ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags24h02 |
|---|---|
| Clone Library Name | barley_pub |
>emb|AJ495769.1|HVU495769 Hordeum vulgare mRNA for putative immunophilin Length = 835 Score = 260 bits (131), Expect = 1e-66 Identities = 150/156 (96%), Gaps = 1/156 (0%) Strand = Plus / Minus Query: 1 attcgattttgacaactagactcctttgtttgaccatggtaatagaatgctcatgtctca 60 |||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||| Sbjct: 697 attcgattttgacaaccagactcctttgtttgaccatggtaatagaatgttcatgtctca 638 Query: 61 ttgcgtctgccctacangagtaagttcccc-atacatagtcctattcgatttggtaactg 119 |||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 637 ttgcgtctgccctacaagagtaagttcccctatacatagtcctattcgatttggtaactg 578 Query: 120 ggcgaacttgctgcgccnagctgnctacagatcact 155 ||||||||||||||||| ||||| |||||||||||| Sbjct: 577 ggcgaacttgctgcgccgagctgcctacagatcact 542
>ref|NM_001039721.1| Mus musculus RIKEN cDNA A230107C01 gene (A230107C01Rik), mRNA Length = 3571 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 43 tagaatgctcatgtctcatt 62 |||||||||||||||||||| Sbjct: 3522 tagaatgctcatgtctcatt 3541
>dbj|AK133307.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4932432C05 product:hypothetical protein, full insert sequence Length = 3571 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 43 tagaatgctcatgtctcatt 62 |||||||||||||||||||| Sbjct: 3522 tagaatgctcatgtctcatt 3541
>gb|AC164564.3| Mus musculus BAC clone RP23-96N11 from chromosome 7, complete sequence Length = 247415 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 43 tagaatgctcatgtctcatt 62 |||||||||||||||||||| Sbjct: 76933 tagaatgctcatgtctcatt 76952
>gb|AC087887.11| Homo sapiens 12 BAC RP11-27M21 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 104526 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 actagactcctttgtttga 33 ||||||||||||||||||| Sbjct: 23802 actagactcctttgtttga 23784 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 696,078 Number of Sequences: 3902068 Number of extensions: 696078 Number of successful extensions: 41047 Number of sequences better than 10.0: 5 Number of HSP's better than 10.0 without gapping: 5 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 41039 Number of HSP's gapped (non-prelim): 7 length of query: 155 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 133 effective length of database: 17,147,199,772 effective search space: 2280577569676 effective search space used: 2280577569676 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)
