>emb|AJ784281.1| Hordeum vulgare subsp. vulgare partial mRNA for putative
           2,3-bisphosphoglycerate-independent phosphoglycerate
           mutase (pgam-I gene)
          Length = 196

 Score =  113 bits (57), Expect = 3e-22
 Identities = 59/60 (98%)
 Strand = Plus / Minus

                                                                       
Query: 252 cgatgagggtcgtctcgtaatcggcaggagcctggaagccatggaggttnatcaccgtgg 311
           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 166 cgatgagggtcgtctcgtaatcggcaggagcctggaagccatggaggttcatcaccgtgg 107

>emb|AJ004915.1|MDJ004915 Malus domestica mRNA for phosphoglyceromutase, complete cds
          Length = 2132

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                       
Query: 248  acttcgatgagggtcgtctcgtaatcggcaggagcctggaagccatggaggttnatcac 306
            |||||||||||||  | |||||| |||  |||||||||||| ||||| ||||| |||||
Sbjct: 1741 acttcgatgagggatggctcgtagtcgctaggagcctggaatccatgcaggttcatcac 1683

>gb|AC007374.6|AC007374 Homo sapiens chromosome 14 clone RP11-325L17 map 14q31, complete sequence
          Length = 190565

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 157    cattccttgacccaccccaaaact 180
              ||||||||||||||||||||||||
Sbjct: 133361 cattccttgacccaccccaaaact 133338

>emb|AL121784.5|CNS01DSH Human chromosome 14 DNA sequence BAC R-305I3 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 180523

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 157    cattccttgacccaccccaaaact 180
              ||||||||||||||||||||||||
Sbjct: 110880 cattccttgacccaccccaaaact 110857

>gb|AC162789.4| Mus musculus chromosome 1, clone RP24-323I23, complete sequence
          Length = 170236

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 155    atcattccttgacccaccccaaaact 180
              |||| |||||||||||||||||||||
Sbjct: 111352 atcaatccttgacccaccccaaaact 111327

>gb|AC134474.4| Mus musculus BAC clone RP23-234N16 from chromosome 6, complete sequence
          Length = 171491

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 274   ggcaggagcctggaagccatggagg 298
             |||||||||||||| ||||||||||
Sbjct: 72358 ggcaggagcctggaggccatggagg 72382

>emb|AL354836.13| Human DNA sequence from clone RP11-157P1 on chromosome 20 Contains the
             LAMA5 gene for laminin alpha 5 (KIAA0533), the GP110 gene
             for cell membrane glycoprotein (surface antigen),
             110000M(r), the KIAA0772 gene with similarity to the gene
             for oxysterol-binding protein and two putative novel
             genes, complete sequence
          Length = 141056

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 86    acctttctcaatgttacacat 106
             |||||||||||||||||||||
Sbjct: 39452 acctttctcaatgttacacat 39432

>gb|AC155641.8| Mus musculus 10 BAC RP24-121N1 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 195480

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 160    tccttgacccaccccaaaact 180
              |||||||||||||||||||||
Sbjct: 117723 tccttgacccaccccaaaact 117743

>gb|U16021.1|MCU16021 Mesembryanthemum crystallinum phosphoglyceromutase (pgm) gene,
            complete cds
          Length = 2032

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 244  gacgacttcgatgagggtcgtctcgtaatcggcaggagcct 284
            |||||| ||||||||||| | ||||||||||  ||||||||
Sbjct: 1775 gacgacctcgatgagggttggctcgtaatcgctaggagcct 1735

>emb|AL627214.15| Mouse DNA sequence from clone RP23-357K18 on chromosome 4, complete
             sequence
          Length = 182829

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 274   ggcaggagcctggaagccatggagg 298
             ||||||| |||||||||||||||||
Sbjct: 62135 ggcaggaacctggaagccatggagg 62159

>emb|AL671867.8| Mouse DNA sequence from clone RP23-131J17 on chromosome 4, complete
             sequence
          Length = 202342

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 154   gatcattccttgacccacccc 174
             |||||||||||||||||||||
Sbjct: 85302 gatcattccttgacccacccc 85322

>dbj|AB063037.1| Macaca fascicularis brain cDNA clone:QmoA-11735, full insert sequence
          Length = 3116

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 86   acctttctcaatgttacacat 106
            |||||||||||||||||||||
Sbjct: 2503 acctttctcaatgttacacat 2483

>gb|AC129576.11| Mus musculus chromosome 10, clone RP24-343D9, complete sequence
          Length = 136276

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 269    taatcggcaggagcctggaagcca 292
              |||| |||||||||||||||||||
Sbjct: 112576 taattggcaggagcctggaagcca 112599

>gb|AC114010.6| Mus musculus BAC clone RP24-378K23 from chromosome 12, complete
             sequence
          Length = 175670

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 57    caaaatagagctaactgcaa 76
             ||||||||||||||||||||
Sbjct: 14198 caaaatagagctaactgcaa 14217

>gb|AY153760.1| Agrostis stolonifera var. palustris chloroplast low molecular weight
            heat shock protein HSP26.8 gene, complete cds; nuclear
            gene for chloroplast product
          Length = 3098

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 188  caaaattggctaccgcaattttgg 211
            |||||||||||||| |||||||||
Sbjct: 2815 caaaattggctacctcaattttgg 2838

>gb|AY153759.1| Agrostis stolonifera var. palustris chloroplast low molecular weight
            heat shock protein HSP26.2m gene, complete cds; nuclear
            gene for chloroplast product
          Length = 2922

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 188  caaaattggctaccgcaattttgg 211
            |||||||||||||| |||||||||
Sbjct: 2787 caaaattggctacctcaattttgg 2810

>gb|AY153758.1| Agrostis stolonifera var. palustris chloroplast low molecular weight
            heat shock protein HSP26.2 gene, complete cds; nuclear
            gene for chloroplast product
          Length = 3064

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 188  caaaattggctaccgcaattttgg 211
            |||||||||||||| |||||||||
Sbjct: 2784 caaaattggctacctcaattttgg 2807

>gb|AC159746.5| Mus musculus 6 BAC RP23-437F11 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 171039

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 161    ccttgacccaccccaaaact 180
              ||||||||||||||||||||
Sbjct: 141948 ccttgacccaccccaaaact 141929

>gb|AC107810.8| Mus musculus chromosome 1, clone RP23-68D4, complete sequence
          Length = 160167

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 164   tgacccaccccaaaactata 183
             ||||||||||||||||||||
Sbjct: 50763 tgacccaccccaaaactata 50782

>emb|AL163011.3|CNS01RI8 Human chromosome 14 DNA sequence BAC C-2324M15 of library CalTech-D
             from chromosome 14 of Homo sapiens (Human), complete
             sequence
          Length = 100791

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 125   ctggcaaatctcaaattatt 144
             ||||||||||||||||||||
Sbjct: 63746 ctggcaaatctcaaattatt 63765


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,207,991
Number of Sequences: 3902068
Number of extensions: 2207991
Number of successful extensions: 39213
Number of sequences better than 10.0: 20
Number of HSP's better than 10.0 without gapping: 20
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 39184
Number of HSP's gapped (non-prelim): 29
length of query: 314
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 292
effective length of database: 17,147,199,772
effective search space: 5006982333424
effective search space used: 5006982333424
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)