ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags24f07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_463799.1| Oryza sativa (japonica cultivar-group), mRNA 351 1e-93
2ref|XM_506675.1| PREDICTED Oryza sativa (japonica cultivar-group... 351 1e-93
3dbj|AK102186.1| Oryza sativa (japonica cultivar-group) cDNA clon... 351 1e-93
4dbj|AK062502.1| Oryza sativa (japonica cultivar-group) cDNA clon... 351 1e-93
5gb|AY323481.1| Oryza sativa (japonica cultivar-group) ribosomal ... 295 7e-77
6dbj|AK064936.1| Oryza sativa (japonica cultivar-group) cDNA clon... 295 7e-77
7dbj|D83527.1|RICGA3 Rice (YK426) mRNA, complete cds 295 7e-77
8dbj|D38012.1|RICRPL9 Oryza sativa (japonica cultivar-group) mRNA... 240 3e-60
9gb|BT016425.1| Zea mays clone Contig258 mRNA sequence 238 1e-59
10gb|AY107309.1| Zea mays PCO113532 mRNA sequence 238 1e-59
11gb|BT016560.1| Zea mays clone Contig393 mRNA sequence 230 3e-57
12gb|AY104547.1| Zea mays PCO113533 mRNA sequence 216 5e-53
13dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 159 1e-35
14dbj|AP004187.3| Oryza sativa (japonica cultivar-group) genomic D... 159 1e-35
15dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 157 4e-35
16gb|DQ235200.1| Solanum tuberosum clone 171E12 unknown mRNA 105 1e-19
17gb|DQ207848.1| Solanum tuberosum clone 074A07 unknown mRNA 105 1e-19
18gb|BT013259.1| Lycopersicon esculentum clone 134794R, mRNA sequence 105 1e-19
19ref|NM_103046.2| Arabidopsis thaliana structural constituent of ... 94 5e-16
20gb|AF339694.1| Arabidopsis thaliana putative ribosomal protein L... 94 5e-16
21gb|AF326873.1| Arabidopsis thaliana putative ribosomal protein L... 94 5e-16
22gb|AY128910.1| Arabidopsis thaliana ribosomal protein L9, putati... 94 5e-16
23gb|AY072446.1| Arabidopsis thaliana ribosomal protein L9, putati... 94 5e-16
24gb|AF324688.2|AF324688 Arabidopsis thaliana At1g33120 (At1g33120... 94 5e-16
25emb|BX814591.1|CNS0ACBL Arabidopsis thaliana Full-length cDNA Co... 94 5e-16
26emb|BX816763.1|CNS0ABNW Arabidopsis thaliana Full-length cDNA Co... 94 5e-16
27gb|AY310780.1| Nicotiana benthamiana clone 8-334 unknown mRNA 88 3e-14
28ref|XM_863754.1| Aspergillus nidulans FGSC A4 hypothetical prote... 82 2e-12
29ref|NM_103048.3| Arabidopsis thaliana structural constituent of ... 76 1e-10
30emb|Y13428.1|HCRIBOL9 Haemonchus contortus mRNA for ribosomal pr... 76 1e-10
31emb|X91958.1|AT60SRL9 A.thaliana mRNA for 60S ribosomal protein L9 76 1e-10
32gb|AF375419.1| Arabidopsis thaliana At1g33140/T9L6_10 mRNA, comp... 76 1e-10
33gb|AY058051.1| Arabidopsis thaliana At1g33140/T9L6_10 mRNA, comp... 76 1e-10
34gb|AY054156.1| Arabidopsis thaliana At1g33140/T9L6_10 mRNA, comp... 76 1e-10
35dbj|AK222147.1| Arabidopsis thaliana mRNA for ribosomal protein ... 76 1e-10
36gb|AY039593.1| Arabidopsis thaliana At1g33140/T9L6_10 mRNA, comp... 76 1e-10
37gb|AY086680.1| Arabidopsis thaliana clone 26744 mRNA, complete s... 76 1e-10
38gb|AC021045.2|AC021045 Arabidopsis thaliana chromosome I BAC T9L... 76 1e-10
39ref|XM_566460.1| Cryptococcus neoformans var. neoformans JEC21 6... 72 2e-09
40gb|AY130411.1| Myxine glutinosa ribosomal protein L9 mRNA, parti... 72 2e-09
41ref|XM_960036.1| Neurospora crassa OR74A hypothetical protein (N... 70 7e-09
42ref|XM_331942.1| Neurospora crassa OR74A hypothetical protein (N... 70 7e-09
43ref|XM_381330.1| Gibberella zeae PH-1 chromosome 1 hypothetical ... 68 3e-08
44dbj|AB226272.1| Aspergillus oryzae cDNA, contig sequence: AoEST3132 68 3e-08
45dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005 68 3e-08
46ref|NM_117113.2| Arabidopsis thaliana structural constituent of ... 66 1e-07
47gb|AY190735.1| Pagrus major ribosomal protein L9 mRNA, complete cds 66 1e-07
48gb|AY117346.1| Arabidopsis thaliana putative ribosomal protein L... 66 1e-07
49gb|AY065259.1| Arabidopsis thaliana putative ribosomal protein L... 66 1e-07
50emb|BX829170.1|CNS0A4I1 Arabidopsis thaliana Full-length cDNA Co... 66 1e-07
51gb|AY086090.1| Arabidopsis thaliana clone 21228 mRNA, complete s... 66 1e-07
52gb|AC149298.1| Populus trichocarpa clone Pop1-021H24, complete s... 64 4e-07
53gb|AC119415.13| Medicago truncatula clone mth2-27n2, complete se... 64 4e-07
54gb|AC126789.20| Medicago truncatula clone mth2-36n23, complete s... 64 4e-07
55ref|XM_362383.1| Magnaporthe grisea 70-15 hypothetical protein (... 60 7e-06
56ref|XM_977388.1| PREDICTED: Mus musculus similar to ribosomal pr... 60 7e-06
57ref|XM_906947.2| PREDICTED: Mus musculus similar to ribosomal pr... 60 7e-06
58ref|XM_485172.3| PREDICTED: Mus musculus similar to ribosomal pr... 60 7e-06
59gb|DQ066193.1| Ixodes scapularis isolate ISUFL92 60S ribosomal p... 60 7e-06
60gb|AC027035.5|AC027035 Arabidopsis thaliana chromosome 1 BAC T16... 60 7e-06
61gb|AC084598.1|CBRG42J05 Caenorhabditis briggsae cosmid G42J05, c... 60 7e-06
62emb|AL935150.10| Mouse DNA sequence from clone RP24-482A24 on ch... 60 7e-06
63gb|AY648736.1| Danio rerio 60S ribosomal protein L9 mRNA, comple... 58 3e-05
64ref|XM_747184.1| Aspergillus fumigatus Af293 60S ribosomal prote... 58 3e-05
65emb|CR759875.6| Zebrafish DNA sequence from clone DKEY-274K22 in... 58 3e-05
66emb|CR405706.7| Zebrafish DNA sequence from clone CH211-233D12 i... 58 3e-05
67emb|X65155.1|PSGAMRF P.sativum GA mRNA (clone F) 58 3e-05
68emb|BX936325.9| Zebrafish DNA sequence from clone CH211-74P16 in... 58 3e-05
69ref|XM_702523.1| PREDICTED: Danio rerio similar to Rpl9 protein,... 58 3e-05
70ref|XM_702522.1| PREDICTED: Danio rerio similar to Rpl9 protein,... 58 3e-05
71ref|XM_679640.1| PREDICTED: Danio rerio similar to Rpl9 protein,... 58 3e-05
72ref|XM_702521.1| PREDICTED: Danio rerio similar to Rpl9 protein,... 58 3e-05
73ref|XM_702519.1| PREDICTED: Danio rerio similar to Rpl9 protein,... 58 3e-05
74emb|BX827856.1|CNS0A3Y4 Arabidopsis thaliana Full-length cDNA Co... 58 3e-05
75gb|BC090911.1| Danio rerio ribosomal protein L9, mRNA (cDNA clon... 58 3e-05
76emb|AL844559.14| Zebrafish DNA sequence from clone DKEY-14K1, co... 58 3e-05
77ref|NM_001003861.1| Danio rerio ribosomal protein L9 (rpl9), mRNA 58 3e-05
78gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chr... 56 1e-04
79ref|XM_504535.1| Yarrowia lipolytica CLIB122, YALI0E29073g predi... 56 1e-04
80emb|X97322.2|PSRPL9PRT Pisum sativum rpL9 gene for ribosomal pro... 56 1e-04
81emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ... 56 1e-04
82gb|BC069963.1| Mus musculus cDNA clone IMAGE:5039327, partial cds 54 4e-04
83gb|AC136513.2| Mus musculus BAC clone RP23-477N9 from chromosome... 54 4e-04
84dbj|AK050296.1| Mus musculus adult male liver tumor cDNA, RIKEN ... 54 4e-04
85dbj|AK053431.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f... 54 4e-04
86emb|AJ718406.1| Nicotiana tabacum cDNA-AFLP-fragment BSTC-22-260... 54 4e-04
87gb|AC102159.10| Mus musculus chromosome 19, clone RP23-398L11, c... 52 0.002
88gb|BC083329.1| Mus musculus ribosomal protein L9, mRNA (cDNA clo... 52 0.002
89gb|BC083166.1| Mus musculus ribosomal protein L9, mRNA (cDNA clo... 52 0.002
90gb|BC081435.1| Mus musculus ribosomal protein L9, mRNA (cDNA clo... 52 0.002
91gb|AC125233.4| Mus musculus BAC clone RP23-9D24 from chromosome ... 52 0.002
92gb|BC013165.1| Mus musculus ribosomal protein L9, mRNA (cDNA clo... 52 0.002
93ref|NM_011292.1| Mus musculus ribosomal protein L9 (Rpl9), mRNA 52 0.002
94gb|AC006679.2| Caenorhabditis elegans cosmid R13A5, complete seq... 52 0.002
95ref|XR_003890.1| PREDICTED: Mus musculus similar to 60S ribosoma... 52 0.002
96ref|XR_002003.1| PREDICTED: Mus musculus similar to 60S ribosoma... 52 0.002
97ref|XM_982604.1| PREDICTED: Mus musculus similar to ribosomal pr... 52 0.002
98ref|XM_990486.1| PREDICTED: Mus musculus similar to ribosomal pr... 52 0.002
99ref|XM_925735.2| PREDICTED: Mus musculus similar to ribosomal pr... 52 0.002
100ref|XM_484272.3| PREDICTED: Mus musculus similar to ribosomal pr... 52 0.002
101ref|XR_002858.1| PREDICTED: Mus musculus similar to ribosomal pr... 52 0.002
102ref|XR_004671.1| PREDICTED: Mus musculus similar to ribosomal pr... 52 0.002
103gb|AC129539.11| Mus musculus chromosome 16, clone RP23-246B24, c... 52 0.002
104gb|AC107711.13| Mus musculus chromosome 14, clone RP23-291I12, c... 52 0.002
105gb|AC115752.8| Mus musculus chromosome 19, clone RP23-18M16, com... 52 0.002
106gb|BC089319.1| Mus musculus ribosomal protein L9, mRNA (cDNA clo... 52 0.002
107gb|AC097273.3| Genomic sequence for Mus musculus, clone RP23-118... 52 0.002
108dbj|AK153562.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 52 0.002
109dbj|AK159980.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu... 52 0.002
110dbj|AK168326.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 52 0.002
111dbj|AK169217.1| Mus musculus 17 days embryo stomach cDNA, RIKEN ... 52 0.002
112dbj|AK088166.1| Mus musculus 2 days neonate thymus thymic cells ... 52 0.002
113dbj|AK084278.1| Mus musculus 12 days embryo eyeball cDNA, RIKEN ... 52 0.002
114dbj|AK012331.1| Mus musculus 11 days embryo whole body cDNA, RIK... 52 0.002
115dbj|AK012445.1| Mus musculus 11 days embryo whole body cDNA, RIK... 52 0.002
116ref|NM_066259.3| Caenorhabditis elegans Ribosomal Protein, Large... 52 0.002
117dbj|AK017427.1| Mus musculus 10 days neonate head cDNA, RIKEN fu... 52 0.002
118dbj|AK017388.1| Mus musculus 6 days neonate head cDNA, RIKEN ful... 52 0.002
119gb|BC093526.1| Mus musculus ribosomal protein L9, mRNA (cDNA clo... 52 0.002
120gb|AF260271.1|AF260271 Mus musculus 60S ribosomal Protein L9 mRN... 52 0.002
121dbj|AK191132.1| Mus musculus cDNA, clone:Y1G0104P04, strand:plus... 52 0.002
122gb|BC086937.1| Mus musculus ribosomal protein L9, mRNA (cDNA clo... 52 0.002
123emb|AL671898.7| Mouse DNA sequence from clone RP23-194K1 on chro... 52 0.002
124gb|AC154199.2| Mus musculus BAC clone RP24-396N5 from 13, comple... 52 0.002
125gb|AC101221.11| Mus musculus chromosome 13, clone RP23-96E4, com... 52 0.002
126emb|CT025645.16| Mouse DNA sequence from clone RP23-233D21 on ch... 52 0.002
127gb|AC154506.4| Mus musculus BAC clone RP24-94N16 from chromosome... 52 0.002
128gb|AC164120.2| Mus musculus BAC clone RP24-289J17 from chromosom... 52 0.002
129gb|U17332.1|MMU17332 Mus musculus ribosomal protein L9 (musl9) m... 52 0.002
130gb|U17331.1|MMU17331 Mus musculus mutant ribosomal protein L9 (m... 52 0.002
131ref|XM_799643.1| Trypanosoma cruzi strain CL Brener 60S ribosoma... 50 0.007
132ref|XM_801188.1| Trypanosoma cruzi strain CL Brener 60S ribosoma... 50 0.007
133ref|XM_808451.1| Trypanosoma cruzi strain CL Brener 60S ribosoma... 50 0.007
134gb|AF548328.1| Branchiostoma belcheri ribosomal protein L9 mRNA,... 50 0.007
135ref|XM_812671.1| Trypanosoma cruzi strain CL Brener 60S ribosoma... 50 0.007
136emb|AL161517.2|ATCHRIV29 Arabidopsis thaliana DNA chromosome 4, ... 50 0.007
137emb|AL049524.1|ATF7L13 Arabidopsis thaliana DNA chromosome 4, BA... 50 0.007
138emb|BX530083.11| Zebrafish DNA sequence from clone DKEY-3L17 in ... 50 0.007
139ref|XM_577847.1| PREDICTED: Rattus norvegicus similar to 60S rib... 50 0.007
140gb|AC161480.9| Mus musculus chromosome 15, clone RP23-404I10, co... 48 0.026
141gb|AC124678.7| Mus musculus chromosome 15, clone RP24-107K17, co... 48 0.026
142gb|AY130412.1| Petromyzon marinus ribosomal protein L9 mRNA, par... 48 0.026
143dbj|AK105332.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.026
144gb|AC110244.10| Mus musculus chromosome 5, clone RP23-247E10, co... 46 0.10
145gb|AY522617.1| Oreochromis mossambicus ribosomal protein L9-like... 46 0.10
146dbj|AK107388.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.10
147dbj|AP004977.1| Lotus japonicus genomic DNA, chromosome 3, clone... 46 0.10
148gb|BC086561.1| Rattus norvegicus ribosomal protein L9, mRNA (cDN... 44 0.40
149ref|XM_522512.1| PREDICTED: Pan troglodytes similar to KM-102-de... 44 0.40
150ref|XM_960709.1| Neurospora crassa OR74A hypothetical protein (N... 44 0.40
151ref|XM_324841.1| Neurospora crassa OR74A hypothetical protein (N... 44 0.40
152gb|AC158987.3| Mus musculus BAC clone RP23-366K1 from chromosome... 44 0.40
153ref|XR_003389.1| PREDICTED: Mus musculus similar to ribosomal pr... 44 0.40
154gb|AC125403.4| Mus musculus BAC clone RP23-4E15 from 1, complete... 44 0.40
155gb|AC112147.5| Mus musculus BAC clone RP23-175E16 from 9, comple... 44 0.40
156ref|XM_791421.1| PREDICTED: Strongylocentrotus purpuratus simila... 44 0.40
157emb|X51706.1|RRRPL9 Rat mRNA for ribosomal protein L9 44 0.40
158emb|AJ843878.1| Platichthys flesus mRNA for 60S ribosomal protei... 44 0.40
159emb|AJ421478.1| Mus musculus X-inactivation center region; segme... 44 0.40
160emb|BX813929.1|CNS0AC47 Arabidopsis thaliana Full-length cDNA Co... 44 0.40
161gb|AY130413.1| Scyliorhinus canicula ribosomal protein L9-like m... 44 0.40
162gb|AF391091.1| Spodoptera frugiperda ribosomal protein L9 mRNA, ... 44 0.40
163ref|XM_234521.2| PREDICTED: Rattus norvegicus similar to 60S rib... 44 0.40
164ref|XM_224924.2| PREDICTED: Rattus norvegicus similar to ribosom... 44 0.40
165ref|XM_223094.3| PREDICTED: Rattus norvegicus similar to 60S rib... 44 0.40
166ref|XM_221450.2| PREDICTED: Rattus norvegicus similar to 60S rib... 44 0.40
167ref|XM_345600.2| PREDICTED: Rattus norvegicus similar to 60S rib... 44 0.40
168dbj|AK204218.1| Mus musculus cDNA, clone:Y1G0147K13, strand:minu... 44 0.40
169dbj|AK173968.1| Ciona intestinalis cDNA, clone:ciad001f19, full ... 44 0.40
170emb|CT030181.13| Mouse DNA sequence from clone RP23-115A18 on ch... 44 0.40
171gb|AC133166.2| Mus musculus BAC clone RP24-186D13 from 1, comple... 44 0.40
172gb|AC138587.11| Mus musculus chromosome 9, clone RP24-160H16, co... 44 0.40
173emb|AL683845.15| Mouse DNA sequence from clone RP23-423B1 on chr... 44 0.40
174gb|DQ214109.1| Taeniopygia guttata clone 0058P0056F08 ribosomal ... 42 1.6
175gb|DQ214108.1| Taeniopygia guttata clone 0058P0018B08 ribosomal ... 42 1.6
176gb|DQ214107.1| Taeniopygia guttata clone 0061P0006A08 ribosomal ... 42 1.6
177gb|DQ214106.1| Taeniopygia guttata clone 0061P0015B05 ribosomal ... 42 1.6
178gb|DQ214105.1| Taeniopygia guttata clone 0058P0059H09 ribosomal ... 42 1.6
179gb|DQ214104.1| Taeniopygia guttata clone 0061P0008H06 ribosomal ... 42 1.6
180ref|XM_677359.1| Aspergillus nidulans FGSC A4 hypothetical prote... 42 1.6
181ref|XR_002731.1| PREDICTED: Mus musculus similar to 60S ribosoma... 42 1.6
182ref|XR_001972.1| PREDICTED: Mus musculus similar to 60S ribosoma... 42 1.6
183ref|XM_001000482.1| PREDICTED: Mus musculus RIKEN cDNA 4930401B1... 42 1.6
184ref|XM_993539.1| PREDICTED: Mus musculus RIKEN cDNA 4930401B11 g... 42 1.6
185ref|XM_986150.1| PREDICTED: Mus musculus RIKEN cDNA 4930401B11 g... 42 1.6
186ref|XM_817275.1| Trypanosoma brucei TREU927 60S ribosomal protei... 42 1.6
187emb|AL669948.8| Mouse DNA sequence from clone RP23-248K2 on chro... 42 1.6
188emb|AM049015.1| Meladema coriacea mRNA for ribosomal protein L9e... 42 1.6
189emb|CR713603.2|CNS0GDKF Tetraodon nigroviridis full-length cDNA 42 1.6
190emb|CR710996.2|CNS0GBK0 Tetraodon nigroviridis full-length cDNA 42 1.6
191emb|AL031644.1|SPCC613 S.pombe chromosome III cosmid c613 42 1.6
192emb|CR932039.2| Medicago truncatula chromosome 5 clone mth2-6h11... 42 1.6
193dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 42 1.6
194ref|NM_001022689.1| Schizosaccharomyces pombe 972h- hypothetical... 42 1.6
195ref|XM_309298.2| Anopheles gambiae str. PEST ENSANGP00000018425 ... 42 1.6
196emb|AL928604.9| Mouse DNA sequence from clone RP23-220K22 on chr... 42 1.6
197ref|NM_172863.2| Mus musculus zinc finger protein 697 (Zfp697), ... 40 6.3
198gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Ph... 40 6.3
199ref|XM_360693.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 6.3
200ref|XM_593641.2| PREDICTED: Bos taurus similar to zinc finger pr... 40 6.3
201ref|XM_983276.1| PREDICTED: Mus musculus similar to 60S ribosoma... 40 6.3
202ref|XM_910917.1| PREDICTED: Mus musculus similar to 60S ribosoma... 40 6.3
203ref|XM_621250.1| PREDICTED: Mus musculus similar to 60S ribosoma... 40 6.3
204ref|XM_755893.1| Ustilago maydis 521 hypothetical protein (UM048... 40 6.3
205ref|XM_380810.1| Gibberella zeae PH-1 chromosome 1 conserved hyp... 40 6.3
206emb|CR734261.2|CNS0GTC4 Tetraodon nigroviridis full-length cDNA 40 6.3
207emb|CR643175.2|CNS0EV8T Tetraodon nigroviridis full-length cDNA 40 6.3
208emb|CR734020.2|CNS0GT5F Tetraodon nigroviridis full-length cDNA 40 6.3
209emb|CR729736.3|CNS0GQ0E Tetraodon nigroviridis full-length cDNA 40 6.3
210emb|CR728488.2|CNS0GP1Q Tetraodon nigroviridis full-length cDNA 40 6.3
211emb|CR727712.2|CNS0GOG6 Tetraodon nigroviridis full-length cDNA 40 6.3
212emb|CR720190.2|CNS0GIN8 Tetraodon nigroviridis full-length cDNA 40 6.3
213emb|CR723145.2|CNS0GKXB Tetraodon nigroviridis full-length cDNA 40 6.3
214emb|CR722790.2|CNS0GKNG Tetraodon nigroviridis full-length cDNA 40 6.3
215emb|CR722547.2|CNS0GKGP Tetraodon nigroviridis full-length cDNA 40 6.3
216emb|CR721878.2|CNS0GJY4 Tetraodon nigroviridis full-length cDNA 40 6.3
217emb|CR721818.2|CNS0GJWG Tetraodon nigroviridis full-length cDNA 40 6.3
218emb|CR721507.2|CNS0GJNT Tetraodon nigroviridis full-length cDNA 40 6.3
219emb|CR721405.2|CNS0GJKZ Tetraodon nigroviridis full-length cDNA 40 6.3
220emb|CR719586.2|CNS0GI6G Tetraodon nigroviridis full-length cDNA 40 6.3
221emb|CR719506.2|CNS0GI48 Tetraodon nigroviridis full-length cDNA 40 6.3
222emb|CR719443.2|CNS0GI2H Tetraodon nigroviridis full-length cDNA 40 6.3
223emb|CR718873.2|CNS0GHMN Tetraodon nigroviridis full-length cDNA 40 6.3
224emb|CR718351.2|CNS0GH85 Tetraodon nigroviridis full-length cDNA 40 6.3
225emb|CR718349.2|CNS0GH83 Tetraodon nigroviridis full-length cDNA 40 6.3
226emb|CR718139.2|CNS0GH29 Tetraodon nigroviridis full-length cDNA 40 6.3
227emb|CR718048.2|CNS0GGZQ Tetraodon nigroviridis full-length cDNA 40 6.3
228emb|CR717531.2|CNS0GGLD Tetraodon nigroviridis full-length cDNA 40 6.3
229emb|CR717402.2|CNS0GGHS Tetraodon nigroviridis full-length cDNA 40 6.3
230emb|CR717342.2|CNS0GGG4 Tetraodon nigroviridis full-length cDNA 40 6.3
231emb|CR717312.2|CNS0GGFA Tetraodon nigroviridis full-length cDNA 40 6.3
232emb|CR716888.2|CNS0GG3L Tetraodon nigroviridis full-length cDNA 40 6.3
233emb|CR716644.2|CNS0GFWT Tetraodon nigroviridis full-length cDNA 40 6.3
234emb|CR716271.2|CNS0GFMG Tetraodon nigroviridis full-length cDNA 40 6.3
235emb|CR716057.2|CNS0GFGL Tetraodon nigroviridis full-length cDNA 40 6.3
236emb|CR715737.2|CNS0GF7P Tetraodon nigroviridis full-length cDNA 40 6.3
237emb|CR715478.2|CNS0GF0I Tetraodon nigroviridis full-length cDNA 40 6.3
238emb|CR713105.2|CNS0GD6L Tetraodon nigroviridis full-length cDNA 40 6.3
239emb|CR712105.2|CNS0GCET Tetraodon nigroviridis full-length cDNA 40 6.3
240emb|CR710960.2|CNS0GBJ0 Tetraodon nigroviridis full-length cDNA 40 6.3
241emb|CR710739.2|CNS0GBCV Tetraodon nigroviridis full-length cDNA 40 6.3
242emb|CR710686.2|CNS0GBBE Tetraodon nigroviridis full-length cDNA 40 6.3
243emb|CR710419.2|CNS0GB3Z Tetraodon nigroviridis full-length cDNA 40 6.3
244emb|CR710040.2|CNS0GATG Tetraodon nigroviridis full-length cDNA 40 6.3
245emb|CR709752.2|CNS0GALG Tetraodon nigroviridis full-length cDNA 40 6.3
246emb|CR709702.2|CNS0GAK2 Tetraodon nigroviridis full-length cDNA 40 6.3
247emb|CR709204.2|CNS0GA68 Tetraodon nigroviridis full-length cDNA 40 6.3
248emb|CR709020.2|CNS0GA14 Tetraodon nigroviridis full-length cDNA 40 6.3
249emb|CR708592.2|CNS0G9P8 Tetraodon nigroviridis full-length cDNA 40 6.3
250emb|CR708146.2|CNS0G9CU Tetraodon nigroviridis full-length cDNA 40 6.3
251emb|CR707430.2|CNS0G8SY Tetraodon nigroviridis full-length cDNA 40 6.3
252emb|CR707213.2|CNS0G8MX Tetraodon nigroviridis full-length cDNA 40 6.3
253emb|CR706008.2|CNS0G7PG Tetraodon nigroviridis full-length cDNA 40 6.3
254emb|CR706498.2|CNS0G832 Tetraodon nigroviridis full-length cDNA 40 6.3
255emb|CR706471.2|CNS0G82B Tetraodon nigroviridis full-length cDNA 40 6.3
256emb|CR706189.2|CNS0G7UH Tetraodon nigroviridis full-length cDNA 40 6.3
257emb|CR705768.2|CNS0G7IS Tetraodon nigroviridis full-length cDNA 40 6.3
258emb|CR705094.2|CNS0G702 Tetraodon nigroviridis full-length cDNA 40 6.3
259emb|CR705043.2|CNS0G6YN Tetraodon nigroviridis full-length cDNA 40 6.3
260emb|CR703327.2|CNS0G5MZ Tetraodon nigroviridis full-length cDNA 40 6.3
261emb|CR703303.2|CNS0G5MB Tetraodon nigroviridis full-length cDNA 40 6.3
262emb|CR702459.2|CNS0G4YV Tetraodon nigroviridis full-length cDNA 40 6.3
263emb|CR701780.2|CNS0G4G0 Tetraodon nigroviridis full-length cDNA 40 6.3
264emb|CR701111.2|CNS0G3XF Tetraodon nigroviridis full-length cDNA 40 6.3
265emb|CR700905.2|CNS0G3RP Tetraodon nigroviridis full-length cDNA 40 6.3
266emb|CR700313.2|CNS0G3B9 Tetraodon nigroviridis full-length cDNA 40 6.3
267emb|CR700144.2|CNS0G36K Tetraodon nigroviridis full-length cDNA 40 6.3
268emb|CR699134.2|CNS0G2EI Tetraodon nigroviridis full-length cDNA 40 6.3
269emb|CR699129.2|CNS0G2ED Tetraodon nigroviridis full-length cDNA 40 6.3
270emb|CR698899.2|CNS0G27Z Tetraodon nigroviridis full-length cDNA 40 6.3
271emb|CR698673.2|CNS0G21P Tetraodon nigroviridis full-length cDNA 40 6.3
272emb|CR696574.2|CNS0G0FE Tetraodon nigroviridis full-length cDNA 40 6.3
273emb|CR696129.2|CNS0G031 Tetraodon nigroviridis full-length cDNA 40 6.3
274emb|CR695477.2|CNS0FZKX Tetraodon nigroviridis full-length cDNA 40 6.3
275emb|CR694784.2|CNS0FZ1O Tetraodon nigroviridis full-length cDNA 40 6.3
276emb|CR694166.2|CNS0FYKI Tetraodon nigroviridis full-length cDNA 40 6.3
277emb|CR693862.2|CNS0FYC2 Tetraodon nigroviridis full-length cDNA 40 6.3
278emb|CR692565.2|CNS0FXC1 Tetraodon nigroviridis full-length cDNA 40 6.3
279emb|CR691164.2|CNS0FW94 Tetraodon nigroviridis full-length cDNA 40 6.3
280emb|CR690409.2|CNS0FVO5 Tetraodon nigroviridis full-length cDNA 40 6.3
281emb|CR689861.2|CNS0FV8X Tetraodon nigroviridis full-length cDNA 40 6.3
282emb|CR689836.2|CNS0FV88 Tetraodon nigroviridis full-length cDNA 40 6.3
283emb|CR689587.2|CNS0FV1B Tetraodon nigroviridis full-length cDNA 40 6.3
284emb|CR689400.2|CNS0FUW4 Tetraodon nigroviridis full-length cDNA 40 6.3
285emb|CR687851.2|CNS0FTP3 Tetraodon nigroviridis full-length cDNA 40 6.3
286emb|CR687800.2|CNS0FTNO Tetraodon nigroviridis full-length cDNA 40 6.3
287emb|CR684630.2|CNS0FR7M Tetraodon nigroviridis full-length cDNA 40 6.3
288emb|CR684141.2|CNS0FQU1 Tetraodon nigroviridis full-length cDNA 40 6.3
289emb|CR683916.2|CNS0FQNS Tetraodon nigroviridis full-length cDNA 40 6.3
290emb|CR683843.2|CNS0FQLR Tetraodon nigroviridis full-length cDNA 40 6.3
291emb|CR683788.2|CNS0FQK8 Tetraodon nigroviridis full-length cDNA 40 6.3
292emb|CR682908.2|CNS0FPVS Tetraodon nigroviridis full-length cDNA 40 6.3
293emb|CR681170.2|CNS0FOJI Tetraodon nigroviridis full-length cDNA 40 6.3
294emb|CR681111.2|CNS0FOHV Tetraodon nigroviridis full-length cDNA 40 6.3
295emb|CR679786.2|CNS0FNH2 Tetraodon nigroviridis full-length cDNA 40 6.3
296emb|CR679671.2|CNS0FNDV Tetraodon nigroviridis full-length cDNA 40 6.3
297emb|CR679251.2|CNS0FN27 Tetraodon nigroviridis full-length cDNA 40 6.3
298emb|CR679547.2|CNS0FNAF Tetraodon nigroviridis full-length cDNA 40 6.3
299emb|CR679126.2|CNS0FMYQ Tetraodon nigroviridis full-length cDNA 40 6.3
300emb|CR678997.2|CNS0FMV5 Tetraodon nigroviridis full-length cDNA 40 6.3
301emb|CR678607.2|CNS0FMKB Tetraodon nigroviridis full-length cDNA 40 6.3
302emb|CR677827.2|CNS0FLYZ Tetraodon nigroviridis full-length cDNA 40 6.3
303emb|CR677957.2|CNS0FM2L Tetraodon nigroviridis full-length cDNA 40 6.3
304emb|CR677952.2|CNS0FM2G Tetraodon nigroviridis full-length cDNA 40 6.3
305emb|CR677871.2|CNS0FM07 Tetraodon nigroviridis full-length cDNA 40 6.3
306emb|CR677205.2|CNS0FLHT Tetraodon nigroviridis full-length cDNA 40 6.3
307emb|CR676569.2|CNS0FL05 Tetraodon nigroviridis full-length cDNA 40 6.3
308emb|CR676516.2|CNS0FKYO Tetraodon nigroviridis full-length cDNA 40 6.3
309emb|CR676837.2|CNS0FL7L Tetraodon nigroviridis full-length cDNA 40 6.3
310emb|CR676789.2|CNS0FL69 Tetraodon nigroviridis full-length cDNA 40 6.3
311emb|CR676392.2|CNS0FKV8 Tetraodon nigroviridis full-length cDNA 40 6.3
312emb|CR676119.2|CNS0FKNX Tetraodon nigroviridis full-length cDNA 40 6.3
313emb|CR676048.2|CNS0FKLY Tetraodon nigroviridis full-length cDNA 40 6.3
314emb|CR675863.2|CNS0FKGT Tetraodon nigroviridis full-length cDNA 40 6.3
315emb|CR675524.2|CNS0FK7E Tetraodon nigroviridis full-length cDNA 40 6.3
316emb|CR674648.2|CNS0FJJ2 Tetraodon nigroviridis full-length cDNA 40 6.3
317emb|CR674466.2|CNS0FJE0 Tetraodon nigroviridis full-length cDNA 40 6.3
318emb|CR674138.2|CNS0FJ4W Tetraodon nigroviridis full-length cDNA 40 6.3
319emb|CR674099.2|CNS0FJ3T Tetraodon nigroviridis full-length cDNA 40 6.3
320emb|CR674064.2|CNS0FJ2U Tetraodon nigroviridis full-length cDNA 40 6.3
321emb|CR673117.2|CNS0FICJ Tetraodon nigroviridis full-length cDNA 40 6.3
322emb|CR672759.2|CNS0FI2L Tetraodon nigroviridis full-length cDNA 40 6.3
323emb|CR672667.2|CNS0FI01 Tetraodon nigroviridis full-length cDNA 40 6.3
324emb|CR672655.2|CNS0FHZP Tetraodon nigroviridis full-length cDNA 40 6.3
325emb|CR672230.2|CNS0FHNW Tetraodon nigroviridis full-length cDNA 40 6.3
326emb|CR672093.2|CNS0FHK3 Tetraodon nigroviridis full-length cDNA 40 6.3
327emb|CR672075.2|CNS0FHJL Tetraodon nigroviridis full-length cDNA 40 6.3
328emb|CR671371.2|CNS0FH01 Tetraodon nigroviridis full-length cDNA 40 6.3
329emb|CR670446.2|CNS0FGAC Tetraodon nigroviridis full-length cDNA 40 6.3
330emb|CR670175.2|CNS0FG2T Tetraodon nigroviridis full-length cDNA 40 6.3
331emb|CR670140.2|CNS0FG1U Tetraodon nigroviridis full-length cDNA 40 6.3
332emb|CR670013.2|CNS0FFYB Tetraodon nigroviridis full-length cDNA 40 6.3
333emb|CR669810.2|CNS0FFSO Tetraodon nigroviridis full-length cDNA 40 6.3
334emb|CR669691.2|CNS0FFPD Tetraodon nigroviridis full-length cDNA 40 6.3
335emb|CR669343.2|CNS0FFFP Tetraodon nigroviridis full-length cDNA 40 6.3
336emb|CR668568.2|CNS0FEU6 Tetraodon nigroviridis full-length cDNA 40 6.3
337emb|CR668338.2|CNS0FENS Tetraodon nigroviridis full-length cDNA 40 6.3
338emb|CR668331.2|CNS0FENL Tetraodon nigroviridis full-length cDNA 40 6.3
339emb|CR668134.2|CNS0FEI4 Tetraodon nigroviridis full-length cDNA 40 6.3
340emb|CR668008.2|CNS0FEEM Tetraodon nigroviridis full-length cDNA 40 6.3
341emb|CR667323.2|CNS0FDVL Tetraodon nigroviridis full-length cDNA 40 6.3
342emb|CR666162.2|CNS0FCZC Tetraodon nigroviridis full-length cDNA 40 6.3
343emb|CR666121.2|CNS0FCY7 Tetraodon nigroviridis full-length cDNA 40 6.3
344emb|CR665440.2|CNS0FCFA Tetraodon nigroviridis full-length cDNA 40 6.3
345emb|CR665319.2|CNS0FCBX Tetraodon nigroviridis full-length cDNA 40 6.3
346emb|CR665277.2|CNS0FCAR Tetraodon nigroviridis full-length cDNA 40 6.3
347emb|CR665194.2|CNS0FC8G Tetraodon nigroviridis full-length cDNA 40 6.3
348emb|CR664731.2|CNS0FBVL Tetraodon nigroviridis full-length cDNA 40 6.3
349emb|CR664719.2|CNS0FBV9 Tetraodon nigroviridis full-length cDNA 40 6.3
350emb|CR664051.2|CNS0FBCP Tetraodon nigroviridis full-length cDNA 40 6.3
351emb|CR663337.2|CNS0FASV Tetraodon nigroviridis full-length cDNA 40 6.3
352emb|CR663199.2|CNS0FAP1 Tetraodon nigroviridis full-length cDNA 40 6.3
353emb|CR663113.2|CNS0FAMN Tetraodon nigroviridis full-length cDNA 40 6.3
354emb|CR662524.2|CNS0FA6A Tetraodon nigroviridis full-length cDNA 40 6.3
355emb|CR662438.2|CNS0FA3W Tetraodon nigroviridis full-length cDNA 40 6.3
356emb|CR662420.2|CNS0FA3E Tetraodon nigroviridis full-length cDNA 40 6.3
357emb|CR661588.2|CNS0F9GA Tetraodon nigroviridis full-length cDNA 40 6.3
358emb|CR661394.2|CNS0F9AW Tetraodon nigroviridis full-length cDNA 40 6.3
359emb|CR660923.2|CNS0F8XT Tetraodon nigroviridis full-length cDNA 40 6.3
360emb|CR660741.2|CNS0F8SR Tetraodon nigroviridis full-length cDNA 40 6.3
361emb|CR660526.2|CNS0F8MS Tetraodon nigroviridis full-length cDNA 40 6.3
362emb|CR660442.2|CNS0F8KG Tetraodon nigroviridis full-length cDNA 40 6.3
363emb|CR660313.2|CNS0F8GV Tetraodon nigroviridis full-length cDNA 40 6.3
364emb|CR660076.2|CNS0F8AA Tetraodon nigroviridis full-length cDNA 40 6.3
365emb|CR659172.2|CNS0F7L6 Tetraodon nigroviridis full-length cDNA 40 6.3
366emb|CR658635.2|CNS0F769 Tetraodon nigroviridis full-length cDNA 40 6.3
367emb|CR658571.2|CNS0F74H Tetraodon nigroviridis full-length cDNA 40 6.3
368emb|CR658476.2|CNS0F71U Tetraodon nigroviridis full-length cDNA 40 6.3
369emb|CR658140.2|CNS0F6SI Tetraodon nigroviridis full-length cDNA 40 6.3
370emb|CR657447.2|CNS0F699 Tetraodon nigroviridis full-length cDNA 40 6.3
371emb|CR656864.2|CNS0F5T2 Tetraodon nigroviridis full-length cDNA 40 6.3
372emb|CR656700.2|CNS0F5OI Tetraodon nigroviridis full-length cDNA 40 6.3
373emb|CR656574.2|CNS0F5L0 Tetraodon nigroviridis full-length cDNA 40 6.3
374emb|CR655211.2|CNS0F4J5 Tetraodon nigroviridis full-length cDNA 40 6.3
375emb|CR656250.2|CNS0F5C0 Tetraodon nigroviridis full-length cDNA 40 6.3
376emb|CR655072.2|CNS0F4FA Tetraodon nigroviridis full-length cDNA 40 6.3
377emb|CR654742.2|CNS0F464 Tetraodon nigroviridis full-length cDNA 40 6.3
378emb|CR653540.2|CNS0F38Q Tetraodon nigroviridis full-length cDNA 40 6.3
379emb|CR653337.2|CNS0F333 Tetraodon nigroviridis full-length cDNA 40 6.3
380emb|CR652902.2|CNS0F2R0 Tetraodon nigroviridis full-length cDNA 40 6.3
381emb|CR650735.2|CNS0F12T Tetraodon nigroviridis full-length cDNA 40 6.3
382emb|CR651123.2|CNS0F1DL Tetraodon nigroviridis full-length cDNA 40 6.3
383emb|CR648502.2|CNS0EZCS Tetraodon nigroviridis full-length cDNA 40 6.3
384emb|CR648424.2|CNS0EZAM Tetraodon nigroviridis full-length cDNA 40 6.3
385emb|CR650197.2|CNS0F0NV Tetraodon nigroviridis full-length cDNA 40 6.3
386emb|CR648994.2|CNS0EZQG Tetraodon nigroviridis full-length cDNA 40 6.3
387emb|CR646853.2|CNS0EY2Z Tetraodon nigroviridis full-length cDNA 40 6.3
388emb|CR646773.2|CNS0EY0R Tetraodon nigroviridis full-length cDNA 40 6.3
389emb|CR643105.2|CNS0EV6V Tetraodon nigroviridis full-length cDNA 40 6.3
390emb|CR646562.2|CNS0EXUW Tetraodon nigroviridis full-length cDNA 40 6.3
391emb|CR646450.2|CNS0EXRS Tetraodon nigroviridis full-length cDNA 40 6.3
392emb|CR646324.2|CNS0EXOA Tetraodon nigroviridis full-length cDNA 40 6.3
393emb|CR645875.2|CNS0EXBT Tetraodon nigroviridis full-length cDNA 40 6.3
394emb|CR645620.2|CNS0EX4Q Tetraodon nigroviridis full-length cDNA 40 6.3
395emb|CR643710.2|CNS0EVNO Tetraodon nigroviridis full-length cDNA 40 6.3
396emb|CR642736.2|CNS0EUWM Tetraodon nigroviridis full-length cDNA 40 6.3
397emb|CR642685.2|CNS0EUV7 Tetraodon nigroviridis full-length cDNA 40 6.3
398emb|CR642648.2|CNS0EUU6 Tetraodon nigroviridis full-length cDNA 40 6.3
399emb|CR642631.2|CNS0EUTP Tetraodon nigroviridis full-length cDNA 40 6.3
400emb|CR642497.2|CNS0EUPZ Tetraodon nigroviridis full-length cDNA 40 6.3
401emb|CR642065.2|CNS0EUDZ Tetraodon nigroviridis full-length cDNA 40 6.3
402emb|CR641619.2|CNS0EU1L Tetraodon nigroviridis full-length cDNA 40 6.3
403emb|CR641028.2|CNS0ETL6 Tetraodon nigroviridis full-length cDNA 40 6.3
404emb|CR640999.2|CNS0ETKD Tetraodon nigroviridis full-length cDNA 40 6.3
405emb|CR640368.2|CNS0ET2U Tetraodon nigroviridis full-length cDNA 40 6.3
406emb|CR638820.2|CNS0ERVU Tetraodon nigroviridis full-length cDNA 40 6.3
407emb|CR638166.2|CNS0ERDO Tetraodon nigroviridis full-length cDNA 40 6.3
408emb|CR637917.2|CNS0ER6R Tetraodon nigroviridis full-length cDNA 40 6.3
409emb|CR637287.2|CNS0EQP9 Tetraodon nigroviridis full-length cDNA 40 6.3
410emb|CR637461.2|CNS0EQU3 Tetraodon nigroviridis full-length cDNA 40 6.3
411emb|CR636762.2|CNS0EQAO Tetraodon nigroviridis full-length cDNA 40 6.3
412emb|CR634946.2|CNS0EOW8 Tetraodon nigroviridis full-length cDNA 40 6.3
413emb|CR635195.2|CNS0EP35 Tetraodon nigroviridis full-length cDNA 40 6.3
414emb|CR634346.2|CNS0EOFK Tetraodon nigroviridis full-length cDNA 40 6.3
415emb|CR634206.2|CNS0EOBO Tetraodon nigroviridis full-length cDNA 40 6.3
416emb|CR633673.2|CNS0ENWV Tetraodon nigroviridis full-length cDNA 40 6.3
417emb|CR633331.2|CNS0ENND Tetraodon nigroviridis full-length cDNA 40 6.3
418emb|CR633315.2|CNS0ENMX Tetraodon nigroviridis full-length cDNA 40 6.3
419emb|CR632685.2|CNS0EN5F Tetraodon nigroviridis full-length cDNA 40 6.3
420emb|CR632606.2|CNS0EN38 Tetraodon nigroviridis full-length cDNA 40 6.3
421emb|CR631211.2|CNS0EM0G Tetraodon nigroviridis full-length cDNA 40 6.3
422emb|CR631178.2|CNS0ELZJ Tetraodon nigroviridis full-length cDNA 40 6.3
423emb|CR632262.2|CNS0EMTO Tetraodon nigroviridis full-length cDNA 40 6.3
424emb|CR631888.2|CNS0EMJA Tetraodon nigroviridis full-length cDNA 40 6.3
425emb|CR631494.2|CNS0EM8C Tetraodon nigroviridis full-length cDNA 40 6.3
426emb|CR631397.2|CNS0EM5M Tetraodon nigroviridis full-length cDNA 40 6.3
427emb|CR631393.2|CNS0EM5I Tetraodon nigroviridis full-length cDNA 40 6.3
428emb|CR631591.2|CNS0EMB1 Tetraodon nigroviridis full-length cDNA 40 6.3
429emb|CR631589.2|CNS0EMAZ Tetraodon nigroviridis full-length cDNA 40 6.3
430gb|BC092534.1| Mus musculus zinc finger protein 697, mRNA (cDNA ... 40 6.3
431emb|AL596095.18| Mouse DNA sequence from clone RP23-188H3 on chr... 40 6.3
432emb|BX470191.8| Zebrafish DNA sequence from clone CH211-89N7 in ... 40 6.3
433gb|CP000133.1| Rhizobium etli CFN 42, complete genome 40 6.3
434gb|AC116664.1| Papio hamadryas, clone RP41-57E23, complete sequence 40 6.3
435gb|AC018995.7| Homo sapiens chromosome 8, clone RP11-652L3, comp... 40 6.3
436dbj|AK034880.1| Mus musculus 12 days embryo embryonic body betwe... 40 6.3
437gb|AF401562.1| Ictalurus punctatus ribosomal protein L9 mRNA, co... 40 6.3
438ref|XM_227502.3| PREDICTED: Rattus norvegicus similar to hypothe... 40 6.3
439dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 40 6.3
440gb|AE000666.1| Methanothermobacter thermautotrophicus str. Delta... 40 6.3
441gb|AC132475.4| Mus musculus BAC clone RP23-114P16 from 3, comple... 40 6.3
442emb|AL935285.6| Zebrafish DNA sequence from clone DKEY-37A1, com... 40 6.3
443dbj|AP004957.1| Lotus japonicus genomic DNA, chromosome 2, clone... 40 6.3
444gb|AC139379.4| Mus musculus BAC clone RP23-233P1 from chromosome... 40 6.3
445gb|AC161053.5| Mus musculus BAC clone RP23-381G13 from chromosom... 40 6.3

>ref|XM_463799.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 823

 Score =  351 bits (177), Expect = 1e-93
 Identities = 294/334 (88%), Gaps = 1/334 (0%)
 Strand = Plus / Minus

                                                                       
Query: 135 tgatggcgcccttgtcgctgacatagatgccgtccaggaacttcctgatgtccttgttct 194
           |||||| ||||||||| |||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 646 tgatggtgcccttgtcactgacatagatgccatccaggaacttcctgatatccttgttct 587

                                                                       
Query: 195 tcacgtggcatttctggttgatcagggcagcagagcgggagacaagctcaatgtcattgc 254
           | ||||||||||||||||||||||| || ||||| |||||||||||||| || |||||||
Sbjct: 586 tgacgtggcatttctggttgatcagtgccgcagaacgggagacaagctcgatatcattgc 527

                                                                       
Query: 255 catccaggacgatctcgtccttgaccttctcggaccgcaggattgtcacaccgtcaagca 314
           |||| ||||| | ||| |||||||||||||| || ||||  ||||||||||| |||||||
Sbjct: 526 catcaaggaccagctcatccttgaccttctcagaacgcaaaattgtcacaccctcaagca 467

                                                                       
Query: 315 tgtcaactttccttaccnnnnnnnctccgaggaagttcctgatctcgatgccgcggttgg 374
           |||| |||||||| |||       | |||||||||||||||||||||||| ||  |||||
Sbjct: 466 tgtccactttcctcaccttcttctcgccgaggaagttcctgatctcgatggcggtgttgg 407

                                                                       
Query: 375 cttgcggtgatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcgg 434
             |  ||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 406 agt-tggtgatggaggcgttgatggggaaatgggcatagacgaagcgcatcttgtagcgg 348

                                             
Query: 435 aagcccttggtgacgccggtgatgaggttctgga 468
            |||||||||||||||||||||||||||||||||
Sbjct: 347 tagcccttggtgacgccggtgatgaggttctgga 314



to top

>ref|XM_506675.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1435_F07.31
           mRNA
          Length = 914

 Score =  351 bits (177), Expect = 1e-93
 Identities = 294/334 (88%), Gaps = 1/334 (0%)
 Strand = Plus / Minus

                                                                       
Query: 135 tgatggcgcccttgtcgctgacatagatgccgtccaggaacttcctgatgtccttgttct 194
           |||||| ||||||||| |||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 651 tgatggtgcccttgtcactgacatagatgccatccaggaacttcctgatatccttgttct 592

                                                                       
Query: 195 tcacgtggcatttctggttgatcagggcagcagagcgggagacaagctcaatgtcattgc 254
           | ||||||||||||||||||||||| || ||||| |||||||||||||| || |||||||
Sbjct: 591 tgacgtggcatttctggttgatcagtgccgcagaacgggagacaagctcgatatcattgc 532

                                                                       
Query: 255 catccaggacgatctcgtccttgaccttctcggaccgcaggattgtcacaccgtcaagca 314
           |||| ||||| | ||| |||||||||||||| || ||||  ||||||||||| |||||||
Sbjct: 531 catcaaggaccagctcatccttgaccttctcagaacgcaaaattgtcacaccctcaagca 472

                                                                       
Query: 315 tgtcaactttccttaccnnnnnnnctccgaggaagttcctgatctcgatgccgcggttgg 374
           |||| |||||||| |||       | |||||||||||||||||||||||| ||  |||||
Sbjct: 471 tgtccactttcctcaccttcttctcgccgaggaagttcctgatctcgatggcggtgttgg 412

                                                                       
Query: 375 cttgcggtgatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcgg 434
             |  ||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 411 agt-tggtgatggaggcgttgatggggaaatgggcatagacgaagcgcatcttgtagcgg 353

                                             
Query: 435 aagcccttggtgacgccggtgatgaggttctgga 468
            |||||||||||||||||||||||||||||||||
Sbjct: 352 tagcccttggtgacgccggtgatgaggttctgga 319



to top

>dbj|AK102186.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086N17, full
           insert sequence
          Length = 914

 Score =  351 bits (177), Expect = 1e-93
 Identities = 294/334 (88%), Gaps = 1/334 (0%)
 Strand = Plus / Minus

                                                                       
Query: 135 tgatggcgcccttgtcgctgacatagatgccgtccaggaacttcctgatgtccttgttct 194
           |||||| ||||||||| |||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 651 tgatggtgcccttgtcactgacatagatgccatccaggaacttcctgatatccttgttct 592

                                                                       
Query: 195 tcacgtggcatttctggttgatcagggcagcagagcgggagacaagctcaatgtcattgc 254
           | ||||||||||||||||||||||| || ||||| |||||||||||||| || |||||||
Sbjct: 591 tgacgtggcatttctggttgatcagtgccgcagaacgggagacaagctcgatatcattgc 532

                                                                       
Query: 255 catccaggacgatctcgtccttgaccttctcggaccgcaggattgtcacaccgtcaagca 314
           |||| ||||| | ||| |||||||||||||| || ||||  ||||||||||| |||||||
Sbjct: 531 catcaaggaccagctcatccttgaccttctcagaacgcaaaattgtcacaccctcaagca 472

                                                                       
Query: 315 tgtcaactttccttaccnnnnnnnctccgaggaagttcctgatctcgatgccgcggttgg 374
           |||| |||||||| |||       | |||||||||||||||||||||||| ||  |||||
Sbjct: 471 tgtccactttcctcaccttcttctcgccgaggaagttcctgatctcgatggcggtgttgg 412

                                                                       
Query: 375 cttgcggtgatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcgg 434
             |  ||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 411 agt-tggtgatggaggcgttgatggggaaatgggcatagacgaagcgcatcttgtagcgg 353

                                             
Query: 435 aagcccttggtgacgccggtgatgaggttctgga 468
            |||||||||||||||||||||||||||||||||
Sbjct: 352 tagcccttggtgacgccggtgatgaggttctgga 319



to top

>dbj|AK062502.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-104-A12, full
           insert sequence
          Length = 823

 Score =  351 bits (177), Expect = 1e-93
 Identities = 294/334 (88%), Gaps = 1/334 (0%)
 Strand = Plus / Minus

                                                                       
Query: 135 tgatggcgcccttgtcgctgacatagatgccgtccaggaacttcctgatgtccttgttct 194
           |||||| ||||||||| |||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 646 tgatggtgcccttgtcactgacatagatgccatccaggaacttcctgatatccttgttct 587

                                                                       
Query: 195 tcacgtggcatttctggttgatcagggcagcagagcgggagacaagctcaatgtcattgc 254
           | ||||||||||||||||||||||| || ||||| |||||||||||||| || |||||||
Sbjct: 586 tgacgtggcatttctggttgatcagtgccgcagaacgggagacaagctcgatatcattgc 527

                                                                       
Query: 255 catccaggacgatctcgtccttgaccttctcggaccgcaggattgtcacaccgtcaagca 314
           |||| ||||| | ||| |||||||||||||| || ||||  ||||||||||| |||||||
Sbjct: 526 catcaaggaccagctcatccttgaccttctcagaacgcaaaattgtcacaccctcaagca 467

                                                                       
Query: 315 tgtcaactttccttaccnnnnnnnctccgaggaagttcctgatctcgatgccgcggttgg 374
           |||| |||||||| |||       | |||||||||||||||||||||||| ||  |||||
Sbjct: 466 tgtccactttcctcaccttcttctcgccgaggaagttcctgatctcgatggcggtgttgg 407

                                                                       
Query: 375 cttgcggtgatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcgg 434
             |  ||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 406 agt-tggtgatggaggcgttgatggggaaatgggcatagacgaagcgcatcttgtagcgg 348

                                             
Query: 435 aagcccttggtgacgccggtgatgaggttctgga 468
            |||||||||||||||||||||||||||||||||
Sbjct: 347 tagcccttggtgacgccggtgatgaggttctgga 314



to top

>gb|AY323481.1| Oryza sativa (japonica cultivar-group) ribosomal L9-like protein
           mRNA, complete cds
          Length = 797

 Score =  295 bits (149), Expect = 7e-77
 Identities = 281/326 (86%), Gaps = 1/326 (0%)
 Strand = Plus / Minus

                                                                       
Query: 143 cccttgtcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtgg 202
           ||||||||||| || ||||| || |||| |||||||||||| ||||||||||||||||||
Sbjct: 613 cccttgtcgctcacgtagataccatccaagaacttcctgatatccttgttcttcacgtgg 554

                                                                       
Query: 203 catttctggttgatcagggcagcagagcgggagacaagctcaatgtcattgccatccagg 262
           |||||||||||||| ||||| || ||||| ||||| ||||| ||||| ||||| || |||
Sbjct: 553 catttctggttgatgagggctgctgagcgagagacgagctcgatgtcgttgccgtcgagg 494

                                                                       
Query: 263 acgatctcgtccttgaccttctcggaccgcaggattgtcacaccgtcaagcatgtcaact 322
           |||| ||||||||| |||||||| ||||||| ||| ||||| || || ||||||||||| 
Sbjct: 493 acgagctcgtccttcaccttctccgaccgcaagatggtcaccccctcgagcatgtcaacc 434

                                                                       
Query: 323 ttccttaccnnnnnnnctccgaggaagttcctgatctcgatgccgcggttggcttgcggt 382
           ||||| |||       | || | ||||||||||||||||||| ||  |||||  |  |||
Sbjct: 433 ttcctcaccttcttctcgcccaagaagttcctgatctcgatggcggtgttggagt-tggt 375

                                                                       
Query: 383 gatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccctt 442
           |||||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||
Sbjct: 374 gatggaggcgttgatggggaagtgagcgtagacgaagcgcatcttgtagcggtagccctt 315

                                     
Query: 443 ggtgacgccggtgatgaggttctgga 468
           ||||||||||||||||||||||||||
Sbjct: 314 ggtgacgccggtgatgaggttctgga 289



to top

>dbj|AK064936.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000P02, full
           insert sequence
          Length = 886

 Score =  295 bits (149), Expect = 7e-77
 Identities = 281/326 (86%), Gaps = 1/326 (0%)
 Strand = Plus / Minus

                                                                       
Query: 143 cccttgtcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtgg 202
           ||||||||||| || ||||| || |||| |||||||||||| ||||||||||||||||||
Sbjct: 630 cccttgtcgctcacgtagataccatccaagaacttcctgatatccttgttcttcacgtgg 571

                                                                       
Query: 203 catttctggttgatcagggcagcagagcgggagacaagctcaatgtcattgccatccagg 262
           |||||||||||||| ||||| || ||||| ||||| ||||| ||||| ||||| || |||
Sbjct: 570 catttctggttgatgagggctgctgagcgagagacgagctcgatgtcgttgccgtcgagg 511

                                                                       
Query: 263 acgatctcgtccttgaccttctcggaccgcaggattgtcacaccgtcaagcatgtcaact 322
           |||| ||||||||| |||||||| ||||||| ||| ||||| || || ||||||||||| 
Sbjct: 510 acgagctcgtccttcaccttctccgaccgcaagatggtcaccccctcgagcatgtcaacc 451

                                                                       
Query: 323 ttccttaccnnnnnnnctccgaggaagttcctgatctcgatgccgcggttggcttgcggt 382
           ||||| |||       | || | ||||||||||||||||||| ||  |||||  |  |||
Sbjct: 450 ttcctcaccttcttctcgcccaagaagttcctgatctcgatggcggtgttggagt-tggt 392

                                                                       
Query: 383 gatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccctt 442
           |||||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||
Sbjct: 391 gatggaggcgttgatggggaagtgagcgtagacgaagcgcatcttgtagcggtagccctt 332

                                     
Query: 443 ggtgacgccggtgatgaggttctgga 468
           ||||||||||||||||||||||||||
Sbjct: 331 ggtgacgccggtgatgaggttctgga 306



to top

>dbj|D83527.1|RICGA3 Rice (YK426) mRNA, complete cds
          Length = 816

 Score =  295 bits (149), Expect = 7e-77
 Identities = 281/326 (86%), Gaps = 1/326 (0%)
 Strand = Plus / Minus

                                                                       
Query: 143 cccttgtcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtgg 202
           ||||||||||| || ||||| || |||| |||||||||||| ||||||||||||||||||
Sbjct: 626 cccttgtcgctcacgtagataccatccaagaacttcctgatatccttgttcttcacgtgg 567

                                                                       
Query: 203 catttctggttgatcagggcagcagagcgggagacaagctcaatgtcattgccatccagg 262
           |||||||||||||| ||||| || ||||| ||||| ||||| ||||| ||||| || |||
Sbjct: 566 catttctggttgatgagggctgctgagcgagagacgagctcgatgtcgttgccgtcgagg 507

                                                                       
Query: 263 acgatctcgtccttgaccttctcggaccgcaggattgtcacaccgtcaagcatgtcaact 322
           |||| ||||||||| |||||||| ||||||| ||| ||||| || || ||||||||||| 
Sbjct: 506 acgagctcgtccttcaccttctccgaccgcaagatggtcaccccctcgagcatgtcaacc 447

                                                                       
Query: 323 ttccttaccnnnnnnnctccgaggaagttcctgatctcgatgccgcggttggcttgcggt 382
           ||||| |||       | || | ||||||||||||||||||| ||  |||||  |  |||
Sbjct: 446 ttcctcaccttcttctcgcccaagaagttcctgatctcgatggcggtgttggagt-tggt 388

                                                                       
Query: 383 gatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccctt 442
           |||||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||
Sbjct: 387 gatggaggcgttgatggggaagtgagcgtagacgaagcgcatcttgtagcggtagccctt 328

                                     
Query: 443 ggtgacgccggtgatgaggttctgga 468
           ||||||||||||||||||||||||||
Sbjct: 327 ggtgacgccggtgatgaggttctgga 302



to top

>dbj|D38012.1|RICRPL9 Oryza sativa (japonica cultivar-group) mRNA for ribosomal protein
           L9, partial cds
          Length = 527

 Score =  240 bits (121), Expect = 3e-60
 Identities = 201/230 (87%)
 Strand = Plus / Minus

                                                                       
Query: 135 tgatggcgcccttgtcgctgacatagatgccgtccaggaacttcctgatgtccttgttct 194
           |||||| ||||||||| |||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 261 tgatggtgcccttgtcactgacatagatgccatccaggaacttcctgatatccttgttct 202

                                                                       
Query: 195 tcacgtggcatttctggttgatcagggcagcagagcgggagacaagctcaatgtcattgc 254
           | ||||||||||||||||||||||| || ||||| |||||||||||||| || |||||||
Sbjct: 201 tgacgtggcatttctggttgatcagtgccgcagaacgggagacaagctcgatatcattgc 142

                                                                       
Query: 255 catccaggacgatctcgtccttgaccttctcggaccgcaggattgtcacaccgtcaagca 314
           |||| ||||| | ||| |||||||||||||| || ||||  ||||||||||| |||||||
Sbjct: 141 catcaaggaccagctcatccttgaccttctcagaacgcaaaattgtcacaccctcaagca 82

                                                             
Query: 315 tgtcaactttccttaccnnnnnnnctccgaggaagttcctgatctcgatg 364
           |||| |||||||| |||       | ||||||||||||||||||||||||
Sbjct: 81  tgtccactttcctcaccttcttctcgccgaggaagttcctgatctcgatg 32



to top

>gb|BT016425.1| Zea mays clone Contig258 mRNA sequence
          Length = 1002

 Score =  238 bits (120), Expect = 1e-59
 Identities = 279/333 (83%), Gaps = 1/333 (0%)
 Strand = Plus / Minus

                                                                       
Query: 136 gatggcgcccttgtcgctgacatagatgccgtccaggaacttcctgatgtccttgttctt 195
           ||||| ||||||||| || |||||||| ||||||| |||||||| ||| ||||| |||||
Sbjct: 614 gatggggcccttgtcactcacatagataccgtccaagaacttccggatatccttcttctt 555

                                                                       
Query: 196 cacgtggcatttctggttgatcagggcagcagagcgggagacaagctcaatgtcattgcc 255
            || |||||||||||||| || || ||||| ||||| |||||||||||||  ||||||||
Sbjct: 554 gacatggcatttctggtttatgagagcagcggagcgagagacaagctcaacatcattgcc 495

                                                                       
Query: 256 atccaggacgatctcgtccttgaccttctcggaccgcaggattgtcacaccgtcaagcat 315
            || || || | ||| |||||||||||||| || |||| ||| |||||||| ||||||||
Sbjct: 494 ttcaagaacaagctcatccttgaccttctctgaacgcaagatggtcacaccttcaagcat 435

                                                                       
Query: 316 gtcaactttccttaccnnnnnnnctccgaggaagttcctgatctcgatgccgcggttggc 375
            ||||| ||||| |||       | ||||||||||| |||||||| ||| ||  ||||||
Sbjct: 434 atcaaccttcctgaccttcttctccccgaggaagtttctgatctcaatggcggagttggc 375

                                                                       
Query: 376 ttgcggtgatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcgga 435
            |  ||||||||| ||||||||||| ||||| ||||||||||| ||||||||||||||||
Sbjct: 374 gt-tggtgatggaggcgttgatgggaaagtgagcgtagacgaaccgcatcttgtagcgga 316

                                            
Query: 436 agcccttggtgacgccggtgatgaggttctgga 468
           | |||||||||||||| | ||||||||||||||
Sbjct: 315 aacccttggtgacgcctgcgatgaggttctgga 283



to top

>gb|AY107309.1| Zea mays PCO113532 mRNA sequence
          Length = 1063

 Score =  238 bits (120), Expect = 1e-59
 Identities = 279/333 (83%), Gaps = 1/333 (0%)
 Strand = Plus / Minus

                                                                       
Query: 136 gatggcgcccttgtcgctgacatagatgccgtccaggaacttcctgatgtccttgttctt 195
           ||||| ||||||||| || |||||||| ||||||| |||||||| ||| ||||| |||||
Sbjct: 711 gatggggcccttgtcactcacatagataccgtccaagaacttccggatatccttcttctt 652

                                                                       
Query: 196 cacgtggcatttctggttgatcagggcagcagagcgggagacaagctcaatgtcattgcc 255
            || |||||||||||||| || || ||||| ||||| |||||||||||||  ||||||||
Sbjct: 651 gacatggcatttctggtttatgagagcagcggagcgagagacaagctcaacatcattgcc 592

                                                                       
Query: 256 atccaggacgatctcgtccttgaccttctcggaccgcaggattgtcacaccgtcaagcat 315
            || || || | ||| |||||||||||||| || |||| ||| |||||||| ||||||||
Sbjct: 591 ttcaagaacaagctcatccttgaccttctctgaacgcaagatggtcacaccttcaagcat 532

                                                                       
Query: 316 gtcaactttccttaccnnnnnnnctccgaggaagttcctgatctcgatgccgcggttggc 375
            ||||| ||||| |||       | ||||||||||| |||||||| ||| ||  ||||||
Sbjct: 531 atcaaccttcctgaccttcttctccccgaggaagtttctgatctcaatggcggagttggc 472

                                                                       
Query: 376 ttgcggtgatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcgga 435
            |  ||||||||| ||||||||||| ||||| ||||||||||| ||||||||||||||||
Sbjct: 471 gt-tggtgatggaggcgttgatgggaaagtgagcgtagacgaaccgcatcttgtagcgga 413

                                            
Query: 436 agcccttggtgacgccggtgatgaggttctgga 468
           | |||||||||||||| | ||||||||||||||
Sbjct: 412 aacccttggtgacgcctgcgatgaggttctgga 380



to top

>gb|BT016560.1| Zea mays clone Contig393 mRNA sequence
          Length = 747

 Score =  230 bits (116), Expect = 3e-57
 Identities = 278/333 (83%), Gaps = 1/333 (0%)
 Strand = Plus / Minus

                                                                       
Query: 136 gatggcgcccttgtcgctgacatagatgccgtccaggaacttcctgatgtccttgttctt 195
           |||| ||||||||||||| |||||||| |||||||  ||||| | ||| ||||| |||||
Sbjct: 605 gatgacgcccttgtcgctcacatagataccgtccaaaaactttcggatatccttcttctt 546

                                                                       
Query: 196 cacgtggcatttctggttgatcagggcagcagagcgggagacaagctcaatgtcattgcc 255
           ||| ||||||||||||||||| ||||| || ||||| || || ||||| | ||| || ||
Sbjct: 545 cacatggcatttctggttgatgagggcggcggagcgagatacgagctcgacgtcgtttcc 486

                                                                       
Query: 256 atccaggacgatctcgtccttgaccttctcggaccgcaggattgtcacaccgtcaagcat 315
            || |||| || ||| |||||||||||||||||||| ||||| ||||| || ||||||||
Sbjct: 485 gtcaaggatgagctcatccttgaccttctcggaccggaggatggtcacgccatcaagcat 426

                                                                       
Query: 316 gtcaactttccttaccnnnnnnnctccgaggaagttcctgatctcgatgccgcggttggc 375
           ||| || ||||| |||       | |||||||||||||||||||||||  ||  ||| ||
Sbjct: 425 gtccaccttcctgaccttcttctcgccgaggaagttcctgatctcgattgcggtgtt-gc 367

                                                                       
Query: 376 ttgcggtgatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcgga 435
           |   ||||||||| ||||||||||||||||||||||||||||| | ||||||||||||| 
Sbjct: 366 tgttggtgatggaggcgttgatggggaagtgggcgtagacgaacctcatcttgtagcggt 307

                                            
Query: 436 agcccttggtgacgccggtgatgaggttctgga 468
           ||||||||||||| ||  |||||||||||||||
Sbjct: 306 agcccttggtgacccccttgatgaggttctgga 274



to top

>gb|AY104547.1| Zea mays PCO113533 mRNA sequence
          Length = 927

 Score =  216 bits (109), Expect = 5e-53
 Identities = 271/326 (83%), Gaps = 1/326 (0%)
 Strand = Plus / Minus

                                                                       
Query: 143 cccttgtcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtgg 202
           ||||||||||| |||||||| || ||||  ||||||||||| ||||| ||||| || |||
Sbjct: 679 cccttgtcgctcacatagataccatccaaaaacttcctgatatccttcttcttgacatgg 620

                                                                       
Query: 203 catttctggttgatcagggcagcagagcgggagacaagctcaatgtcattgccatccagg 262
           |||||||||||||| ||||| || ||||| ||||| | ||| | ||| |||||||| || 
Sbjct: 619 catttctggttgatgagggcggcggagcgagagactaactcgacgtcgttgccatcgaga 560

                                                                       
Query: 263 acgatctcgtccttgaccttctcggaccgcaggattgtcacaccgtcaagcatgtcaact 322
           |  | ||||||||||||||||||||| || ||||| ||||| |||||||||||||| || 
Sbjct: 559 ataagctcgtccttgaccttctcggagcggaggatggtcacgccgtcaagcatgtccacc 500

                                                                       
Query: 323 ttccttaccnnnnnnnctccgaggaagttcctgatctcgatgccgcggttggcttgcggt 382
           || || |||       | |||||||||||||| ||||||||| ||  |||||  |  |||
Sbjct: 499 tttctgaccttcttctcgccgaggaagttccttatctcgatggcggtgttggagt-tggt 441

                                                                       
Query: 383 gatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccctt 442
           |||||| |||||||||||||| |||||||||||||| | ||||||||||||| |||||||
Sbjct: 440 gatggacgcgttgatggggaaatgggcgtagacgaacctcatcttgtagcggtagccctt 381

                                     
Query: 443 ggtgacgccggtgatgaggttctgga 468
           |||||| ||  |||||||||||||||
Sbjct: 380 ggtgacccccttgatgaggttctgga 355



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2,
              complete sequence
          Length = 35954743

 Score =  159 bits (80), Expect = 1e-35
 Identities = 117/128 (91%), Gaps = 1/128 (0%)
 Strand = Plus / Plus

                                                                          
Query: 341    ccgaggaagttcctgatctcgatgccgcggttggcttgcggtgatggatgcgttgatggg 400
              |||||||||||||||||||||||| ||  |||||  |  ||||||||| |||||||||||
Sbjct: 182997 ccgaggaagttcctgatctcgatggcggtgttggagtt-ggtgatggaggcgttgatggg 183055

                                                                          
Query: 401    gaagtgggcgtagacgaagcgcatcttgtagcggaagcccttggtgacgccggtgatgag 460
              ||| ||||| |||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 183056 gaaatgggcatagacgaagcgcatcttgtagcggtagcccttggtgacgccggtgatgag 183115

                      
Query: 461    gttctgga 468
              ||||||||
Sbjct: 183116 gttctgga 183123



 Score =  119 bits (60), Expect = 9e-24
 Identities = 105/120 (87%)
 Strand = Plus / Plus

                                                                          
Query: 208    ctggttgatcagggcagcagagcgggagacaagctcaatgtcattgccatccaggacgat 267
              |||||||||||| || ||||| |||||||||||||| || ||||||||||| ||||| | 
Sbjct: 182394 ctggttgatcagtgccgcagaacgggagacaagctcgatatcattgccatcaaggaccag 182453

                                                                          
Query: 268    ctcgtccttgaccttctcggaccgcaggattgtcacaccgtcaagcatgtcaactttcct 327
              ||| |||||||||||||| || ||||  ||||||||||| ||||||||||| ||||||||
Sbjct: 182454 ctcatccttgaccttctcagaacgcaaaattgtcacaccctcaagcatgtccactttcct 182513



 Score =  111 bits (56), Expect = 2e-21
 Identities = 71/76 (93%)
 Strand = Plus / Plus

                                                                          
Query: 135    tgatggcgcccttgtcgctgacatagatgccgtccaggaacttcctgatgtccttgttct 194
              |||||| ||||||||| |||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 180615 tgatggtgcccttgtcactgacatagatgccatccaggaacttcctgatatccttgttct 180674

                              
Query: 195    tcacgtggcatttctg 210
              | ||||||||||||||
Sbjct: 180675 tgacgtggcatttctg 180690



to top

>dbj|AP004187.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OJ1435_F07
          Length = 139041

 Score =  159 bits (80), Expect = 1e-35
 Identities = 117/128 (91%), Gaps = 1/128 (0%)
 Strand = Plus / Plus

                                                                          
Query: 341    ccgaggaagttcctgatctcgatgccgcggttggcttgcggtgatggatgcgttgatggg 400
              |||||||||||||||||||||||| ||  |||||  |  ||||||||| |||||||||||
Sbjct: 132024 ccgaggaagttcctgatctcgatggcggtgttggagtt-ggtgatggaggcgttgatggg 132082

                                                                          
Query: 401    gaagtgggcgtagacgaagcgcatcttgtagcggaagcccttggtgacgccggtgatgag 460
              ||| ||||| |||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 132083 gaaatgggcatagacgaagcgcatcttgtagcggtagcccttggtgacgccggtgatgag 132142

                      
Query: 461    gttctgga 468
              ||||||||
Sbjct: 132143 gttctgga 132150



 Score =  119 bits (60), Expect = 9e-24
 Identities = 105/120 (87%)
 Strand = Plus / Plus

                                                                          
Query: 208    ctggttgatcagggcagcagagcgggagacaagctcaatgtcattgccatccaggacgat 267
              |||||||||||| || ||||| |||||||||||||| || ||||||||||| ||||| | 
Sbjct: 131421 ctggttgatcagtgccgcagaacgggagacaagctcgatatcattgccatcaaggaccag 131480

                                                                          
Query: 268    ctcgtccttgaccttctcggaccgcaggattgtcacaccgtcaagcatgtcaactttcct 327
              ||| |||||||||||||| || ||||  ||||||||||| ||||||||||| ||||||||
Sbjct: 131481 ctcatccttgaccttctcagaacgcaaaattgtcacaccctcaagcatgtccactttcct 131540



 Score =  111 bits (56), Expect = 2e-21
 Identities = 71/76 (93%)
 Strand = Plus / Plus

                                                                          
Query: 135    tgatggcgcccttgtcgctgacatagatgccgtccaggaacttcctgatgtccttgttct 194
              |||||| ||||||||| |||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 129642 tgatggtgcccttgtcactgacatagatgccatccaggaacttcctgatatccttgttct 129701

                              
Query: 195    tcacgtggcatttctg 210
              | ||||||||||||||
Sbjct: 129702 tgacgtggcatttctg 129717



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  157 bits (79), Expect = 4e-35
 Identities = 113/123 (91%), Gaps = 1/123 (0%)
 Strand = Plus / Plus

                                                                            
Query: 346      gaagttcctgatctcgatgccgcggttggcttgcggtgatggatgcgttgatggggaagt 405
                ||||||||||||||||||| ||  |||||  |  ||||||||| ||||||||||||||||
Sbjct: 18584697 gaagttcctgatctcgatggcggtgttggagtt-ggtgatggaggcgttgatggggaagt 18584755

                                                                            
Query: 406      gggcgtagacgaagcgcatcttgtagcggaagcccttggtgacgccggtgatgaggttct 465
                | ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 18584756 gagcgtagacgaagcgcatcttgtagcggtagcccttggtgacgccggtgatgaggttct 18584815

                   
Query: 466      gga 468
                |||
Sbjct: 18584816 gga 18584818



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 102/120 (85%)
 Strand = Plus / Plus

                                                                            
Query: 208      ctggttgatcagggcagcagagcgggagacaagctcaatgtcattgccatccaggacgat 267
                ||||||||| ||||| || ||||| ||||| ||||| ||||| ||||| || ||||||| 
Sbjct: 18584445 ctggttgatgagggctgctgagcgagagacgagctcgatgtcgttgccgtcgaggacgag 18584504

                                                                            
Query: 268      ctcgtccttgaccttctcggaccgcaggattgtcacaccgtcaagcatgtcaactttcct 327
                ||||||||| |||||||| ||||||| ||| ||||| || || ||||||||||| |||||
Sbjct: 18584505 ctcgtccttcaccttctccgaccgcaagatggtcaccccctcgagcatgtcaaccttcct 18584564



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Plus

                                                                            
Query: 143      cccttgtcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtgg 202
                ||||||||||| || ||||| || |||| |||||||||||| ||||||||||||||||||
Sbjct: 18583646 cccttgtcgctcacgtagataccatccaagaacttcctgatatccttgttcttcacgtgg 18583705

                        
Query: 203      catttctg 210
                ||||||||
Sbjct: 18583706 catttctg 18583713



to top

>gb|DQ235200.1| Solanum tuberosum clone 171E12 unknown mRNA
          Length = 858

 Score =  105 bits (53), Expect = 1e-19
 Identities = 152/185 (82%)
 Strand = Plus / Minus

                                                                       
Query: 143 cccttgtcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtgg 202
           ||||| || ||||||||||| || || || ||||| | ||| |||||||||||||| |||
Sbjct: 621 cccttctcactgacatagataccatcaagaaactttcggatatccttgttcttcacatgg 562

                                                                       
Query: 203 catttctggttgatcagggcagcagagcgggagacaagctcaatgtcattgccatccagg 262
           ||||| ||||| || ||||| |||||||| || || |||||||||||||| |||||||  
Sbjct: 561 catttttggttaatgagggctgcagagcgagaaacgagctcaatgtcatttccatccaat 502

                                                                       
Query: 263 acgatctcgtccttgaccttctcggaccgcaggattgtcacaccgtcaagcatgtcaact 322
           || | ||| ||||| |||||||| || || |  | ||| || || |||||||||||||||
Sbjct: 501 acaagctcatccttaaccttctcagatcgaacaactgttactccatcaagcatgtcaact 442

                
Query: 323 ttcct 327
           |||||
Sbjct: 441 ttcct 437



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 379 cggtgatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgta 430
           |||||||||| || |||||||| ||||| || || || || |||||||||||
Sbjct: 386 cggtgatggaggcattgatgggaaagtgagcatacacaaaacgcatcttgta 335



to top

>gb|DQ207848.1| Solanum tuberosum clone 074A07 unknown mRNA
          Length = 838

 Score =  105 bits (53), Expect = 1e-19
 Identities = 152/185 (82%)
 Strand = Plus / Minus

                                                                       
Query: 143 cccttgtcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtgg 202
           ||||| |||||||| ||||| || || |||||||| | ||| || ||||||||||| |||
Sbjct: 588 cccttctcgctgacgtagataccatcaaggaacttacggatatctttgttcttcacatgg 529

                                                                       
Query: 203 catttctggttgatcagggcagcagagcgggagacaagctcaatgtcattgccatccagg 262
           ||||| ||||| ||||||||||| || || |||||||| ||||||||||| |||||||  
Sbjct: 528 catttttggtttatcagggcagctgatcgagagacaagttcaatgtcatttccatccaaa 469

                                                                       
Query: 263 acgatctcgtccttgaccttctcggaccgcaggattgtcacaccgtcaagcatgtcaact 322
           || | ||| ||||| || ||||| || || |  |  || |||||||||||||| ||||||
Sbjct: 468 accaactcatccttaactttctctgagcggacaacagtgacaccgtcaagcatatcaact 409

                
Query: 323 ttcct 327
           |||||
Sbjct: 408 ttcct 404



to top

>gb|BT013259.1| Lycopersicon esculentum clone 134794R, mRNA sequence
          Length = 870

 Score =  105 bits (53), Expect = 1e-19
 Identities = 152/185 (82%)
 Strand = Plus / Minus

                                                                       
Query: 143 cccttgtcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtgg 202
           ||||| |||||||| ||||| || || |||||||| | ||| || ||||||||||| |||
Sbjct: 617 cccttctcgctgacgtagataccatcaaggaacttacggatatctttgttcttcacatgg 558

                                                                       
Query: 203 catttctggttgatcagggcagcagagcgggagacaagctcaatgtcattgccatccagg 262
           ||||| ||||| ||||||||||| || || |||||||| ||||||||||| |||||||  
Sbjct: 557 catttttggtttatcagggcagctgatcgtgagacaagttcaatgtcatttccatccaaa 498

                                                                       
Query: 263 acgatctcgtccttgaccttctcggaccgcaggattgtcacaccgtcaagcatgtcaact 322
           || | ||| ||||| || ||||| || || |  |  || |||||||||||||| ||||||
Sbjct: 497 accaactcatccttaactttctctgaacggacaacagtgacaccgtcaagcatatcaact 438

                
Query: 323 ttcct 327
           |||||
Sbjct: 437 ttcct 433



to top

>ref|NM_103046.2| Arabidopsis thaliana structural constituent of ribosome AT1G33120
           mRNA, complete cds
          Length = 966

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 65/71 (91%)
 Strand = Plus / Minus

                                                                       
Query: 149 tcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtggcatttc 208
           ||||| |||||||| ||||| |||||||||||||| ||||| ||||||||||| ||||||
Sbjct: 637 tcgctaacatagataccgtcaaggaacttcctgatatccttcttcttcacgtgacatttc 578

                      
Query: 209 tggttgatcag 219
           |||||||||||
Sbjct: 577 tggttgatcag 567



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 383 gatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           |||||| ||||||||||| || |||||||| ||||| | ||||||||| |||||
Sbjct: 404 gatggaggcgttgatgggaaaatgggcgtacacgaacctcatcttgtaacggaa 351



to top

>gb|AF339694.1| Arabidopsis thaliana putative ribosomal protein L9 (At1g33120)
           mRNA, complete cds
          Length = 635

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 65/71 (91%)
 Strand = Plus / Minus

                                                                       
Query: 149 tcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtggcatttc 208
           ||||| |||||||| ||||| |||||||||||||| ||||| ||||||||||| ||||||
Sbjct: 557 tcgctaacatagataccgtcaaggaacttcctgatatccttcttcttcacgtgacatttc 498

                      
Query: 209 tggttgatcag 219
           |||||||||||
Sbjct: 497 tggttgatcag 487



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 383 gatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           |||||| ||||||||||| || |||||||| ||||| | ||||||||| |||||
Sbjct: 324 gatggaggcgttgatgggaaaatgggcgtacacgaacctcatcttgtaacggaa 271



to top

>gb|AF326873.1| Arabidopsis thaliana putative ribosomal protein L9 (At1g33120)
           mRNA, complete cds
          Length = 824

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 65/71 (91%)
 Strand = Plus / Minus

                                                                       
Query: 149 tcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtggcatttc 208
           ||||| |||||||| ||||| |||||||||||||| ||||| ||||||||||| ||||||
Sbjct: 637 tcgctaacatagataccgtcaaggaacttcctgatatccttcttcttcacgtgacatttc 578

                      
Query: 209 tggttgatcag 219
           |||||||||||
Sbjct: 577 tggttgatcag 567



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 383 gatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           |||||| ||||||||||| || |||||||| ||||| | ||||||||| |||||
Sbjct: 404 gatggaggcgttgatgggaaaatgggcgtacacgaacctcatcttgtaacggaa 351



to top

>gb|AY128910.1| Arabidopsis thaliana ribosomal protein L9, putative (At1g33120)
           mRNA, complete cds
          Length = 661

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 65/71 (91%)
 Strand = Plus / Minus

                                                                       
Query: 149 tcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtggcatttc 208
           ||||| |||||||| ||||| |||||||||||||| ||||| ||||||||||| ||||||
Sbjct: 557 tcgctaacatagataccgtcaaggaacttcctgatatccttcttcttcacgtgacatttc 498

                      
Query: 209 tggttgatcag 219
           |||||||||||
Sbjct: 497 tggttgatcag 487



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 383 gatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           |||||| ||||||||||| || |||||||| ||||| | ||||||||| |||||
Sbjct: 324 gatggaggcgttgatgggaaaatgggcgtacacgaacctcatcttgtaacggaa 271



to top

>gb|AY072446.1| Arabidopsis thaliana ribosomal protein L9, putative (At1g33120)
           mRNA, complete cds
          Length = 770

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 65/71 (91%)
 Strand = Plus / Minus

                                                                       
Query: 149 tcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtggcatttc 208
           ||||| |||||||| ||||| |||||||||||||| ||||| ||||||||||| ||||||
Sbjct: 601 tcgctaacatagataccgtcaaggaacttcctgatatccttcttcttcacgtgacatttc 542

                      
Query: 209 tggttgatcag 219
           |||||||||||
Sbjct: 541 tggttgatcag 531



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 383 gatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           |||||| ||||||||||| || |||||||| ||||| | ||||||||| |||||
Sbjct: 368 gatggaggcgttgatgggaaaatgggcgtacacgaacctcatcttgtaacggaa 315



to top

>gb|AF324688.2|AF324688 Arabidopsis thaliana At1g33120 (At1g33120/T9L6_8) mRNA, complete
           cds
          Length = 808

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 65/71 (91%)
 Strand = Plus / Minus

                                                                       
Query: 149 tcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtggcatttc 208
           ||||| |||||||| ||||| |||||||||||||| ||||| ||||||||||| ||||||
Sbjct: 637 tcgctaacatagataccgtcaaggaacttcctgatatccttcttcttcacgtgacatttc 578

                      
Query: 209 tggttgatcag 219
           |||||||||||
Sbjct: 577 tggttgatcag 567



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 383 gatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           |||||| ||||||||||| || |||||||| ||||| | ||||||||| |||||
Sbjct: 404 gatggaggcgttgatgggaaaatgggcgtacacgaacctcatcttgtaacggaa 351



to top

>emb|BX814591.1|CNS0ACBL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB83ZB06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 817

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 65/71 (91%)
 Strand = Plus / Minus

                                                                       
Query: 149 tcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtggcatttc 208
           ||||| |||||||| ||||| |||||||||||||| ||||| ||||||||||| ||||||
Sbjct: 625 tcgctaacatagataccgtcaaggaacttcctgatatccttcttcttcacgtgacatttc 566

                      
Query: 209 tggttgatcag 219
           |||||||||||
Sbjct: 565 tggttgatcag 555



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 383 gatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           |||||| ||||||||||| || |||||||| ||||| | ||||||||| |||||
Sbjct: 392 gatggaggcgttgatgggaaaatgggcgtacacgaacctcatcttgtaacggaa 339



to top

>emb|BX816763.1|CNS0ABNW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH67ZC07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 873

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 65/71 (91%)
 Strand = Plus / Minus

                                                                       
Query: 149 tcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtggcatttc 208
           ||||| |||||||| ||||| |||||||||||||| ||||| ||||||||||| ||||||
Sbjct: 630 tcgctaacatagataccgtcaaggaacttcctgatatccttcttcttcacgtgacatttc 571

                      
Query: 209 tggttgatcag 219
           |||||||||||
Sbjct: 570 tggttgatcag 560



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 383 gatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           |||||| ||||||||||| || |||||||| ||||| | ||||||||| |||||
Sbjct: 397 gatggaggcgttgatgggaaaatgggcgtacacgaacctcatcttgtaacggaa 344



to top

>gb|AY310780.1| Nicotiana benthamiana clone 8-334 unknown mRNA
          Length = 252

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 68/76 (89%)
 Strand = Plus / Minus

                                                                       
Query: 185 tccttgttcttcacgtggcatttctggttgatcagggcagcagagcgggagacaagctca 244
           |||||||||||||| |||||||| || ||||| |||||||||||||| || || ||||||
Sbjct: 224 tccttgttcttcacatggcatttttgattgatgagggcagcagagcgagaaacgagctca 165

                           
Query: 245 atgtcattgccatcca 260
           |||||||| |||||||
Sbjct: 164 atgtcatttccatcca 149



to top

>ref|XM_863754.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN9465.2), mRNA
          Length = 579

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 65/73 (89%)
 Strand = Plus / Minus

                                                                       
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagcccttggtgacgc 450
           |||||||||| ||||| ||||||||| |||||||||||||   ||||||||||||||| |
Sbjct: 301 cgttgatgggaaagtgagcgtagacgtagcgcatcttgtacttgaagcccttggtgacac 242

                        
Query: 451 cggtgatgaggtt 463
           || ||||||||||
Sbjct: 241 cgatgatgaggtt 229



to top

>ref|NM_103048.3| Arabidopsis thaliana structural constituent of ribosome AT1G33140
           mRNA, complete cds
          Length = 935

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 149 tcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtggcatttc 208
           ||||| |||||||| || || || ||||||||||| ||||| ||||||||||| ||||||
Sbjct: 642 tcgctaacatagataccatcaagaaacttcctgatatccttcttcttcacgtgacatttc 583

                     
Query: 209 tggttgatca 218
           ||||||||||
Sbjct: 582 tggttgatca 573



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 383 gatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           |||||| ||||||||||| || |||||||| ||||| | ||||||||| |||||
Sbjct: 409 gatggaggcgttgatgggaaaatgggcgtacacgaacctcatcttgtaacggaa 356



to top

>emb|Y13428.1|HCRIBOL9 Haemonchus contortus mRNA for ribosomal protein L9
          Length = 460

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagcccttggtgac 448
           ||||||||||||| |||||||| ||| | ||||||||||||||||| |||||||||||
Sbjct: 338 cgttgatggggaaatgggcgtatacggatcgcatcttgtagcggaaacccttggtgac 281



to top

>emb|X91958.1|AT60SRL9 A.thaliana mRNA for 60S ribosomal protein L9
          Length = 768

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 149 tcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtggcatttc 208
           ||||| |||||||| || || || ||||||||||| ||||| ||||||||||| ||||||
Sbjct: 586 tcgctaacatagataccatcaagaaacttcctgatatccttcttcttcacgtgacatttc 527

                     
Query: 209 tggttgatca 218
           ||||||||||
Sbjct: 526 tggttgatca 517



to top

>gb|AF375419.1| Arabidopsis thaliana At1g33140/T9L6_10 mRNA, complete cds
          Length = 898

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 149 tcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtggcatttc 208
           ||||| |||||||| || || || ||||||||||| ||||| ||||||||||| ||||||
Sbjct: 605 tcgctaacatagataccatcaagaaacttcctgatatccttcttcttcacgtgacatttc 546

                     
Query: 209 tggttgatca 218
           ||||||||||
Sbjct: 545 tggttgatca 536



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 383 gatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           |||||| ||||||||||| || |||||||| ||||| | ||||||||| |||||
Sbjct: 372 gatggaggcgttgatgggaaaatgggcgtacacgaacctcatcttgtaacggaa 319



to top

>gb|AY058051.1| Arabidopsis thaliana At1g33140/T9L6_10 mRNA, complete cds
          Length = 809

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 149 tcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtggcatttc 208
           ||||| |||||||| || || || ||||||||||| ||||| ||||||||||| ||||||
Sbjct: 611 tcgctaacatagataccatcaagaaacttcctgatatccttcttcttcacgtgacatttc 552

                     
Query: 209 tggttgatca 218
           ||||||||||
Sbjct: 551 tggttgatca 542



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 383 gatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           |||||| ||||||||||| || |||||||| ||||| | ||||||||| |||||
Sbjct: 378 gatggaggcgttgatgggaaaatgggcgtacacgaacctcatcttgtaacggaa 325



to top

>gb|AY054156.1| Arabidopsis thaliana At1g33140/T9L6_10 mRNA, complete cds
          Length = 585

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 149 tcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtggcatttc 208
           ||||| |||||||| || || || ||||||||||| ||||| ||||||||||| ||||||
Sbjct: 557 tcgctaacatagataccatcaagaaacttcctgatatccttcttcttcacgtgacatttc 498

                     
Query: 209 tggttgatca 218
           ||||||||||
Sbjct: 497 tggttgatca 488



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 383 gatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           |||||| ||||||||||| || |||||||| ||||| | ||||||||| |||||
Sbjct: 324 gatggaggcgttgatgggaaaatgggcgtacacgaacctcatcttgtaacggaa 271



to top

>dbj|AK222147.1| Arabidopsis thaliana mRNA for ribosomal protein L9, partial cds,
           clone: RAFL23-02-D12
          Length = 504

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 149 tcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtggcatttc 208
           ||||| |||||||| || || || ||||||||||| ||||| ||||||||||| ||||||
Sbjct: 270 tcgctaacatagataccatcaagaaacttcctgatatccttcttcttcacgtgacatttc 211

                     
Query: 209 tggttgatca 218
           ||||||||||
Sbjct: 210 tggttgatca 201



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 383 gatggatgcgttgatggggaagtgggcgtagacgaa 418
           |||||| ||||||||||| || |||||||| |||||
Sbjct: 37  gatggaggcgttgatgggaaaatgggcgtacacgaa 2



to top

>gb|AY039593.1| Arabidopsis thaliana At1g33140/T9L6_10 mRNA, complete cds
          Length = 929

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 149 tcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtggcatttc 208
           ||||| |||||||| || || || ||||||||||| ||||| ||||||||||| ||||||
Sbjct: 636 tcgctaacatagataccatcaagaaacttcctgatatccttcttcttcacgtgacatttc 577

                     
Query: 209 tggttgatca 218
           ||||||||||
Sbjct: 576 tggttgatca 567



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 383 gatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           |||||| ||||||||||| || |||||||| ||||| | ||||||||| |||||
Sbjct: 403 gatggaggcgttgatgggaaaatgggcgtacacgaacctcatcttgtaacggaa 350



to top

>gb|AY086680.1| Arabidopsis thaliana clone 26744 mRNA, complete sequence
          Length = 829

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 149 tcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtggcatttc 208
           ||||| |||||||| || || || ||||||||||| ||||| ||||||||||| ||||||
Sbjct: 643 tcgctaacatagataccatcaagaaacttcctgatatccttcttcttcacgtgacatttc 584

                     
Query: 209 tggttgatca 218
           ||||||||||
Sbjct: 583 tggttgatca 574



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 383 gatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           |||||| ||||||||||| || |||||||| ||||| | ||||||||| |||||
Sbjct: 410 gatggaggcgttgatgggaaaatgggcgtacacgaacctcatcttgtaacggaa 357



to top

>gb|AC021045.2|AC021045 Arabidopsis thaliana chromosome I BAC T9L6 genomic sequence, complete
             sequence
          Length = 90632

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                         
Query: 149   tcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtggcatttc 208
             ||||| |||||||| ||||| |||||||||||||| ||||| ||||||||||| ||||||
Sbjct: 45004 tcgctaacatagataccgtcaaggaacttcctgatatccttcttcttcacgtgacatttc 44945

               
Query: 209   tg 210
             ||
Sbjct: 44944 tg 44943



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                         
Query: 149   tcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtggcatttc 208
             ||||| |||||||| || || || ||||||||||| ||||| ||||||||||| ||||||
Sbjct: 57283 tcgctaacatagataccatcaagaaacttcctgatatccttcttcttcacgtgacatttc 57224

               
Query: 209   tg 210
             ||
Sbjct: 57223 tg 57222



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                   
Query: 383   gatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
             |||||| ||||||||||| || |||||||| ||||| | ||||||||| |||||
Sbjct: 56492 gatggaggcgttgatgggaaaatgggcgtacacgaacctcatcttgtaacggaa 56439



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                   
Query: 383   gatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
             |||||| ||||||||||| || |||||||| ||||| | ||||||||| |||||
Sbjct: 44118 gatggaggcgttgatgggaaaatgggcgtacacgaacctcatcttgtaacggaa 44065



to top

>ref|XM_566460.1| Cryptococcus neoformans var. neoformans JEC21 60s ribosomal protein
           l9 (CNA00250) partial mRNA
          Length = 661

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 390 gcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagcccttggtgacg 449
           |||||||||||||| || |||||||| |  |||||||||||| |||||||||||||||| 
Sbjct: 317 gcgttgatggggaaatgcgcgtagacaagtcgcatcttgtagaggaagcccttggtgaca 258

                   
Query: 450 ccggtgat 457
           ||| ||||
Sbjct: 257 ccgatgat 250



to top

>gb|AY130411.1| Myxine glutinosa ribosomal protein L9 mRNA, partial cds
          Length = 480

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           ||||||||||||||||| || ||| |||||||||||||||||||||||
Sbjct: 227 ttgatggggaagtgggcatacacggagcgcatcttgtagcggaagccc 180



to top

>ref|XM_960036.1| Neurospora crassa OR74A hypothetical protein (NCU02744.1) partial
           mRNA
          Length = 582

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 59/67 (88%)
 Strand = Plus / Minus

                                                                       
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagcccttggtgacgc 450
           ||||||||||||| ||||| |||||| |||||||||||||   ||||||||||||||| |
Sbjct: 301 cgttgatggggaaatgggcatagacgtagcgcatcttgtacttgaagcccttggtgacac 242

                  
Query: 451 cggtgat 457
           || ||||
Sbjct: 241 cgatgat 235



to top

>ref|XM_331942.1| Neurospora crassa OR74A hypothetical protein (NCU02744.1) partial
           mRNA
          Length = 582

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 59/67 (88%)
 Strand = Plus / Minus

                                                                       
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagcccttggtgacgc 450
           ||||||||||||| ||||| |||||| |||||||||||||   ||||||||||||||| |
Sbjct: 301 cgttgatggggaaatgggcatagacgtagcgcatcttgtacttgaagcccttggtgacac 242

                  
Query: 451 cggtgat 457
           || ||||
Sbjct: 241 cgatgat 235



to top

>ref|XM_381330.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG01154.1)
           partial mRNA
          Length = 753

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagcccttggtgac 448
           ||||||||||||| |||||||||||| | |||||||||||   |||||||||||||||
Sbjct: 472 cgttgatggggaaatgggcgtagacgtatcgcatcttgtacttgaagcccttggtgac 415



to top

>dbj|AB226272.1| Aspergillus oryzae cDNA, contig sequence: AoEST3132
          Length = 1032

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagcccttggtgac 448
           |||||||||| ||||| ||||||||| |||||||||||||   |||||||||||||||
Sbjct: 482 cgttgatgggaaagtgagcgtagacgtagcgcatcttgtacttgaagcccttggtgac 425



to top

>dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005
          Length = 4429080

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                         
Query: 391     cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagcccttggtgac 448
               |||||||||| ||||| ||||||||| |||||||||||||   |||||||||||||||
Sbjct: 4295757 cgttgatgggaaagtgagcgtagacgtagcgcatcttgtacttgaagcccttggtgac 4295700



to top

>ref|NM_117113.2| Arabidopsis thaliana structural constituent of ribosome AT4G10450
           mRNA, complete cds
          Length = 900

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 111/137 (81%)
 Strand = Plus / Minus

                                                                       
Query: 149 tcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtggcatttc 208
           ||||| |||||||| || || || ||||||||||| ||||| |||||||| || ||||||
Sbjct: 624 tcgctcacatagataccatcaagaaacttcctgatatccttcttcttcacatgacatttc 565

                                                                       
Query: 209 tggttgatcagggcagcagagcgggagacaagctcaatgtcattgccatccaggacgatc 268
           || |||||||  |||  ||| || || ||||||||||| ||||| || || || |  |||
Sbjct: 564 tgattgatcaaagcacaagaccgtgaaacaagctcaatatcatttccctcaagaataatc 505

                            
Query: 269 tcgtccttgaccttctc 285
           || ||||| ||||||||
Sbjct: 504 tcatccttaaccttctc 488



to top

>gb|AY190735.1| Pagrus major ribosomal protein L9 mRNA, complete cds
          Length = 703

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 149 tcgctgacatagatgccgtccaggaacttcctgatgtcctt 189
           |||||||  ||||||||||||||||||||||||||||||||
Sbjct: 690 tcgctgatgtagatgccgtccaggaacttcctgatgtcctt 650



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||||| |||||||| ||| ||||||| |||||||||||
Sbjct: 317 cgttgatggggaaatgggcgtacacggagcgcattttgtagcggaa 272



to top

>gb|AY117346.1| Arabidopsis thaliana putative ribosomal protein L9 (At4g10450)
           mRNA, complete cds
          Length = 616

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 111/137 (81%)
 Strand = Plus / Minus

                                                                       
Query: 149 tcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtggcatttc 208
           ||||| |||||||| || || || ||||||||||| ||||| |||||||| || ||||||
Sbjct: 557 tcgctcacatagataccatcaagaaacttcctgatatccttcttcttcacatgacatttc 498

                                                                       
Query: 209 tggttgatcagggcagcagagcgggagacaagctcaatgtcattgccatccaggacgatc 268
           || |||||||  |||  ||| || || ||||||||||| ||||| || || || |  |||
Sbjct: 497 tgattgatcaaagcacaagaccgtgaaacaagctcaatatcatttccctcaagaataatc 438

                            
Query: 269 tcgtccttgaccttctc 285
           || ||||| ||||||||
Sbjct: 437 tcatccttaaccttctc 421



to top

>gb|AY065259.1| Arabidopsis thaliana putative ribosomal protein L9 (At4g10450)
           mRNA, complete cds
          Length = 812

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 111/137 (81%)
 Strand = Plus / Minus

                                                                       
Query: 149 tcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtggcatttc 208
           ||||| |||||||| || || || ||||||||||| ||||| |||||||| || ||||||
Sbjct: 624 tcgctcacatagataccatcaagaaacttcctgatatccttcttcttcacatgacatttc 565

                                                                       
Query: 209 tggttgatcagggcagcagagcgggagacaagctcaatgtcattgccatccaggacgatc 268
           || |||||||  |||  ||| || || ||||||||||| ||||| || || || |  |||
Sbjct: 564 tgattgatcaaagcacaagaccgtgaaacaagctcaatatcatttccctcaagaataatc 505

                            
Query: 269 tcgtccttgaccttctc 285
           || ||||| ||||||||
Sbjct: 504 tcatccttaaccttctc 488



to top

>emb|BX829170.1|CNS0A4I1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL77ZF10 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 834

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 111/137 (81%)
 Strand = Plus / Minus

                                                                       
Query: 149 tcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtggcatttc 208
           ||||| |||||||| || || || ||||||||||| ||||| |||||||| || ||||||
Sbjct: 563 tcgctcacatagataccatcaagaaacttcctgatatccttcttcttcacatgacatttc 504

                                                                       
Query: 209 tggttgatcagggcagcagagcgggagacaagctcaatgtcattgccatccaggacgatc 268
           || |||||||  |||  ||| || || ||||||||||| ||||| || || || |  |||
Sbjct: 503 tgattgatcaaagcacaagaccgtgaaacaagctcaatatcatttccctcaagaataatc 444

                            
Query: 269 tcgtccttgaccttctc 285
           || ||||| ||||||||
Sbjct: 443 tcatccttaaccttctc 427



to top

>gb|AY086090.1| Arabidopsis thaliana clone 21228 mRNA, complete sequence
          Length = 797

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 111/137 (81%)
 Strand = Plus / Minus

                                                                       
Query: 149 tcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtggcatttc 208
           ||||| |||||||| || || || ||||||||||| ||||| |||||||| || ||||||
Sbjct: 625 tcgctcacatagataccatcaagaaacttcctgatatccttcttcttcacatgacatttc 566

                                                                       
Query: 209 tggttgatcagggcagcagagcgggagacaagctcaatgtcattgccatccaggacgatc 268
           || |||||||  |||  ||| || || ||||||||||| ||||| || || || |  |||
Sbjct: 565 tgattgatcaaagcacaagaccgtgaaacaagctcaatatcatttccctcaagaataatc 506

                            
Query: 269 tcgtccttgaccttctc 285
           || ||||| ||||||||
Sbjct: 505 tcatccttaaccttctc 489



to top

>gb|AC149298.1| Populus trichocarpa clone Pop1-021H24, complete sequence
          Length = 146635

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 98/120 (81%)
 Strand = Plus / Plus

                                                                         
Query: 208   ctggttgatcagggcagcagagcgggagacaagctcaatgtcattgccatccaggacgat 267
             ||||||||||| ||| || || || || ||||||||||| ||||||||||| ||||||| 
Sbjct: 95235 ctggttgatcaaggctgccgaccgtgaaacaagctcaatatcattgccatctaggacgag 95294

                                                                         
Query: 268   ctcgtccttgaccttctcggaccgcaggattgtcacaccgtcaagcatgtcaactttcct 327
             ||| ||||| ||||| || || || || ||  | || ||||||||||| ||||| |||||
Sbjct: 95295 ctcatccttcaccttttcagatcggagaatactaaccccgtcaagcatatcaaccttcct 95354



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 64/75 (85%)
 Strand = Plus / Plus

                                                                         
Query: 208   ctggttgatcagggcagcagagcgggagacaagctcaatgtcattgccatccaggacgat 267
             ||||||||||| ||| || || || || ||||||||||| ||||||||||| ||||||| 
Sbjct: 90468 ctggttgatcaaggctgccgaccgtgaaacaagctcaatatcattgccatctaggacgag 90527

                            
Query: 268   ctcgtccttgacctt 282
             ||| ||||| |||||
Sbjct: 90528 ctcatccttcacctt 90542



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 63/75 (84%)
 Strand = Plus / Plus

                                                                          
Query: 208    ctggttgatcagggcagcagagcgggagacaagctcaatgtcattgccatccaggacgat 267
              |||||||||||  || || || || || ||||||||||| ||||||||||| ||||||| 
Sbjct: 102956 ctggttgatcaaagctgccgaccgtgaaacaagctcaatatcattgccatctaggacgag 103015

                             
Query: 268    ctcgtccttgacctt 282
              ||| ||||| |||||
Sbjct: 103016 ctcatccttcacctt 103030



to top

>gb|AC119415.13| Medicago truncatula clone mth2-27n2, complete sequence
          Length = 139330

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                          
Query: 390    gcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagcccttggtgacg 449
              |||||||||||||| || || || || || | ||||||||||||||| ||||||||||| 
Sbjct: 100656 gcgttgatggggaaatgagcatacacaaacctcatcttgtagcggaatcccttggtgaca 100597

                              
Query: 450    ccggtgatgaggttct 465
              || |||||||| ||||
Sbjct: 100596 ccagtgatgagattct 100581



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                    
Query: 173    aacttcctgatgtccttgttcttcacgtggcatttctg 210
              ||||||||||| ||||| ||||| || |||||||||||
Sbjct: 101425 aacttcctgatatccttcttcttaacatggcatttctg 101388



to top

>gb|AC126789.20| Medicago truncatula clone mth2-36n23, complete sequence
          Length = 126875

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                         
Query: 390   gcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagcccttggtgacg 449
             |||||||||||||| || || || || || | ||||||||||||||| ||||||||||| 
Sbjct: 54816 gcgttgatggggaaatgagcatacacaaacctcatcttgtagcggaatcccttggtgaca 54757

                             
Query: 450   ccggtgatgaggttct 465
             || |||||||| ||||
Sbjct: 54756 ccagtgatgagattct 54741



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 173   aacttcctgatgtccttgttcttcacgtggcatttctg 210
             ||||||||||| ||||| ||||| || |||||||||||
Sbjct: 55585 aacttcctgatatccttcttcttaacatggcatttctg 55548



to top

>ref|XM_362383.1| Magnaporthe grisea 70-15 hypothetical protein (MG04829.4) partial
           cds
          Length = 585

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagcccttggtgac 448
           ||||||||||||| |||||||||||| | |||||||||||   | |||||||||||||
Sbjct: 301 cgttgatggggaaatgggcgtagacgtaacgcatcttgtacttgtagcccttggtgac 244



to top

>ref|XM_977388.1| PREDICTED: Mus musculus similar to ribosomal protein L9
           (LOC433546), mRNA
          Length = 688

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||| ||||||||||||| ||||||
Sbjct: 557 acatagatgccgtccagaaacttcctgatgtacttgtt 520



to top

>ref|XM_906947.2| PREDICTED: Mus musculus similar to ribosomal protein L9
           (LOC433546), mRNA
          Length = 688

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||| ||||||||||||| ||||||
Sbjct: 557 acatagatgccgtccagaaacttcctgatgtacttgtt 520



to top

>ref|XM_485172.3| PREDICTED: Mus musculus similar to ribosomal protein L9
           (LOC433546), mRNA
          Length = 688

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||| ||||||||||||| ||||||
Sbjct: 557 acatagatgccgtccagaaacttcctgatgtacttgtt 520



to top

>gb|DQ066193.1| Ixodes scapularis isolate ISUFL92 60S ribosomal protein L9 mRNA,
           complete cds
          Length = 570

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 158 tagatgccgtccaggaacttcctgatgtccttgttcttcacg 199
           ||||||||||||| |||||| | |||||||||||||||||||
Sbjct: 533 tagatgccgtccaagaactttcggatgtccttgttcttcacg 492



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagcccttggt 445
           |||||||||||||||||||| ||   ||||||||||||  |||||||||||||
Sbjct: 299 ttgatggggaagtgggcgtacaccgtgcgcatcttgtactggaagcccttggt 247



to top

>gb|AC027035.5|AC027035 Arabidopsis thaliana chromosome 1 BAC T16O9 genomic sequence,
            complete sequence
          Length = 81609

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                        
Query: 149  tcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtggcatttc 208
            ||||| |||||||| || || || ||||||||||| ||||| ||||||||||| ||||||
Sbjct: 1019 tcgctaacatagataccatcaagaaacttcctgatatccttcttcttcacgtgacatttc 960

              
Query: 209  tg 210
            ||
Sbjct: 959  tg 958



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 383 gatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           |||||| ||||||||||| || |||||||| ||||| | ||||||||| |||||
Sbjct: 228 gatggaggcgttgatgggaaaatgggcgtacacgaacctcatcttgtaacggaa 175



to top

>gb|AC084598.1|CBRG42J05 Caenorhabditis briggsae cosmid G42J05, complete sequence
          Length = 40229

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                           
Query: 391   cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
             ||||||||||||| ||||| || ||| |||||||||||||||||||
Sbjct: 11523 cgttgatggggaaatgggcatatacggagcgcatcttgtagcggaa 11568



to top

>emb|AL935150.10| Mouse DNA sequence from clone RP24-482A24 on chromosome 2, complete
             sequence
          Length = 163240

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                   
Query: 155   acatagatgccgtccaggaacttcctgatgtccttgtt 192
             ||||||||||||||||| ||||||||||||| ||||||
Sbjct: 15683 acatagatgccgtccagaaacttcctgatgtacttgtt 15720



to top

>gb|AY648736.1| Danio rerio 60S ribosomal protein L9 mRNA, complete cds
          Length = 644

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 142 gcccttgtcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcac 198
           |||||| ||||||||||| || || ||||||||||||| ||||||||| ||| ||||
Sbjct: 555 gcccttctcgctgacataaatcccatccaggaacttccggatgtccttcttcctcac 499



to top

>ref|XM_747184.1| Aspergillus fumigatus Af293 60S ribosomal protein L9 b (Afu1g09100)
           partial mRNA
          Length = 579

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                       
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagcccttggtgacgc 450
           |||||||||| ||||| ||||||||| |||||||||||||   |||||||  |||||| |
Sbjct: 301 cgttgatgggaaagtgagcgtagacgtagcgcatcttgtacttgaagccccgggtgacac 242

                        
Query: 451 cggtgatgaggtt 463
           || |||| |||||
Sbjct: 241 cgatgatcaggtt 229



to top

>emb|CR759875.6| Zebrafish DNA sequence from clone DKEY-274K22 in linkage group 1,
             complete sequence
          Length = 216255

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                      
Query: 142   gcccttgtcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcac 198
             |||||| ||||||||||| || || ||||||||||||| ||||||||| ||| ||||
Sbjct: 36793 gcccttctcgctgacataaatcccatccaggaacttccggatgtccttcttcctcac 36849



to top

>emb|CR405706.7| Zebrafish DNA sequence from clone CH211-233D12 in linkage group 1,
              complete sequence
          Length = 181249

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                       
Query: 142    gcccttgtcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcac 198
              |||||| ||||||||||| || || ||||||||||||| ||||||||| ||| ||||
Sbjct: 127517 gcccttctcgctgacataaatcccatccaggaacttccggatgtccttcttcctcac 127573



to top

>emb|X65155.1|PSGAMRF P.sativum GA mRNA (clone F)
          Length = 901

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 92/113 (81%)
 Strand = Plus / Minus

                                                                       
Query: 173 aacttcctgatgtccttgttcttcacgtggcatttctggttgatcagggcagcagagcgg 232
           ||||||||||| ||||| || || || |||||||||||||| || || |||   || || 
Sbjct: 590 aacttcctgatatccttctttttaacatggcatttctggttaataagagcacatgatcga 531

                                                                
Query: 233 gagacaagctcaatgtcattgccatccaggacgatctcgtccttgaccttctc 285
           || ||||||||||||||||| |||||||  || | ||| ||||| ||||||||
Sbjct: 530 gaaacaagctcaatgtcatttccatccaaaacaacctcatccttcaccttctc 478



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 422 catcttgtagcggaagcccttggtgacgccggtgatgaggttct 465
           ||||||||||||||| ||||||||||| || |||||||| ||||
Sbjct: 342 catcttgtagcggaaacccttggtgacaccagtgatgagattct 299



to top

>emb|BX936325.9| Zebrafish DNA sequence from clone CH211-74P16 in linkage group 1,
              complete sequence
          Length = 185075

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                       
Query: 142    gcccttgtcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcac 198
              |||||| ||||||||||| || || ||||||||||||| ||||||||| ||| ||||
Sbjct: 123770 gcccttctcgctgacataaatcccatccaggaacttccggatgtccttcttcctcac 123714



to top

>ref|XM_702523.1| PREDICTED: Danio rerio similar to Rpl9 protein, transcript variant
           6 (LOC558574), mRNA
          Length = 848

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 142 gcccttgtcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcac 198
           |||||| ||||||||||| || || ||||||||||||| ||||||||| ||| ||||
Sbjct: 773 gcccttctcgctgacataaatcccatccaggaacttccggatgtccttcttcctcac 717



to top

>ref|XM_702522.1| PREDICTED: Danio rerio similar to Rpl9 protein, transcript variant
           5 (LOC558574), mRNA
          Length = 847

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 142 gcccttgtcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcac 198
           |||||| ||||||||||| || || ||||||||||||| ||||||||| ||| ||||
Sbjct: 772 gcccttctcgctgacataaatcccatccaggaacttccggatgtccttcttcctcac 716



to top

>ref|XM_679640.1| PREDICTED: Danio rerio similar to Rpl9 protein, transcript variant
           1 (LOC558574), mRNA
          Length = 645

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 142 gcccttgtcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcac 198
           |||||| ||||||||||| || || ||||||||||||| ||||||||| ||| ||||
Sbjct: 572 gcccttctcgctgacataaatcccatccaggaacttccggatgtccttcttcctcac 516



to top

>ref|XM_702521.1| PREDICTED: Danio rerio similar to Rpl9 protein, transcript variant
           4 (LOC558574), mRNA
          Length = 736

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 142 gcccttgtcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcac 198
           |||||| ||||||||||| || || ||||||||||||| ||||||||| ||| ||||
Sbjct: 661 gcccttctcgctgacataaatcccatccaggaacttccggatgtccttcttcctcac 605



to top

>ref|XM_702519.1| PREDICTED: Danio rerio similar to Rpl9 protein, transcript variant
           2 (LOC558574), mRNA
          Length = 768

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 142 gcccttgtcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcac 198
           |||||| ||||||||||| || || ||||||||||||| ||||||||| ||| ||||
Sbjct: 693 gcccttctcgctgacataaatcccatccaggaacttccggatgtccttcttcctcac 637



to top

>emb|BX827856.1|CNS0A3Y4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH27ZF12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 845

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 92/113 (81%)
 Strand = Plus / Minus

                                                                       
Query: 173 aacttcctgatgtccttgttcttcacgtggcatttctggttgatcagggcagcagagcgg 232
           ||||||||||| ||||| |||||||| || |||||||| |||||||  |||  ||| || 
Sbjct: 591 aacttcctgatatccttcttcttcacatgacatttctgattgatcaaagcacaagaccgt 532

                                                                
Query: 233 gagacaagctcaatgtcattgccatccaggacgatctcgtccttgaccttctc 285
           || ||||||||||| ||||| || || || |  ||||| ||||| ||||||||
Sbjct: 531 gaaacaagctcaatatcatttccctcaagaataatctcatccttaaccttctc 479



to top

>gb|BC090911.1| Danio rerio ribosomal protein L9, mRNA (cDNA clone MGC:103730
           IMAGE:7266206), complete cds
          Length = 852

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 142 gcccttgtcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcac 198
           |||||| ||||||||||| || || ||||||||||||| ||||||||| ||| ||||
Sbjct: 757 gcccttctcgctgacataaatcccatccaggaacttccggatgtccttcttcctcac 701



to top

>emb|AL844559.14| Zebrafish DNA sequence from clone DKEY-14K1, complete sequence
          Length = 216608

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                       
Query: 142    gcccttgtcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcac 198
              |||||| ||||||||||| || || ||||||||||||| ||||||||| ||| ||||
Sbjct: 183469 gcccttctcgctgacataaatcccatccaggaacttccggatgtccttcttcctcac 183413



to top

>ref|NM_001003861.1| Danio rerio ribosomal protein L9 (rpl9), mRNA
          Length = 644

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 142 gcccttgtcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcac 198
           |||||| ||||||||||| || || ||||||||||||| ||||||||| ||| ||||
Sbjct: 555 gcccttctcgctgacataaatcccatccaggaacttccggatgtccttcttcctcac 499



to top

>gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 1, complete
             sequence
          Length = 2300533

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                 
Query: 390   gcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccct 441
             |||||||||||||| || |||||||| |  |||||||||||| |||||||||
Sbjct: 76459 gcgttgatggggaaatgcgcgtagacaagtcgcatcttgtagaggaagccct 76408



to top

>ref|XM_504535.1| Yarrowia lipolytica CLIB122, YALI0E29073g predicted mRNA
          Length = 567

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgta 430
           ||||||||||||| |||||||||||| | |||||||||||
Sbjct: 301 cgttgatggggaaatgggcgtagacgtatcgcatcttgta 262



to top

>emb|X97322.2|PSRPL9PRT Pisum sativum rpL9 gene for ribosomal protein L9
          Length = 2641

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                        
Query: 422  catcttgtagcggaagcccttggtgacgccggtgatgaggttct 465
            ||||||||||||||| ||||||||||| || |||||||| ||||
Sbjct: 1852 catcttgtagcggaaacccttggtgacaccagtgatgagattct 1809



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                              
Query: 236  acaagctcaatgtcattgccatccaggacgatctcgtccttgaccttctc 285
            ||||||||||||||||| |||||||  || | ||| ||||| ||||||||
Sbjct: 2220 acaagctcaatgtcatttccatccaaaacaacctcatccttcaccttctc 2171



to top

>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica
          Length = 4224103

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                       
Query: 391     cgttgatggggaagtgggcgtagacgaagcgcatcttgta 430
               ||||||||||||| |||||||||||| | |||||||||||
Sbjct: 3440020 cgttgatggggaaatgggcgtagacgtatcgcatcttgta 3440059



to top

>gb|BC069963.1| Mus musculus cDNA clone IMAGE:5039327, partial cds
          Length = 1505

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccct 441
           |||||||||||||||| ||||| ||  | ||||||||||| ||||||||||
Sbjct: 294 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccct 244



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 155  acatagatgccgtccaggaacttcctgatgtccttgtt 192
            ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 1246 acatagatgccgtccaaaaacttcctgatatccttgtt 1209



to top

>gb|AC136513.2| Mus musculus BAC clone RP23-477N9 from chromosome 5, complete sequence
          Length = 188517

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                                 
Query: 391    cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccct 441
              |||||||||||||||| ||||| ||  | ||||||||||| ||||||||||
Sbjct: 152460 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccct 152410



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                    
Query: 155    acatagatgccgtccaggaacttcctgatgtccttgtt 192
              ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 153412 acatagatgccgtccaaaaacttcctgatatccttgtt 153375



to top

>dbj|AK050296.1| Mus musculus adult male liver tumor cDNA, RIKEN full-length enriched
            library, clone:C730035F01 product:ribosomal protein L9,
            full insert sequence
          Length = 2652

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 391  cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccct 441
            |||||||||||||||| ||||| ||  | ||||||||||| ||||||||||
Sbjct: 1455 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccct 1405



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 155  acatagatgccgtccaggaacttcctgatgtccttgtt 192
            ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 2407 acatagatgccgtccaaaaacttcctgatatccttgtt 2370



to top

>dbj|AK053431.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
            library, clone:E130017A20 product:ribosomal protein L9,
            full insert sequence
          Length = 2691

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 391  cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccct 441
            |||||||||||||||| ||||| ||  | ||||||||||| ||||||||||
Sbjct: 1494 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccct 1444



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 155  acatagatgccgtccaggaacttcctgatgtccttgtt 192
            ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 2446 acatagatgccgtccaaaaacttcctgatatccttgtt 2409



to top

>emb|AJ718406.1| Nicotiana tabacum cDNA-AFLP-fragment BSTC-22-260B, cultivar Bright
           Yellow 2
          Length = 219

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 72/87 (82%)
 Strand = Plus / Minus

                                                                       
Query: 379 cggtgatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagc 438
           |||||||||| || ||||| || ||||| || || ||||| ||||||||||||||| | |
Sbjct: 120 cggtgatggaggcattgatcggaaagtgagcatacacgaaacgcatcttgtagcggtaac 61

                                      
Query: 439 ccttggtgacgccggtgatgaggttct 465
           | ||||| || || |||||||| ||||
Sbjct: 60  ctttggtcacaccagtgatgagattct 34



to top

>gb|AC102159.10| Mus musculus chromosome 19, clone RP23-398L11, complete sequence
          Length = 197134

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                    
Query: 155    acatagatgccgtccaggaacttcctgatgtccttgtt 192
              ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 121075 acatagatgccgtccaaaaacttcctgatatccttgtt 121038



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                
Query: 391    cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
              |||||||||||||||| ||||| ||  | |||||||||||  ||||||||
Sbjct: 120840 cgttgatggggaagtgagcgtacacagaccgcatcttgtattggaagccc 120791



to top

>gb|BC083329.1| Mus musculus ribosomal protein L9, mRNA (cDNA clone MGC:102003
           IMAGE:6824346), complete cds
          Length = 698

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 548 acatagatgccgtccaaaaacttcctgatatccttgtt 511



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 313 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 264



to top

>gb|BC083166.1| Mus musculus ribosomal protein L9, mRNA (cDNA clone MGC:102393
           IMAGE:6397429), complete cds
          Length = 701

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 550 acatagatgccgtccaaaaacttcctgatatccttgtt 513



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 315 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 266



to top

>gb|BC081435.1| Mus musculus ribosomal protein L9, mRNA (cDNA clone MGC:102002
           IMAGE:6824107), complete cds
          Length = 688

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 545 acatagatgccgtccaaaaacttcctgatatccttgtt 508



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 310 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 261



to top

>gb|AC125233.4| Mus musculus BAC clone RP23-9D24 from chromosome 5, complete sequence
          Length = 212792

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                   
Query: 155   acatagatgccgtccaggaacttcctgatgtccttgtt 192
             ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 87652 acatagatgccgtccaaaaacttcctgatatccttgtt 87689



to top

>gb|BC013165.1| Mus musculus ribosomal protein L9, mRNA (cDNA clone MGC:6543
           IMAGE:2655358), complete cds
          Length = 702

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 559 acatagatgccgtccaaaaacttcctgatatccttgtt 522



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 324 cgttgatggggaagtgagcgtacacagaacgcatcttgtatcggaagccc 275



to top

>ref|NM_011292.1| Mus musculus ribosomal protein L9 (Rpl9), mRNA
          Length = 694

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 569 acatagatgccgtccaaaaacttcctgatatccttgtt 532



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 334 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 285



to top

>gb|AC006679.2| Caenorhabditis elegans cosmid R13A5, complete sequence
          Length = 56448

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                           
Query: 391   cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
             ||||||||||||| ||||| || ||| | |||||||||||||||||
Sbjct: 33803 cgttgatggggaaatgggcatatacggaacgcatcttgtagcggaa 33848



to top

>ref|XR_003890.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L9
           (LOC672532), mRNA
          Length = 718

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 576 acatagatgccgtccaaaaacttcctgatatccttgtt 539



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 392 gttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           ||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 340 gttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 292



to top

>ref|XR_002003.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L9
           (LOC667290), mRNA
          Length = 718

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 576 acatagatgccgtccaaaaacttcctgatatccttgtt 539



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 392 gttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           ||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 340 gttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 292



to top

>ref|XM_982604.1| PREDICTED: Mus musculus similar to ribosomal protein L9
           (LOC637379), mRNA
          Length = 762

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 608 acatagatgccgtccaaaaacttcctgatatccttgtt 571



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 373 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 324



to top

>ref|XM_990486.1| PREDICTED: Mus musculus similar to ribosomal protein L9
           (LOC637379), mRNA
          Length = 653

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 506 acatagatgccgtccaaaaacttcctgatatccttgtt 469



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 271 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 222



to top

>ref|XM_925735.2| PREDICTED: Mus musculus similar to ribosomal protein L9, transcript
           variant 2 (LOC637379), mRNA
          Length = 660

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 506 acatagatgccgtccaaaaacttcctgatatccttgtt 469



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 271 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 222



to top

>ref|XM_484272.3| PREDICTED: Mus musculus similar to ribosomal protein L9
           (LOC432768), mRNA
          Length = 724

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 333 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 284



to top

>ref|XR_002858.1| PREDICTED: Mus musculus similar to ribosomal protein L9
           (LOC670203), mRNA
          Length = 714

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 576 acatagatgccgtccaaaaacttcctgatatccttgtt 539



to top

>ref|XR_004671.1| PREDICTED: Mus musculus similar to ribosomal protein L9
           (LOC674636), mRNA
          Length = 713

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 576 acatagatgccgtccaaaaacttcctgatatccttgtt 539



to top

>gb|AC129539.11| Mus musculus chromosome 16, clone RP23-246B24, complete sequence
          Length = 238585

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                    
Query: 155    acatagatgccgtccaggaacttcctgatgtccttgtt 192
              ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 141261 acatagatgccgtccaaaaacttcctgatatccttgtt 141224



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                               
Query: 392    gttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
              ||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 141025 gttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 140977



to top

>gb|AC107711.13| Mus musculus chromosome 14, clone RP23-291I12, complete sequence
          Length = 228302

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                    
Query: 155    acatagatgccgtccaggaacttcctgatgtccttgtt 192
              ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 216390 acatagatgccgtccaaaaacttcctgatatccttgtt 216353



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                
Query: 391    cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
              |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 216155 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 216106



to top

>gb|AC115752.8| Mus musculus chromosome 19, clone RP23-18M16, complete sequence
          Length = 214925

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                   
Query: 155   acatagatgccgtccaggaacttcctgatgtccttgtt 192
             ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 59842 acatagatgccgtccaaaaacttcctgatatccttgtt 59805



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 391   cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
             |||||||||||||||| ||||| ||  | |||||||||||  ||||||||
Sbjct: 59607 cgttgatggggaagtgagcgtacacagaccgcatcttgtattggaagccc 59558



to top

>gb|BC089319.1| Mus musculus ribosomal protein L9, mRNA (cDNA clone MGC:102001
           IMAGE:6823996), complete cds
          Length = 765

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 548 acatagatgccgtccaaaaacttcctgatatccttgtt 511



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 313 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 264



to top

>gb|AC097273.3| Genomic sequence for Mus musculus, clone RP23-118N13, complete sequence
          Length = 211657

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                                
Query: 391    cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
              |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 188335 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 188384



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                    
Query: 155    acatagatgccgtccaggaacttcctgatgtccttgtt 192
              ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 188100 acatagatgccgtccaaaaacttcctgatatccttgtt 188137



to top

>dbj|AK153562.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830175N05 product:ribosomal
           protein L9, full insert sequence
          Length = 694

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 569 acatagatgccgtccaaaaacttcctgatatccttgtt 532



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 334 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 285



to top

>dbj|AK159980.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched
           library, clone:I420041N04 product:ribosomal protein L9,
           full insert sequence
          Length = 694

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 569 acatagatgccgtccaaaaacttcctgatatccttgtt 532



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 334 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 285



to top

>dbj|AK168326.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730090P04 product:ribosomal protein L9, full
           insert sequence
          Length = 692

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 567 acatagatgccgtccaaaaacttcctgatatccttgtt 530



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 332 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 283



to top

>dbj|AK169217.1| Mus musculus 17 days embryo stomach cDNA, RIKEN full-length
           enriched library, clone:I920091H01 product:ribosomal
           protein L9, full insert sequence
          Length = 692

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 567 acatagatgccgtccaaaaacttcctgatatccttgtt 530



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 332 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 283



to top

>dbj|AK088166.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430005G08
           product:ribosomal protein L9, full insert sequence
          Length = 694

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 569 acatagatgccgtccaaaaacttcctgatatccttgtt 532



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 334 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 285



to top

>dbj|AK084278.1| Mus musculus 12 days embryo eyeball cDNA, RIKEN full-length
           enriched library, clone:D230017F17 product:ribosomal
           protein L9, full insert sequence
          Length = 695

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 570 acatagatgccgtccaaaaacttcctgatatccttgtt 533



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 335 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 286



to top

>dbj|AK012331.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2700038F06 product:ribosomal
           protein L9, full insert sequence
          Length = 693

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 569 acatagatgccgtccaaaaacttcctgatatccttgtt 532



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 334 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 285



to top

>dbj|AK012445.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2700056G17 product:ribosomal
           protein L9, full insert sequence
          Length = 694

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 569 acatagatgccgtccaaaaacttcctgatatccttgtt 532



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 334 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 285



to top

>ref|NM_066259.3| Caenorhabditis elegans Ribosomal Protein, Large subunit family
           member (rpl-9) (rpl-9) mRNA, complete cds
          Length = 630

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||||| ||||| || ||| | |||||||||||||||||
Sbjct: 317 cgttgatggggaaatgggcatatacggaacgcatcttgtagcggaa 272



to top

>dbj|AK017427.1| Mus musculus 10 days neonate head cDNA, RIKEN full-length enriched
           library, clone:5530400L19 product:ribosomal protein L9,
           full insert sequence
          Length = 694

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 569 acatagatgccgtccaaaaacttcctgatatccttgtt 532



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 334 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 285



to top

>dbj|AK017388.1| Mus musculus 6 days neonate head cDNA, RIKEN full-length enriched
           library, clone:5430433M11 product:ribosomal protein L9,
           full insert sequence
          Length = 694

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 569 acatagatgccgtccaaaaacttcctgatatccttgtt 532



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 334 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 285



to top

>gb|BC093526.1| Mus musculus ribosomal protein L9, mRNA (cDNA clone MGC:102392
           IMAGE:5150493), complete cds
          Length = 744

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 548 acatagatgccgtccaaaaacttcctgatatccttgtt 511



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 313 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 264



to top

>gb|AF260271.1|AF260271 Mus musculus 60S ribosomal Protein L9 mRNA, complete cds
          Length = 694

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 569 acatagatgccgtccaaaaacttcctgatatccttgtt 532



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 334 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 285



to top

>dbj|AK191132.1| Mus musculus cDNA, clone:Y1G0104P04, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000063797, based on BLAT search
          Length = 375

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 237 acatagatgccgtccaaaaacttcctgatatccttgtt 200



to top

>gb|BC086937.1| Mus musculus ribosomal protein L9, mRNA (cDNA clone MGC:107692
           IMAGE:6787671), complete cds
          Length = 709

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 566 acatagatgccgtccaaaaacttcctgatatccttgtt 529



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 331 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 282



to top

>emb|AL671898.7| Mouse DNA sequence from clone RP23-194K1 on chromosome X, complete
              sequence
          Length = 212406

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                
Query: 391    cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
              |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 102952 cgttgatggggaagtgagcgtacacagatcgcatcttgtatcggaagccc 102903



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                    
Query: 155    acatagatgccgtccaggaacttcctgatgtccttgtt 192
              ||||||||||||| ||  ||||||||||| ||||||||
Sbjct: 103187 acatagatgccgttcaaaaacttcctgatatccttgtt 103150



to top

>gb|AC154199.2| Mus musculus BAC clone RP24-396N5 from 13, complete sequence
          Length = 120685

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                               
Query: 391   cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
             |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 50485 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 50534



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                   
Query: 155   acatagatgccgtccaggaacttcctgatgtccttgtt 192
             ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 50250 acatagatgccgtccaaaaacttcctgatatccttgtt 50287



to top

>gb|AC101221.11| Mus musculus chromosome 13, clone RP23-96E4, complete sequence
          Length = 258193

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                                
Query: 391    cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
              |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 138710 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 138759



to top

>emb|CT025645.16| Mouse DNA sequence from clone RP23-233D21 on chromosome 13, complete
             sequence
          Length = 225179

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                   
Query: 155   acatagatgccgtccaggaacttcctgatgtccttgtt 192
             ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 50603 acatagatgccgtccaaaaacttcctgatatccttgtt 50566



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                               
Query: 391   cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
             |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 50368 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 50319



to top

>gb|AC154506.4| Mus musculus BAC clone RP24-94N16 from chromosome 13, complete sequence
          Length = 164500

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                               
Query: 391   cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
             |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 13442 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 13491



to top

>gb|AC164120.2| Mus musculus BAC clone RP24-289J17 from chromosome 14, complete
            sequence
          Length = 147050

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 155  acatagatgccgtccaggaacttcctgatgtccttgtt 192
            ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 9001 acatagatgccgtccaaaaacttcctgatatccttgtt 8964



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 391  cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
            |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 8766 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 8717



to top

>gb|U17332.1|MMU17332 Mus musculus ribosomal protein L9 (musl9) mRNA, partial cds
          Length = 519

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 505 acatagatgccgtccaaaaacttcctgatatccttgtt 468



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 270 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 221



to top

>gb|U17331.1|MMU17331 Mus musculus mutant ribosomal protein L9 (musl9mu) mRNA, partial
           cds
          Length = 519

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  ||||||||||| ||||||||
Sbjct: 505 acatagatgccgtccaaaaacttcctgatatccttgtt 468



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           |||||||||||||||| ||||| ||  | ||||||||||| |||||||||
Sbjct: 270 cgttgatggggaagtgagcgtacacagaccgcatcttgtatcggaagccc 221



to top

>ref|XM_799643.1| Trypanosoma cruzi strain CL Brener 60S ribosomal protein L9
           (Tc00.1047053504181.10) partial mRNA
          Length = 570

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 158 tagatgccgtccaggaacttcctgatgtccttgttcttcac 198
           |||||||||||||||||||| | ||| ||||| ||||||||
Sbjct: 533 tagatgccgtccaggaacttgcggatatcctttttcttcac 493



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 395 gatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           |||||| |||||||||||| ||||||| |||||  | |||||||||
Sbjct: 297 gatgggaaagtgggcgtaggcgaagcgaatcttaaaacggaagccc 252



to top

>ref|XM_801188.1| Trypanosoma cruzi strain CL Brener 60S ribosomal protein L9
           (Tc00.1047053511729.40) partial mRNA
          Length = 570

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 158 tagatgccgtccaggaacttcctgatgtccttgttcttcac 198
           |||||||||||||||||||| | ||| ||||| ||||||||
Sbjct: 533 tagatgccgtccaggaacttgcggatatcctttttcttcac 493



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 395 gatggggaagtgggcgtagacgaagcgcatctt 427
           |||||| |||||||||||| ||||||| |||||
Sbjct: 297 gatgggaaagtgggcgtaggcgaagcgaatctt 265



to top

>ref|XM_808451.1| Trypanosoma cruzi strain CL Brener 60S ribosomal protein L9
           (Tc00.1047053506835.30) partial mRNA
          Length = 570

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 158 tagatgccgtccaggaacttcctgatgtccttgttcttcac 198
           |||||||||||||||||||| | ||| ||||| ||||||||
Sbjct: 533 tagatgccgtccaggaacttgcggatatccttcttcttcac 493



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 395 gatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           |||||| |||||||||||| ||||||| |||||  | |||||||||
Sbjct: 297 gatgggaaagtgggcgtaggcgaagcgaatcttaaaacggaagccc 252



to top

>gb|AF548328.1| Branchiostoma belcheri ribosomal protein L9 mRNA, complete cds
          Length = 633

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 392 gttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           |||||||||||| |||||||| ||| | | ||||||||||||| |||||
Sbjct: 303 gttgatggggaaatgggcgtacacggacctcatcttgtagcggtagccc 255



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 158 tagatgccgtccaggaacttcctgatgtccttgttcttcac 198
           ||||| || |||| |||||| | ||||||||||||||||||
Sbjct: 536 tagattccatccaagaacttgcggatgtccttgttcttcac 496



to top

>ref|XM_812671.1| Trypanosoma cruzi strain CL Brener 60S ribosomal protein L9
           (Tc00.1047053509695.170) partial mRNA
          Length = 570

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 158 tagatgccgtccaggaacttcctgatgtccttgttcttcac 198
           |||||||||||||||||||| | ||| ||||| ||||||||
Sbjct: 533 tagatgccgtccaggaacttgcggatatcctttttcttcac 493



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 395 gatggggaagtgggcgtagacgaagcgcatctt 427
           |||||| |||||||||||| ||||||| |||||
Sbjct: 297 gatgggaaagtgggcgtaggcgaagcgaatctt 265



to top

>emb|AL161517.2|ATCHRIV29 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 29
          Length = 199861

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                         
Query: 149   tcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtggcatttc 208
             ||||| |||||||| || || || ||||||||||| ||||| |||||||| || ||||||
Sbjct: 95460 tcgctcacatagataccatcaagaaacttcctgatatccttcttcttcacatgacatttc 95519

              
Query: 209   t 209
             |
Sbjct: 95520 t 95520



to top

>emb|AL049524.1|ATF7L13 Arabidopsis thaliana DNA chromosome 4, BAC clone  F7L13 (ESSA project)
          Length = 95076

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                         
Query: 149   tcgctgacatagatgccgtccaggaacttcctgatgtccttgttcttcacgtggcatttc 208
             ||||| |||||||| || || || ||||||||||| ||||| |||||||| || ||||||
Sbjct: 35497 tcgctcacatagataccatcaagaaacttcctgatatccttcttcttcacatgacatttc 35556

              
Query: 209   t 209
             |
Sbjct: 35557 t 35557



to top

>emb|BX530083.11| Zebrafish DNA sequence from clone DKEY-3L17 in linkage group 10,
             complete sequence
          Length = 155046

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                          
Query: 142   gcccttgtcgctgacatagatgccgtccaggaacttcctgatgtc 186
             |||||| ||||||||||| || || ||||||||||||| ||||||
Sbjct: 63803 gcccttctcgctgacataaatcccatccaggaacttccagatgtc 63847



to top

>ref|XM_577847.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L9
           (LOC365386), mRNA
          Length = 642

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgttctt 195
           ||||||||||| ||||  ||||||||||| |||||||||||
Sbjct: 605 acatagatgccatccaaaaacttcctgatatccttgttctt 565



to top

>gb|AC161480.9| Mus musculus chromosome 15, clone RP23-404I10, complete sequence
          Length = 187202

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                 
Query: 157   atagatgccgtccaggaacttcctgatgtccttgtt 192
             ||||||||||||||  ||||||||||| ||||||||
Sbjct: 14305 atagatgccgtccaaaaacttcctgatatccttgtt 14270



to top

>gb|AC124678.7| Mus musculus chromosome 15, clone RP24-107K17, complete sequence
          Length = 137248

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                 
Query: 157   atagatgccgtccaggaacttcctgatgtccttgtt 192
             ||||||||||||||  ||||||||||| ||||||||
Sbjct: 50543 atagatgccgtccaaaaacttcctgatatccttgtt 50508



to top

>gb|AY130412.1| Petromyzon marinus ribosomal protein L9 mRNA, partial cds
          Length = 506

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||||||||| || ||  ||||||||||||| |||||
Sbjct: 267 ttgatggggaagtgggcatacaccgagcgcatcttgtaccggaa 224



to top

>dbj|AK105332.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-118-D01, full
           insert sequence
          Length = 649

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                       
Query: 392 gttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagcccttggtgacgcc 451
           ||||||||| ||||| || |||||||| |||||||||||   | |||||||| |||||||
Sbjct: 340 gttgatgggaaagtgagcatagacgaatcgcatcttgtacttgtagcccttgatgacgcc 281



to top

>gb|AC110244.10| Mus musculus chromosome 5, clone RP23-247E10, complete sequence
          Length = 214638

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 174    acttcctgatgtccttgttcttc 196
              |||||||||||||||||||||||
Sbjct: 125947 acttcctgatgtccttgttcttc 125925



to top

>gb|AY522617.1| Oreochromis mossambicus ribosomal protein L9-like mRNA, partial
           sequence
          Length = 765

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 214 gatcagggcagcagagcgggagacaagctcaatgtcattgccatccaggacgatctcgtc 273
           |||||| |||||||||  ||| || ||||||||||| || || |||||||| | ||||||
Sbjct: 411 gatcagagcagcagagttggacaccagctcaatgtcgttaccctccaggaccagctcgtc 352

              
Query: 274 ctt 276
           |||
Sbjct: 351 ctt 349



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||||| |||||||| ||| | ||||| ||||| |||||
Sbjct: 235 cgttgatggggaaatgggcgtacacggaacgcattttgtaccggaa 190



to top

>dbj|AK107388.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-127-C09, full
            insert sequence
          Length = 2566

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 245  atgtcattgccatccaggacgatctcgtccttgac 279
            ||||| |||||||||||||||| |||| |||||||
Sbjct: 1490 atgtcgttgccatccaggacgagctcgaccttgac 1524



to top

>dbj|AP004977.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT12A10, TM0160,
           complete sequence
          Length = 74313

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 173 aacttcctgatgtccttgttcttcacgtggcattt 207
           ||||||||||| ||||||||||| || ||||||||
Sbjct: 434 aacttcctgatatccttgttcttaacatggcattt 400



to top

>gb|BC086561.1| Rattus norvegicus ribosomal protein L9, mRNA (cDNA clone MGC:105798
           IMAGE:7304371), complete cds
          Length = 705

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||| ||||  ||||||||||| ||||||||
Sbjct: 548 acatagatgccatccaaaaacttcctgatatccttgtt 511



to top

>ref|XM_522512.1| PREDICTED: Pan troglodytes similar to KM-102-derived reductase-like
           factor (LOC467112), mRNA
          Length = 3489

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
           ||||||||||||||||||| || ||  | | ||||||||| |||||||||
Sbjct: 52  cgttgatggggaagtgggcatacacagacctcatcttgtaacggaagccc 3



to top

>ref|XM_960709.1| Neurospora crassa OR74A hypothetical protein (NCU00662.1) partial
            mRNA
          Length = 1104

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 264  cgatctcgtccttgaccttctc 285
            ||||||||||||||||||||||
Sbjct: 1041 cgatctcgtccttgaccttctc 1020



to top

>ref|XM_324841.1| Neurospora crassa OR74A hypothetical protein (NCU00662.1) partial
            mRNA
          Length = 1104

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 264  cgatctcgtccttgaccttctc 285
            ||||||||||||||||||||||
Sbjct: 1041 cgatctcgtccttgaccttctc 1020



to top

>gb|AC158987.3| Mus musculus BAC clone RP23-366K1 from chromosome 9, complete sequence
          Length = 222125

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                           
Query: 395   gatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
             |||||||||||| ||||| || || | ||||||||| |||||||||
Sbjct: 28756 gatggggaagtgagcgtatacaaacctcatcttgtaacggaagccc 28801



to top

>ref|XR_003389.1| PREDICTED: Mus musculus similar to ribosomal protein L9
           (LOC671349), mRNA
          Length = 706

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  |||||||||||  |||||||
Sbjct: 574 acatagatgccgtccaaaaacttcctgataaccttgtt 537



to top

>gb|AC125403.4| Mus musculus BAC clone RP23-4E15 from 1, complete sequence
          Length = 126790

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                   
Query: 155   acatagatgccgtccaggaacttcctgatgtccttgtt 192
             ||||||||||||||||  |||||||||||  |||||||
Sbjct: 51817 acatagatgccgtccaaaaacttcctgataaccttgtt 51854



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                              
Query: 392   gttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
             ||||||||||||||| ||||  ||  | ||||||||||| |||||||||
Sbjct: 52053 gttgatggggaagtgagcgtccacagaccgcatcttgtatcggaagccc 52101



to top

>gb|AC112147.5| Mus musculus BAC clone RP23-175E16 from 9, complete sequence
          Length = 202928

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 155   acatagatgccgtccaggaacttcctgatgtccttgtt 192
             ||||||||||| |||| |||||| ||||| ||||||||
Sbjct: 97356 acatagatgccatccaagaacttactgatatccttgtt 97319



to top

>ref|XM_791421.1| PREDICTED: Strongylocentrotus purpuratus similar to ribosomal
           protein L9 (LOC591874), mRNA
          Length = 666

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 158 tagatgccgtccaggaacttcctgatgtccttgttctt 195
           |||| ||| |||| ||| ||||||||||||||||||||
Sbjct: 557 tagacgccatccaagaatttcctgatgtccttgttctt 520



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 391 cgttgatggggaagtgggcgtagacgaagcgcatcttgtagcgg 434
           |||||||||||||||| ||||| ||  | | |||||||||||||
Sbjct: 325 cgttgatggggaagtgagcgtacacagacctcatcttgtagcgg 282



to top

>emb|X51706.1|RRRPL9 Rat mRNA for ribosomal protein L9
          Length = 671

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||| ||||  ||||||||||| ||||||||
Sbjct: 548 acatagatgccatccaaaaacttcctgatatccttgtt 511



to top

>emb|AJ843878.1| Platichthys flesus mRNA for 60S ribosomal protein L9 (rpl9 gene)
          Length = 769

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 239 agctcaatgtcattgccatccaggacgatctcgtcctt 276
           ||||||||||||||||| |||||||  | |||||||||
Sbjct: 469 agctcaatgtcattgccttccaggatcagctcgtcctt 432



to top

>emb|AJ421478.1| Mus musculus X-inactivation center region; segment 1/3
          Length = 247850

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                    
Query: 155    acatagatgccgtccaggaacttcctgatgtccttgtt 192
              ||||||||||| ||||  ||||||||||| ||||||||
Sbjct: 238832 acatagatgccatccaaaaacttcctgatatccttgtt 238869



to top

>emb|BX813929.1|CNS0AC47 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB48ZD08 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 700

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 383 gatggatgcgttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           |||||| ||||||||||| |  |||||||| ||||| | ||||||||| |||||
Sbjct: 316 gatggaggcgttgatgggaacatgggcgtacacgaacctcatcttgtaacggaa 263



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 58/68 (85%), Gaps = 3/68 (4%)
 Strand = Plus / Minus

                                                                       
Query: 155 acatagatg-ccgtccaggaacttcc--tgatgtccttgttcttcacgtggcatttctgg 211
           ||||||||| ||||| |||||||||   |||| ||||| ||||||||||| || ||||||
Sbjct: 549 acatagatgaccgtcaaggaacttcgcgtgatatccttcttcttcacgtgacacttctgg 490

                   
Query: 212 ttgatcag 219
           || |||||
Sbjct: 489 ttcatcag 482



to top

>gb|AY130413.1| Scyliorhinus canicula ribosomal protein L9-like mRNA, partial
           sequence
          Length = 501

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 215 atcagggcagcagagcgggagacaagctcaatgtcatt 252
           |||||||||||||||  ||| || ||||||||||||||
Sbjct: 441 atcagggcagcagagttggataccagctcaatgtcatt 404



to top

>gb|AF391091.1| Spodoptera frugiperda ribosomal protein L9 mRNA, complete cds
          Length = 737

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 392 gttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagcccttggt 445
           |||||||||||| |||||||| ||| | ||||| |||||  |||| ||||||||
Sbjct: 416 gttgatggggaaatgggcgtatacggaacgcattttgtactggaatcccttggt 363



to top

>ref|XM_234521.2| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L9
           (LOC314434), mRNA
          Length = 704

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||| ||||  ||||||||||| ||||||||
Sbjct: 573 acatagatgccatccaaaaacttcctgatatccttgtt 536



to top

>ref|XM_224924.2| PREDICTED: Rattus norvegicus similar to ribosomal protein L9
           (LOC306511), mRNA
          Length = 738

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||||||||  ||||| ||||| ||||||||
Sbjct: 701 acatagatgccgtccaaaaacttactgatatccttgtt 664



to top

>ref|XM_223094.3| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L9
           (LOC305087), mRNA
          Length = 801

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||| ||||  ||||||||||| ||||||||
Sbjct: 764 acatagatgccatccaaaaacttcctgatatccttgtt 727



to top

>ref|XM_221450.2| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L9
           (LOC303930), mRNA
          Length = 1026

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||| ||||  ||||||||||| ||||||||
Sbjct: 989 acatagatgccatccaaaaacttcctgatatccttgtt 952



to top

>ref|XM_345600.2| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L9
           (LOC366500), mRNA
          Length = 685

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgtt 192
           ||||||||||| ||||  ||||||||||| ||||||||
Sbjct: 551 acatagatgccatccaaaaacttcctgatatccttgtt 514



to top

>dbj|AK204218.1| Mus musculus cDNA, clone:Y1G0147K13, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000063797, based on BLAT search
          Length = 308

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 155 acatagatgccgtccaggaacttcctgatgtcct 188
           ||||||||||||||||  ||||||||||| ||||
Sbjct: 172 acatagatgccgtccaaaaacttcctgatatcct 139



to top

>dbj|AK173968.1| Ciona intestinalis cDNA, clone:ciad001f19, full insert sequence
          Length = 638

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 158 tagatgccgtccaggaacttcctgatgtccttgttctt 195
           ||||| ||||||| |||||| | |||||||||||||||
Sbjct: 547 tagattccgtccaagaactttcggatgtccttgttctt 510



to top

>emb|CT030181.13| Mouse DNA sequence from clone RP23-115A18 on chromosome 9, complete
              sequence
          Length = 281479

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                    
Query: 155    acatagatgccgtccaggaacttcctgatgtccttgtt 192
              ||||||||||||||||  ||||||| ||| ||||||||
Sbjct: 207060 acatagatgccgtccaaaaacttccagatatccttgtt 207023



to top

>gb|AC133166.2| Mus musculus BAC clone RP24-186D13 from 1, complete sequence
          Length = 158206

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                   
Query: 155   acatagatgccgtccaggaacttcctgatgtccttgtt 192
             ||||||||||||||||  |||||||||||  |||||||
Sbjct: 34743 acatagatgccgtccaaaaacttcctgataaccttgtt 34780



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                              
Query: 392   gttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
             ||||||||||||||| ||||  ||  | ||||||||||| |||||||||
Sbjct: 34979 gttgatggggaagtgagcgtccacagaccgcatcttgtatcggaagccc 35027



to top

>gb|AC138587.11| Mus musculus chromosome 9, clone RP24-160H16, complete sequence
          Length = 185915

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                            
Query: 395    gatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccc 440
              |||||||||||| ||||| || || | ||||||||| |||||||||
Sbjct: 172677 gatggggaagtgagcgtatacaaacctcatcttgtaacggaagccc 172722



to top

>emb|AL683845.15| Mouse DNA sequence from clone RP23-423B1 on chromosome X, complete
             sequence
          Length = 134201

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 155   acatagatgccgtccaggaacttcctgatgtccttgtt 192
             ||||||||||| ||||  ||||||||||| ||||||||
Sbjct: 64725 acatagatgccatccaaaaacttcctgatatccttgtt 64688



to top

>gb|DQ214109.1| Taeniopygia guttata clone 0058P0056F08 ribosomal protein L9-like
           mRNA, complete sequence
          Length = 783

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgttctt 195
           |||||||| || |||| ||| |||||||| |||||||||||
Sbjct: 617 acatagataccatccaagaatttcctgatatccttgttctt 577



to top

>gb|DQ214108.1| Taeniopygia guttata clone 0058P0018B08 ribosomal protein L9-like
           mRNA, complete sequence
          Length = 1025

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgttctt 195
           |||||||| || |||| ||| |||||||| |||||||||||
Sbjct: 851 acatagataccatccaagaatttcctgatatccttgttctt 811



to top

>gb|DQ214107.1| Taeniopygia guttata clone 0061P0006A08 ribosomal protein L9-like
           mRNA, complete sequence
          Length = 735

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgttctt 195
           |||||||| || |||| ||| |||||||| |||||||||||
Sbjct: 569 acatagataccatccaagaatttcctgatatccttgttctt 529



to top

>gb|DQ214106.1| Taeniopygia guttata clone 0061P0015B05 ribosomal protein L9-like
           mRNA, complete sequence
          Length = 737

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgttctt 195
           |||||||| || |||| ||| |||||||| |||||||||||
Sbjct: 569 acatagataccatccaagaatttcctgatatccttgttctt 529



to top

>gb|DQ214105.1| Taeniopygia guttata clone 0058P0059H09 ribosomal protein L9-like
           mRNA, complete sequence
          Length = 735

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgttctt 195
           |||||||| || |||| ||| |||||||| |||||||||||
Sbjct: 569 acatagataccatccaagaatttcctgatatccttgttctt 529



to top

>gb|DQ214104.1| Taeniopygia guttata clone 0061P0008H06 ribosomal protein L9-like
           mRNA, complete sequence
          Length = 732

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 155 acatagatgccgtccaggaacttcctgatgtccttgttctt 195
           |||||||| || |||| ||| |||||||| |||||||||||
Sbjct: 558 acatagataccatccaagaatttcctgatatccttgttctt 518



to top

>ref|XM_677359.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN9182.2), mRNA
          Length = 3150

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 234  agacaagctcaatgtcattgccatc 258
            ||||||||||| |||||||||||||
Sbjct: 1363 agacaagctcattgtcattgccatc 1387



to top

>ref|XR_002731.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L9
           (LOC435256), mRNA
          Length = 577

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 155 acatagatgccgtccaggaacttcctgat 183
           ||||||||||||||||  |||||||||||
Sbjct: 540 acatagatgccgtccaaaaacttcctgat 512



to top

>ref|XR_001972.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L9
           (LOC435256), mRNA
          Length = 577

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 155 acatagatgccgtccaggaacttcctgat 183
           ||||||||||||||||  |||||||||||
Sbjct: 540 acatagatgccgtccaaaaacttcctgat 512



to top

>ref|XM_001000482.1| PREDICTED: Mus musculus RIKEN cDNA 4930401B11 gene (4930401B11Rik),
            mRNA
          Length = 1421

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 43/49 (87%), Gaps = 1/49 (2%)
 Strand = Plus / Minus

                                                             
Query: 391  cgttgatggggaagtgggcgtagacga-agcgcatcttgtagcggaagc 438
            |||||||||||||||| || || |||| | ||||||||||| |||||||
Sbjct: 1154 cgttgatggggaagtgagcatacacgagaccgcatcttgtaacggaagc 1106



to top

>ref|XM_993539.1| PREDICTED: Mus musculus RIKEN cDNA 4930401B11 gene (4930401B11Rik),
            mRNA
          Length = 1421

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 43/49 (87%), Gaps = 1/49 (2%)
 Strand = Plus / Minus

                                                             
Query: 391  cgttgatggggaagtgggcgtagacga-agcgcatcttgtagcggaagc 438
            |||||||||||||||| || || |||| | ||||||||||| |||||||
Sbjct: 1154 cgttgatggggaagtgagcatacacgagaccgcatcttgtaacggaagc 1106



to top

>ref|XM_986150.1| PREDICTED: Mus musculus RIKEN cDNA 4930401B11 gene (4930401B11Rik),
            mRNA
          Length = 1421

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 43/49 (87%), Gaps = 1/49 (2%)
 Strand = Plus / Minus

                                                             
Query: 391  cgttgatggggaagtgggcgtagacga-agcgcatcttgtagcggaagc 438
            |||||||||||||||| || || |||| | ||||||||||| |||||||
Sbjct: 1154 cgttgatggggaagtgagcatacacgagaccgcatcttgtaacggaagc 1106



to top

>ref|XM_817275.1| Trypanosoma brucei TREU927 60S ribosomal protein L9 (Tb10.70.7010)
           partial mRNA
          Length = 570

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 158 tagatgccgtccaggaacttcctgatgtccttgttcttcac 198
           ||||||||||||| |||||| | ||| ||||| ||||||||
Sbjct: 533 tagatgccgtccaagaacttacggatatccttcttcttcac 493



to top

>emb|AL669948.8| Mouse DNA sequence from clone RP23-248K2 on chromosome 11, complete
              sequence
          Length = 223030

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 155    acatagatgccgtccaggaacttcctgat 183
              ||||||||||||||||  |||||||||||
Sbjct: 138460 acatagatgccgtccaaaaacttcctgat 138432



to top

>emb|AM049015.1| Meladema coriacea mRNA for ribosomal protein L9e (rpL9e gene)
          Length = 570

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 344 aggaagttcctgatctcgatg 364
           |||||||||||||||||||||
Sbjct: 347 aggaagttcctgatctcgatg 327



to top

>emb|CR713603.2|CNS0GDKF Tetraodon nigroviridis full-length cDNA
          Length = 505

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccct 441
           ||||||||||| ||||| || ||| ||||||| ||||| ||||| ||||
Sbjct: 81  ttgatggggaaatgggcatacacggagcgcattttgtaccggaaaccct 33



to top

>emb|CR710996.2|CNS0GBK0 Tetraodon nigroviridis full-length cDNA
          Length = 525

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaagccct 441
           ||||||||||| ||||| || ||| ||||||| ||||| ||||| ||||
Sbjct: 101 ttgatggggaaatgggcatacacggagcgcattttgtaccggaaaccct 53



to top

>emb|AL031644.1|SPCC613 S.pombe chromosome III cosmid c613
          Length = 28999

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                          
Query: 392   gttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
             ||||||||| ||||| || ||||| |  |||||||||||||||||
Sbjct: 10279 gttgatgggaaagtgagcatagacaagacgcatcttgtagcggaa 10235



to top

>emb|CR932039.2| Medicago truncatula chromosome 5 clone mth2-6h11, COMPLETE SEQUENCE
          Length = 132508

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 232    ggagacaagctcaatgtcatt 252
              |||||||||||||||||||||
Sbjct: 102351 ggagacaagctcaatgtcatt 102371



to top

>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 267     tctcgtccttgaccttctcgg 287
               |||||||||||||||||||||
Sbjct: 3203932 tctcgtccttgaccttctcgg 3203912



to top

>ref|NM_001022689.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPCC613.06),
           partial mRNA
          Length = 570

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 392 gttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||| ||||| || ||||| |  |||||||||||||||||
Sbjct: 300 gttgatgggaaagtgagcatagacaagacgcatcttgtagcggaa 256



to top

>ref|XM_309298.2| Anopheles gambiae str. PEST ENSANGP00000018425
           (ENSANGG00000015936), partial mRNA
          Length = 2034

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 167 tccaggaacttcctgatgtccttgt 191
           |||||||||||| ||||||||||||
Sbjct: 395 tccaggaacttcttgatgtccttgt 371



to top

>emb|AL928604.9| Mouse DNA sequence from clone RP23-220K22 on chromosome 2, complete
              sequence
          Length = 181572

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 43/49 (87%), Gaps = 1/49 (2%)
 Strand = Plus / Plus

                                                               
Query: 391    cgttgatggggaagtgggcgtagacga-agcgcatcttgtagcggaagc 438
              |||||||||||||||| || || |||| | ||||||||||| |||||||
Sbjct: 130194 cgttgatggggaagtgagcatacacgagaccgcatcttgtaacggaagc 130242



to top

>ref|NM_172863.2| Mus musculus zinc finger protein 697 (Zfp697), mRNA
          Length = 4731

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 424  tcttgtagcggaagcccttg 443
            ||||||||||||||||||||
Sbjct: 1740 tcttgtagcggaagcccttg 1721



to top

>gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Philadelphia 1, complete
              genome
          Length = 3397754

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 79     gctaccggctacagaggagc 98
              ||||||||||||||||||||
Sbjct: 168290 gctaccggctacagaggagc 168309



to top

>ref|XM_360693.1| Magnaporthe grisea 70-15 hypothetical protein (MG03236.4) partial
           mRNA
          Length = 720

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 270 cgtccttgaccttctcggac 289
           ||||||||||||||||||||
Sbjct: 619 cgtccttgaccttctcggac 600



to top

>ref|XM_593641.2| PREDICTED: Bos taurus similar to zinc finger protein 697 (LOC540379),
            mRNA
          Length = 1787

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 424  tcttgtagcggaagcccttg 443
            ||||||||||||||||||||
Sbjct: 1615 tcttgtagcggaagcccttg 1596



to top

>ref|XM_983276.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L9
           (LOC546500), mRNA
          Length = 579

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 155 acatagatgccgtccaggaacttcctga 182
           ||||||||||||||||  ||||||||||
Sbjct: 542 acatagatgccgtccaaaaacttcctga 515



to top

>ref|XM_910917.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L9
           (LOC546500), mRNA
          Length = 579

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 155 acatagatgccgtccaggaacttcctga 182
           ||||||||||||||||  ||||||||||
Sbjct: 542 acatagatgccgtccaaaaacttcctga 515



to top

>ref|XM_621250.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L9
           (LOC546500), mRNA
          Length = 579

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 155 acatagatgccgtccaggaacttcctga 182
           ||||||||||||||||  ||||||||||
Sbjct: 542 acatagatgccgtccaaaaacttcctga 515



to top

>ref|XM_755893.1| Ustilago maydis 521 hypothetical protein (UM04839.1) partial mRNA
          Length = 759

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 392 gttgatggggaagtgggcgtagac 415
           |||||||||||| |||||||||||
Sbjct: 486 gttgatggggaaatgggcgtagac 463



to top

>ref|XM_380810.1| Gibberella zeae PH-1 chromosome 1 conserved hypothetical protein
           (FG00634.1) partial mRNA
          Length = 714

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 268 ctcgtccttgaccttctcgg 287
           ||||||||||||||||||||
Sbjct: 615 ctcgtccttgaccttctcgg 596



to top

>emb|CR734261.2|CNS0GTC4 Tetraodon nigroviridis full-length cDNA
          Length = 729

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 309 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 266



to top

>emb|CR643175.2|CNS0EV8T Tetraodon nigroviridis full-length cDNA
          Length = 663

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265



to top

>emb|CR734020.2|CNS0GT5F Tetraodon nigroviridis full-length cDNA
          Length = 731

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 309 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 266



to top

>emb|CR729736.3|CNS0GQ0E Tetraodon nigroviridis full-length cDNA
          Length = 732

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265



to top

>emb|CR728488.2|CNS0GP1Q Tetraodon nigroviridis full-length cDNA
          Length = 602

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265



to top

>emb|CR727712.2|CNS0GOG6 Tetraodon nigroviridis full-length cDNA
          Length = 728

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265



to top

>emb|CR720190.2|CNS0GIN8 Tetraodon nigroviridis full-length cDNA
          Length = 729

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265



to top

>emb|CR723145.2|CNS0GKXB Tetraodon nigroviridis full-length cDNA
          Length = 703

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 292 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 249



to top

>emb|CR722790.2|CNS0GKNG Tetraodon nigroviridis full-length cDNA
          Length = 732

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265



to top

>emb|CR722547.2|CNS0GKGP Tetraodon nigroviridis full-length cDNA
          Length = 731

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265



to top

>emb|CR721878.2|CNS0GJY4 Tetraodon nigroviridis full-length cDNA
          Length = 633

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 211 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 168



to top

>emb|CR721818.2|CNS0GJWG Tetraodon nigroviridis full-length cDNA
          Length = 602

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265



to top

>emb|CR721507.2|CNS0GJNT Tetraodon nigroviridis full-length cDNA
          Length = 732

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265



to top

>emb|CR721405.2|CNS0GJKZ Tetraodon nigroviridis full-length cDNA
          Length = 733

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265



to top

>emb|CR719586.2|CNS0GI6G Tetraodon nigroviridis full-length cDNA
          Length = 601

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265



to top

>emb|CR719506.2|CNS0GI48 Tetraodon nigroviridis full-length cDNA
          Length = 715

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 307 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 264



to top

>emb|CR719443.2|CNS0GI2H Tetraodon nigroviridis full-length cDNA
          Length = 594

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265



to top

>emb|CR718873.2|CNS0GHMN Tetraodon nigroviridis full-length cDNA
          Length = 731

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265



to top

>emb|CR718351.2|CNS0GH85 Tetraodon nigroviridis full-length cDNA
          Length = 793

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 373 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 330



to top

>emb|CR718349.2|CNS0GH83 Tetraodon nigroviridis full-length cDNA
          Length = 731

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265



to top

>emb|CR718139.2|CNS0GH29 Tetraodon nigroviridis full-length cDNA
          Length = 731

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265



to top

>emb|CR718048.2|CNS0GGZQ Tetraodon nigroviridis full-length cDNA
          Length = 730

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265



to top

>emb|CR717531.2|CNS0GGLD Tetraodon nigroviridis full-length cDNA
          Length = 730

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 306 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 263



to top

>emb|CR717402.2|CNS0GGHS Tetraodon nigroviridis full-length cDNA
          Length = 732

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265



to top

>emb|CR717342.2|CNS0GGG4 Tetraodon nigroviridis full-length cDNA
          Length = 727

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 307 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 264



to top

>emb|CR717312.2|CNS0GGFA Tetraodon nigroviridis full-length cDNA
          Length = 727

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265



to top

>emb|CR716888.2|CNS0GG3L Tetraodon nigroviridis full-length cDNA
          Length = 732

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265



to top

>emb|CR716644.2|CNS0GFWT Tetraodon nigroviridis full-length cDNA
          Length = 732

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265



to top

>emb|CR716271.2|CNS0GFMG Tetraodon nigroviridis full-length cDNA
          Length = 730

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265



to top

>emb|CR716057.2|CNS0GFGL Tetraodon nigroviridis full-length cDNA
          Length = 758

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 335 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 292



to top

>emb|CR715737.2|CNS0GF7P Tetraodon nigroviridis full-length cDNA
          Length = 732

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265



to top

>emb|CR715478.2|CNS0GF0I Tetraodon nigroviridis full-length cDNA
          Length = 781

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 357 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 314



to top

>emb|CR713105.2|CNS0GD6L Tetraodon nigroviridis full-length cDNA
          Length = 685

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 261 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 218



to top

>emb|CR712105.2|CNS0GCET Tetraodon nigroviridis full-length cDNA
          Length = 726

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265



to top

>emb|CR710960.2|CNS0GBJ0 Tetraodon nigroviridis full-length cDNA
          Length = 732

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265



to top

>emb|CR710739.2|CNS0GBCV Tetraodon nigroviridis full-length cDNA
          Length = 759

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 335 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 292



to top

>emb|CR710686.2|CNS0GBBE Tetraodon nigroviridis full-length cDNA
          Length = 727

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265



to top

>emb|CR710419.2|CNS0GB3Z Tetraodon nigroviridis full-length cDNA
          Length = 732

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265



to top

>emb|CR710040.2|CNS0GATG Tetraodon nigroviridis full-length cDNA
          Length = 758

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 334 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 291



to top

>emb|CR709752.2|CNS0GALG Tetraodon nigroviridis full-length cDNA
          Length = 759

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 335 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 292



to top

>emb|CR709702.2|CNS0GAK2 Tetraodon nigroviridis full-length cDNA
          Length = 730

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265



to top

>emb|CR709204.2|CNS0GA68 Tetraodon nigroviridis full-length cDNA
          Length = 726

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265



to top

>emb|CR709020.2|CNS0GA14 Tetraodon nigroviridis full-length cDNA
          Length = 732

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265



to top

>emb|CR708592.2|CNS0G9P8 Tetraodon nigroviridis full-length cDNA
          Length = 732

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265



to top

>emb|CR708146.2|CNS0G9CU Tetraodon nigroviridis full-length cDNA
          Length = 732

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 393 ttgatggggaagtgggcgtagacgaagcgcatcttgtagcggaa 436
           ||||||||||| ||||| || ||| ||||||| ||||| |||||
Sbjct: 308 ttgatggggaaatgggcatacacggagcgcattttgtaccggaa 265


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,976,305
Number of Sequences: 3902068
Number of extensions: 2976305
Number of successful extensions: 57210
Number of sequences better than 10.0: 445
Number of HSP's better than 10.0 without gapping: 440
Number of HSP's successfully gapped in prelim test: 5
Number of HSP's that attempted gapping in prelim test: 56038
Number of HSP's gapped (non-prelim): 1166
length of query: 468
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 446
effective length of database: 17,147,199,772
effective search space: 7647651098312
effective search space used: 7647651098312
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top