ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags24h17
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AM039900.1| Hordeum vulgare partial mRNA for chromomethylase... 662 0.0
2gb|BT009291.1| Triticum aestivum clone wlm0.pk0028.h3:fis, full ... 385 e-104
3gb|AC134545.5| Mus musculus BAC clone RP24-470H2 from chromosome... 50 0.005
4emb|X81088.1|HVB914 Hordeum vulgare B194 promoter sequence 50 0.005
5gb|AC146000.4| Pan troglodytes BAC clone RP43-147L18 from 7, com... 48 0.019
6gb|AC123797.3| Mus musculus BAC clone RP24-326O4 from chromosome... 48 0.019
7gb|AC144428.1| Pan troglodytes BAC clone RP43-2C19 from 7, compl... 48 0.019
8gb|AC113464.17| Mus musculus chromosome 8, clone RP23-183P1, com... 48 0.019
9emb|AL589661.21| Mouse DNA sequence from clone RP23-58B7 on chro... 48 0.019
10gb|AC160972.4| Mus musculus BAC clone RP24-571D21 from chromosom... 46 0.076
11gb|AC118017.15| Mus musculus chromosome 7, clone RP23-457C1, com... 46 0.076
12gb|DQ481663.1| Takifugu rubripes HoxAa gene cluster, complete se... 46 0.076
13gb|AC113495.15| Mus musculus chromosome 9, clone RP23-361O11, co... 46 0.076
14gb|AC009127.10| Homo sapiens chromosome 16 clone RP11-498D10, co... 46 0.076
15gb|AC131769.3| Mus musculus BAC clone RP24-290G2 from chromosome... 46 0.076
16emb|AL365360.9| Human DNA sequence from clone RP11-546N22 on chr... 46 0.076
17gb|AC115986.3| Homo sapiens chromosome 18, clone RP11-112C14, co... 46 0.076
18gb|AC022743.7| Homo sapiens chromosome 18, clone RP11-789C7, com... 46 0.076
19gb|AC161113.2| Mus musculus BAC clone RP24-362N9 from chromosome... 46 0.076
20dbj|AK165915.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-... 46 0.076
21gb|AC084272.41| Mus musculus strain C57BL/6J clone rp23-11g21 ma... 46 0.076
22gb|AC148988.5| Mus musculus BAC clone RP23-85B15 from chromosome... 46 0.076
23gb|AC009087.4|AC009087 Homo sapiens chromosome 16 clone RP11-384... 46 0.076
24emb|X56010.1|SVHRGPG Sorghum vulgare hydroxyproline-rich glycopr... 46 0.076
25emb|BX571817.14| Zebrafish DNA sequence from clone DKEY-287H13 i... 46 0.076
26gb|AC163357.5| Mus musculus BAC clone RP23-3K10 from chromosome ... 46 0.076
27emb|CR450796.7| Zebrafish DNA sequence from clone CH211-9N7 in l... 46 0.076
28emb|AL928926.9| Mouse DNA sequence from clone RP23-443G7 on chro... 46 0.076
29gb|AC164883.5| Mus musculus BAC clone RP23-88A20 from chromosome... 44 0.30
30gb|AY019546.1| Oryza sativa microsatellite MRG1871 containing (A... 44 0.30
31gb|AY017730.1| Oryza sativa microsatellite MRG0055 containing (A... 44 0.30
32gb|AC102151.8| Mus musculus chromosome 18, clone RP23-312L17, co... 44 0.30
33gb|AC132902.9| Mus musculus chromosome 13, clone RP24-286O14, co... 44 0.30
34gb|AC102532.12| Mus musculus chromosome 12, clone RP23-49D23, co... 44 0.30
35gb|AC121290.6| Mus musculus chromosome 16, clone RP23-84N4, comp... 44 0.30
36gb|AC165352.2| Mus musculus BAC clone RP23-205C7 from chromosome... 44 0.30
37gb|AC161257.2| Mus musculus BAC clone RP24-91A16 from chromosome... 44 0.30
38gb|AC125460.4| Mus musculus BAC clone RP24-448D10 from chromosom... 44 0.30
39gb|AC125114.3| Mus musculus BAC clone RP24-254M13 from chromosom... 44 0.30
40gb|AC117248.3| Mus musculus BAC clone RP24-345A14 from chromosom... 44 0.30
41gb|AC126026.4| Mus musculus BAC clone RP24-486A17 from chromosom... 44 0.30
42emb|CR956382.7| Pig DNA sequence from clone CH242-231E9 on chrom... 44 0.30
43emb|CR450739.19| Zebrafish DNA sequence from clone DKEY-175B17 i... 44 0.30
44gb|AC121523.6| Mus musculus chromosome 18, clone RP24-92N23, com... 44 0.30
45gb|AC113287.8| Mus musculus chromosome 3, clone RP23-412L13, com... 44 0.30
46gb|AC158751.7| Mus musculus chromosome 7, clone RP23-413C19, com... 44 0.30
47gb|AC158512.2| Mus musculus BAC clone RP24-319O6 from chromosome... 44 0.30
48gb|AC163029.5| Mus musculus chromosome 1, clone RP23-267I23, com... 44 0.30
49emb|AL139230.25| Human DNA sequence from clone RP11-182M20 on ch... 44 0.30
50gb|AC161177.4| Mus musculus chromosome 18, clone RP24-131H12, co... 44 0.30
51emb|AL021396.8|HS971N18 Human DNA sequence from clone RP5-971N18... 44 0.30
52emb|AL645644.8| Mouse DNA sequence from clone RP23-400O5 on chro... 44 0.30
53emb|AL662902.14| Mouse DNA sequence from clone RP23-417K16 on ch... 44 0.30
54emb|AL663040.6| Mouse DNA sequence from clone RP23-61M22 on chro... 44 0.30
55emb|AL929183.14| Zebrafish DNA sequence from clone CH211-142M8 i... 44 0.30
56emb|CR853303.6| Pig DNA sequence from clone PigE-173F2, complete... 44 0.30
57gb|AC104236.2| Homo sapiens chromosome 15, clone RP11-24J19, com... 44 0.30
58gb|AC090457.6| Homo sapiens chromosome 18, clone RP11-357H3, com... 44 0.30
59gb|AC096566.2| Homo sapiens BAC clone RP11-292B1 from 4, complet... 44 0.30
60gb|AC105151.8| Mus musculus chromosome 1, clone RP23-28N2, compl... 44 0.30
61gb|AC025296.10| Oryza sativa chromosome 10 BAC OSJNBa0076F20 gen... 44 0.30
62dbj|AK083880.1| Mus musculus 12 days embryo spinal ganglion cDNA... 44 0.30
63dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.30
64gb|AC154803.2| Mus musculus BAC clone RP24-505I19 from chromosom... 44 0.30
65gb|AF221986.1|AF221986 Calliactis parasitica peptidylglycine alp... 44 0.30
66gb|AC123835.4| Mus musculus BAC clone RP23-365J20 from chromosom... 44 0.30
67gb|AC104020.10| Homo sapiens chromosome 15, clone RP11-369K8, co... 44 0.30
68emb|BX005464.7| Zebrafish DNA sequence from clone DKEY-24J21, co... 44 0.30
69emb|BX248102.11| Zebrafish DNA sequence from clone CH211-243F3, ... 44 0.30
70emb|AL732452.5| Mouse DNA sequence from clone RP23-177C20 on chr... 44 0.30
71gb|AC124636.23| Mus musculus chromosome 16, clone RP23-454J20, c... 44 0.30
72emb|AL645755.20| Zebrafish DNA sequence from clone RP71-1N18 in ... 44 0.30
73gb|AC120123.19| Mus musculus chromosome 7, clone RP23-152B12, co... 44 0.30
74emb|BX927343.16| Zebrafish DNA sequence from clone CH211-57L21 i... 44 0.30
75gb|AC102255.10| Mus musculus chromosome 18, clone RP24-182H11, c... 44 0.30
76gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 44 0.30
77gb|AC161272.3| Mus musculus BAC clone RP23-56M19 from chromosome... 44 0.30
78emb|AL732539.6| Mouse DNA sequence from clone RP23-255E6 on chro... 44 0.30
79emb|CT033847.5| Mouse DNA sequence from clone RP24-225N8 on chro... 44 0.30
80emb|AL929572.10| Mouse DNA sequence from clone RP23-464H12 on ch... 44 0.30
81emb|AL591598.8| Mouse DNA sequence from clone RP23-272C14 on chr... 44 0.30
82emb|AL805901.6| Mouse DNA sequence from clone RP23-24K4 on chrom... 44 0.30
83gb|AC166773.7| Mus musculus chromosome 7, clone RP24-303J15, com... 42 1.2
84gb|AC155249.2| Mus musculus BAC clone RP24-254A5 from chromosome... 42 1.2
85gb|AC099975.11| Mus musculus chromosome 5, clone RP23-23A2, comp... 42 1.2
86gb|AC155712.8| Mus musculus 10 BAC RP24-183O8 (Roswell Park Canc... 42 1.2
87gb|AC132396.6| Mus musculus BAC clone RP23-394F17 from chromosom... 42 1.2
88gb|AC165161.3| Mus musculus BAC clone RP23-187K9 from chromosome... 42 1.2
89gb|AC165317.8| Mus musculus chromosome 5, clone RP23-265O20, com... 42 1.2
90gb|AC104196.8| Mus musculus chromosome 5, clone RP24-239K15, com... 42 1.2
91gb|AC102603.11| Mus musculus chromosome 14, clone RP23-385I17, c... 42 1.2
92gb|AY083355.1| Gerstaeckeria galapagoensis microsatellite GERST2... 42 1.2
93gb|AC135599.3| Oryza sativa (japonica cultivar-group) chromosome... 42 1.2
94gb|AC101715.8| Mus musculus chromosome 1, clone RP23-283P17, com... 42 1.2
95gb|AC123746.20| Mus musculus chromosome 1, clone RP24-122E21, co... 42 1.2
96gb|AC125255.15| Mus musculus chromosome 5, clone RP24-332C17, co... 42 1.2
97gb|AC093100.2| Drosophila melanogaster clone BACR05J04, complete... 42 1.2
98gb|AC113485.19| Mus musculus chromosome 19, clone RP23-346D12, c... 42 1.2
99gb|AC116798.11| Mus musculus chromosome 1, clone RP24-329K22, co... 42 1.2
100gb|AC138654.4| Mus musculus BAC clone RP23-344O11 from chromosom... 42 1.2
101gb|AC122548.10| Mus musculus chromosome 19, clone RP23-273O15, c... 42 1.2
102gb|AC120085.5| Rattus norvegicus 10 BAC CH230-490B8 (Children's ... 42 1.2
103gb|AC138401.9| Mus musculus chromosome 13, clone RP24-79G5, comp... 42 1.2
104gb|AC161276.2| Pan troglodytes BAC clone CH251-520C21 from chrom... 42 1.2
105gb|AC121785.3| Mus musculus BAC clone RP23-382K4 from chromosome... 42 1.2
106gb|AC110209.11| Mus musculus chromosome 12, clone RP23-279O18, c... 42 1.2
107gb|AC140451.3| Mus musculus BAC clone RP23-52L6 from chromosome ... 42 1.2
108gb|AC126453.5| Mus musculus BAC clone RP23-244A6 from chromosome... 42 1.2
109gb|AC134576.3| Mus musculus BAC clone RP24-68G10 from chromosome... 42 1.2
110gb|AC140249.2| Mus musculus BAC clone RP24-285O1 from chromosome... 42 1.2
111gb|AC144630.2| Mus musculus BAC clone RP23-284O15 from chromosom... 42 1.2
112gb|AC125268.10| Mus musculus chromosome 1, clone RP23-127L7, com... 42 1.2
113gb|AF252827.5| Homo sapiens chromosome 8 clone RP11-166E20 map q... 42 1.2
114gb|AF228660.5| Homo sapiens chromosome 8 clone RP11-37N22 map q2... 42 1.2
115gb|AC147883.2| Xenopus tropicalis clone CH216-117C13, complete s... 42 1.2
116gb|AC113540.12| Mus musculus chromosome 17, clone RP23-158F13, c... 42 1.2
117gb|AC167241.2| Mus musculus BAC clone RP24-560M14 from chromosom... 42 1.2
118gb|AC163687.5| Mus musculus BAC clone RP23-3H13 from chromosome ... 42 1.2
119gb|AC116387.7| Mus musculus chromosome 18, clone RP23-37P9, comp... 42 1.2
120gb|AC121286.7| Mus musculus chromosome 12, clone RP23-36H21, com... 42 1.2
121gb|AC113304.15| Mus musculus chromosome 9, clone RP23-431B6, com... 42 1.2
122gb|AC144808.2| Mus musculus BAC clone RP24-434O1 from chromosome... 42 1.2
123emb|CT010488.9| Mouse DNA sequence from clone RP23-133A3 on chro... 42 1.2
124emb|CR450841.7| Zebrafish DNA sequence from clone DKEY-16N9 in l... 42 1.2
125gb|AC124364.4| Mus musculus BAC clone RP24-538E16 from chromosom... 42 1.2
126gb|AC122930.4| Mus musculus BAC clone RP23-13L19 from chromosome... 42 1.2
127gb|AC125044.3| Mus musculus BAC clone RP23-348B10 from chromosom... 42 1.2
128gb|AC003108.1|HUAC003108 Human Chromosome 16 BAC clone CIT987SK-... 42 1.2
129emb|AJ843655.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.2
130emb|AJ843654.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.2
131emb|AJ843643.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.2
132emb|AJ843642.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.2
133emb|AJ843637.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.2
134emb|AJ843636.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.2
135emb|AJ843633.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.2
136emb|AJ843632.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.2
137emb|AJ843631.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.2
138emb|AJ843628.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.2
139gb|AC122374.4| Mus musculus BAC clone RP23-468F24 from chromosom... 42 1.2
140gb|AC117242.3| Mus musculus BAC clone RP24-151P1 from chromosome... 42 1.2
141gb|AC123921.3| Mus musculus BAC clone RP24-180J14 from chromosom... 42 1.2
142gb|AC125410.4| Mus musculus BAC clone RP23-146N3 from 3, complet... 42 1.2
143gb|AC125408.3| Mus musculus BAC clone RP23-94M23 from 3, complet... 42 1.2
144gb|AC122802.2| Mus musculus BAC clone RP24-136N24 from 6, comple... 42 1.2
145gb|AC121903.2| Mus musculus BAC clone RP24-174G24 from 18, compl... 42 1.2
146gb|AC121936.2| Mus musculus BAC clone RP24-207J5 from 13, comple... 42 1.2
147gb|AC122053.3| Mus musculus BAC clone RP24-463C3 from 3, complet... 42 1.2
148gb|AC116383.11| Mus musculus chromosome 5, clone RP23-15P21, com... 42 1.2
149gb|AC098885.3| Mus musculus BAC clone RP23-122L17 from 5, comple... 42 1.2
150gb|AC004947.2| Homo sapiens PAC clone RP5-1007F24 from 7, comple... 42 1.2
151gb|AC006988.3| Homo sapiens BAC clone RP11-174I14 from 7, comple... 42 1.2
152gb|AC108409.8| Mus musculus chromosome 19, clone RP23-84G7, comp... 42 1.2
153gb|AC117810.8| Mus musculus chromosome 18, clone RP24-571D2, com... 42 1.2
154gb|AC113292.6| Mus musculus chromosome 15, clone RP23-418M3, com... 42 1.2
155gb|AC146142.1| Pan troglodytes BAC clone RP43-23M11 from 7, comp... 42 1.2
156emb|BX005211.21| Zebrafish DNA sequence from clone CH211-128A7 i... 42 1.2
157ref|NG_000007.3| Homo sapiens beta globin region (HBB@) on chrom... 42 1.2
158gb|AC096035.6| Rattus norvegicus 4 BAC CH230-16M16 (Children's H... 42 1.2
159gb|AY349012.1| Homo sapiens hemoglobin beta pseudogene, intron 2... 42 1.2
160gb|AF339400.1| Homo sapiens haplotype PB26 beta-globin pseudogen... 42 1.2
161gb|AF339399.1| Homo sapiens haplotype PB25 beta-globin pseudogen... 42 1.2
162gb|AF339398.1| Homo sapiens haplotype PB24 beta-globin pseudogen... 42 1.2
163gb|AF339397.1| Homo sapiens haplotype PB23 beta-globin pseudogen... 42 1.2
164gb|AF339396.1| Homo sapiens haplotype PB22 beta-globin pseudogen... 42 1.2
165gb|AF339395.1| Homo sapiens haplotype PB21 beta-globin pseudogen... 42 1.2
166gb|AF339394.1| Homo sapiens haplotype PB20 beta-globin pseudogen... 42 1.2
167gb|AF339393.1| Homo sapiens haplotype PB19 beta-globin pseudogen... 42 1.2
168gb|AF339392.1| Homo sapiens haplotype PB18 beta-globin pseudogen... 42 1.2
169gb|AF339391.1| Homo sapiens haplotype PB17 beta-globin pseudogen... 42 1.2
170gb|AF339390.1| Homo sapiens haplotype PB16 beta-globin pseudogen... 42 1.2
171gb|AF339389.1| Homo sapiens haplotype PB15 beta-globin pseudogen... 42 1.2
172gb|AF339388.1| Homo sapiens haplotype PB14 beta-globin pseudogen... 42 1.2
173gb|AF339387.1| Homo sapiens haplotype PB13 beta-globin pseudogen... 42 1.2
174gb|AF339386.1| Homo sapiens haplotype PB12 beta-globin pseudogen... 42 1.2
175gb|AF339385.1| Homo sapiens haplotype PB11 beta-globin pseudogen... 42 1.2
176gb|AF339384.1| Homo sapiens haplotype PB10 beta-globin pseudogen... 42 1.2
177gb|AF339383.1| Homo sapiens haplotype PB9 beta-globin pseudogene... 42 1.2
178gb|AF339382.1| Homo sapiens haplotype PB8 beta-globin pseudogene... 42 1.2
179gb|AF339381.1| Homo sapiens haplotype PB7 beta-globin pseudogene... 42 1.2
180gb|AF339380.1| Homo sapiens haplotype PB6 beta-globin pseudogene... 42 1.2
181gb|AF339379.1| Homo sapiens haplotype PB5 beta-globin pseudogene... 42 1.2
182gb|AF339378.1| Homo sapiens haplotype PB4b beta-globin pseudogen... 42 1.2
183gb|AF339377.1| Homo sapiens haplotype PB4 beta-globin pseudogene... 42 1.2
184gb|AF339376.1| Homo sapiens haplotype PB3b beta-globin pseudogen... 42 1.2
185gb|AF339375.1| Homo sapiens haplotype PB3 beta-globin pseudogene... 42 1.2
186gb|AF339374.1| Homo sapiens haplotype PB2 beta-globin pseudogene... 42 1.2
187gb|AF339373.1| Homo sapiens haplotype PB1 beta-globin pseudogene... 42 1.2
188emb|AL117336.22|HSA324I22 Human DNA sequence from clone RP11-324... 42 1.2
189gb|AC104482.2| Sus scrofa clone RP44-423C21, complete sequence 42 1.2
190gb|AC162287.4| Mus musculus chromosome 7, clone RP24-243J4, comp... 42 1.2
191ref|NM_001017329.2| Xenopus tropicalis craniofacial development ... 42 1.2
192gb|AC153837.4| Mus musculus 6 BAC RP23-192D5 (Roswell Park Cance... 42 1.2
193emb|AL591064.11| Mouse DNA sequence from clone RP23-395E18 on ch... 42 1.2
194emb|AL606831.17| Mouse DNA sequence from clone RP23-432M23 on ch... 42 1.2
195emb|CR450817.6| Zebrafish DNA sequence from clone DKEYP-74B4 in ... 42 1.2
196emb|BX571855.11| Zebrafish DNA sequence from clone DKEY-260N18 i... 42 1.2
197emb|AL935054.11| Mouse DNA sequence from clone RP23-280A12 on ch... 42 1.2
198emb|AL671560.7| Mouse DNA sequence from clone RP23-149A5 on chro... 42 1.2
199gb|BC081491.1| Danio rerio zgc:103591, mRNA (cDNA clone MGC:1035... 42 1.2
200emb|BX569794.8| Zebrafish DNA sequence from clone DKEYP-15B2 in ... 42 1.2
201emb|AL671005.7| Mouse DNA sequence from clone RP23-76J17 on chro... 42 1.2
202emb|AL845294.3| Mouse DNA sequence from clone RP23-285N19 on chr... 42 1.2
203gb|AC163106.4| Mus musculus BAC clone RP23-278O13 from chromosom... 42 1.2
204gb|AC154634.2| Mus musculus BAC clone RP23-298D14 from chromosom... 42 1.2
205emb|BX927179.9| Zebrafish DNA sequence from clone CH211-194N20 i... 42 1.2
206emb|BX537120.8| Zebrafish DNA sequence from clone DKEY-13P21 in ... 42 1.2
207gb|AC008556.5| Homo sapiens chromosome 19 clone CTC-526N19, comp... 42 1.2
208gb|AC105351.2| Drosophila melanogaster X BAC RP98-34B12 (Roswell... 42 1.2
209gb|AC078874.13| Homo sapiens 12 BAC RP11-781C15 (Roswell Park Ca... 42 1.2
210gb|AC090921.7| Homo sapiens chromosome 8, clone RP11-37N22, comp... 42 1.2
211gb|AC100871.2| Homo sapiens chromosome 8, clone RP11-959I15, com... 42 1.2
212gb|AC091906.3| Homo sapiens chromosome 5 clone RP11-193P20, comp... 42 1.2
213gb|AC159652.6| Mus musculus 10 BAC RP24-123H21 (Roswell Park Can... 42 1.2
214emb|BX323835.9| Zebrafish DNA sequence from clone DKEYP-22F6 in ... 42 1.2
215gb|AC158130.7| Mus musculus chromosome 19, clone RP24-360F11, co... 42 1.2
216gb|AC156801.2| Mus musculus BAC clone RP23-142F22 from chromosom... 42 1.2
217gb|AC156567.3| Mus musculus BAC clone RP23-333F2 from chromosome... 42 1.2
218gb|AC024259.17| Homo sapiens chromosome 7 clone RP11-105B19, com... 42 1.2
219gb|AC159711.8| Mus musculus 10 BAC RP23-214N15 (Roswell Park Can... 42 1.2
220emb|BX511157.10| Zebrafish DNA sequence from clone DKEY-197M14 i... 42 1.2
221gb|AC114625.11| Mus musculus chromosome 3, clone RP24-107N14, co... 42 1.2
222dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.2
223dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.2
224dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.2
225gb|AC016257.22|AC016257 Homo sapiens 12 BAC RP11-61E11 (Roswell ... 42 1.2
226ref|NM_001004681.1| Danio rerio zgc:103591 (zgc:103591), mRNA 42 1.2
227gb|AF339362.1|AF339362 Pan troglodytes beta-globin (HBP) pseudog... 42 1.2
228gb|AC155840.8| Mus musculus 6 BAC RP24-223C8 (Roswell Park Cance... 42 1.2
229gb|AC102703.16| Mus musculus chromosome 1, clone RP24-442E5, com... 42 1.2
230gb|AC154182.2| Mus musculus BAC clone RP23-471C19 from chromosom... 42 1.2
231gb|AC154717.2| Mus musculus BAC clone RP24-369E16 from chromosom... 42 1.2
232gb|AC157090.6| Mus musculus 10 BAC RP24-360A19 (Roswell Park Can... 42 1.2
233gb|AC012621.8| Homo sapiens chromosome 16 clone CTD-2055J8, comp... 42 1.2
234gb|AC104389.8| Homo sapiens chromosome 11, clone CTD-2643I7, com... 42 1.2
235gb|AC087781.17| Mus musculus strain C57BL/6J chromosome 1 clone ... 42 1.2
236gb|AC129505.8| Homo sapiens chromosome 11, clone RP11-1205H24, c... 42 1.2
237gb|AC079949.45| Homo sapiens 12 BAC RP11-575F12 (Roswell Park Ca... 42 1.2
238gb|AC133941.4| Mus musculus BAC clone RP23-466I9 from chromosome... 42 1.2
239gb|AC122369.5| Mus musculus BAC clone RP23-454D13 from chromosom... 42 1.2
240gb|AC107815.11| Mus musculus chromosome 7, clone RP23-114A6, com... 42 1.2
241dbj|AP005420.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.2
242emb|BX571681.7| Zebrafish DNA sequence from clone DKEY-73N10 in ... 42 1.2
243emb|AL773581.25| Mouse DNA sequence from clone RP23-338H21 on ch... 42 1.2
244emb|BX571883.3| Zebrafish DNA sequence from clone DKEY-151P17 in... 42 1.2
245dbj|AP005871.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.2
246dbj|AP005405.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.2
247dbj|AB086065.1| Irpex lacteus nucleomorph mRNA for ribonuclease ... 42 1.2
248emb|X60158.1|HVPSAG H.vulgare PsaG mRNA 42 1.2
249gb|AC004615.1|AC004615 Homo sapiens BAC clone GS1-405L21 from 5p... 42 1.2
250gb|AC154440.2| Mus musculus BAC clone RP24-175D9 from 9, complet... 42 1.2
251gb|AC154288.2| Mus musculus BAC clone RP23-447G10 from 17, compl... 42 1.2
252emb|CR388135.16| Zebrafish DNA sequence from clone CH211-152C12 ... 42 1.2
253emb|CR356238.10| Zebrafish DNA sequence from clone CH211-193K19 ... 42 1.2
254gb|AC153931.2| Mus musculus 10 BAC RP24-147A18 (Roswell Park Can... 42 1.2
255emb|CR847970.10| Zebrafish DNA sequence from clone DKEY-220D24 i... 42 1.2
256gb|AC155287.6| Mus musculus 6 BAC RP23-103G18 (Roswell Park Canc... 42 1.2
257gb|AE003613.4| Drosophila melanogaster chromosome 2L, section 22... 42 1.2
258emb|CR848564.2| Xenopus tropicalis finished cDNA, clone TEgg044o05 42 1.2
259gb|AE003426.3| Drosophila melanogaster chromosome X, section 10 ... 42 1.2
260gb|U01317.1|HUMHBB Human beta globin region on chromosome 11 42 1.2
261gb|AC101658.8| Mus musculus chromosome 7, clone RP23-470G18, com... 42 1.2
262gb|AC119978.7| Mus musculus chromosome 9, clone RP24-487D12, com... 42 1.2
263gb|AC174722.2| Mus musculus chromosome 5, clone wi1-1220K19, com... 42 1.2
264gb|AC157656.3| Mus musculus BAC clone RP23-406A5 from chromosome... 42 1.2
265emb|CT033751.4| Mouse DNA sequence from clone RP24-236O3 on chro... 42 1.2
266gb|AC100541.17| Mus musculus chromosome 8, clone RP23-152F18, co... 42 1.2
267gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 42 1.2
268gb|AC005285.1|AC005285 Drosophila melanogaster DNA sequence (P1s... 42 1.2
269emb|BX004805.6| Zebrafish DNA sequence from clone DKEY-196N8 in ... 42 1.2
270emb|CT010497.9| Mouse DNA sequence from clone RP23-239L12 on chr... 42 1.2
271gb|AC138307.2| Mus musculus BAC clone RP24-159M5 from 12, comple... 42 1.2
272emb|CT009575.8| Mouse DNA sequence from clone RP23-107N17 on chr... 42 1.2
273emb|CR848742.8| Zebrafish DNA sequence from clone DKEY-181C1 in ... 42 1.2
274emb|CT030173.7| Mouse DNA sequence from clone RP24-264B23 on chr... 42 1.2
275gb|AC158116.2| Gallus gallus BAC clone CH261-122G21 from chromos... 42 1.2
276gb|AC135641.7| Mus musculus BAC clone RP23-376H20 from 12, compl... 42 1.2
277emb|CR847564.6| Zebrafish DNA sequence from clone DKEY-190E10 in... 42 1.2
278emb|CT010457.7| Mouse DNA sequence from clone RP23-96M8 on chrom... 42 1.2
279dbj|AP006698.1| Lotus japonicus genomic DNA, chromosome 1, clone... 42 1.2
280gb|AC148768.16| Mus musculus chromosome 8, clone RP23-439G21, co... 42 1.2
281gb|AC170884.3| Mus musculus BAC clone RP24-111L17 from chromosom... 42 1.2
282gb|AC171729.1| Lycopersicon esculentum chromosome 01 clone C01HB... 42 1.2
283gb|M93716.1|CHPPHYGEN Pan paniscus DNA fragment 42 1.2
284emb|AL672089.17| Mouse DNA sequence from clone RP23-295D9 on chr... 42 1.2
285emb|AL670285.10| Mouse DNA sequence from clone RP23-308N2 on chr... 42 1.2
286emb|AL669891.12| Mouse DNA sequence from clone RP23-271F3 on chr... 42 1.2
287emb|AL607109.21| Mouse DNA sequence from clone RP23-352D7 on chr... 42 1.2
288emb|X02135.1|PTBGLOP Chimpanzee beta-type globin pseudogene 42 1.2
289emb|X02134.1|GGBGLOP Gorilla beta-type globin pseudogene 42 1.2
290emb|X79724.1|PPETAPS P.paniscus eta-globin pseudogene 42 1.2
291emb|AL121805.1|DMBN4L24 Drosophila melanogaster clone BACN4L24 42 1.2
292emb|X02133.1|HSBGLOP Human beta-type globin pseudogene 42 1.2
293gb|K02543.1|GORHBBPG Gorilla beta-globin and eta-globin pseudoge... 42 1.2
294gb|K02542.1|CHPHBBPCH Chimpanzee beta-globin and eta-globin pseu... 42 1.2
295gb|AC160122.2| Mus musculus BAC clone RP23-390G1 from chromosome... 42 1.2
296emb|AL627235.12| Mouse DNA sequence from clone RP23-324C12 on ch... 42 1.2
297gb|AC116501.7| Mus musculus chromosome 5, clone RP24-300D7, comp... 40 4.7
298gb|AC102288.11| Mus musculus chromosome 18, clone RP24-346H24, c... 40 4.7
299gb|AC102588.7| Mus musculus chromosome 18, clone RP23-334D14, co... 40 4.7
300gb|AC131036.4| Mus musculus chromosome 5, clone RP23-358D12, com... 40 4.7
301gb|AC153609.2| Mus musculus 6 BAC RP23-77I23 (Roswell Park Cance... 40 4.7
302gb|AC102775.6| Mus musculus chromosome 8, clone RP23-115C10, com... 40 4.7
303gb|AC114666.31| Mus musculus chromosome 5, clone RP24-175N6, com... 40 4.7
304gb|AY958086.1| Zygnema circumcarinatum chloroplast, complete genome 40 4.7
305gb|DQ235090.1| Cricetulus griseus external transcribed spacer, 1... 40 4.7
306gb|AC129582.10| Mus musculus chromosome 5, clone RP24-485O24, co... 40 4.7
307gb|AC110035.8| Mus musculus chromosome 1, clone RP23-237M24, com... 40 4.7
308gb|AC153490.1| Mus musculus BAC RP23-210M12 (Roswell Park Cance... 40 4.7
309gb|AC102655.7| Mus musculus chromosome 19, clone RP23-13N2, comp... 40 4.7
310gb|AC170584.4| Mus musculus chromosome 1, clone RP24-360E22, com... 40 4.7
311gb|AC122562.8| Mus musculus chromosome 5, clone RP24-103L16, com... 40 4.7
312gb|AC152949.1| Mus musculus 10 BAC RP23-184H3 (Roswell Park Canc... 40 4.7
313gb|AC113991.4| Mus musculus chromosome 3, clone RP24-138E17, com... 40 4.7
314gb|AC161382.4| Mus musculus BAC clone RP23-25A17 from chromosome... 40 4.7
315gb|AC167243.3| Mus musculus BAC clone RP24-144E2 from chromosome... 40 4.7
316gb|AC115830.6| Mus musculus chromosome 7, clone RP24-96A19, comp... 40 4.7
317gb|AC158537.2| Mus musculus BAC clone RP23-2H7 from chromosome 1... 40 4.7
318gb|AC163666.2| Mus musculus BAC clone RP23-46B12 from chromosome... 40 4.7
319gb|AC167164.6| Mus musculus chromosome 7, clone RP24-276M8, comp... 40 4.7
320gb|AC113302.13| Mus musculus chromosome 5, clone RP23-431M7, com... 40 4.7
321gb|AC153973.33| Mus musculus 10 BAC RP24-158P6 (Roswell Park Can... 40 4.7
322gb|AC115026.16| Mus musculus chromosome 1, clone RP24-238A19, co... 40 4.7
323gb|AC118193.9| Mus musculus chromosome 8, clone RP23-241A10, com... 40 4.7
324gb|AC114629.12| Mus musculus chromosome 1, clone RP24-111F20, co... 40 4.7
325gb|AY588562.1| Triatoma infestans clone TiH09 microsatellite seq... 40 4.7
326gb|AY588551.1| Triatoma infestans clone TiG08 microsatellite seq... 40 4.7
327gb|AY588493.1| Triatoma infestans clone TiA11 microsatellite seq... 40 4.7
328gb|AC114537.6| Mus musculus chromosome 15, clone RP23-51A16, com... 40 4.7
329gb|AC160118.2| Mus musculus BAC clone RP23-440L7 from chromosome... 40 4.7
330gb|AC129022.5| Mus musculus BAC clone RP23-318P2 from chromosome... 40 4.7
331gb|AC165246.2| Mus musculus BAC clone RP24-220A15 from chromosom... 40 4.7
332gb|AC163097.11| Mus musculus chromosome 8, clone RP23-135D17, co... 40 4.7
333gb|AC165151.2| Mus musculus BAC clone RP24-77O15 from chromosome... 40 4.7
334gb|AC161218.10| Mus musculus chromosome 7, clone RP24-161J8, com... 40 4.7
335gb|AC137848.31| Mus musculus chromosome 9, clone RP24-118I23, co... 40 4.7
336gb|AC122159.30| Mus musculus strain 129/Sv clone ct7-575j15 map ... 40 4.7
337gb|AC163447.5| Mus musculus chromosome 7, clone RP24-314E16, com... 40 4.7
338gb|AC153526.13| Mus musculus 10 BAC RP23-383C2 (Roswell Park Can... 40 4.7
339gb|AC163337.2| Mus musculus chromosome 5, clone RP23-297I15, com... 40 4.7
340gb|AC022775.16| Mus musculus chromosome 15, clone RP23-71O17, co... 40 4.7
341gb|AY753011.1| Penaeus monodon clone t1603 microsatellite sequence 40 4.7
342gb|AC168277.2| Mus musculus BAC RP24-186L17 (Roswell Park Cance... 40 4.7
343gb|AY222411.1| Exoneura nigrescens N127 microsatellite sequence 40 4.7
344gb|AY149282.1| Mus musculus sodium-dependent orphan neurotransmi... 40 4.7
345gb|AY023993.1| Oryza sativa microsatellite MRG6318 containing (C... 40 4.7
346gb|AC111097.10| Mus musculus chromosome 3, clone RP23-174G7, com... 40 4.7
347gb|AC130597.2| Oryza sativa (japonica cultivar-group) chromosome... 40 4.7
348gb|AC162291.13| Mus musculus chromosome 18, clone RP23-264B14, c... 40 4.7
349gb|AC115932.11| Mus musculus chromosome 1, clone RP24-538F21, co... 40 4.7
350gb|AC147480.13| Mus musculus chromosome 14, clone RP23-429N24, c... 40 4.7
351gb|AC102757.6| Mus musculus chromosome 5, clone RP24-196M24, com... 40 4.7
352gb|AC091274.11| Mus musculus chromosome 5, clone RP23-149A1, com... 40 4.7
353gb|AC168064.3| Mus musculus BAC clone RP23-182K16 from chromosom... 40 4.7
354gb|AC134415.8| Mus musculus chromosome 3, clone RP24-224P21, com... 40 4.7
355gb|AC124985.16| Mus musculus chromosome 8, clone RP24-230O22, co... 40 4.7
356gb|AC153152.4| Mus musculus BAC clone RP23-78F1 from chromosome ... 40 4.7
357gb|AC154528.2| Mus musculus BAC clone RP23-460I18 from chromosom... 40 4.7
358gb|AC154227.2| Mus musculus BAC clone RP24-142A23 from chromosom... 40 4.7
359gb|AC150658.7| Mus musculus BAC clone RP24-474E20 from chromosom... 40 4.7
360gb|AC104856.19| Mus musculus chromosome 5, clone RP23-53G23, com... 40 4.7
361gb|AC160456.8| Mus musculus chromosome 8, clone RP23-121F17, com... 40 4.7
362gb|AC167221.9| Mus musculus 10 BAC RP23-3P24 (Roswell Park Cance... 40 4.7
363gb|AC166082.11| Mus musculus 10 BAC RP23-150M2 (Roswell Park Can... 40 4.7
364gb|AC123708.17| Mus musculus chromosome 9, clone RP23-366E1, com... 40 4.7
365gb|AC113983.13| Mus musculus chromosome 5, clone RP24-95M11, com... 40 4.7
366gb|AC102483.8| Mus musculus chromosome 1, clone RP24-450F12, com... 40 4.7
367gb|AC102101.7| Mus musculus chromosome 15, clone RP23-74N15, com... 40 4.7
368gb|AC098570.7| Mus musculus chromosome 1, clone RP23-278N11, com... 40 4.7
369gb|AC092238.2| Drosophila melanogaster clone BACR03D18, complete... 40 4.7
370gb|AC092241.2| Drosophila melanogaster clone BACR09F02, complete... 40 4.7
371gb|AC069469.5| Mus musculus strain C57BL6/J chromosome 6 clone R... 40 4.7
372gb|AC108422.10| Mus musculus chromosome 1, clone RP23-438D3, com... 40 4.7
373gb|AC100726.7| Mus musculus chromosome 19, clone RP24-245B11, co... 40 4.7
374gb|AC117784.13| Mus musculus chromosome 15, clone RP24-545F24, c... 40 4.7
375gb|AC114434.4| Rattus norvegicus 1 BAC CH230-210C18 (Children's ... 40 4.7
376gb|AC120148.13| Mus musculus chromosome 9, clone RP24-225E14, co... 40 4.7
377gb|AC131577.16| Mus musculus chromosome 1, clone RP23-23I4, comp... 40 4.7
378gb|AC068605.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 40 4.7
379gb|AC138676.9| Mus musculus chromosome 3, clone RP23-381I16, com... 40 4.7
380gb|AC166334.8| Mus musculus chromosome 7, clone RP23-470P9, comp... 40 4.7
381gb|AC182692.2| Populus trichocarpa clone Pop1-44B2, complete seq... 40 4.7
382gb|AC113548.22| Mus musculus chromosome 9, clone RP23-268F15, co... 40 4.7
383gb|AC116811.15| Mus musculus chromosome 6, clone RP24-356D15, co... 40 4.7
384gb|AC109140.6| Mus musculus chromosome 5, clone RP23-153N23, com... 40 4.7
385gb|AC108806.10| Mus musculus chromosome 14, clone RP23-246G7, co... 40 4.7
386gb|AC110897.11| Mus musculus chromosome 15, clone RP24-108J19, c... 40 4.7
387gb|AC114674.10| Mus musculus chromosome 9, clone RP24-209N21, co... 40 4.7
388gb|AC139060.5| Mus musculus chromosome 16, clone RP23-58G17, com... 40 4.7
389gb|AC127361.4| Mus musculus BAC clone RP23-125M8 from chromosome... 40 4.7
390gb|AC134336.2| Mus musculus BAC clone RP23-134A10 from chromosom... 40 4.7
391gb|AC141477.4| Mus musculus BAC clone RP23-386J14 from chromosom... 40 4.7
392gb|AC132119.2| Mus musculus BAC clone RP23-467E2 from chromosome... 40 4.7
393gb|AC110381.5| Mus musculus BAC clone RP24-198I16 from chromosom... 40 4.7
394gb|AC137961.5| Mus musculus chromosome 14, clone RP24-550E9, com... 40 4.7
395gb|AC123741.9| Mus musculus chromosome 1, clone RP24-113A5, comp... 40 4.7
396gb|AC108412.8| Mus musculus chromosome 1, clone RP24-266K12, com... 40 4.7
397gb|AC110496.12| Mus musculus chromosome 7, clone RP23-56P3, comp... 40 4.7
398gb|AF131866.2| Mus musculus chromosome X clone CT7-271B7 map qA7... 40 4.7
399gb|AC115236.4| Rattus norvegicus 15 BAC CH230-87I6 (Children's H... 40 4.7
400gb|AC132919.9| Mus musculus chromosome 12, clone RP24-356H3, com... 40 4.7
401gb|AC146485.2| Xenopus tropicalis clone CH216-8M11, complete seq... 40 4.7
402gb|AC158556.9| Mus musculus chromosome 15, clone RP23-140F20, co... 40 4.7
403gb|AC134530.3| Mus musculus BAC clone RP24-507K16 from chromosom... 40 4.7
404gb|AC147629.3| Mus musculus BAC clone RP24-495E2 from chromosome... 40 4.7
405gb|AC121873.3| Mus musculus BAC clone RP24-123L3 from chromosome... 40 4.7
406gb|AC122006.3| Mus musculus BAC clone RP24-344B12 from chromosom... 40 4.7
407gb|AC068501.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 40 4.7
408gb|AC141483.4| Mus musculus BAC clone RP23-58E17 from chromosome... 40 4.7
409gb|AC130222.4| Mus musculus BAC clone RP23-18K19 from chromosome... 40 4.7
410gb|AC125395.3| Mus musculus BAC clone RP23-213J1 from chromosome... 40 4.7
411gb|AC123075.5| Mus musculus BAC clone RP23-181C16 from chromosom... 40 4.7
412gb|AC127417.3| Mus musculus BAC clone RP23-459M2 from chromosome... 40 4.7
413gb|AC129023.4| Mus musculus BAC clone RP23-430E12 from chromosom... 40 4.7
414gb|AC125322.4| Mus musculus BAC clone RP23-407J24 from chromosom... 40 4.7
415gb|AC140921.2| Mus musculus BAC clone RP24-472I23 from chromosom... 40 4.7
416gb|AC147613.2| Mus musculus BAC clone RP23-381J20 from chromosom... 40 4.7
417gb|AC145557.3| Mus musculus BAC clone RP23-313I19 from chromosom... 40 4.7
418gb|AC125186.6| Mus musculus BAC clone RP23-302C16 from chromosom... 40 4.7
419gb|AC087860.2| Bos taurus clone RP42-135P2, complete sequence 40 4.7
420gb|AC154442.3| Mus musculus BAC clone RP24-178L2 from chromosome... 40 4.7
421gb|AC162458.4| Mus musculus chromosome 19, clone RP24-140G9, com... 40 4.7
422gb|AC125016.20| Mus musculus chromosome 7, clone RP24-157A17, co... 40 4.7
423gb|AC102388.7| Mus musculus chromosome 3, clone RP24-298F19, com... 40 4.7
424gb|AY317465.2| Mus musculus olfactory receptor Olfr369-ps1 pseud... 40 4.7
425gb|AC022699.11| Mus musculus chromosome 10, clone RP23-107I8, co... 40 4.7
426gb|AC168220.1| Mus musculus BAC clone RP23-77O10 from chromosome... 40 4.7
427gb|AC138667.8| Mus musculus chromosome 14, clone RP24-122H16, co... 40 4.7
428gb|AC114593.12| Mus musculus chromosome 14, clone RP23-44B17, co... 40 4.7
429gb|AC124676.7| Mus musculus chromosome 6, clone RP24-93M1, compl... 40 4.7
430gb|AC153518.14| Mus musculus 10 BAC RP23-426B18 (Roswell Park Ca... 40 4.7
431gb|AC110883.12| Mus musculus chromosome 8, clone RP23-200N24, co... 40 4.7
432gb|AC164300.3| Mus musculus BAC clone RP23-310J6 from chromosome... 40 4.7
433gb|AC158652.5| Mus musculus 6 BAC RP23-238I17 (Roswell Park Canc... 40 4.7
434gb|AC109139.15| Mus musculus chromosome 8, clone RP23-47L13, com... 40 4.7
435gb|AC163275.4| Mus musculus chromosome 5, clone RP23-458G12, com... 40 4.7
436gb|AC116107.10| Mus musculus chromosome 1, clone RP23-28F18, com... 40 4.7
437gb|AC165092.3| Mus musculus BAC clone RP23-10M2 from chromosome ... 40 4.7
438gb|DP000008.1| Bos taurus target 1 genomic scaffold 40 4.7
439gb|AC161170.7| Mus musculus chromosome 1, clone RP23-307G23, com... 40 4.7
440gb|AC109271.10| Mus musculus chromosome 1, clone RP23-353I19, co... 40 4.7
441gb|AC118639.12| Mus musculus chromosome 15, clone RP24-112I4, co... 40 4.7
442gb|AC162789.4| Mus musculus chromosome 1, clone RP24-323I23, com... 40 4.7
443gb|AC161056.5| Mus musculus BAC clone RP23-241J7 from chromosome... 40 4.7
444gb|AC158521.2| Mus musculus BAC clone RP23-404M10 from chromosom... 40 4.7
445gb|AC125064.6| Mus musculus BAC clone RP23-430F7 from chromosome... 40 4.7
446gb|AC163395.6| Mus musculus chromosome 7, clone RP24-251J14, com... 40 4.7
447gb|AC118232.10| Mus musculus chromosome 9, clone RP23-462C3, com... 40 4.7
448gb|AC136022.3| Mus musculus BAC clone RP24-497H18 from chromosom... 40 4.7
449gb|AC115046.7| Mus musculus chromosome 5, clone RP24-321O4, comp... 40 4.7
450gb|AC172242.3| Gallus gallus BAC clone CH261-162M6 from chromoso... 40 4.7
451gb|AC137108.12| Mus musculus chromosome 9, clone RP23-277J20, co... 40 4.7
452gb|AC147051.2| Mus musculus BAC clone RP23-90H22 from chromosome... 40 4.7
453gb|AC122523.5| Mus musculus BAC clone RP24-492N18 from chromosom... 40 4.7
454gb|AC139240.4| Mus musculus BAC clone RP24-128J14 from chromosom... 40 4.7
455gb|AC125141.4| Mus musculus BAC clone RP24-333C3 from chromosome... 40 4.7
456gb|AC025353.9| Mus musculus chromosome 9, clone RP23-93E19, comp... 40 4.7
457gb|AC124669.8| Mus musculus chromosome 1, clone RP23-110B5, comp... 40 4.7
458gb|AC121097.6| Mus musculus chromosome 13, clone RP24-449F13, co... 40 4.7
459gb|AC117656.13| Mus musculus chromosome 14, clone RP23-298L3, co... 40 4.7
460gb|AC121497.15| Mus musculus chromosome 6, clone RP23-2M23, comp... 40 4.7
461ref|XM_988683.1| PREDICTED: Mus musculus RIKEN cDNA 3200001K10 g... 40 4.7
462ref|XM_979804.1| PREDICTED: Mus musculus six transmembrane epith... 40 4.7
463ref|XM_979777.1| PREDICTED: Mus musculus six transmembrane epith... 40 4.7
464ref|XM_979751.1| PREDICTED: Mus musculus six transmembrane epith... 40 4.7
465ref|XM_979723.1| PREDICTED: Mus musculus six transmembrane epith... 40 4.7
466ref|XM_895655.2| PREDICTED: Mus musculus RIKEN cDNA 3200001K10 g... 40 4.7
467ref|XM_920610.2| PREDICTED: Mus musculus RIKEN cDNA 3200001K10 g... 40 4.7
468ref|XM_892706.2| PREDICTED: Mus musculus six transmembrane epith... 40 4.7
469ref|XM_900284.2| PREDICTED: Mus musculus six transmembrane epith... 40 4.7
470ref|XM_284053.5| PREDICTED: Mus musculus six transmembrane epith... 40 4.7
471ref|XM_900299.2| PREDICTED: Mus musculus six transmembrane epith... 40 4.7
472ref|XM_905527.2| PREDICTED: Mus musculus six transmembrane epith... 40 4.7
473ref|XM_919426.2| PREDICTED: Mus musculus six transmembrane epith... 40 4.7
474ref|XM_919422.2| PREDICTED: Mus musculus six transmembrane epith... 40 4.7
475ref|XM_919444.2| PREDICTED: Mus musculus six transmembrane epith... 40 4.7
476gb|AC132608.2| Mus musculus BAC clone RP23-451E12 from chromosom... 40 4.7
477gb|AC132317.2| Mus musculus BAC clone RP24-241J19 from chromosom... 40 4.7
478gb|AC129013.3| Mus musculus BAC clone RP24-550P17 from chromosom... 40 4.7
479gb|AC140245.3| Mus musculus BAC clone RP23-293J3 from chromosome... 40 4.7
480gb|AC131667.4| Mus musculus BAC clone RP23-290D15 from chromosom... 40 4.7
481gb|AC140193.3| Mus musculus BAC clone RP23-247C12 from chromosom... 40 4.7
482emb|CT025525.8| Mouse DNA sequence from clone RP23-285C6 on chro... 40 4.7
483emb|CT025531.9| Mouse DNA sequence from clone RP23-280C13 on chr... 40 4.7
484emb|CT009710.8| Mouse DNA sequence from clone RP23-131M7 on chro... 40 4.7
485emb|CT025679.5| Mouse DNA sequence from clone RP24-296K22 on chr... 40 4.7
486emb|CR450806.9| Zebrafish DNA sequence from clone DKEY-110O13 in... 40 4.7
487emb|BX890591.12| Zebrafish DNA sequence from clone DKEY-184J23 i... 40 4.7
488emb|AJ534364.1|OTS534364 Oncorhynchus tshawytscha microsatellite... 40 4.7
489emb|AJ578568.1|EGU578568 Elaeis guineensis microsatellite DNA, c... 40 4.7
490emb|AJ566577.1|TCA566577 Theobroma cacao microsatellite, clone m... 40 4.7
491emb|AJ853849.1| Sus scrofa PRSS11 gene (partial), DMBT1 gene, AW... 40 4.7
492emb|AJ586834.1| Ephippiger ephippiger microsatellite DNA, clone ... 40 4.7
493emb|BX927165.18| Zebrafish DNA sequence from clone DKEYP-120H9 i... 40 4.7
494emb|CR352236.17| Zebrafish DNA sequence from clone DKEYP-123E12 ... 40 4.7
495emb|BX649356.19| Zebrafish DNA sequence from clone CH211-209H5 i... 40 4.7
496emb|CT010434.8| Mouse DNA sequence from clone RP23-225H9 on chro... 40 4.7
497gb|AY176046.1| Mus musculus thyroid hormone receptor associated ... 40 4.7
498gb|AC099948.9| Mus musculus chromosome 10, clone RP23-19D21, com... 40 4.7
499emb|CR352265.10| Zebrafish DNA sequence from clone DKEY-33C18 in... 40 4.7
500gb|AC132333.3| Mus musculus BAC clone RP24-226I7 from chromosome... 40 4.7

>emb|AM039900.1| Hordeum vulgare partial mRNA for chromomethylase 2 (cmt2 gene)
          Length = 1077

 Score =  662 bits (334), Expect = 0.0
 Identities = 343/345 (99%), Gaps = 1/345 (0%)
 Strand = Plus / Minus

                                                                        
Query: 11   acatacatacatacatactttttctagtacaacaaaggctacatacacacatgtactttt 70
            |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 1015 acatacatacatacatactttt-ctagtacaacaaaggctacatacacacatgtactttt 957

                                                                        
Query: 71   atagtacaacaaaggctctctcggagaggaactccactggagccacctacacctgcccat 130
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 956  atagtacaacaaaggctctctcggagaggaactccactggagccacctacacctgcccat 897

                                                                        
Query: 131  ctgagcttctaacaaatgtatgtgacaaagttatgatgcatacattcttttaccgtacaa 190
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 896  ctgagcttctaacaaatgtatgtgacaaagttatgatgcatacattcttttaccgtacaa 837

                                                                        
Query: 191  cacaaggttctctcaggagaaaccttactgagcaacttacacctgcctccggaaagttct 250
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 836  cacaaggttctctcaggagaaaccttactgagcaacttacacctgcctccggaaagttct 777

                                                                        
Query: 251  aagaaactaagatgttaccaggtacancatggcaataaaatgaatcaaaacttatgttaa 310
            |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 776  aagaaactaagatgttaccaggtacaacatggcaataaaatgaatcaaaacttatgttaa 717

                                                         
Query: 311  aatgggcatgccctaacgatattcatgagccctaatgatattcac 355
            |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 716  aatgggcatgccctaacgatattcatgagccctaatgatattcac 672



to top

>gb|BT009291.1| Triticum aestivum clone wlm0.pk0028.h3:fis, full insert mRNA
           sequence
          Length = 681

 Score =  385 bits (194), Expect = e-104
 Identities = 266/290 (91%), Gaps = 9/290 (3%)
 Strand = Plus / Minus

                                                                       
Query: 66  cttttatagtacaacaaaggctctctcggagaggaactccactggagccacctacacctg 125
           |||||||||||||||||||||        ||||||||| ||||| |||||||||||||||
Sbjct: 572 cttttatagtacaacaaaggc--------agaggaact-cactgcagccacctacacctg 522

                                                                       
Query: 126 cccatctgagcttctaacaaatgtatgtgacaaagttatgatgcatacattcttttaccg 185
           ||||| |||||||||||||||||| ||||||||||||||||| |||||||||||||||  
Sbjct: 521 cccatgtgagcttctaacaaatgtgtgtgacaaagttatgatacatacattcttttacaa 462

                                                                       
Query: 186 tacaacacaaggttctctcaggagaaaccttactgagcaacttacacctgcctccggaaa 245
           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 461 tacaacacaaggttctctcaggagaaaccttactgagcaacttacacctgcctacggaaa 402

                                                                       
Query: 246 gttctaagaaactaagatgttaccaggtacancatggcaataaaatgaatcaaaacttat 305
            |||||||||||||||||||||| ||||||| ||||||||||||||||||||| |||| |
Sbjct: 401 cttctaagaaactaagatgttacaaggtacaacatggcaataaaatgaatcaagacttgt 342

                                                             
Query: 306 gttaaaatgggcatgccctaacgatattcatgagccctaatgatattcac 355
           |||||||||||||||||||||||||||||| ||| ||||||| |||||||
Sbjct: 341 gttaaaatgggcatgccctaacgatattcacgagtcctaatggtattcac 292



to top

>gb|AC134545.5| Mus musculus BAC clone RP24-470H2 from chromosome 18, complete sequence
          Length = 155887

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 4     tcctatcacatacatacatacatac 28
             |||||||||||||||||||||||||
Sbjct: 33087 tcctatcacatacatacatacatac 33111



to top

>emb|X81088.1|HVB914 Hordeum vulgare B194 promoter sequence
          Length = 1254

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 8   atcacatacatacatacatactttt 32
           |||||||||||||||||||||||||
Sbjct: 522 atcacatacatacatacatactttt 498



to top

>gb|AC146000.4| Pan troglodytes BAC clone RP43-147L18 from 7, complete sequence
          Length = 176192

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 10     cacatacatacatacatacttttt 33
              ||||||||||||||||||||||||
Sbjct: 161083 cacatacatacatacatacttttt 161106



to top

>gb|AC123797.3| Mus musculus BAC clone RP24-326O4 from chromosome 9, complete sequence
          Length = 135119

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 10    cacatacatacatacatacttttt 33
             ||||||||||||||||||||||||
Sbjct: 81848 cacatacatacatacatacttttt 81871



to top

>gb|AC144428.1| Pan troglodytes BAC clone RP43-2C19 from 7, complete sequence
          Length = 208183

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 10     cacatacatacatacatacttttt 33
              ||||||||||||||||||||||||
Sbjct: 163338 cacatacatacatacatacttttt 163315



to top

>gb|AC113464.17| Mus musculus chromosome 8, clone RP23-183P1, complete sequence
          Length = 191444

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 11    acatacatacatacatactttttctagt 38
             |||||||||||||||||||||| |||||
Sbjct: 10563 acatacatacatacatacttttgctagt 10536



to top

>emb|AL589661.21| Mouse DNA sequence from clone RP23-58B7 on chromosome 15, complete
              sequence
          Length = 241432

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 5      cctatcacatacatacatacatac 28
              ||||||||||||||||||||||||
Sbjct: 164854 cctatcacatacatacatacatac 164877



to top

>gb|AC160972.4| Mus musculus BAC clone RP24-571D21 from chromosome 12, complete
             sequence
          Length = 184921

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 11    acatacatacatacatacttttt 33
             |||||||||||||||||||||||
Sbjct: 10425 acatacatacatacatacttttt 10447



to top

>gb|AC118017.15| Mus musculus chromosome 7, clone RP23-457C1, complete sequence
          Length = 196427

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 11     acatacatacatacatacttttt 33
              |||||||||||||||||||||||
Sbjct: 164814 acatacatacatacatacttttt 164792



to top

>gb|DQ481663.1| Takifugu rubripes HoxAa gene cluster, complete sequence
          Length = 385816

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 11     acatacatacatacatacttttt 33
              |||||||||||||||||||||||
Sbjct: 316514 acatacatacatacatacttttt 316492



to top

>gb|AC113495.15| Mus musculus chromosome 9, clone RP23-361O11, complete sequence
          Length = 195356

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 11     acatacatacatacatacttttt 33
              |||||||||||||||||||||||
Sbjct: 170049 acatacatacatacatacttttt 170027



to top

>gb|AC009127.10| Homo sapiens chromosome 16 clone RP11-498D10, complete sequence
          Length = 173128

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 11    acatacatacatacatacttttt 33
             |||||||||||||||||||||||
Sbjct: 33863 acatacatacatacatacttttt 33841



to top

>gb|AC131769.3| Mus musculus BAC clone RP24-290G2 from chromosome 3, complete sequence
          Length = 148675

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 11    acatacatacatacatacttttt 33
             |||||||||||||||||||||||
Sbjct: 97724 acatacatacatacatacttttt 97746



to top

>emb|AL365360.9| Human DNA sequence from clone RP11-546N22 on chromosome 9 Contains the
             5' end of a novel gene (FLJ23309), an adenylate kinase 3
             (AK3) pseudogene, the MLANA gene for melan-A (MART-1), a
             novel gene, the 3' end of the gene for novel protein
             similar to K06A9.1b.p (includes FLJ34054) (KIAA2026), the
             3' end of a novel gene and a CpG island, complete sequence
          Length = 157023

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 11    acatacatacatacatacttttt 33
             |||||||||||||||||||||||
Sbjct: 43076 acatacatacatacatacttttt 43054



to top

>gb|AC115986.3| Homo sapiens chromosome 18, clone RP11-112C14, complete sequence
          Length = 179590

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 11     acatacatacatacatacttttt 33
              |||||||||||||||||||||||
Sbjct: 145894 acatacatacatacatacttttt 145872



to top

>gb|AC022743.7| Homo sapiens chromosome 18, clone RP11-789C7, complete sequence
          Length = 182466

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 11     acatacatacatacatacttttt 33
              |||||||||||||||||||||||
Sbjct: 129328 acatacatacatacatacttttt 129350



to top

>gb|AC161113.2| Mus musculus BAC clone RP24-362N9 from chromosome 9, complete sequence
          Length = 171642

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 11     acatacatacatacatacttttt 33
              |||||||||||||||||||||||
Sbjct: 104690 acatacatacatacatacttttt 104668



to top

>dbj|AK165915.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-length enriched
            library, clone:G730018P09 product:reticulon 2 (Z-band
            associated protein), full insert sequence
          Length = 3632

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 11   acatacatacatacatacttttt 33
            |||||||||||||||||||||||
Sbjct: 3212 acatacatacatacatacttttt 3234



to top

>gb|AC084272.41| Mus musculus strain C57BL/6J clone rp23-11g21 map 3, complete sequence
          Length = 206230

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 11     acatacatacatacatacttttt 33
              |||||||||||||||||||||||
Sbjct: 112733 acatacatacatacatacttttt 112755



to top

>gb|AC148988.5| Mus musculus BAC clone RP23-85B15 from chromosome 7, complete sequence
          Length = 154177

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 11    acatacatacatacatacttttt 33
             |||||||||||||||||||||||
Sbjct: 81660 acatacatacatacatacttttt 81682



to top

>gb|AC009087.4|AC009087 Homo sapiens chromosome 16 clone RP11-384M15, complete sequence
          Length = 174933

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 11     acatacatacatacatacttttt 33
              |||||||||||||||||||||||
Sbjct: 138853 acatacatacatacatacttttt 138831



to top

>emb|X56010.1|SVHRGPG Sorghum vulgare hydroxyproline-rich glycoprotein gene
          Length = 4231

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 10   cacatacatacatacatactttttcta 36
            ||||||||||||||||||| |||||||
Sbjct: 3446 cacatacatacatacatacattttcta 3472



to top

>emb|BX571817.14| Zebrafish DNA sequence from clone DKEY-287H13 in linkage group 18,
            complete sequence
          Length = 167381

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 10   cacatacatacatacatactttt 32
            |||||||||||||||||||||||
Sbjct: 2065 cacatacatacatacatactttt 2087



to top

>gb|AC163357.5| Mus musculus BAC clone RP23-3K10 from chromosome 12, complete sequence
          Length = 236266

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 11     acatacatacatacatacttttt 33
              |||||||||||||||||||||||
Sbjct: 142925 acatacatacatacatacttttt 142947



to top

>emb|CR450796.7| Zebrafish DNA sequence from clone CH211-9N7 in linkage group 11, complete
              sequence
          Length = 172794

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 11     acatacatacatacatacttttt 33
              |||||||||||||||||||||||
Sbjct: 116762 acatacatacatacatacttttt 116740



to top

>emb|AL928926.9| Mouse DNA sequence from clone RP23-443G7 on chromosome 2, complete
              sequence
          Length = 211456

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 11     acatacatacatacatacttttt 33
              |||||||||||||||||||||||
Sbjct: 113444 acatacatacatacatacttttt 113422



to top

>gb|AC164883.5| Mus musculus BAC clone RP23-88A20 from chromosome 15, complete sequence
          Length = 260402

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 11     acatacatacatacatactttt 32
              ||||||||||||||||||||||
Sbjct: 220369 acatacatacatacatactttt 220390



to top

>gb|AY019546.1| Oryza sativa microsatellite MRG1871 containing (AT)X37, closest to
           marker C488, genomic sequence
          Length = 274

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 11  acatacatacatacatactttt 32
           ||||||||||||||||||||||
Sbjct: 196 acatacatacatacatactttt 175



to top

>gb|AY017730.1| Oryza sativa microsatellite MRG0055 containing (AC)X17, genomic
           sequence
          Length = 234

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 11  acatacatacatacatactttt 32
           ||||||||||||||||||||||
Sbjct: 230 acatacatacatacatactttt 209



to top

>gb|AC102151.8| Mus musculus chromosome 18, clone RP23-312L17, complete sequence
          Length = 175398

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 52   catacacacatgtacttttata 73
            ||||||||||||||||||||||
Sbjct: 1626 catacacacatgtacttttata 1647



to top

>gb|AC132902.9| Mus musculus chromosome 13, clone RP24-286O14, complete sequence
          Length = 160759

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 7     tatcacatacatacatacatac 28
             ||||||||||||||||||||||
Sbjct: 63109 tatcacatacatacatacatac 63088



to top

>gb|AC102532.12| Mus musculus chromosome 12, clone RP23-49D23, complete sequence
          Length = 170606

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 11     acatacatacatacatactttt 32
              ||||||||||||||||||||||
Sbjct: 118876 acatacatacatacatactttt 118897



to top

>gb|AC121290.6| Mus musculus chromosome 16, clone RP23-84N4, complete sequence
          Length = 241184

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 7     tatcacatacatacatacatac 28
             ||||||||||||||||||||||
Sbjct: 96586 tatcacatacatacatacatac 96607



 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 7     tatcacatacatacatacatac 28
             ||||||||||||||||||||||
Sbjct: 74621 tatcacatacatacatacatac 74642



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 8      atcacatacatacatacatac 28
              |||||||||||||||||||||
Sbjct: 120721 atcacatacatacatacatac 120741



to top

>gb|AC165352.2| Mus musculus BAC clone RP23-205C7 from chromosome 15, complete sequence
          Length = 202977

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 11    acatacatacatacatactttt 32
             ||||||||||||||||||||||
Sbjct: 91609 acatacatacatacatactttt 91588



to top

>gb|AC161257.2| Mus musculus BAC clone RP24-91A16 from chromosome 9, complete sequence
          Length = 245088

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 11    acatacatacatacatactttt 32
             ||||||||||||||||||||||
Sbjct: 20592 acatacatacatacatactttt 20571



to top

>gb|AC125460.4| Mus musculus BAC clone RP24-448D10 from chromosome 15, complete sequence
          Length = 205859

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 7      tatcacatacatacatacatac 28
              ||||||||||||||||||||||
Sbjct: 139173 tatcacatacatacatacatac 139152



to top

>gb|AC125114.3| Mus musculus BAC clone RP24-254M13 from chromosome 18, complete
             sequence
          Length = 158836

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 7     tatcacatacatacatacatac 28
             ||||||||||||||||||||||
Sbjct: 93212 tatcacatacatacatacatac 93191



to top

>gb|AC117248.3| Mus musculus BAC clone RP24-345A14 from chromosome 9, complete sequence
          Length = 185810

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 11    acatacatacatacatactttt 32
             ||||||||||||||||||||||
Sbjct: 74966 acatacatacatacatactttt 74987



to top

>gb|AC126026.4| Mus musculus BAC clone RP24-486A17 from chromosome 18, complete
             sequence
          Length = 138242

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 7     tatcacatacatacatacatac 28
             ||||||||||||||||||||||
Sbjct: 29044 tatcacatacatacatacatac 29023



to top

>emb|CR956382.7| Pig DNA sequence from clone CH242-231E9 on chromosome 6, complete
              sequence
          Length = 186091

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 10     cacatacatacatacatactttttct 35
              ||||||||||||||||| ||||||||
Sbjct: 150010 cacatacatacatacattctttttct 150035



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 9     tcacatacatacatacatac 28
             ||||||||||||||||||||
Sbjct: 62040 tcacatacatacatacatac 62059



to top

>emb|CR450739.19| Zebrafish DNA sequence from clone DKEY-175B17 in linkage group 13,
            complete sequence
          Length = 180895

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 11   acatacatacatacatactttt 32
            ||||||||||||||||||||||
Sbjct: 7231 acatacatacatacatactttt 7252



to top

>gb|AC121523.6| Mus musculus chromosome 18, clone RP24-92N23, complete sequence
          Length = 202346

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 11    acatacatacatacatactttt 32
             ||||||||||||||||||||||
Sbjct: 52540 acatacatacatacatactttt 52561



to top

>gb|AC113287.8| Mus musculus chromosome 3, clone RP23-412L13, complete sequence
          Length = 214444

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 11    acatacatacatacatactttttcta 36
             |||||||||||||||||| |||||||
Sbjct: 80717 acatacatacatacatacattttcta 80692



to top

>gb|AC158751.7| Mus musculus chromosome 7, clone RP23-413C19, complete sequence
          Length = 198442

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 11   acatacatacatacatactttt 32
            ||||||||||||||||||||||
Sbjct: 7797 acatacatacatacatactttt 7818



to top

>gb|AC158512.2| Mus musculus BAC clone RP24-319O6 from chromosome 9, complete sequence
          Length = 171723

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 11     acatacatacatacatactttt 32
              ||||||||||||||||||||||
Sbjct: 149566 acatacatacatacatactttt 149587



to top

>gb|AC163029.5| Mus musculus chromosome 1, clone RP23-267I23, complete sequence
          Length = 181761

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 11     acatacatacatacatactttt 32
              ||||||||||||||||||||||
Sbjct: 137230 acatacatacatacatactttt 137209



to top

>emb|AL139230.25| Human DNA sequence from clone RP11-182M20 on chromosome 13 Contains the
             5' end of the TBC1D4 gene for TBC1 domain family, member 4
             (KIAA0603), a novel gene and a CpG island, complete
             sequence
          Length = 133362

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 9     tcacatacatacatacatactttttc 34
             ||||||||||||||||||| ||||||
Sbjct: 52469 tcacatacatacatacatagtttttc 52494



to top

>gb|AC161177.4| Mus musculus chromosome 18, clone RP24-131H12, complete sequence
          Length = 189231

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 11     acatacatacatacatactttt 32
              ||||||||||||||||||||||
Sbjct: 106367 acatacatacatacatactttt 106388



to top

>emb|AL021396.8|HS971N18 Human DNA sequence from clone RP5-971N18 on chromosome 20p12 Contains
             the PHKBP1 pseudogene (phosphorylase kinase, beta
             pseudogene 1), two novel genes and a CpG island, complete
             sequence
          Length = 125729

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 11    acatacatacatacatactttt 32
             ||||||||||||||||||||||
Sbjct: 57822 acatacatacatacatactttt 57801



to top

>emb|AL645644.8| Mouse DNA sequence from clone RP23-400O5 on chromosome 11 Contains the
             3' end of the gene for a novel protein (A530001H01), the
             5' end of the Myh10 gene for non-muscle myosin heavy chain
             10 and a CpG island, complete sequence
          Length = 195322

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 7     tatcacatacatacatacatac 28
             ||||||||||||||||||||||
Sbjct: 25083 tatcacatacatacatacatac 25062



to top

>emb|AL662902.14| Mouse DNA sequence from clone RP23-417K16 on chromosome 11 Contains
            two novel genes, complete sequence
          Length = 154002

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 12   catacatacatacatacttttt 33
            ||||||||||||||||||||||
Sbjct: 2529 catacatacatacatacttttt 2550



to top

>emb|AL663040.6| Mouse DNA sequence from clone RP23-61M22 on chromosome 11, complete
             sequence
          Length = 81885

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 7     tatcacatacatacatacatac 28
             ||||||||||||||||||||||
Sbjct: 76344 tatcacatacatacatacatac 76365



to top

>emb|AL929183.14| Zebrafish DNA sequence from clone CH211-142M8 in linkage group 25,
              complete sequence
          Length = 180603

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 7      tatcacatacatacatacatac 28
              ||||||||||||||||||||||
Sbjct: 164248 tatcacatacatacatacatac 164269



to top

>emb|CR853303.6| Pig DNA sequence from clone PigE-173F2, complete sequence
          Length = 151259

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 10     cacatacatacatacatactttttct 35
              ||||||||||||||||| ||||||||
Sbjct: 103118 cacatacatacatacattctttttct 103143



to top

>gb|AC104236.2| Homo sapiens chromosome 15, clone RP11-24J19, complete sequence
          Length = 160392

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 10    cacatacatacatacatacttt 31
             ||||||||||||||||||||||
Sbjct: 17267 cacatacatacatacatacttt 17288



to top

>gb|AC090457.6| Homo sapiens chromosome 18, clone RP11-357H3, complete sequence
          Length = 173765

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 11     acatacatacatacatactttt 32
              ||||||||||||||||||||||
Sbjct: 136715 acatacatacatacatactttt 136736



to top

>gb|AC096566.2| Homo sapiens BAC clone RP11-292B1 from 4, complete sequence
          Length = 101931

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 7     tatcacatacatacatacatac 28
             ||||||||||||||||||||||
Sbjct: 57943 tatcacatacatacatacatac 57922



to top

>gb|AC105151.8| Mus musculus chromosome 1, clone RP23-28N2, complete sequence
          Length = 270578

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 11  acatacatacatacatactttt 32
           ||||||||||||||||||||||
Sbjct: 706 acatacatacatacatactttt 727



to top

>gb|AC025296.10| Oryza sativa chromosome 10 BAC OSJNBa0076F20 genomic sequence, complete
             sequence
          Length = 165394

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 11    acatacatacatacatactttt 32
             ||||||||||||||||||||||
Sbjct: 68985 acatacatacatacatactttt 69006



to top

>dbj|AK083880.1| Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length
            enriched library, clone:D130043C18
            product:unclassifiable, full insert sequence
          Length = 4261

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 11   acatacatacatacatactttt 32
            ||||||||||||||||||||||
Sbjct: 1905 acatacatacatacatactttt 1926



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 11       acatacatacatacatactttt 32
                ||||||||||||||||||||||
Sbjct: 19441119 acatacatacatacatactttt 19441140



to top

>gb|AC154803.2| Mus musculus BAC clone RP24-505I19 from chromosome 9, complete sequence
          Length = 140552

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 11     acatacatacatacatactttttcta 36
              |||||||||||||||| |||||||||
Sbjct: 112005 acatacatacatacattctttttcta 111980



to top

>gb|AF221986.1|AF221986 Calliactis parasitica peptidylglycine alpha-amidating monooxygenase
            gene, complete cds
          Length = 23859

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 11   acatacatacatacatactttt 32
            ||||||||||||||||||||||
Sbjct: 6750 acatacatacatacatactttt 6729



to top

>gb|AC123835.4| Mus musculus BAC clone RP23-365J20 from chromosome 9, complete
            sequence
          Length = 219799

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 11   acatacatacatacatactttt 32
            ||||||||||||||||||||||
Sbjct: 6596 acatacatacatacatactttt 6617



to top

>gb|AC104020.10| Homo sapiens chromosome 15, clone RP11-369K8, complete sequence
          Length = 171307

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 10   cacatacatacatacatacttt 31
            ||||||||||||||||||||||
Sbjct: 2415 cacatacatacatacatacttt 2394



to top

>emb|BX005464.7| Zebrafish DNA sequence from clone DKEY-24J21, complete sequence
          Length = 199639

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 7      tatcacatacatacatacatac 28
              ||||||||||||||||||||||
Sbjct: 139165 tatcacatacatacatacatac 139144



to top

>emb|BX248102.11| Zebrafish DNA sequence from clone CH211-243F3, complete sequence
          Length = 150473

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 11     acatacatacatacatactttt 32
              ||||||||||||||||||||||
Sbjct: 145653 acatacatacatacatactttt 145674



to top

>emb|AL732452.5| Mouse DNA sequence from clone RP23-177C20 on chromosome 2, complete
              sequence
          Length = 190165

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 7      tatcacatacatacatacatac 28
              ||||||||||||||||||||||
Sbjct: 153527 tatcacatacatacatacatac 153506



to top

>gb|AC124636.23| Mus musculus chromosome 16, clone RP23-454J20, complete sequence
          Length = 187247

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 7     tatcacatacatacatacatac 28
             ||||||||||||||||||||||
Sbjct: 44453 tatcacatacatacatacatac 44474



to top

>emb|AL645755.20| Zebrafish DNA sequence from clone RP71-1N18 in linkage group 22,
             complete sequence
          Length = 141779

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 7     tatcacatacatacatacatac 28
             ||||||||||||||||||||||
Sbjct: 43432 tatcacatacatacatacatac 43411



to top

>gb|AC120123.19| Mus musculus chromosome 7, clone RP23-152B12, complete sequence
          Length = 229054

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 11     acatacatacatacatactttt 32
              ||||||||||||||||||||||
Sbjct: 186046 acatacatacatacatactttt 186067



to top

>emb|BX927343.16| Zebrafish DNA sequence from clone CH211-57L21 in linkage group 16,
             complete sequence
          Length = 166820

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 11    acatacatacatacatactttt 32
             ||||||||||||||||||||||
Sbjct: 51753 acatacatacatacatactttt 51732



to top

>gb|AC102255.10| Mus musculus chromosome 18, clone RP24-182H11, complete sequence
          Length = 195275

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 52    catacacacatgtacttttata 73
             ||||||||||||||||||||||
Sbjct: 37133 catacacacatgtacttttata 37112



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 11       acatacatacatacatactttt 32
                ||||||||||||||||||||||
Sbjct: 19452395 acatacatacatacatactttt 19452416



to top

>gb|AC161272.3| Mus musculus BAC clone RP23-56M19 from chromosome 9, complete sequence
          Length = 192003

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 11     acatacatacatacatactttttcta 36
              |||||||||||||||| |||||||||
Sbjct: 191056 acatacatacatacattctttttcta 191081



to top

>emb|AL732539.6| Mouse DNA sequence from clone RP23-255E6 on chromosome 11 Contains the
             3' end of the Msi2h gene for Musashi homolog 2
             (Drosophila), an eukaryotic translation elongation factor
             2 (Eef2) pseudogene and a ribosomal protein L35a (Rpl35a)
             pseudogene, complete sequence
          Length = 216688

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 32    ttctagtacaacaaaggctaca 53
             ||||||||||||||||||||||
Sbjct: 46778 ttctagtacaacaaaggctaca 46757



to top

>emb|CT033847.5| Mouse DNA sequence from clone RP24-225N8 on chromosome 17, complete
             sequence
          Length = 171164

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 12    catacatacatacatacttttt 33
             ||||||||||||||||||||||
Sbjct: 36871 catacatacatacatacttttt 36892



to top

>emb|AL929572.10| Mouse DNA sequence from clone RP23-464H12 on chromosome 2, complete
              sequence
          Length = 191603

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 7      tatcacatacatacatacatac 28
              ||||||||||||||||||||||
Sbjct: 110749 tatcacatacatacatacatac 110770



to top

>emb|AL591598.8| Mouse DNA sequence from clone RP23-272C14 on chromosome 2, complete
              sequence
          Length = 191520

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 7      tatcacatacatacatacatac 28
              ||||||||||||||||||||||
Sbjct: 141193 tatcacatacatacatacatac 141214



to top

>emb|AL805901.6| Mouse DNA sequence from clone RP23-24K4 on chromosome X, complete
              sequence
          Length = 243012

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 7      tatcacatacatacatacatac 28
              ||||||||||||||||||||||
Sbjct: 177375 tatcacatacatacatacatac 177396



to top

>gb|AC166773.7| Mus musculus chromosome 7, clone RP24-303J15, complete sequence
          Length = 193859

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 10     cacatacatacatacatactt 30
              |||||||||||||||||||||
Sbjct: 124275 cacatacatacatacatactt 124295



to top

>gb|AC155249.2| Mus musculus BAC clone RP24-254A5 from chromosome 9, complete sequence
          Length = 191932

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 11     acatacatacatacatacttt 31
              |||||||||||||||||||||
Sbjct: 113439 acatacatacatacatacttt 113459



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 9      tcacatacatacatacatac 28
              ||||||||||||||||||||
Sbjct: 113425 tcacatacatacatacatac 113444



to top

>gb|AC099975.11| Mus musculus chromosome 5, clone RP23-23A2, complete sequence
          Length = 213359

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 11     acatacatacatacatactttttct 35
              ||||||||||||||||||| |||||
Sbjct: 200404 acatacatacatacatactctttct 200380



to top

>gb|AC155712.8| Mus musculus 10 BAC RP24-183O8 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 151709

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 8     atcacatacatacatacatac 28
             |||||||||||||||||||||
Sbjct: 80071 atcacatacatacatacatac 80051



to top

>gb|AC132396.6| Mus musculus BAC clone RP23-394F17 from chromosome 6, complete sequence
          Length = 190146

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 7      tatcacatacatacatacata 27
              |||||||||||||||||||||
Sbjct: 161393 tatcacatacatacatacata 161373



to top

>gb|AC165161.3| Mus musculus BAC clone RP23-187K9 from chromosome 18, complete sequence
          Length = 191720

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 8      atcacatacatacatacatac 28
              |||||||||||||||||||||
Sbjct: 184230 atcacatacatacatacatac 184250



to top

>gb|AC165317.8| Mus musculus chromosome 5, clone RP23-265O20, complete sequence
          Length = 190857

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 10    cacatacatacatacatactt 30
             |||||||||||||||||||||
Sbjct: 49038 cacatacatacatacatactt 49058



to top

>gb|AC104196.8| Mus musculus chromosome 5, clone RP24-239K15, complete sequence
          Length = 160345

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 11     acatacatacatacatactttttct 35
              ||||||||||||||||| |||||||
Sbjct: 149387 acatacatacatacatattttttct 149411



to top

>gb|AC102603.11| Mus musculus chromosome 14, clone RP23-385I17, complete sequence
          Length = 204565

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 282   gcaataaaatgaatcaaaact 302
             |||||||||||||||||||||
Sbjct: 68037 gcaataaaatgaatcaaaact 68057



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 11     acatacatacatacatactt 30
              ||||||||||||||||||||
Sbjct: 130847 acatacatacatacatactt 130828



to top

>gb|AY083355.1| Gerstaeckeria galapagoensis microsatellite GERST2 sequence
          Length = 196

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 8   atcacatacatacatacatac 28
           |||||||||||||||||||||
Sbjct: 118 atcacatacatacatacatac 98



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 11  acatacatacatacatactt 30
           ||||||||||||||||||||
Sbjct: 107 acatacatacatacatactt 88



to top

>gb|AC135599.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0045P14, complete sequence
          Length = 121894

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 8     atcacatacatacatacatac 28
             |||||||||||||||||||||
Sbjct: 25209 atcacatacatacatacatac 25189



to top

>gb|AC101715.8| Mus musculus chromosome 1, clone RP23-283P17, complete sequence
          Length = 148387

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 10    cacatacatacatacatactt 30
             |||||||||||||||||||||
Sbjct: 74471 cacatacatacatacatactt 74451



to top

>gb|AC123746.20| Mus musculus chromosome 1, clone RP24-122E21, complete sequence
          Length = 160429

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 10     cacatacatacatacatactt 30
              |||||||||||||||||||||
Sbjct: 113187 cacatacatacatacatactt 113167



to top

>gb|AC125255.15| Mus musculus chromosome 5, clone RP24-332C17, complete sequence
          Length = 173258

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 8     atcacatacatacatacatac 28
             |||||||||||||||||||||
Sbjct: 97727 atcacatacatacatacatac 97707



to top

>gb|AC093100.2| Drosophila melanogaster clone BACR05J04, complete sequence
          Length = 214621

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 10     cacatacatacatacatactt 30
              |||||||||||||||||||||
Sbjct: 113315 cacatacatacatacatactt 113335



to top

>gb|AC113485.19| Mus musculus chromosome 19, clone RP23-346D12, complete sequence
          Length = 190974

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 10    cacatacatacatacatactt 30
             |||||||||||||||||||||
Sbjct: 60965 cacatacatacatacatactt 60985



to top

>gb|AC116798.11| Mus musculus chromosome 1, clone RP24-329K22, complete sequence
          Length = 173479

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 8     atcacatacatacatacatac 28
             |||||||||||||||||||||
Sbjct: 98224 atcacatacatacatacatac 98204



to top

>gb|AC138654.4| Mus musculus BAC clone RP23-344O11 from chromosome 5, complete sequence
          Length = 198036

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 8      atcacatacatacatacatac 28
              |||||||||||||||||||||
Sbjct: 144367 atcacatacatacatacatac 144387



to top

>gb|AC122548.10| Mus musculus chromosome 19, clone RP23-273O15, complete sequence
          Length = 189169

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 10    cacatacatacatacatactt 30
             |||||||||||||||||||||
Sbjct: 83896 cacatacatacatacatactt 83876



to top

>gb|AC120085.5| Rattus norvegicus 10 BAC CH230-490B8 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 157493

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 11     acatacatacatacatacttt 31
              |||||||||||||||||||||
Sbjct: 105619 acatacatacatacatacttt 105639



to top

>gb|AC138401.9| Mus musculus chromosome 13, clone RP24-79G5, complete sequence
          Length = 209942

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 11     acatacatacatacatacttt 31
              |||||||||||||||||||||
Sbjct: 197417 acatacatacatacatacttt 197437



to top

>gb|AC161276.2| Pan troglodytes BAC clone CH251-520C21 from chromosome 7, complete
              sequence
          Length = 210088

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 10     cacatacatacatacatactt 30
              |||||||||||||||||||||
Sbjct: 125882 cacatacatacatacatactt 125902



to top

>gb|AC121785.3| Mus musculus BAC clone RP23-382K4 from chromosome 3, complete sequence
          Length = 197272

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 11     acatacatacatacatacttt 31
              |||||||||||||||||||||
Sbjct: 163822 acatacatacatacatacttt 163802



to top

>gb|AC110209.11| Mus musculus chromosome 12, clone RP23-279O18, complete sequence
          Length = 177587

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 11    acatacatacatacatacttt 31
             |||||||||||||||||||||
Sbjct: 95953 acatacatacatacatacttt 95933



to top

>gb|AC140451.3| Mus musculus BAC clone RP23-52L6 from chromosome 14, complete sequence
          Length = 224897

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 8      atcacatacatacatacatac 28
              |||||||||||||||||||||
Sbjct: 104849 atcacatacatacatacatac 104869



to top

>gb|AC126453.5| Mus musculus BAC clone RP23-244A6 from chromosome 6, complete sequence
          Length = 172616

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 7     tatcacatacatacatacata 27
             |||||||||||||||||||||
Sbjct: 58021 tatcacatacatacatacata 58001



to top

>gb|AC134576.3| Mus musculus BAC clone RP24-68G10 from chromosome 18, complete sequence
          Length = 249301

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 10    cacatacatacatacatactt 30
             |||||||||||||||||||||
Sbjct: 97629 cacatacatacatacatactt 97649



to top

>gb|AC140249.2| Mus musculus BAC clone RP24-285O1 from chromosome 12, complete sequence
          Length = 160337

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 11    acatacatacatacatacttt 31
             |||||||||||||||||||||
Sbjct: 71992 acatacatacatacatacttt 71972



to top

>gb|AC144630.2| Mus musculus BAC clone RP23-284O15 from chromosome 1, complete sequence
          Length = 188928

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 10     cacatacatacatacatactt 30
              |||||||||||||||||||||
Sbjct: 185307 cacatacatacatacatactt 185327



to top

>gb|AC125268.10| Mus musculus chromosome 1, clone RP23-127L7, complete sequence
          Length = 233529

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 7      tatcacatacatacatacata 27
              |||||||||||||||||||||
Sbjct: 193675 tatcacatacatacatacata 193695



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 11    acatacatacatacatactt 30
             ||||||||||||||||||||
Sbjct: 60090 acatacatacatacatactt 60071



to top

>gb|AF252827.5| Homo sapiens chromosome 8 clone RP11-166E20 map q24.13, complete sequence
          Length = 165347

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 13     atacatacatacatacttttt 33
              |||||||||||||||||||||
Sbjct: 147740 atacatacatacatacttttt 147760



to top

>gb|AF228660.5| Homo sapiens chromosome 8 clone RP11-37N22 map q24.13, complete
            sequence
          Length = 182016

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 13   atacatacatacatacttttt 33
            |||||||||||||||||||||
Sbjct: 7186 atacatacatacatacttttt 7206



to top

>gb|AC147883.2| Xenopus tropicalis clone CH216-117C13, complete sequence
          Length = 165987

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 11    acatacatacatacatacttt 31
             |||||||||||||||||||||
Sbjct: 95833 acatacatacatacatacttt 95813



to top

>gb|AC113540.12| Mus musculus chromosome 17, clone RP23-158F13, complete sequence
          Length = 219781

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 8     atcacatacatacatacatac 28
             |||||||||||||||||||||
Sbjct: 33612 atcacatacatacatacatac 33592



to top

>gb|AC167241.2| Mus musculus BAC clone RP24-560M14 from chromosome 17, complete sequence
          Length = 184079

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 8      atcacatacatacatacatac 28
              |||||||||||||||||||||
Sbjct: 110465 atcacatacatacatacatac 110485



to top

>gb|AC163687.5| Mus musculus BAC clone RP23-3H13 from chromosome 17, complete sequence
          Length = 220643

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 8     atcacatacatacatacatac 28
             |||||||||||||||||||||
Sbjct: 54797 atcacatacatacatacatac 54817



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 11    acatacatacatacatactt 30
             ||||||||||||||||||||
Sbjct: 54820 acatacatacatacatactt 54839



to top

>gb|AC116387.7| Mus musculus chromosome 18, clone RP23-37P9, complete sequence
          Length = 217116

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 8      atcacatacatacatacatac 28
              |||||||||||||||||||||
Sbjct: 182243 atcacatacatacatacatac 182263



to top

>gb|AC121286.7| Mus musculus chromosome 12, clone RP23-36H21, complete sequence
          Length = 227648

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 7071 atcacatacatacatacatac 7051



to top

>gb|AC113304.15| Mus musculus chromosome 9, clone RP23-431B6, complete sequence
          Length = 202182

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 11     acatacatacatacatacttt 31
              |||||||||||||||||||||
Sbjct: 118845 acatacatacatacatacttt 118825



to top

>gb|AC144808.2| Mus musculus BAC clone RP24-434O1 from chromosome 5, complete sequence
          Length = 152463

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 10     cacatacatacatacatactt 30
              |||||||||||||||||||||
Sbjct: 147875 cacatacatacatacatactt 147895



to top

>emb|CT010488.9| Mouse DNA sequence from clone RP23-133A3 on chromosome 9, complete
             sequence
          Length = 219139

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 11    acatacatacatacatacttt 31
             |||||||||||||||||||||
Sbjct: 30745 acatacatacatacatacttt 30725



to top

>emb|CR450841.7| Zebrafish DNA sequence from clone DKEY-16N9 in linkage group 11,
             complete sequence
          Length = 263287

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 8     atcacatacatacatacatac 28
             |||||||||||||||||||||
Sbjct: 52398 atcacatacatacatacatac 52378



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 8     atcacatacatacatacatac 28
             |||||||||||||||||||||
Sbjct: 52291 atcacatacatacatacatac 52271



to top

>gb|AC124364.4| Mus musculus BAC clone RP24-538E16 from chromosome 12, complete
             sequence
          Length = 177697

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 10    cacatacatacatacatactt 30
             |||||||||||||||||||||
Sbjct: 18366 cacatacatacatacatactt 18386



to top

>gb|AC122930.4| Mus musculus BAC clone RP23-13L19 from chromosome 9, complete sequence
          Length = 224108

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 11     acatacatacatacatacttt 31
              |||||||||||||||||||||
Sbjct: 109294 acatacatacatacatacttt 109274



to top

>gb|AC125044.3| Mus musculus BAC clone RP23-348B10 from chromosome 17, complete
             sequence
          Length = 222615

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 8     atcacatacatacatacatac 28
             |||||||||||||||||||||
Sbjct: 64654 atcacatacatacatacatac 64674



to top

>gb|AC003108.1|HUAC003108 Human Chromosome 16 BAC clone CIT987SK-327O24, complete sequence
          Length = 164564

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 10    cacatacatacatacatactt 30
             |||||||||||||||||||||
Sbjct: 92920 cacatacatacatacatactt 92900



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 11    acatacatacatacatactt 30
             ||||||||||||||||||||
Sbjct: 94767 acatacatacatacatactt 94748



to top

>emb|AJ843655.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 67_2
          Length = 1711

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 8   atcacatacatacatacatac 28
           |||||||||||||||||||||
Sbjct: 98  atcacatacatacatacatac 118



to top

>emb|AJ843654.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 67_1
          Length = 1691

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 8   atcacatacatacatacatac 28
           |||||||||||||||||||||
Sbjct: 98  atcacatacatacatacatac 118



to top

>emb|AJ843643.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 13_2
          Length = 1691

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 8   atcacatacatacatacatac 28
           |||||||||||||||||||||
Sbjct: 98  atcacatacatacatacatac 118



to top

>emb|AJ843642.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 13_1
          Length = 1691

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 8   atcacatacatacatacatac 28
           |||||||||||||||||||||
Sbjct: 98  atcacatacatacatacatac 118



to top

>emb|AJ843637.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 111_2
          Length = 1711

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 8   atcacatacatacatacatac 28
           |||||||||||||||||||||
Sbjct: 98  atcacatacatacatacatac 118



to top

>emb|AJ843636.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 111_1
          Length = 1692

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 8   atcacatacatacatacatac 28
           |||||||||||||||||||||
Sbjct: 98  atcacatacatacatacatac 118



to top

>emb|AJ843633.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 109_2
          Length = 1691

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 8   atcacatacatacatacatac 28
           |||||||||||||||||||||
Sbjct: 98  atcacatacatacatacatac 118



to top

>emb|AJ843632.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 109_1
          Length = 1691

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 8   atcacatacatacatacatac 28
           |||||||||||||||||||||
Sbjct: 98  atcacatacatacatacatac 118



to top

>emb|AJ843631.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 108_2
          Length = 1691

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 8   atcacatacatacatacatac 28
           |||||||||||||||||||||
Sbjct: 98  atcacatacatacatacatac 118



to top

>emb|AJ843628.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 107_1
          Length = 1711

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 8   atcacatacatacatacatac 28
           |||||||||||||||||||||
Sbjct: 98  atcacatacatacatacatac 118



to top

>gb|AC122374.4| Mus musculus BAC clone RP23-468F24 from chromosome 6, complete sequence
          Length = 195113

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 11     acatacatacatacatactttttct 35
              ||||||||||||||||| |||||||
Sbjct: 176450 acatacatacatacatattttttct 176474



to top

>gb|AC117242.3| Mus musculus BAC clone RP24-151P1 from chromosome 6, complete sequence
          Length = 209736

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 10    cacatacatacatacatactt 30
             |||||||||||||||||||||
Sbjct: 28034 cacatacatacatacatactt 28014



to top

>gb|AC123921.3| Mus musculus BAC clone RP24-180J14 from chromosome 8, complete sequence
          Length = 183936

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 8     atcacatacatacatacatac 28
             |||||||||||||||||||||
Sbjct: 96512 atcacatacatacatacatac 96492



to top

>gb|AC125410.4| Mus musculus BAC clone RP23-146N3 from 3, complete sequence
          Length = 213701

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 10     cacatacatacatacatactt 30
              |||||||||||||||||||||
Sbjct: 181837 cacatacatacatacatactt 181817



to top

>gb|AC125408.3| Mus musculus BAC clone RP23-94M23 from 3, complete sequence
          Length = 210519

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 10     cacatacatacatacatactt 30
              |||||||||||||||||||||
Sbjct: 195307 cacatacatacatacatactt 195327



to top

>gb|AC122802.2| Mus musculus BAC clone RP24-136N24 from 6, complete sequence
          Length = 185938

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 7      tatcacatacatacatacatacttt 31
              ||||||||||||||||| |||||||
Sbjct: 134545 tatcacatacatacatatatacttt 134569



to top

>gb|AC121903.2| Mus musculus BAC clone RP24-174G24 from 18, complete sequence
          Length = 172114

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 8     atcacatacatacatacatac 28
             |||||||||||||||||||||
Sbjct: 75122 atcacatacatacatacatac 75142



to top

>gb|AC121936.2| Mus musculus BAC clone RP24-207J5 from 13, complete sequence
          Length = 157713

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 11    acatacatacatacatacttt 31
             |||||||||||||||||||||
Sbjct: 66777 acatacatacatacatacttt 66797



to top

>gb|AC122053.3| Mus musculus BAC clone RP24-463C3 from 3, complete sequence
          Length = 151640

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 10    cacatacatacatacatactt 30
             |||||||||||||||||||||
Sbjct: 50190 cacatacatacatacatactt 50210



to top

>gb|AC116383.11| Mus musculus chromosome 5, clone RP23-15P21, complete sequence
          Length = 259299

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 11     acatacatacatacatactttttct 35
              ||||||||||||||||||| |||||
Sbjct: 102095 acatacatacatacatactctttct 102071



to top

>gb|AC098885.3| Mus musculus BAC clone RP23-122L17 from 5, complete sequence
          Length = 211112

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 8     atcacatacatacatacatac 28
             |||||||||||||||||||||
Sbjct: 73390 atcacatacatacatacatac 73410



to top

>gb|AC004947.2| Homo sapiens PAC clone RP5-1007F24 from 7, complete sequence
          Length = 124004

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 8     atcacatacatacatacatac 28
             |||||||||||||||||||||
Sbjct: 74335 atcacatacatacatacatac 74315



to top

>gb|AC006988.3| Homo sapiens BAC clone RP11-174I14 from 7, complete sequence
          Length = 107430

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 10    cacatacatacatacatactt 30
             |||||||||||||||||||||
Sbjct: 80193 cacatacatacatacatactt 80173



to top

>gb|AC108409.8| Mus musculus chromosome 19, clone RP23-84G7, complete sequence
          Length = 270854

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 10    cacatacatacatacatactt 30
             |||||||||||||||||||||
Sbjct: 54951 cacatacatacatacatactt 54931



to top

>gb|AC117810.8| Mus musculus chromosome 18, clone RP24-571D2, complete sequence
          Length = 207527

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 8     atcacatacatacatacatac 28
             |||||||||||||||||||||
Sbjct: 18482 atcacatacatacatacatac 18502



to top

>gb|AC113292.6| Mus musculus chromosome 15, clone RP23-418M3, complete sequence
          Length = 218109

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 8      atcacatacatacatacatac 28
              |||||||||||||||||||||
Sbjct: 207652 atcacatacatacatacatac 207632



to top

>gb|AC146142.1| Pan troglodytes BAC clone RP43-23M11 from 7, complete sequence
          Length = 173557

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 8      atcacatacatacatacatac 28
              |||||||||||||||||||||
Sbjct: 172415 atcacatacatacatacatac 172395



to top

>emb|BX005211.21| Zebrafish DNA sequence from clone CH211-128A7 in linkage group 14,
             complete sequence
          Length = 191332

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 11    acatacatacatacatacttt 31
             |||||||||||||||||||||
Sbjct: 65605 acatacatacatacatacttt 65625



to top

>ref|NG_000007.3| Homo sapiens beta globin region (HBB@) on chromosome 11
          Length = 81706

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 8     atcacatacatacatacatac 28
             |||||||||||||||||||||
Sbjct: 55044 atcacatacatacatacatac 55024



to top

>gb|AC096035.6| Rattus norvegicus 4 BAC CH230-16M16 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 228433

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 8      atcacatacatacatacatac 28
              |||||||||||||||||||||
Sbjct: 191377 atcacatacatacatacatac 191397



to top

>gb|AY349012.1| Homo sapiens hemoglobin beta pseudogene, intron 2 and exon 3
          Length = 595

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 8   atcacatacatacatacatac 28
           |||||||||||||||||||||
Sbjct: 213 atcacatacatacatacatac 193



to top

>gb|AF339400.1| Homo sapiens haplotype PB26 beta-globin pseudogene, complete sequence
          Length = 3087

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1937 atcacatacatacatacatac 1917



to top

>gb|AF339399.1| Homo sapiens haplotype PB25 beta-globin pseudogene, complete sequence
          Length = 3087

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1937 atcacatacatacatacatac 1917



to top

>gb|AF339398.1| Homo sapiens haplotype PB24 beta-globin pseudogene, complete sequence
          Length = 3083

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1933 atcacatacatacatacatac 1913



to top

>gb|AF339397.1| Homo sapiens haplotype PB23 beta-globin pseudogene, complete sequence
          Length = 3083

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1933 atcacatacatacatacatac 1913



to top

>gb|AF339396.1| Homo sapiens haplotype PB22 beta-globin pseudogene, complete sequence
          Length = 3079

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1929 atcacatacatacatacatac 1909



to top

>gb|AF339395.1| Homo sapiens haplotype PB21 beta-globin pseudogene, complete sequence
          Length = 3075

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1925 atcacatacatacatacatac 1905



to top

>gb|AF339394.1| Homo sapiens haplotype PB20 beta-globin pseudogene, complete sequence
          Length = 3080

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1929 atcacatacatacatacatac 1909



to top

>gb|AF339393.1| Homo sapiens haplotype PB19 beta-globin pseudogene, complete sequence
          Length = 3079

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1929 atcacatacatacatacatac 1909



to top

>gb|AF339392.1| Homo sapiens haplotype PB18 beta-globin pseudogene, complete sequence
          Length = 3080

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1929 atcacatacatacatacatac 1909



to top

>gb|AF339391.1| Homo sapiens haplotype PB17 beta-globin pseudogene, complete sequence
          Length = 3080

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1929 atcacatacatacatacatac 1909



to top

>gb|AF339390.1| Homo sapiens haplotype PB16 beta-globin pseudogene, complete sequence
          Length = 3080

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1929 atcacatacatacatacatac 1909



to top

>gb|AF339389.1| Homo sapiens haplotype PB15 beta-globin pseudogene, complete sequence
          Length = 3080

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1929 atcacatacatacatacatac 1909



to top

>gb|AF339388.1| Homo sapiens haplotype PB14 beta-globin pseudogene, complete sequence
          Length = 3080

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1929 atcacatacatacatacatac 1909



to top

>gb|AF339387.1| Homo sapiens haplotype PB13 beta-globin pseudogene, complete sequence
          Length = 3080

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1929 atcacatacatacatacatac 1909



to top

>gb|AF339386.1| Homo sapiens haplotype PB12 beta-globin pseudogene, complete sequence
          Length = 3080

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1929 atcacatacatacatacatac 1909



to top

>gb|AF339385.1| Homo sapiens haplotype PB11 beta-globin pseudogene, complete sequence
          Length = 3080

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1929 atcacatacatacatacatac 1909



to top

>gb|AF339384.1| Homo sapiens haplotype PB10 beta-globin pseudogene, complete sequence
          Length = 3079

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1929 atcacatacatacatacatac 1909



to top

>gb|AF339383.1| Homo sapiens haplotype PB9 beta-globin pseudogene, complete sequence
          Length = 3079

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1929 atcacatacatacatacatac 1909



to top

>gb|AF339382.1| Homo sapiens haplotype PB8 beta-globin pseudogene, complete sequence
          Length = 3079

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1929 atcacatacatacatacatac 1909



to top

>gb|AF339381.1| Homo sapiens haplotype PB7 beta-globin pseudogene, complete sequence
          Length = 3080

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1929 atcacatacatacatacatac 1909



to top

>gb|AF339380.1| Homo sapiens haplotype PB6 beta-globin pseudogene, complete sequence
          Length = 3079

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1929 atcacatacatacatacatac 1909



to top

>gb|AF339379.1| Homo sapiens haplotype PB5 beta-globin pseudogene, complete sequence
          Length = 3080

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1929 atcacatacatacatacatac 1909



to top

>gb|AF339378.1| Homo sapiens haplotype PB4b beta-globin pseudogene, complete sequence
          Length = 3080

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1929 atcacatacatacatacatac 1909



to top

>gb|AF339377.1| Homo sapiens haplotype PB4 beta-globin pseudogene, complete sequence
          Length = 3080

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1929 atcacatacatacatacatac 1909



to top

>gb|AF339376.1| Homo sapiens haplotype PB3b beta-globin pseudogene, complete sequence
          Length = 3080

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1929 atcacatacatacatacatac 1909



to top

>gb|AF339375.1| Homo sapiens haplotype PB3 beta-globin pseudogene, complete sequence
          Length = 3080

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1929 atcacatacatacatacatac 1909



to top

>gb|AF339374.1| Homo sapiens haplotype PB2 beta-globin pseudogene, complete sequence
          Length = 3080

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1929 atcacatacatacatacatac 1909



to top

>gb|AF339373.1| Homo sapiens haplotype PB1 beta-globin pseudogene, complete sequence
          Length = 3080

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1929 atcacatacatacatacatac 1909



to top

>emb|AL117336.22|HSA324I22 Human DNA sequence from clone RP11-324I22 on chromosome 10 Contains the
             3' end of the CREM gene  for cAMP responsive element
             modulator, the 5' end of the gene for cyclin fold protein
             1 (CFP1) (CBCP1), two novel genes, a novel gene containing
             part of FLJ32718 and two CpG islands, complete sequence
          Length = 190690

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 10    cacatacatacatacatactt 30
             |||||||||||||||||||||
Sbjct: 13014 cacatacatacatacatactt 13034



to top

>gb|AC104482.2| Sus scrofa clone RP44-423C21, complete sequence
          Length = 164846

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 12    catacatacatacatactttttcta 36
             ||||||||||||||| |||||||||
Sbjct: 33454 catacatacatacattctttttcta 33478



to top

>gb|AC162287.4| Mus musculus chromosome 7, clone RP24-243J4, complete sequence
          Length = 152934

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 9     tcacatacatacatacatact 29
             |||||||||||||||||||||
Sbjct: 75318 tcacatacatacatacatact 75338



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 9     tcacatacatacatacatac 28
             ||||||||||||||||||||
Sbjct: 75338 tcacatacatacatacatac 75357



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 9     tcacatacatacatacatac 28
             ||||||||||||||||||||
Sbjct: 75247 tcacatacatacatacatac 75266



to top

>ref|NM_001017329.2| Xenopus tropicalis craniofacial development protein 1 (cfdp1), mRNA
          Length = 2462

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1913 atcacatacatacatacatac 1933



to top

>gb|AC153837.4| Mus musculus 6 BAC RP23-192D5 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 232039

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 4     tcctatcacatacatacatacatac 28
             |||| ||||||||||||||||||||
Sbjct: 78986 tcctctcacatacatacatacatac 78962



to top

>emb|AL591064.11| Mouse DNA sequence from clone RP23-395E18 on chromosome 2, complete
              sequence
          Length = 200078

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 8      atcacatacatacatacatac 28
              |||||||||||||||||||||
Sbjct: 136493 atcacatacatacatacatac 136473



to top

>emb|AL606831.17| Mouse DNA sequence from clone RP23-432M23 on chromosome 11 Contains the
             5' end of Ntn1 gene for netrin 1, three genes for a novel
             proteins (F730038I15Rik), the 3' end of a novel gene
             (4930535C22Rik) and two CpG islands, complete sequence
          Length = 221455

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 8     atcacatacatacatacatac 28
             |||||||||||||||||||||
Sbjct: 61645 atcacatacatacatacatac 61665



to top

>emb|CR450817.6| Zebrafish DNA sequence from clone DKEYP-74B4 in linkage group 25,
             complete sequence
          Length = 196897

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 55    acacacatgtacttttatagt 75
             |||||||||||||||||||||
Sbjct: 10330 acacacatgtacttttatagt 10310



to top

>emb|BX571855.11| Zebrafish DNA sequence from clone DKEY-260N18 in linkage group 9,
             complete sequence
          Length = 114407

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 10    cacatacatacatacatactt 30
             |||||||||||||||||||||
Sbjct: 90409 cacatacatacatacatactt 90389



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 10    cacatacatacatacatactt 30
             |||||||||||||||||||||
Sbjct: 90049 cacatacatacatacatactt 90029



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 11    acatacatacatacatactt 30
             ||||||||||||||||||||
Sbjct: 90620 acatacatacatacatactt 90601



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 11    acatacatacatacatactt 30
             ||||||||||||||||||||
Sbjct: 90512 acatacatacatacatactt 90493



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 11    acatacatacatacatactt 30
             ||||||||||||||||||||
Sbjct: 90456 acatacatacatacatactt 90437



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 11    acatacatacatacatactt 30
             ||||||||||||||||||||
Sbjct: 90096 acatacatacatacatactt 90077



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 11    acatacatacatacatactt 30
             ||||||||||||||||||||
Sbjct: 89800 acatacatacatacatactt 89781



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 11    acatacatacatacatactt 30
             ||||||||||||||||||||
Sbjct: 89676 acatacatacatacatactt 89657



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 11    acatacatacatacatactt 30
             ||||||||||||||||||||
Sbjct: 89644 acatacatacatacatactt 89625



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 11    acatacatacatacatactt 30
             ||||||||||||||||||||
Sbjct: 89560 acatacatacatacatactt 89541



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 11    acatacatacatacatactt 30
             ||||||||||||||||||||
Sbjct: 89504 acatacatacatacatactt 89485



to top

>emb|AL935054.11| Mouse DNA sequence from clone RP23-280A12 on chromosome 11 Contains
            the 5' end of the gene for a novel protein
            (C330012F17Rik, C130096N06Rik), a ribosomal protein L37a
            (Rpl37a) pseudogene, a pseudogene similar to part of a
            novel protein (D130064H19Rik), a fibrillarin (Fbl)
            pseudogene, the 5' end of the gene for a novel protein
            (4931428D14Rik) (2300003H10) and three CpG islands,
            complete sequence
          Length = 199018

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 11   acatacatacatacatactttttct 35
            ||||||||||||||||| |||||||
Sbjct: 5888 acatacatacatacatagtttttct 5912



to top

>emb|AL671560.7| Mouse DNA sequence from clone RP23-149A5 on chromosome 1 Contains the 3'
              end of the Nrp2 gene for neuropilin 2, complete sequence
          Length = 157987

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 8      atcacatacatacatacatac 28
              |||||||||||||||||||||
Sbjct: 137518 atcacatacatacatacatac 137538



to top

>gb|BC081491.1| Danio rerio zgc:103591, mRNA (cDNA clone MGC:103591 IMAGE:7246622),
           complete cds
          Length = 911

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 9   tcacatacatacatacatacttttt 33
           |||||||||||||||||||| ||||
Sbjct: 709 tcacatacatacatacatacatttt 733



to top

>emb|BX569794.8| Zebrafish DNA sequence from clone DKEYP-15B2 in linkage group 6, complete
              sequence
          Length = 162388

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 11     acatacatacatacatactttttct 35
              |||||||||||||||||| ||||||
Sbjct: 151178 acatacatacatacatacattttct 151154



to top

>emb|AL671005.7| Mouse DNA sequence from clone RP23-76J17 on chromosome 4 Contains the
              Zdhhc21 gene for zinc finger and DHHC domain containing
              protein 21 and a CpG island, complete sequence
          Length = 202374

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 11     acatacatacatacatacttt 31
              |||||||||||||||||||||
Sbjct: 155089 acatacatacatacatacttt 155109



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 11    acatacatacatacatactt 30
             ||||||||||||||||||||
Sbjct: 88704 acatacatacatacatactt 88723



to top

>emb|AL845294.3| Mouse DNA sequence from clone RP23-285N19 on chromosome 4 Contains a
             ribosomal protein L9 (Rpl9) pseudogene, a cysteine-rich
             secretory protein 1 (Crisp1) pseudogene and a eukaryotic
             translation initiation factor 1A (Eif1a) pseudogene,
             complete sequence
          Length = 167418

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 4     tcctatcacatacatacatacatac 28
             |||||| ||||||||||||||||||
Sbjct: 96788 tcctattacatacatacatacatac 96812



to top

>gb|AC163106.4| Mus musculus BAC clone RP23-278O13 from chromosome 3, complete
            sequence
          Length = 200512

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 10   cacatacatacatacatactt 30
            |||||||||||||||||||||
Sbjct: 1555 cacatacatacatacatactt 1575



to top

>gb|AC154634.2| Mus musculus BAC clone RP23-298D14 from chromosome 14, complete sequence
          Length = 218356

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 8      atcacatacatacatacatac 28
              |||||||||||||||||||||
Sbjct: 171168 atcacatacatacatacatac 171148



to top

>emb|BX927179.9| Zebrafish DNA sequence from clone CH211-194N20 in linkage group 5,
             complete sequence
          Length = 121960

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 11    acatacatacatacatacttt 31
             |||||||||||||||||||||
Sbjct: 25735 acatacatacatacatacttt 25755



to top

>emb|BX537120.8| Zebrafish DNA sequence from clone DKEY-13P21 in linkage group 21,
              complete sequence
          Length = 242772

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 11     acatacatacatacatacttt 31
              |||||||||||||||||||||
Sbjct: 235767 acatacatacatacatacttt 235787



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 11    acatacatacatacatacttt 31
             |||||||||||||||||||||
Sbjct: 62467 acatacatacatacatacttt 62487



to top

>gb|AC008556.5| Homo sapiens chromosome 19 clone CTC-526N19, complete sequence
          Length = 142515

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 8     atcacatacatacatacatactttt 32
             |||| ||||||||||||||||||||
Sbjct: 20003 atcatatacatacatacatactttt 19979



to top

>gb|AC105351.2| Drosophila melanogaster X BAC RP98-34B12 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 179795

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 4      tcctatcacatacatacatacatac 28
              |||| ||||||||||||||||||||
Sbjct: 133576 tcctctcacatacatacatacatac 133552



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 9      tcacatacatacatacatac 28
              ||||||||||||||||||||
Sbjct: 137558 tcacatacatacatacatac 137539



to top

>gb|AC078874.13| Homo sapiens 12 BAC RP11-781C15 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 166450

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 8      atcacatacatacatacatac 28
              |||||||||||||||||||||
Sbjct: 154475 atcacatacatacatacatac 154455



to top

>gb|AC090921.7| Homo sapiens chromosome 8, clone RP11-37N22, complete sequence
          Length = 182041

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 13     atacatacatacatacttttt 33
              |||||||||||||||||||||
Sbjct: 174855 atacatacatacatacttttt 174835



to top

>gb|AC100871.2| Homo sapiens chromosome 8, clone RP11-959I15, complete sequence
          Length = 215314

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 13    atacatacatacatacttttt 33
             |||||||||||||||||||||
Sbjct: 70801 atacatacatacatacttttt 70781



to top

>gb|AC091906.3| Homo sapiens chromosome 5 clone RP11-193P20, complete sequence
          Length = 195510

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 10    cacatacatacatacatactttttc 34
             |||||||||||| ||||||||||||
Sbjct: 76572 cacatacatacacacatactttttc 76596



to top

>gb|AC159652.6| Mus musculus 10 BAC RP24-123H21 (Roswell Park Cancer Institute
            (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 202827

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 10   cacatacatacatacatactttttc 34
            ||||||||||||||||||| |||||
Sbjct: 6720 cacatacatacatacatacgttttc 6744



to top

>emb|BX323835.9| Zebrafish DNA sequence from clone DKEYP-22F6 in linkage group 14,
             complete sequence
          Length = 172378

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 11    acatacatacatacatacttt 31
             |||||||||||||||||||||
Sbjct: 60499 acatacatacatacatacttt 60519



to top

>gb|AC158130.7| Mus musculus chromosome 19, clone RP24-360F11, complete sequence
          Length = 206879

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 10    cacatacatacatacatactt 30
             |||||||||||||||||||||
Sbjct: 76342 cacatacatacatacatactt 76322



to top

>gb|AC156801.2| Mus musculus BAC clone RP23-142F22 from chromosome 9, complete sequence
          Length = 197974

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 11     acatacatacatacatacttt 31
              |||||||||||||||||||||
Sbjct: 128105 acatacatacatacatacttt 128085



to top

>gb|AC156567.3| Mus musculus BAC clone RP23-333F2 from chromosome 13, complete sequence
          Length = 204778

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 8      atcacatacatacatacatac 28
              |||||||||||||||||||||
Sbjct: 197999 atcacatacatacatacatac 197979



to top

>gb|AC024259.17| Homo sapiens chromosome 7 clone RP11-105B19, complete sequence
          Length = 177303

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 11     acatacatacatacatacttt 31
              |||||||||||||||||||||
Sbjct: 156220 acatacatacatacatacttt 156200



to top

>gb|AC159711.8| Mus musculus 10 BAC RP23-214N15 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 192308

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 10    cacatacatacatacatactt 30
             |||||||||||||||||||||
Sbjct: 31166 cacatacatacatacatactt 31146



to top

>emb|BX511157.10| Zebrafish DNA sequence from clone DKEY-197M14 in linkage group 5,
              complete sequence
          Length = 159528

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 11     acatacatacatacatacttt 31
              |||||||||||||||||||||
Sbjct: 132204 acatacatacatacatacttt 132184



to top

>gb|AC114625.11| Mus musculus chromosome 3, clone RP24-107N14, complete sequence
          Length = 160025

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 11    acatacatacatacatacttt 31
             |||||||||||||||||||||
Sbjct: 84060 acatacatacatacatacttt 84040



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 8        atcacatacatacatacatac 28
                |||||||||||||||||||||
Sbjct: 10835689 atcacatacatacatacatac 10835669



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 11       acatacatacatacatacttt 31
                |||||||||||||||||||||
Sbjct: 15321018 acatacatacatacatacttt 15321038



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 10       cacatacatacatacatactttttc 34
                |||| ||||||||||||||||||||
Sbjct: 22750233 cacacacatacatacatactttttc 22750257



to top

>gb|AC016257.22|AC016257 Homo sapiens 12 BAC RP11-61E11 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 161096

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 8      atcacatacatacatacatac 28
              |||||||||||||||||||||
Sbjct: 127130 atcacatacatacatacatac 127110



to top

>ref|NM_001004681.1| Danio rerio zgc:103591 (zgc:103591), mRNA
          Length = 911

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 9   tcacatacatacatacatacttttt 33
           |||||||||||||||||||| ||||
Sbjct: 709 tcacatacatacatacatacatttt 733



to top

>gb|AF339362.1|AF339362 Pan troglodytes beta-globin (HBP) pseudogene, complete sequence
          Length = 3074

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1926 atcacatacatacatacatac 1906



to top

>gb|AC155840.8| Mus musculus 6 BAC RP24-223C8 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 188181

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 8     atcacatacatacatacatac 28
             |||||||||||||||||||||
Sbjct: 66523 atcacatacatacatacatac 66503



to top

>gb|AC102703.16| Mus musculus chromosome 1, clone RP24-442E5, complete sequence
          Length = 197439

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 11    acatacatacatacatacttt 31
             |||||||||||||||||||||
Sbjct: 89034 acatacatacatacatacttt 89014



to top

>gb|AC154182.2| Mus musculus BAC clone RP23-471C19 from chromosome 16, complete
             sequence
          Length = 180782

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 10    cacatacatacatacatactt 30
             |||||||||||||||||||||
Sbjct: 37747 cacatacatacatacatactt 37727



to top

>gb|AC154717.2| Mus musculus BAC clone RP24-369E16 from chromosome 17, complete
             sequence
          Length = 159625

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 8     atcacatacatacatacatac 28
             |||||||||||||||||||||
Sbjct: 41016 atcacatacatacatacatac 41036



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 11    acatacatacatacatacttt 31
             |||||||||||||||||||||
Sbjct: 36377 acatacatacatacatacttt 36397



to top

>gb|AC157090.6| Mus musculus 10 BAC RP24-360A19 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 169459

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 10    cacatacatacatacatactt 30
             |||||||||||||||||||||
Sbjct: 99086 cacatacatacatacatactt 99066



to top

>gb|AC012621.8| Homo sapiens chromosome 16 clone CTD-2055J8, complete sequence
          Length = 145023

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 10    cacatacatacatacatactt 30
             |||||||||||||||||||||
Sbjct: 68599 cacatacatacatacatactt 68579



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 11    acatacatacatacatactt 30
             ||||||||||||||||||||
Sbjct: 70446 acatacatacatacatactt 70427



to top

>gb|AC104389.8| Homo sapiens chromosome 11, clone CTD-2643I7, complete sequence
          Length = 207343

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 8     atcacatacatacatacatac 28
             |||||||||||||||||||||
Sbjct: 44912 atcacatacatacatacatac 44932



to top

>gb|AC087781.17| Mus musculus strain C57BL/6J chromosome 1 clone rp23-370c6, complete
              sequence
          Length = 173335

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 7      tatcacatacatacatacata 27
              |||||||||||||||||||||
Sbjct: 158824 tatcacatacatacatacata 158804



to top

>gb|AC129505.8| Homo sapiens chromosome 11, clone RP11-1205H24, complete sequence
          Length = 117817

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 8      atcacatacatacatacatac 28
              |||||||||||||||||||||
Sbjct: 116161 atcacatacatacatacatac 116181



to top

>gb|AC079949.45| Homo sapiens 12 BAC RP11-575F12 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 141775

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 9     tcacatacatacatacatacttttt 33
             ||||||||| |||||||||||||||
Sbjct: 92318 tcacatacacacatacatacttttt 92342



to top

>gb|AC133941.4| Mus musculus BAC clone RP23-466I9 from chromosome 18, complete sequence
          Length = 185668

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 8     atcacatacatacatacatac 28
             |||||||||||||||||||||
Sbjct: 81979 atcacatacatacatacatac 81999



to top

>gb|AC122369.5| Mus musculus BAC clone RP23-454D13 from chromosome 6, complete sequence
          Length = 203593

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 11     acatacatacatacatactttttct 35
              ||||||||||||||||| |||||||
Sbjct: 182851 acatacatacatacatattttttct 182827



to top

>gb|AC107815.11| Mus musculus chromosome 7, clone RP23-114A6, complete sequence
          Length = 228068

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 9     tcacatacatacatacatact 29
             |||||||||||||||||||||
Sbjct: 27875 tcacatacatacatacatact 27855



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 9     tcacatacatacatacatac 28
             ||||||||||||||||||||
Sbjct: 27946 tcacatacatacatacatac 27927



 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 9     tcacatacatacatacatac 28
             ||||||||||||||||||||
Sbjct: 27855 tcacatacatacatacatac 27836



to top

>dbj|AP005420.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
              clone:P0418B08
          Length = 165909

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 11     acatacatacatacatacttt 31
              |||||||||||||||||||||
Sbjct: 100207 acatacatacatacatacttt 100227



to top

>emb|BX571681.7| Zebrafish DNA sequence from clone DKEY-73N10 in linkage group 18,
              complete sequence
          Length = 184543

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 11     acatacatacatacatacttt 31
              |||||||||||||||||||||
Sbjct: 175212 acatacatacatacatacttt 175192



to top

>emb|AL773581.25| Mouse DNA sequence from clone RP23-338H21 on chromosome 4, complete
             sequence
          Length = 56013

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 8     atcacatacatacatacatac 28
             |||||||||||||||||||||
Sbjct: 45203 atcacatacatacatacatac 45223



to top

>emb|BX571883.3| Zebrafish DNA sequence from clone DKEY-151P17 in linkage group 18,
              complete sequence
          Length = 253172

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 11     acatacatacatacatacttt 31
              |||||||||||||||||||||
Sbjct: 197209 acatacatacatacatacttt 197189



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 11     acatacatacatacatacttt 31
              |||||||||||||||||||||
Sbjct: 154281 acatacatacatacatacttt 154261



to top

>dbj|AP005871.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:B1116H04
          Length = 140142

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 10    cacatacatacatacatactttttc 34
             |||| ||||||||||||||||||||
Sbjct: 76875 cacacacatacatacatactttttc 76899



to top

>dbj|AP005405.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:B1111C03
          Length = 144879

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 10     cacatacatacatacatactttttc 34
              |||| ||||||||||||||||||||
Sbjct: 119027 cacacacatacatacatactttttc 119051



to top

>dbj|AB086065.1| Irpex lacteus nucleomorph mRNA for ribonuclease T2, complete cds
          Length = 1848

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 8    atcacatacatacatacatac 28
            |||||||||||||||||||||
Sbjct: 1787 atcacatacatacatacatac 1767



to top

>emb|X60158.1|HVPSAG H.vulgare PsaG mRNA
          Length = 724

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 9   tcacatacatacatacatact 29
           |||||||||||||||||||||
Sbjct: 689 tcacatacatacatacatact 669



to top

>gb|AC004615.1|AC004615 Homo sapiens BAC clone GS1-405L21 from 5p15.2, complete sequence
          Length = 235141

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 10    cacatacatacatacatactttttc 34
             |||||||||||| ||||||||||||
Sbjct: 91840 cacatacatacacacatactttttc 91816



to top

>gb|AC154440.2| Mus musculus BAC clone RP24-175D9 from 9, complete sequence
          Length = 162520

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 11     acatacatacatacatacttt 31
              |||||||||||||||||||||
Sbjct: 140099 acatacatacatacatacttt 140119


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,589,465
Number of Sequences: 3902068
Number of extensions: 4589465
Number of successful extensions: 377702
Number of sequences better than 10.0: 1180
Number of HSP's better than 10.0 without gapping: 1180
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 358133
Number of HSP's gapped (non-prelim): 17748
length of query: 355
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 333
effective length of database: 17,147,199,772
effective search space: 5710017524076
effective search space used: 5710017524076
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top