactgctt 256
              ||||| |||||||| || |||| ||||||||||||
Sbjct: 121298 agcggaaacttgatcttggagtcgtggaactgctt 121332

to top

>emb|BX053393.1|CNS09DD1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 165

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 111 caccagcgggaatcggatcttcgagttgtggaactgctt 149

to top

>emb|BX072011.1|CNS09RQ7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 702

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 434 caccagcgggaatcggatcttcgagttgtggaactgctt 472

to top

>emb|BX072010.1|CNS09RQ6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 773

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 506 caccagcgggaatcggatcttcgagttgtggaactgctt 468

to top

>emb|BX071935.1|CNS09RO3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 940

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 414 caccagcgggaatcggatcttcgagttgtggaactgctt 452

to top

>emb|BX071934.1|CNS09RO2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 492 caccagcgggaatcggatcttcgagttgtggaactgctt 454

to top

>emb|BX071198.1|CNS09R3M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 407 caccagcgggaatcggatcttcgagttgtggaactgctt 445

to top

>emb|BX071197.1|CNS09R3L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 482 caccagcgggaatcggatcttcgagttgtggaactgctt 444

to top

>emb|BX071326.1|CNS09R76 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 482 caccagcgggaatcggatcttcgagttgtggaactgctt 444

to top

>emb|BX071022.1|CNS09QYQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 422 caccagcgggaatcggatcttcgagttgtggaactgctt 460

to top

>emb|BX071021.1|CNS09QYP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 885

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 497 caccagcgggaatcggatcttcgagttgtggaactgctt 459

to top

>emb|BX070958.1|CNS09QWY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 931

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 420 caccagcgggaatcggatcttcgagttgtggaactgctt 458

to top

>emb|BX070094.1|CNS09Q8Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 684

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 479 caccagcgggaatcggatcttcgagttgtggaactgctt 441

to top

>emb|BX069977.1|CNS09Q5P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 489 caccagcgggaatcggatcttcgagttgtggaactgctt 451

to top

>emb|BX069941.1|CNS09Q4P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 694

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 413 caccagcgggaatcggatcttcgagttgtggaactgctt 451

to top

>emb|BX069940.1|CNS09Q4O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 932

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 467 caccagcgggaatcggatcttcgagttgtggaactgctt 429

to top

>emb|BX069703.1|CNS09PY3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6BH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 950

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 392 caccagcgggaatcggatcttcgagttgtggaactgctt 430

to top

>emb|BX069702.1|CNS09PY2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6BH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 940

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 476 caccagcgggaatcggatcttcgagttgtggaactgctt 438

to top

>emb|BX060940.1|CNS09J6O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 392

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 348 caccagcgggaatcggatcttcgagttgtggaactgctt 386

to top

>emb|BX060939.1|CNS09J6N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 476 caccagcgggaatcggatcttcgagttgtggaactgctt 438

to top

>emb|BX069369.1|CNS09POT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6AA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 577

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 437 caccagcgggaatcggatcttcgagttgtggaactgctt 475

to top

>emb|BX069368.1|CNS09POS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6AA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 503 caccagcgggaatcggatcttcgagttgtggaactgctt 465

to top

>emb|BX069214.1|CNS09PKI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53DB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 981

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 441 caccagcgggaatcggatcttcgagttgtggaactgctt 479

to top

>emb|BX069213.1|CNS09PKH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 493 caccagcgggaatcggatcttcgagttgtggaactgctt 455

to top

>emb|BX068918.1|CNS09PCA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53BE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 443 caccagcgggaatcggatcttcgagttgtggaactgctt 481

to top

>emb|BX068917.1|CNS09PC9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 516 caccagcgggaatcggatcttcgagttgtggaactgctt 478

to top

>emb|BX068781.1|CNS09P8H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 514

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 447 caccagcgggaatcggatcttcgagttgtggaactgctt 485

to top

>emb|BX068780.1|CNS09P8G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 501 caccagcgggaatcggatcttcgagttgtggaactgctt 463

to top

>emb|BX068699.1|CNS09P67 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 435 caccagcgggaatcggatcttcgagttgtggaactgctt 473

to top

>emb|BX068698.1|CNS09P66 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 486 caccagcgggaatcggatcttcgagttgtggaactgctt 448

to top

>emb|BX068685.1|CNS09P5T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 796

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 271 caccagcgggaatcggatcttcgagttgtggaactgctt 309

to top

>emb|BX068632.1|CNS09P4C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 469

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 401 caccagcgggaatcggatcttcgagttgtggaactgctt 439

to top

>emb|BX068631.1|CNS09P4B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 494 caccagcgggaatcggatcttcgagttgtggaactgctt 456

to top

>emb|BX068389.1|CNS09OXL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 494 caccagcgggaatcggatcttcgagttgtggaactgctt 456

to top

>emb|BX068343.1|CNS09OWB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52BH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 894

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 387 caccagcgggaatcggatcttcgagttgtggaactgctt 425

to top

>emb|BX068342.1|CNS09OWA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 858

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 471 caccagcgggaatcggatcttcgagttgtggaactgctt 433

to top

>emb|BX068334.1|CNS09OW2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 488 caccagcgggaatcggatcttcgagttgtggaactgctt 450

to top

>emb|BX068304.1|CNS09OV8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 978

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 500 caccagcgggaatcggatcttcgagttgtggaactgctt 462

to top

>emb|BX068271.1|CNS09OUB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52BE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 538

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 347 caccagcgggaatcggatcttcgagttgtggaactgctt 385

to top

>emb|BX068270.1|CNS09OUA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 483 caccagcgggaatcggatcttcgagttgtggaactgctt 445

to top

>emb|BX068265.1|CNS09OU5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52BE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 790

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 411 caccagcgggaatcggatcttcgagttgtggaactgctt 449

to top

>emb|BX068264.1|CNS09OU4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 741

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 490 caccagcgggaatcggatcttcgagttgtggaactgctt 452

to top

>emb|BX068004.1|CNS09OMW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 832

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 400 caccagcgggaatcggatcttcgagttgtggaactgctt 438

to top

>emb|BX068003.1|CNS09OMV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 822

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 470 caccagcgggaatcggatcttcgagttgtggaactgctt 432

to top

>emb|BX067731.1|CNS09OFB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51CB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 887

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 422 caccagcgggaatcggatcttcgagttgtggaactgctt 460

to top

>emb|BX067730.1|CNS09OFA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 492 caccagcgggaatcggatcttcgagttgtggaactgctt 454

to top

>emb|BX067102.1|CNS09NXU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 564

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 438 caccagcgggaatcggatcttcgagttgtggaactgctt 476

to top

>emb|BX067101.1|CNS09NXT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 801

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 500 caccagcgggaatcggatcttcgagttgtggaactgctt 462

to top

>emb|BX066999.1|CNS09NUZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 755

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 430 caccagcgggaatcggatcttcgagttgtggaactgctt 468

to top

>emb|BX066998.1|CNS09NUY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 869

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 494 caccagcgggaatcggatcttcgagttgtggaactgctt 456

to top

>emb|BX066931.1|CNS09NT3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 491 caccagcgggaatcggatcttcgagttgtggaactgctt 453

to top

>emb|BX066843.1|CNS09NQN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 429 caccagcgggaatcggatcttcgagttgtggaactgctt 467

to top

>emb|BX066842.1|CNS09NQM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 499 caccagcgggaatcggatcttcgagttgtggaactgctt 461

to top

>emb|BX066697.1|CNS09NML Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 613

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 495 caccagcgggaatcggatcttcgagttgtggaactgctt 457

to top

>emb|BX066444.1|CNS09NFK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 815

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 486 caccagcgggaatcggatcttcgagttgtggaactgctt 448

to top

>emb|BX065926.1|CNS09N16 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 508

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 424 caccagcgggaatcggatctttgagttgtggaactgctt 462

to top

>emb|BX065925.1|CNS09N15 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 483 caccagcgggaatcggatctttgagttgtggaactgctt 445

to top

>emb|BX065769.1|CNS09MWT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49DB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 648

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 419 caccagcgggaatcggatcttcgagttgtggaactgctt 457

to top

>emb|BX065768.1|CNS09MWS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 873

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 497 caccagcgggaatcggatcttcgagttgtggaactgctt 459

to top

>emb|BX065563.1|CNS09MR3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49CA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 853

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 401 caccagcgggaatcggatcttcgagttgtggaactgctt 439

to top

>emb|BX065562.1|CNS09MR2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49CA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 522 caccagcgggaatcggatcttcgagttgtggaactgctt 484

to top

>emb|BX065379.1|CNS09MLZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 425 caccagcgggaatcggatcttcgagttgtggaactgctt 463

to top

>emb|BX065287.1|CNS09MJF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 779

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 410 caccagcgggaatcggatcttcgagttgtggaactgctt 448

to top

>emb|BX065286.1|CNS09MJE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 854

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 480 caccagcgggaatcggatcttcgagttgtggaactgctt 442

to top

>emb|BX065104.1|CNS09MEC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 814

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 407 caccagcgggaatcggatcttcgagttgtggaactgctt 445

to top

>emb|BX065103.1|CNS09MEB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 479 caccagcgggaatcggatcttcgagttgtggaactgctt 441

to top

>emb|BX065085.1|CNS09MDT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 681

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 311 caccagcgggaatcggatcttcgagttgtggaactgctt 273

to top

>emb|BX065080.1|CNS09MDO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 895

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 402 caccagcgggaatcggatcttcgagttgtggaactgctt 440

to top

>emb|BX065079.1|CNS09MDN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 481 caccagcgggaatcggatcttcgagttgtggaactgctt 443

to top

>emb|BX065033.1|CNS09MCD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 824

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 402 caccagcgggaatcggatcttcgagttgtggaactgctt 440

to top

>emb|BX065032.1|CNS09MCC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 218 caccagcgggaacttgatnttngagttgtggaactgctt 256
           ||||||||||||   ||| || |||||||||||||||||
Sbjct: 471 caccagcgggaatcggatcttcgagttgtggaactgctt 433


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,337,764
Number of Sequences: 3902068
Number of extensions: 2337764
Number of successful extensions: 44826
Number of sequences better than 10.0: 519
Number of HSP's better than 10.0 without gapping: 520
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 43898
Number of HSP's gapped (non-prelim): 915
length of query: 355
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 333
effective length of database: 17,147,199,772
effective search space: 5710017524076
effective search space used: 5710017524076
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result