ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags24f04 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|D38090.1|WHTPH2AD Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-9 Length = 704 Score = 708 bits (357), Expect = 0.0 Identities = 449/479 (93%), Gaps = 3/479 (0%) Strand = Plus / Minus Query: 145 ggctactccttggcggcgggggccttcttcttgggggacttggtggccgtcttcttcttg 204 |||||||||||||||||| |||||||||||||||||||||||| |||||||||||| Sbjct: 505 ggctactccttggcggcga---ccttcttcttgggggacttggtggaggtcttcttcttg 449 Query: 205 ggcgacttggtctccttctcggcggcggcggtggacttcttcgggagaagaacagagttg 264 |||||||||| |||||||||||||||||||| ||||||||| ||||| || || |||||| Sbjct: 448 ggcgacttggcctccttctcggcggcggcgggggacttcttggggagcagcacggagttg 389 Query: 265 atgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctcc 324 ||||||||||| || || |||||||||||||||||||| ||||||||||| ||||||||| Sbjct: 388 atgttggggatcacgccaccgtgggcgatggtgacgccagcgagcagcctgccgagctcc 329 Query: 325 tggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtcc 384 |||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 328 tggtcgttgcggacagcgagcagcaggtggcgcgggatgatgcgggtcttcttgttgtcc 269 Query: 385 ttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggcg 444 |||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| Sbjct: 268 ttggccgcgttgccggcaagctccagcacctcggcggcgaggtactcgaggacggcggcg 209 Query: 445 aggtagacgggggcgccggagccgacgcgctgggcgtaacggcccttcttgaggtaacgc 504 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| Sbjct: 208 aggtagacgggggcgccggagccgacgcgctgggcgtagcggcccttcttgaggtagcgc 149 Query: 505 ccgatgcggccgacggggaactggagcccggccttgacggacctggtcaccgccttcttc 564 ||||||||||||||||||||||||||||||||||| ||||| | |||||||||||||||| Sbjct: 148 ccgatgcggccgacggggaactggagcccggccttcacggagcgggtcaccgccttcttc 89 Query: 565 ctgtcgccgcccttcctcccggccatcttcttgcttgctacttctccggcgaactggaa 623 ||||||||||||||||| ||||||||||||||||||||| | |||||||||| |||||| Sbjct: 88 ctgtcgccgcccttccttccggccatcttcttgcttgctgcgtctccggcgagctggaa 30
>dbj|D38087.1|WHTPH2AA Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-2 Length = 717 Score = 688 bits (347), Expect = 0.0 Identities = 493/539 (91%), Gaps = 12/539 (2%) Strand = Plus / Minus Query: 83 actgctcatcttgtccatgagaaatggaac---gaagcaacacaggctaggctatggg-- 137 |||||||||||||||||||||||||||||| | ||||| || |||||||||||||| Sbjct: 592 actgctcatcttgtccatgagaaatggaacagagcagcaagactggctaggctatgggaa 533 Query: 138 tgcgggcggctactccttggcggcgggggccttcttcttgggggacttggtggccgtctt 197 || || |||||||||||||| ||| | || |||||||||||||||||||| ||| | ||| Sbjct: 532 tggggacggctactccttggtggctgcggtcttcttcttgggggacttggcggcggcctt 473 Query: 198 cttcttgggcgacttggtctccttctcggcggcggcggtggacttcttcgggagaagaac 257 || ||||||||| ||||||||||||||| |||| ||||||||| ||||| || || Sbjct: 472 ct------gcgacttggcctccttctcggcggctgcgggggacttcttggggagcagcac 419 Query: 258 agagttgatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttcc 317 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| || Sbjct: 418 ggagttgatgttggggatgacgccgccgtgggcgatggtgacgccggcgagcagcctgcc 359 Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| Sbjct: 358 gagctcctggtcgttgcggacggccagcagcaggtggcgcgggatgatgcgcgtcttctt 299 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 ||||||||||||||||||||||||||||||||| | |||||| ||||||||||||||||| Sbjct: 298 gttgtccttggccgcgttgccggcaagctccaggacctcggcggcgaggtactcgaggac 239 Query: 438 ggcggcgaggtagacgggggcgccggagccgacgcgctgggcgtaacggcccttcttgag 497 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 238 ggcggcgaggtagacgggggcgccggagccgacgcgctgggcgtagcggcccttcttgag 179 Query: 498 gtaacgcccgatgcggccgacggggaactggagcccggccttgacggacctggtcaccgc 557 ||| |||||||||||||||||||||||||| ||||||||||||||||| | ||||||||| Sbjct: 178 gtagcgcccgatgcggccgacggggaactgcagcccggccttgacggagcgggtcaccgc 119 Query: 558 cttcttcctgtcgccgcccttcctcccggccatcttcttgcttgctacttctccggcga 616 |||||||||||||||||||||||| |||||||||||||| |||||| |||||||||||| Sbjct: 118 cttcttcctgtcgccgcccttccttccggccatcttctt-cttgctgcttctccggcga 61
>dbj|D38088.1|WHTPH2AB Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-3 Length = 1153 Score = 620 bits (313), Expect = e-174 Identities = 438/478 (91%), Gaps = 5/478 (1%) Strand = Plus / Minus Query: 124 ggctaggctatggg--tgcgggcggctactccttggcggcgggggccttcttcttggggg 181 |||||||||||||| || || |||||||||||||| ||| | || |||||||||||||| Sbjct: 555 ggctaggctatggggatggggacggctactccttggtggctgcggtcttcttcttggggg 496 Query: 182 acttggtggccgtcttcttcttgggcgacttggt---ctccttctcggcggcggcggtgg 238 |||||||||| | ||||||||||||||||||||| |||||||||||||||| ||| || Sbjct: 495 acttggtggcggccttcttcttgggcgacttggtggactccttctcggcggcgccggcgg 436 Query: 239 acttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtga 298 |||||| ||||| || || |||||||||||||||||||| ||||||||||||||||||| Sbjct: 435 ccttcttggggagcagcacggagttgatgttggggatgacgccgccgtgggcgatggtga 376 Query: 299 cgccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcg 358 |||||||||||||||| || ||||||||||||||||||||||| |||||||||||||||| Sbjct: 375 cgccggcgagcagcctgcccagctcctggtcgttgcggacggccagcagcaggtggcgcg 316 Query: 359 ggatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagcagctcgg 418 |||||||||| ||||||||||||||||||||||||||||||| |||||||| | ||||| Sbjct: 315 ggatgatgcgcgtcttcttgttgtccttggccgcgttgccggcgagctccaggacctcgg 256 Query: 419 cagcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctggg 478 | ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | Sbjct: 255 cggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacggcctgcg 196 Query: 479 cgtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagcccggcct 538 |||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 195 cgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcccggcct 136 Query: 539 tgacggacctggtcaccgccttcttcctgtcgccgcccttcctcccggccatcttctt 596 | ||||| | |||||||||||||||||| |||||||||||||| |||||||||||||| Sbjct: 135 tcacggagcgggtcaccgccttcttcctctcgccgcccttccttccggccatcttctt 78
>emb|X94973.1|TAH2A274 T.aestivum histone H2A gene (clone TH274) Length = 2546 Score = 444 bits (224), Expect = e-121 Identities = 366/411 (89%), Gaps = 8/411 (1%) Strand = Plus / Minus Query: 3 cctacagaaat-acagatacaatgtcacccttgctgcgccaatctaagaacagaagcact 61 ||||||||||| ||||| |||||| |||||||||| || |||||||| |||||| ||| Sbjct: 2466 cctacagaaatcacagacacaatgccacccttgctcagcgaatctaaggacagaacgact 2407 Query: 62 gctcatctaactaaccaaaagactgctcatcttgtccatgagaaatggaacgaagcaaca 121 ||||||||||||||||||||||||||||||||||||| |||||||||| | |||||||| Sbjct: 2406 actcatctaactaaccaaaagactgctcatcttgtccacgagaaatggatctaagcaaca 2347 Query: 122 caggctaggctatgggtgcgggcggctactccttggcggcgggggccttcttcttggggg 181 ||||| ||||||| || ||||||||||||||| ||||||||||||||| Sbjct: 2346 atggctatgctatgg----ggaattctactccttggcggcaa---ccttcttcttggggg 2294 Query: 182 acttggtggccgtcttcttcttgggcgacttggtctccttctcggcggcggcggtggact 241 ||||||||| |||||||||||||||||||||| |||||||||||||||||||| ||||| Sbjct: 2293 acttggtggaggtcttcttcttgggcgacttggcctccttctcggcggcggcgggggact 2234 Query: 242 tcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgacgc 301 |||| || || || || |||||||| |||||||||| |||||||||||||||||||||| Sbjct: 2233 tcttgggcagcagcacggagttgattgtggggatgacgccgccgtgggcgatggtgacgc 2174 Query: 302 cggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcggga 361 |||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2173 cggcaagcagcctgccgagctcctggtcgttgcggacggcgagcagcaggtggcgcggga 2114 Query: 362 tgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagca 412 |||||||| ||||||||||||||||||| |||||||||||||||||||||| Sbjct: 2113 tgatgcgggtcttcttgttgtccttggctgcgttgccggcaagctccagca 2063 Score = 317 bits (160), Expect = 2e-83 Identities = 195/204 (95%), Gaps = 2/204 (0%) Strand = Plus / Minus Query: 414 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcg 473 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 1966 ctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgatgcg 1907 Query: 474 ctgggcgtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagccc 533 ||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 1906 ctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagccc 1847 Query: 534 ggccttgacggacctggtcaccgccttcttcctgtcgccgcccttcctcccggccatctt 593 |||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 1846 ggccttcacggacctggtcaccgccttcttcctgtcgccgcccttccttccggccatctt 1787 Query: 594 -cttgcttgctacttctccggcga 616 ||||| | ||||||||||||||| Sbjct: 1786 gcttgc-tactacttctccggcga 1764
>gb|L75802.1|WHTHIH2A Triticum aestivum histone H2A gene, complete cds Length = 2546 Score = 444 bits (224), Expect = e-121 Identities = 366/411 (89%), Gaps = 8/411 (1%) Strand = Plus / Minus Query: 3 cctacagaaat-acagatacaatgtcacccttgctgcgccaatctaagaacagaagcact 61 ||||||||||| ||||| |||||| |||||||||| || |||||||| |||||| ||| Sbjct: 2466 cctacagaaatcacagacacaatgccacccttgctcagcgaatctaaggacagaacgact 2407 Query: 62 gctcatctaactaaccaaaagactgctcatcttgtccatgagaaatggaacgaagcaaca 121 ||||||||||||||||||||||||||||||||||||| |||||||||| | |||||||| Sbjct: 2406 actcatctaactaaccaaaagactgctcatcttgtccacgagaaatggatctaagcaaca 2347 Query: 122 caggctaggctatgggtgcgggcggctactccttggcggcgggggccttcttcttggggg 181 ||||| ||||||| || ||||||||||||||| ||||||||||||||| Sbjct: 2346 atggctatgctatgg----ggaattctactccttggcggcaa---ccttcttcttggggg 2294 Query: 182 acttggtggccgtcttcttcttgggcgacttggtctccttctcggcggcggcggtggact 241 ||||||||| |||||||||||||||||||||| |||||||||||||||||||| ||||| Sbjct: 2293 acttggtggaggtcttcttcttgggcgacttggcctccttctcggcggcggcgggggact 2234 Query: 242 tcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgacgc 301 |||| || || || || |||||||| |||||||||| |||||||||||||||||||||| Sbjct: 2233 tcttgggcagcagcacggagttgattgtggggatgacgccgccgtgggcgatggtgacgc 2174 Query: 302 cggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcggga 361 |||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2173 cggcaagcagcctgccgagctcctggtcgttgcggacggcgagcagcaggtggcgcggga 2114 Query: 362 tgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagca 412 |||||||| ||||||||||||||||||| |||||||||||||||||||||| Sbjct: 2113 tgatgcgggtcttcttgttgtccttggctgcgttgccggcaagctccagca 2063 Score = 317 bits (160), Expect = 2e-83 Identities = 195/204 (95%), Gaps = 2/204 (0%) Strand = Plus / Minus Query: 414 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcg 473 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 1966 ctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgatgcg 1907 Query: 474 ctgggcgtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagccc 533 ||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 1906 ctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagccc 1847 Query: 534 ggccttgacggacctggtcaccgccttcttcctgtcgccgcccttcctcccggccatctt 593 |||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 1846 ggccttcacggacctggtcaccgccttcttcctgtcgccgcccttccttccggccatctt 1787 Query: 594 -cttgcttgctacttctccggcga 616 ||||| | ||||||||||||||| Sbjct: 1786 gcttgc-tactacttctccggcga 1764
>gb|BT016569.1| Zea mays clone Contig402 mRNA sequence Length = 719 Score = 385 bits (194), Expect = e-103 Identities = 278/306 (90%) Strand = Plus / Minus Query: 261 gttgatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgag 320 |||||||||||||| ||| ||||||||||||||||||||||||| |||||| | ||||| Sbjct: 471 gttgatgttggggaggacgccgccgtgggcgatggtgacgccggacagcagcttgccgag 412 Query: 321 ctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgtt 380 ||||| ||||||||||| ||| || |||| ||||||||||||||||||| |||||||||| Sbjct: 411 ctcctcgtcgttgcggatggcaaggagcacgtggcgcgggatgatgcgggtcttcttgtt 352 Query: 381 gtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 440 ||||||||| ||||||||||| |||||||||| |||||| || ||||||||||||||||| Sbjct: 351 gtccttggcagcgttgccggccagctccagcacctcggcggccaggtactcgaggacggc 292 Query: 441 ggcgaggtagacgggggcgccggagccgacgcgctgggcgtaacggcccttcttgaggta 500 ||| ||||||||||||||||| | |||||||||||| ||||| ||||||||||| ||||| Sbjct: 291 ggccaggtagacgggggcgcccgtgccgacgcgctgcgcgtaccggcccttcttcaggta 232 Query: 501 acgcccgatgcggccgacggggaactggagcccggccttgacggacctggtcaccgcctt 560 |||||||||||||||||||| ||||| |||||||||||||||||||| ||||||| ||| Sbjct: 231 ccgcccgatgcggccgacgggaaactgcagcccggccttgacggacctcgtcaccgactt 172 Query: 561 cttcct 566 |||||| Sbjct: 171 cttcct 166
>gb|AY103710.1| Zea mays PCO123562 mRNA sequence Length = 770 Score = 385 bits (194), Expect = e-103 Identities = 278/306 (90%) Strand = Plus / Minus Query: 261 gttgatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgag 320 |||||||||||||| ||| ||||||||||||||||||||||||| |||||| | ||||| Sbjct: 471 gttgatgttggggaggacgccgccgtgggcgatggtgacgccggacagcagcttgccgag 412 Query: 321 ctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgtt 380 ||||| ||||||||||| ||| || |||| ||||||||||||||||||| |||||||||| Sbjct: 411 ctcctcgtcgttgcggatggcaaggagcacgtggcgcgggatgatgcgggtcttcttgtt 352 Query: 381 gtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 440 ||||||||| ||||||||||| |||||||||| |||||| || ||||||||||||||||| Sbjct: 351 gtccttggcagcgttgccggccagctccagcacctcggcggccaggtactcgaggacggc 292 Query: 441 ggcgaggtagacgggggcgccggagccgacgcgctgggcgtaacggcccttcttgaggta 500 ||| ||||||||||||||||| | |||||||||||| ||||| ||||||||||| ||||| Sbjct: 291 ggccaggtagacgggggcgcccgtgccgacgcgctgcgcgtaccggcccttcttcaggta 232 Query: 501 acgcccgatgcggccgacggggaactggagcccggccttgacggacctggtcaccgcctt 560 |||||||||||||||||||| ||||| |||||||||||||||||||| ||||||| ||| Sbjct: 231 ccgcccgatgcggccgacgggaaactgcagcccggccttgacggacctcgtcaccgactt 172 Query: 561 cttcct 566 |||||| Sbjct: 171 cttcct 166 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 198 cttcttgggcgacttggtctcctt 221 ||||||||||||||||| |||||| Sbjct: 537 cttcttgggcgacttggcctcctt 514
>gb|BT019008.1| Zea mays clone Contig499.F mRNA sequence Length = 674 Score = 339 bits (171), Expect = 7e-90 Identities = 274/307 (89%), Gaps = 1/307 (0%) Strand = Plus / Minus Query: 261 gttgatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttcc-ga 319 |||||||||||| | || ||||||||||||||||| ||||||| ||||||||||| || Sbjct: 429 gttgatgttgggcaacacgccgccgtgggcgatggtcacgccggtcagcagccttcccga 370 Query: 320 gctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgt 379 |||||| ||||||||||| || ||||||| ||||||||||| |||||| ||||||||| Sbjct: 369 gctcctcgtcgttgcggatcgccagcagcacgtggcgcgggacgatgcgcgtcttcttgt 310 Query: 380 tgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacgg 439 |||||||||| ||||||||||| |||||||| | ||| || ||||||||||| ||||||| Sbjct: 309 tgtccttggcagcgttgccggcgagctccaggacctcagcggcgaggtactccaggacgg 250 Query: 440 cggcgaggtagacgggggcgccggagccgacgcgctgggcgtaacggcccttcttgaggt 499 | ||||||||||||||||| ||| |||||||||||| ||||| |||||||||||||||| Sbjct: 249 ccgcgaggtagacgggggcaccgctgccgacgcgctgcgcgtagcggcccttcttgaggt 190 Query: 500 aacgcccgatgcggccgacggggaactggagcccggccttgacggacctggtcaccgcct 559 | |||||||||||||||||||||||||||||||||||||| |||||||| ||||||| || Sbjct: 189 agcgcccgatgcggccgacggggaactggagcccggccttcacggacctcgtcaccgact 130 Query: 560 tcttcct 566 ||||||| Sbjct: 129 tcttcct 123 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 198 cttcttgggcgacttggtctcctt 221 ||||||||||||||||| |||||| Sbjct: 504 cttcttgggcgacttggcctcctt 481
>dbj|AK121750.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087I02, full insert sequence Length = 754 Score = 337 bits (170), Expect = 3e-89 Identities = 272/306 (88%) Strand = Plus / Minus Query: 261 gttgatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgag 320 |||||||||||| | || || ||||| |||||||| |||||||| |||||| | ||||| Sbjct: 468 gttgatgttgggcagcacgcctccgtgcgcgatggtcacgccggccagcagcttgccgag 409 Query: 321 ctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgtt 380 ||||| |||||| | || || ||||||| ||||||||||||||| | | |||||||||| Sbjct: 408 ctcctcgtcgttcctgatcgccagcagcacgtggcgcgggatgatcctgttcttcttgtt 349 Query: 381 gtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 440 |||| |||||||||| ||||| |||||||||| ||||||||||||||||||||||||||| Sbjct: 348 gtccctggccgcgttcccggcgagctccagcacctcggcagcgaggtactcgaggacggc 289 Query: 441 ggcgaggtagacgggggcgccggagccgacgcgctgggcgtaacggcccttcttgaggta 500 ||||||||||||||||||||||| ||||| |||||||||||| ||||||||||||||||| Sbjct: 288 ggcgaggtagacgggggcgccggtgccgatgcgctgggcgtagcggcccttcttgaggta 229 Query: 501 acgcccgatgcggccgacggggaactggagcccggccttgacggacctggtcaccgcctt 560 || ||||| ||||||||||||||||||||||||||||||||||| | | ||||||||| Sbjct: 228 gcggccgatacggccgacggggaactggagcccggccttgacggagcgcgacaccgcctt 169 Query: 561 cttcct 566 |||||| Sbjct: 168 cttcct 163 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 198 cttcttgggcgacttggtctccttctcggcggcggcgg 235 ||||||||||||||||| |||||| |||||||||||| Sbjct: 540 cttcttgggcgacttggcctccttgccggcggcggcgg 503
>dbj|AK074018.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033075N03, full insert sequence Length = 797 Score = 337 bits (170), Expect = 3e-89 Identities = 272/306 (88%) Strand = Plus / Minus Query: 240 cttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgac 299 |||||||||||| || || | ||||||||| || | || |||||||| ||||||||||| Sbjct: 467 cttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatggtgac 408 Query: 300 gccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcgg 359 |||||||||||| | |||||||||| ||||||||||| || ||||||| ||| | ||| Sbjct: 407 cccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgcctcgg 348 Query: 360 gatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| ||| |||||||||||||| |||||||| ||||| |||||||||| ||| || Sbjct: 347 gatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctccagcacctctgc 288 Query: 420 agcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 479 ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 287 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgacgcgctgggc 228 Query: 480 gtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagcccggcctt 539 ||| ||||||||||||||||| || ||||||||||||||||||||||||||||||||||| Sbjct: 227 gtagcggcccttcttgaggtagcggccgatgcggccgacggggaactggagcccggcctt 168 Query: 540 gacgga 545 |||||| Sbjct: 167 gacgga 162
>gb|AY103585.1| Zea mays PCO123564 mRNA sequence Length = 1953 Score = 327 bits (165), Expect = 3e-86 Identities = 273/309 (88%) Strand = Plus / Minus Query: 259 gagttgatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccg 318 |||| ||||||||||| ||| |||||||| ||||||||||||||||| |||||| | ||| Sbjct: 591 gagtggatgttggggaggacgccgccgtgcgcgatggtgacgccggccagcagcttcccg 532 Query: 319 agctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttg 378 ||||||| ||||||||||| || || |||| |||||||||||||||||| |||||||| Sbjct: 531 agctcctcgtcgttgcggatcgccaggagcacgtggcgcgggatgatgcgcgtcttcttg 472 Query: 379 ttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacg 438 ||||| || |||||||| || || | |||||| | |||||| ||||||||||| |||||| Sbjct: 471 ttgtctttcgccgcgttccctgccaactccagaacctcggcggcgaggtactccaggacg 412 Query: 439 gcggcgaggtagacgggggcgccggagccgacgcgctgggcgtaacggcccttcttgagg 498 ||||||||||||||||||||||| | ||| |||||||| ||||| ||||||||||||||| Sbjct: 411 gcggcgaggtagacgggggcgccagtgcccacgcgctgcgcgtaccggcccttcttgagg 352 Query: 499 taacgcccgatgcggccgacggggaactggagcccggccttgacggacctggtcaccgcc 558 || |||||||| ||||||||||||||||| ||||||||||||||||||| ||||||| | Sbjct: 351 tagcgcccgatccggccgacggggaactgcagcccggccttgacggaccgcgtcaccgac 292 Query: 559 ttcttcctg 567 ||||||||| Sbjct: 291 ttcttcctg 283
>ref|NM_193707.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 480 Score = 321 bits (162), Expect = 2e-84 Identities = 270/306 (88%) Strand = Plus / Minus Query: 261 gttgatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgag 320 |||||||||||| | || || ||||| |||||||| |||||||| |||||| | ||||| Sbjct: 378 gttgatgttgggcagcacgcctccgtgcgcgatggtcacgccggccagcagcttgccgag 319 Query: 321 ctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgtt 380 ||||| |||||| | || || ||||||| ||||||||||||||| | | |||||||||| Sbjct: 318 ctcctcgtcgttcctgatcgccagcagcacgtggcgcgggatgatcctgttcttcttgtt 259 Query: 381 gtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 440 |||| |||||||||| ||||| |||||||||| |||||| |||||||||||||||||||| Sbjct: 258 gtccctggccgcgttcccggcgagctccagcacctcggcggcgaggtactcgaggacggc 199 Query: 441 ggcgaggtagacgggggcgccggagccgacgcgctgggcgtaacggcccttcttgaggta 500 ||||||||||||||||||||||| ||||| |||||| ||||| ||||||||||||||||| Sbjct: 198 ggcgaggtagacgggggcgccggtgccgatgcgctgcgcgtagcggcccttcttgaggta 139 Query: 501 acgcccgatgcggccgacggggaactggagcccggccttgacggacctggtcaccgcctt 560 || ||||| ||||||||||||||||||||||||||||||||||| | | ||||||||| Sbjct: 138 gcggccgatacggccgacggggaactggagcccggccttgacggagcgcgacaccgcctt 79 Query: 561 cttcct 566 |||||| Sbjct: 78 cttcct 73 Score = 54.0 bits (27), Expect = 6e-04 Identities = 56/65 (86%), Gaps = 3/65 (4%) Strand = Plus / Minus Query: 171 cttcttgggggacttggtggccgtcttcttcttgggcgacttggtctccttctcggcggc 230 |||||||||||||||| ||||| |||||| ||||||||||| |||||| ||||||| Sbjct: 474 cttcttgggggacttgccggccgccttctt---gggcgacttggcctccttgccggcggc 418 Query: 231 ggcgg 235 ||||| Sbjct: 417 ggcgg 413
>ref|XM_475374.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 492 Score = 311 bits (157), Expect = 2e-81 Identities = 283/325 (87%) Strand = Plus / Minus Query: 240 cttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgac 299 |||||| ||||| || || | |||||||||||| | || |||||||| ||||||||||| Sbjct: 393 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 334 Query: 300 gccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcgg 359 |||||| |||||| | |||||||||| ||||||||||| || ||||||| ||| ||||| Sbjct: 333 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 274 Query: 360 gatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| ||| |||||||||||||| |||||||| || |||||||| |||| |||||| Sbjct: 273 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagcacctcggc 214 Query: 420 agcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 479 ||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| Sbjct: 213 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctggga 154 Query: 480 gtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagcccggcctt 539 ||| ||||| | ||||||||| || ||||| ||||||||||||||||||||||||||||| Sbjct: 153 gtagcggccttgcttgaggtagcggccgatacggccgacggggaactggagcccggcctt 94 Query: 540 gacggacctggtcaccgccttcttc 564 |||||| | || ||||| ||||||| Sbjct: 93 gacggagcgggacaccggcttcttc 69
>gb|BT019315.1| Zea mays clone Contig989.F mRNA sequence Length = 699 Score = 311 bits (157), Expect = 2e-81 Identities = 271/309 (87%) Strand = Plus / Minus Query: 259 gagttgatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccg 318 |||| ||||||||||| ||| || ||||| ||||||||||||||||| |||||| | ||| Sbjct: 442 gagtggatgttggggaggacgccaccgtgcgcgatggtgacgccggccagcagcttcccg 383 Query: 319 agctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttg 378 ||||||| ||||||||||| || || |||| |||||||||||||||||| |||||||| Sbjct: 382 agctcctcgtcgttgcggatcgccaggagcacgtggcgcgggatgatgcgcgtcttcttg 323 Query: 379 ttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacg 438 ||||| || |||||||| || || | |||||| | |||||| ||||||||||| || ||| Sbjct: 322 ttgtctttcgccgcgttccctgccaactccagaacctcggcggcgaggtactccagaacg 263 Query: 439 gcggcgaggtagacgggggcgccggagccgacgcgctgggcgtaacggcccttcttgagg 498 ||||||||||||||||||||||| | ||| |||||||| ||||| ||||||||||||||| Sbjct: 262 gcggcgaggtagacgggggcgccagtgcccacgcgctgcgcgtaccggcccttcttgagg 203 Query: 499 taacgcccgatgcggccgacggggaactggagcccggccttgacggacctggtcaccgcc 558 || |||||||| ||||||||||||||||| ||||||||||||||||||| ||||||| | Sbjct: 202 tagcgcccgatccggccgacggggaactgcagcccggccttgacggaccgcgtcaccgac 143 Query: 559 ttcttcctg 567 ||||||||| Sbjct: 142 ttcttcctg 134
>dbj|AK067406.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013099N23, full insert sequence Length = 1097 Score = 311 bits (157), Expect = 2e-81 Identities = 283/325 (87%) Strand = Plus / Minus Query: 240 cttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgac 299 |||||| ||||| || || | |||||||||||| | || |||||||| ||||||||||| Sbjct: 464 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 405 Query: 300 gccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcgg 359 |||||| |||||| | |||||||||| ||||||||||| || ||||||| ||| ||||| Sbjct: 404 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 345 Query: 360 gatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| ||| |||||||||||||| |||||||| || |||||||| |||| |||||| Sbjct: 344 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagcacctcggc 285 Query: 420 agcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 479 ||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| Sbjct: 284 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctggga 225 Query: 480 gtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagcccggcctt 539 ||| ||||| | ||||||||| || ||||| ||||||||||||||||||||||||||||| Sbjct: 224 gtagcggccttgcttgaggtagcggccgatacggccgacggggaactggagcccggcctt 165 Query: 540 gacggacctggtcaccgccttcttc 564 |||||| | || ||||| ||||||| Sbjct: 164 gacggagcgggacaccggcttcttc 140
>dbj|AK099763.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013094K03, full insert sequence Length = 912 Score = 305 bits (154), Expect = 9e-80 Identities = 268/306 (87%) Strand = Plus / Minus Query: 240 cttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgac 299 |||||| ||||| || || | |||||||||||| | || |||||||| ||||||||||| Sbjct: 463 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 404 Query: 300 gccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcgg 359 |||||| |||||| | |||||||||| ||||||||||| || ||||||| ||| ||||| Sbjct: 403 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 344 Query: 360 gatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| ||| |||||||||||||| |||||||| || |||||||| |||| |||||| Sbjct: 343 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagcacctcggc 284 Query: 420 agcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 479 ||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| Sbjct: 283 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctggga 224 Query: 480 gtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagcccggcctt 539 ||| ||||| | ||||||||| || ||||| ||||||||||||||||||||||||||||| Sbjct: 223 gtagcggccttgcttgaggtagcggccgatacggccgacggggaactggagcccggcctt 164 Query: 540 gacgga 545 |||||| Sbjct: 163 gacgga 158
>gb|AF493985.1| Triticum aestivum H2A-1 gene, partial sequence Length = 538 Score = 250 bits (126), Expect = 5e-63 Identities = 196/218 (89%), Gaps = 1/218 (0%) Strand = Plus / Plus Query: 95 gtccatgagaaatggaacgaagcaacacaggctaggctatgggtgcgggcggctactcct 154 |||||||||||||||| | |||||||| |||||||||||||| || ||||||||||| Sbjct: 120 gtccatgagaaatggatctaagcaacaatggctaggctatggggacga-cggctactcct 178 Query: 155 tggcggcgggggccttcttcttgggggacttggtggccgtcttcttcttgggcgacttgg 214 | | ||||| | |||||||||||||||||||| |||||||||||||||||||||||||| Sbjct: 179 tcgtggcggccgtcttcttcttgggggacttggcggccgtcttcttcttgggcgacttgg 238 Query: 215 tctccttctcggcggcggcggtggacttcttcgggagaagaacagagttgatgttgggga 274 |||||||||||||||||| | ||||||||| ||||| || || |||||||||||||||| Sbjct: 239 cctccttctcggcggcggcaggggacttcttggggagcagcacggagttgatgttgggga 298 Query: 275 tgacaccgccgtgggcgatggtgacgccggcgagcagc 312 | |||||||||||||||||||||||||||||||||||| Sbjct: 299 tcacaccgccgtgggcgatggtgacgccggcgagcagc 336 Score = 40.1 bits (20), Expect = 8.7 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Plus Query: 6 acagaaat-acagatacaatgtcacccttgct 36 |||||||| |||| |||||||||||||||||| Sbjct: 31 acagaaatcacaggtacaatgtcacccttgct 62
>gb|U08225.1|ZMU08225 Zea mays W-22 histone H2A mRNA, complete cds Length = 714 Score = 250 bits (126), Expect = 5e-63 Identities = 276/327 (84%) Strand = Plus / Minus Query: 240 cttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgac 299 |||||| || || ||||||| |||||| ||||||| ||||||||||| |||||||| || Sbjct: 467 cttcttgggcagcagaacagggttgatattggggagcacaccgccgtgagcgatggtcac 408 Query: 300 gccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcgg 359 |||| | | |||| | || ||||||| |||||| |||| || || |||| ||||||||| Sbjct: 407 gccgcccaacagcttcccaagctcctcgtcgttccggatcgccagaagcacgtggcgcgg 348 Query: 360 gatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagcagctcggc 419 || ||||| |||||||||||||| |||| || || ||||| |||||||| | ||| || Sbjct: 347 aataatgcgagtcttcttgttgtccctggcagcattaccggcgagctccagaacctcagc 288 Query: 420 agcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 479 |||||||| |||||||| ||||||||||||||||||||||||| |||||| ||| || Sbjct: 287 ggcgaggtattcgaggacagcggcgaggtagacgggggcgccggtgccgacrrnctgcgc 228 Query: 480 gtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagcccggcctt 539 ||| ||||||||||| | ||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 227 gtagcggcccttcttcaagtagcgcccgatgcggccgacggggaactggagaccggcctt 168 Query: 540 gacggacctggtcaccgccttcttcct 566 |||||||| | ||||| ||||||||| Sbjct: 167 cacggacctcgacaccgacttcttcct 141
>gb|BT016301.1| Zea mays clone Contig134 mRNA sequence Length = 846 Score = 240 bits (121), Expect = 5e-60 Identities = 259/305 (84%) Strand = Plus / Minus Query: 241 ttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgacg 300 ||||| ||||| || |||| |||||||||||| | || |||||||| |||||||||||| Sbjct: 396 ttcttggggagcagcacagggttgatgttgggcagaaccccgccgtgtgcgatggtgacg 337 Query: 301 ccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcggg 360 ||||| || ||| | |||||||||| ||||||||||| || ||||| | ||| |||||| Sbjct: 336 ccggccagtagcttcccgagctcctcgtcgttgcggatcgccagcagtacgtgccgcggg 277 Query: 361 atgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagcagctcggca 420 ||||| ||| |||||||||||||| || ||||| || || | ||| || |||||||| Sbjct: 276 atgatccggttcttcttgttgtcccgcgctgcgttccccgccaactcgaggagctcggcg 217 Query: 421 gcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggcg 480 |||||||||||||||||||| |||||||||||||||||||||| |||||| ||||||| | Sbjct: 216 gcgaggtactcgaggacggcagcgaggtagacgggggcgccggtgccgacacgctgggag 157 Query: 481 taacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagcccggccttg 540 || || |||| ||||||||| || ||||| ||||| |||||||||||||| |||||||| Sbjct: 156 tagcgaccctgcttgaggtagcggccgatacggcctacggggaactggaggccggccttc 97 Query: 541 acgga 545 ||||| Sbjct: 96 acgga 92
>gb|AY109370.1| Zea mays CL2029_4 mRNA sequence Length = 1051 Score = 238 bits (120), Expect = 2e-59 Identities = 274/327 (83%) Strand = Plus / Minus Query: 240 cttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgac 299 |||||| || || ||||||| |||||| ||||||| ||||||||||| |||||||| || Sbjct: 486 cttcttgggcagcagaacagggttgatattggggagcacaccgccgtgagcgatggtcac 427 Query: 300 gccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcgg 359 |||| | |||||| | || ||||||| |||||| |||| || || |||| ||||||||| Sbjct: 426 gccgcccagcagcttcccaagctcctcgtcgttccggatcgccagaagcacgtggcgcgg 367 Query: 360 gatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagcagctcggc 419 || ||||| |||||||||||||| |||| || || || || |||||||| | ||| || Sbjct: 366 aataatgcgagtcttcttgttgtccctggcagcattaccagcgagctccagaacctcagc 307 Query: 420 agcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 479 |||||||| |||||||| |||||||||||||| |||||| |||||| ||||| || Sbjct: 306 ggcgaggtattcgaggacagcggcgaggtagacnnnnncgccggtgccgacacgctgcgc 247 Query: 480 gtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagcccggcctt 539 ||| ||||||||||| | ||| |||||||||||||||||||||||||||||||||||||| Sbjct: 246 gtagcggcccttcttcaagtagcgcccgatgcggccgacggggaactggagcccggcctt 187 Query: 540 gacggacctggtcaccgccttcttcct 566 |||||||| | ||||| ||||||||| Sbjct: 186 cacggacctcgacaccgacttcttcct 160
>gb|AY104486.1| Zea mays PCO109435 mRNA sequence Length = 992 Score = 232 bits (117), Expect = 1e-57 Identities = 258/305 (84%) Strand = Plus / Minus Query: 241 ttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgacg 300 ||||| ||||| || |||| |||||||||||| | || |||||||| |||||||||||| Sbjct: 467 ttcttggggagcagcacagggttgatgttgggcagaaccccgccgtgtgcgatggtgacg 408 Query: 301 ccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcggg 360 ||||| || ||| | |||||||||| |||||||||| || ||||| | ||| |||||| Sbjct: 407 ccggccagtagcttcccgagctcctcatcgttgcggatcgccagcagtacgtgtcgcggg 348 Query: 361 atgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagcagctcggca 420 ||||| ||| |||||||||||||| || ||||| || || | ||| || |||||||| Sbjct: 347 atgatccggttcttcttgttgtcccgcgctgcgttccccgccaactcgaggagctcggcg 288 Query: 421 gcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggcg 480 |||||||||||||||||||| |||||||||||||||||||||| |||||| ||||||| | Sbjct: 287 gcgaggtactcgaggacggcagcgaggtagacgggggcgccggtgccgacacgctgggag 228 Query: 481 taacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagcccggccttg 540 || || |||| ||||||||| || ||||| ||||| |||||||||||||| |||||||| Sbjct: 227 tagcgaccctgcttgaggtagcggccgatacggcctacggggaactggaggccggccttc 168 Query: 541 acgga 545 ||||| Sbjct: 167 acgga 163
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 224 bits (113), Expect = 3e-55 Identities = 143/153 (93%) Strand = Plus / Plus Query: 414 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcg 473 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| Sbjct: 9471498 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcg 9471557 Query: 474 ctgggcgtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagccc 533 ||||||||| ||||||||||||||||| || ||||| ||||||||||||||||||||||| Sbjct: 9471558 ctgggcgtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagccc 9471617 Query: 534 ggccttgacggacctggtcaccgccttcttcct 566 |||||||||||| | | ||||||||||||||| Sbjct: 9471618 ggccttgacggagcgcgacaccgccttcttcct 9471650 Score = 141 bits (71), Expect = 3e-30 Identities = 113/127 (88%) Strand = Plus / Minus Query: 414 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcg 473 |||||| |||||||||||||||||||||| |||||||||||||||||||| ||||||||| Sbjct: 28998065 ctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacgcg 28998006 Query: 474 ctgggcgtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagccc 533 || ||||| ||| ||||||||| || |||||||||||||||||||||||||||| Sbjct: 28998005 ctccgcgtacttgccggccttgaggtagcgggcgatgcggccgacggggaactggagccc 28997946 Query: 534 ggccttg 540 ||||||| Sbjct: 28997945 ggccttg 28997939 Score = 119 bits (60), Expect = 1e-23 Identities = 129/152 (84%) Strand = Plus / Plus Query: 261 gttgatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgag 320 |||||||||||| | || || ||||| |||||||| |||||||| |||||| | ||||| Sbjct: 9471244 gttgatgttgggcagcacgcctccgtgcgcgatggtcacgccggccagcagcttgccgag 9471303 Query: 321 ctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgtt 380 ||||| |||||| | || || ||||||| ||||||||||||||| | | |||||||||| Sbjct: 9471304 ctcctcgtcgttcctgatcgccagcagcacgtggcgcgggatgatcctgttcttcttgtt 9471363 Query: 381 gtccttggccgcgttgccggcaagctccagca 412 |||| |||||||||| ||||| |||||||||| Sbjct: 9471364 gtccctggccgcgttcccggcgagctccagca 9471395 Score = 105 bits (53), Expect = 2e-19 Identities = 71/77 (92%) Strand = Plus / Minus Query: 490 ttcttgaggtaacgcccgatgcggccgacggggaactggagcccggccttgacggacctg 549 ||||||||||| |||||||| |||||||||||||| |||||||||||||||||||| | Sbjct: 2464021 ttcttgaggtagcgcccgatacggccgacggggaattggagcccggccttgacggagcgc 2463962 Query: 550 gtcaccgccttcttcct 566 ||||||||||||||||| Sbjct: 2463961 gtcaccgccttcttcct 2463945 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 371 tcttcttgttgtccttggccgcgttgccggcaagctccagca 412 |||||||||||||| | |||||||| ||||| |||||||||| Sbjct: 28998212 tcttcttgttgtccctcgccgcgttcccggccagctccagca 28998171 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 198 cttcttgggcgacttggtctccttctcggcggcggcgg 235 ||||||||||||||||| |||||| |||||||||||| Sbjct: 9471172 cttcttgggcgacttggcctccttgccggcggcggcgg 9471209 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 cggcgggggccttcttcttgg 178 ||||||||||||||||||||| Sbjct: 30359282 cggcgggggccttcttcttgg 30359262 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 cggcgggggccttcttcttgg 178 ||||||||||||||||||||| Sbjct: 29416086 cggcgggggccttcttcttgg 29416066 Score = 42.1 bits (21), Expect = 2.2 Identities = 39/45 (86%) Strand = Plus / Minus Query: 390 cgcgttgccggcaagctccagcagctcggcagcgaggtactcgag 434 |||||||||||| |||||||| | |||||| | ||||||||||| Sbjct: 3353558 cgcgttgccggccagctccaggacctcggcggttaggtactcgag 3353514
>gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0002D01, from chromosome 3, complete sequence Length = 187589 Score = 224 bits (113), Expect = 3e-55 Identities = 143/153 (93%) Strand = Plus / Plus Query: 414 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcg 473 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| Sbjct: 168898 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcg 168957 Query: 474 ctgggcgtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagccc 533 ||||||||| ||||||||||||||||| || ||||| ||||||||||||||||||||||| Sbjct: 168958 ctgggcgtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagccc 169017 Query: 534 ggccttgacggacctggtcaccgccttcttcct 566 |||||||||||| | | ||||||||||||||| Sbjct: 169018 ggccttgacggagcgcgacaccgccttcttcct 169050 Score = 119 bits (60), Expect = 1e-23 Identities = 129/152 (84%) Strand = Plus / Plus Query: 261 gttgatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgag 320 |||||||||||| | || || ||||| |||||||| |||||||| |||||| | ||||| Sbjct: 168644 gttgatgttgggcagcacgcctccgtgcgcgatggtcacgccggccagcagcttgccgag 168703 Query: 321 ctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgtt 380 ||||| |||||| | || || ||||||| ||||||||||||||| | | |||||||||| Sbjct: 168704 ctcctcgtcgttcctgatcgccagcagcacgtggcgcgggatgatcctgttcttcttgtt 168763 Query: 381 gtccttggccgcgttgccggcaagctccagca 412 |||| |||||||||| ||||| |||||||||| Sbjct: 168764 gtccctggccgcgttcccggcgagctccagca 168795 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 198 cttcttgggcgacttggtctccttctcggcggcggcgg 235 ||||||||||||||||| |||||| |||||||||||| Sbjct: 168572 cttcttgggcgacttggcctccttgccggcggcggcgg 168609
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 224 bits (113), Expect = 3e-55 Identities = 143/153 (93%) Strand = Plus / Plus Query: 414 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcg 473 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| Sbjct: 9469619 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcg 9469678 Query: 474 ctgggcgtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagccc 533 ||||||||| ||||||||||||||||| || ||||| ||||||||||||||||||||||| Sbjct: 9469679 ctgggcgtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagccc 9469738 Query: 534 ggccttgacggacctggtcaccgccttcttcct 566 |||||||||||| | | ||||||||||||||| Sbjct: 9469739 ggccttgacggagcgcgacaccgccttcttcct 9469771 Score = 141 bits (71), Expect = 3e-30 Identities = 113/127 (88%) Strand = Plus / Minus Query: 414 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcg 473 |||||| |||||||||||||||||||||| |||||||||||||||||||| ||||||||| Sbjct: 29089487 ctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacgcg 29089428 Query: 474 ctgggcgtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagccc 533 || ||||| ||| ||||||||| || |||||||||||||||||||||||||||| Sbjct: 29089427 ctccgcgtacttgccggccttgaggtagcgggcgatgcggccgacggggaactggagccc 29089368 Query: 534 ggccttg 540 ||||||| Sbjct: 29089367 ggccttg 29089361 Score = 119 bits (60), Expect = 1e-23 Identities = 129/152 (84%) Strand = Plus / Plus Query: 261 gttgatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgag 320 |||||||||||| | || || ||||| |||||||| |||||||| |||||| | ||||| Sbjct: 9469365 gttgatgttgggcagcacgcctccgtgcgcgatggtcacgccggccagcagcttgccgag 9469424 Query: 321 ctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgtt 380 ||||| |||||| | || || ||||||| ||||||||||||||| | | |||||||||| Sbjct: 9469425 ctcctcgtcgttcctgatcgccagcagcacgtggcgcgggatgatcctgttcttcttgtt 9469484 Query: 381 gtccttggccgcgttgccggcaagctccagca 412 |||| |||||||||| ||||| |||||||||| Sbjct: 9469485 gtccctggccgcgttcccggcgagctccagca 9469516 Score = 105 bits (53), Expect = 2e-19 Identities = 71/77 (92%) Strand = Plus / Minus Query: 490 ttcttgaggtaacgcccgatgcggccgacggggaactggagcccggccttgacggacctg 549 ||||||||||| |||||||| |||||||||||||| |||||||||||||||||||| | Sbjct: 2464131 ttcttgaggtagcgcccgatacggccgacggggaattggagcccggccttgacggagcgc 2464072 Query: 550 gtcaccgccttcttcct 566 ||||||||||||||||| Sbjct: 2464071 gtcaccgccttcttcct 2464055 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 371 tcttcttgttgtccttggccgcgttgccggcaagctccagca 412 |||||||||||||| | |||||||| ||||| |||||||||| Sbjct: 29089634 tcttcttgttgtccctcgccgcgttcccggccagctccagca 29089593 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 198 cttcttgggcgacttggtctccttctcggcggcggcgg 235 ||||||||||||||||| |||||| |||||||||||| Sbjct: 9469293 cttcttgggcgacttggcctccttgccggcggcggcgg 9469330 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 cggcgggggccttcttcttgg 178 ||||||||||||||||||||| Sbjct: 30450704 cggcgggggccttcttcttgg 30450684 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 cggcgggggccttcttcttgg 178 ||||||||||||||||||||| Sbjct: 29507508 cggcgggggccttcttcttgg 29507488 Score = 42.1 bits (21), Expect = 2.2 Identities = 39/45 (86%) Strand = Plus / Minus Query: 390 cgcgttgccggcaagctccagcagctcggcagcgaggtactcgag 434 |||||||||||| |||||||| | |||||| | ||||||||||| Sbjct: 3353669 cgcgttgccggccagctccaggacctcggcggttaggtactcgag 3353625
>ref|XM_475081.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 522 Score = 216 bits (109), Expect = 7e-53 Identities = 121/125 (96%) Strand = Plus / Minus Query: 421 gcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggcg 480 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Sbjct: 209 gcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgacgcgctgggcg 150 Query: 481 taacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagcccggccttg 540 || ||||||||||||||||| || |||||||||||||||||||||||||||||||||||| Sbjct: 149 tagcggcccttcttgaggtagcggccgatgcggccgacggggaactggagcccggccttg 90 Query: 541 acgga 545 ||||| Sbjct: 89 acgga 85 Score = 129 bits (65), Expect = 1e-26 Identities = 146/173 (84%) Strand = Plus / Minus Query: 240 cttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgac 299 |||||||||||| || || | ||||||||| || | || |||||||| ||||||||||| Sbjct: 441 cttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatggtgac 382 Query: 300 gccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcgg 359 |||||||||||| | |||||||||| ||||||||||| || ||||||| ||| | ||| Sbjct: 381 cccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgcctcgg 322 Query: 360 gatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagca 412 |||||| ||| |||||||||||||| |||||||| ||||| |||||||||| Sbjct: 321 gatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctccagca 269
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 216 bits (109), Expect = 7e-53 Identities = 121/125 (96%) Strand = Plus / Minus Query: 421 gcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggcg 480 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Sbjct: 707144 gcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgacgcgctgggcg 707085 Query: 481 taacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagcccggccttg 540 || ||||||||||||||||| || |||||||||||||||||||||||||||||||||||| Sbjct: 707084 tagcggcccttcttgaggtagcggccgatgcggccgacggggaactggagcccggccttg 707025 Query: 541 acgga 545 ||||| Sbjct: 707024 acgga 707020 Score = 188 bits (95), Expect = 2e-44 Identities = 137/151 (90%) Strand = Plus / Plus Query: 414 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcg 473 |||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| ||| Sbjct: 22512577 ctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcg 22512636 Query: 474 ctgggcgtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagccc 533 ||||| ||| ||||| | ||||||||| || ||||| ||||||||||||||||||||||| Sbjct: 22512637 ctgggagtagcggccttgcttgaggtagcggccgatacggccgacggggaactggagccc 22512696 Query: 534 ggccttgacggacctggtcaccgccttcttc 564 |||||||||||| | || ||||| ||||||| Sbjct: 22512697 ggccttgacggagcgggacaccggcttcttc 22512727 Score = 129 bits (65), Expect = 1e-26 Identities = 146/173 (84%) Strand = Plus / Plus Query: 240 cttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgac 299 |||||| ||||| || || | |||||||||||| | || |||||||| ||||||||||| Sbjct: 22512327 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 22512386 Query: 300 gccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcgg 359 |||||| |||||| | |||||||||| ||||||||||| || ||||||| ||| ||||| Sbjct: 22512387 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 22512446 Query: 360 gatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagca 412 |||||| ||| |||||||||||||| |||||||| || |||||||| |||| Sbjct: 22512447 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagca 22512499 Score = 129 bits (65), Expect = 1e-26 Identities = 146/173 (84%) Strand = Plus / Minus Query: 240 cttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgac 299 |||||||||||| || || | ||||||||| || | || |||||||| ||||||||||| Sbjct: 707404 cttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatggtgac 707345 Query: 300 gccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcgg 359 |||||||||||| | |||||||||| ||||||||||| || ||||||| ||| | ||| Sbjct: 707344 cccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgcctcgg 707285 Query: 360 gatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagca 412 |||||| ||| |||||||||||||| |||||||| ||||| |||||||||| Sbjct: 707284 gatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctccagca 707232
>gb|AC093921.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0041A22, complete sequence Length = 117919 Score = 216 bits (109), Expect = 7e-53 Identities = 121/125 (96%) Strand = Plus / Minus Query: 421 gcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggcg 480 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Sbjct: 52343 gcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgacgcgctgggcg 52284 Query: 481 taacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagcccggccttg 540 || ||||||||||||||||| || |||||||||||||||||||||||||||||||||||| Sbjct: 52283 tagcggcccttcttgaggtagcggccgatgcggccgacggggaactggagcccggccttg 52224 Query: 541 acgga 545 ||||| Sbjct: 52223 acgga 52219 Score = 129 bits (65), Expect = 1e-26 Identities = 146/173 (84%) Strand = Plus / Minus Query: 240 cttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgac 299 |||||||||||| || || | ||||||||| || | || |||||||| ||||||||||| Sbjct: 52603 cttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatggtgac 52544 Query: 300 gccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcgg 359 |||||||||||| | |||||||||| ||||||||||| || ||||||| ||| | ||| Sbjct: 52543 cccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgcctcgg 52484 Query: 360 gatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagca 412 |||||| ||| |||||||||||||| |||||||| ||||| |||||||||| Sbjct: 52483 gatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctccagca 52431
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 208 bits (105), Expect = 2e-50 Identities = 141/153 (92%) Strand = Plus / Minus Query: 414 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcg 473 |||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| ||| Sbjct: 17416864 ctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcg 17416805 Query: 474 ctgggcgtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagccc 533 ||| ||||| ||||||||||||||||| || ||||| ||||||||||||||||||||||| Sbjct: 17416804 ctgcgcgtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagccc 17416745 Query: 534 ggccttgacggacctggtcaccgccttcttcct 566 |||||||||||| | | ||||||||||||||| Sbjct: 17416744 ggccttgacggagcgcgacaccgccttcttcct 17416712 Score = 119 bits (60), Expect = 1e-23 Identities = 129/152 (84%) Strand = Plus / Minus Query: 261 gttgatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgag 320 |||||||||||| | || || ||||| |||||||| |||||||| |||||| | ||||| Sbjct: 17417128 gttgatgttgggcagcacgcctccgtgcgcgatggtcacgccggccagcagcttgccgag 17417069 Query: 321 ctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgtt 380 ||||| |||||| | || || ||||||| ||||||||||||||| | | |||||||||| Sbjct: 17417068 ctcctcgtcgttcctgatcgccagcagcacgtggcgcgggatgatcctgttcttcttgtt 17417009 Query: 381 gtccttggccgcgttgccggcaagctccagca 412 |||| |||||||||| ||||| |||||||||| Sbjct: 17417008 gtccctggccgcgttcccggcgagctccagca 17416977 Score = 54.0 bits (27), Expect = 6e-04 Identities = 56/65 (86%), Gaps = 3/65 (4%) Strand = Plus / Minus Query: 171 cttcttgggggacttggtggccgtcttcttcttgggcgacttggtctccttctcggcggc 230 |||||||||||||||| ||||| |||||| ||||||||||| |||||| ||||||| Sbjct: 17417224 cttcttgggggacttgccggccgccttctt---gggcgacttggcctccttgccggcggc 17417168 Query: 231 ggcgg 235 ||||| Sbjct: 17417167 ggcgg 17417163 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 ggcgatggtgacgccggcgag 308 ||||||||||||||||||||| Sbjct: 23243788 ggcgatggtgacgccggcgag 23243768 Score = 40.1 bits (20), Expect = 8.7 Identities = 46/54 (85%), Gaps = 3/54 (5%) Strand = Plus / Minus Query: 171 cttcttgggggactt---ggtggccgtcttcttcttgggcgacttggtctcctt 221 ||||||||||||||| |||||| | |||||||| |||||||||| |||||| Sbjct: 43063463 cttcttgggggacttggcggtggcggggttcttctttggcgacttggcctcctt 43063410 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 437 cggcggcgaggtagacgggg 456 |||||||||||||||||||| Sbjct: 31905177 cggcggcgaggtagacgggg 31905196
>dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0507H06 Length = 136351 Score = 208 bits (105), Expect = 2e-50 Identities = 141/153 (92%) Strand = Plus / Minus Query: 414 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcg 473 |||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| ||| Sbjct: 70256 ctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcg 70197 Query: 474 ctgggcgtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagccc 533 ||| ||||| ||||||||||||||||| || ||||| ||||||||||||||||||||||| Sbjct: 70196 ctgcgcgtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagccc 70137 Query: 534 ggccttgacggacctggtcaccgccttcttcct 566 |||||||||||| | | ||||||||||||||| Sbjct: 70136 ggccttgacggagcgcgacaccgccttcttcct 70104 Score = 119 bits (60), Expect = 1e-23 Identities = 129/152 (84%) Strand = Plus / Minus Query: 261 gttgatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgag 320 |||||||||||| | || || ||||| |||||||| |||||||| |||||| | ||||| Sbjct: 70520 gttgatgttgggcagcacgcctccgtgcgcgatggtcacgccggccagcagcttgccgag 70461 Query: 321 ctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgtt 380 ||||| |||||| | || || ||||||| ||||||||||||||| | | |||||||||| Sbjct: 70460 ctcctcgtcgttcctgatcgccagcagcacgtggcgcgggatgatcctgttcttcttgtt 70401 Query: 381 gtccttggccgcgttgccggcaagctccagca 412 |||| |||||||||| ||||| |||||||||| Sbjct: 70400 gtccctggccgcgttcccggcgagctccagca 70369 Score = 54.0 bits (27), Expect = 6e-04 Identities = 56/65 (86%), Gaps = 3/65 (4%) Strand = Plus / Minus Query: 171 cttcttgggggacttggtggccgtcttcttcttgggcgacttggtctccttctcggcggc 230 |||||||||||||||| ||||| |||||| ||||||||||| |||||| ||||||| Sbjct: 70616 cttcttgggggacttgccggccgccttctt---gggcgacttggcctccttgccggcggc 70560 Query: 231 ggcgg 235 ||||| Sbjct: 70559 ggcgg 70555
>gb|BT017719.1| Zea mays clone EL01N0447A04.c mRNA sequence Length = 772 Score = 206 bits (104), Expect = 6e-50 Identities = 251/300 (83%) Strand = Plus / Minus Query: 240 cttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgac 299 |||||| ||||| || || | ||| |||||||| | ||||||||||| ||||||||||| Sbjct: 449 cttcttggggaggaggacggggttaatgttgggcagcacaccgccgtgcgcgatggtgac 390 Query: 300 gccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcgg 359 || | |||||| | |||||||||| ||||||||||| |||||| || ||||||||||| Sbjct: 389 cccacccagcagcttgccgagctcctcgtcgttgcggatggcgaggaggaggtggcgcgg 330 Query: 360 gatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||||||| | ||||||||||| ||||||||||| || |||||||| | ||| || Sbjct: 329 gatgatgcgggttttcttgttgtcgcgcgccgcgttgccagccagctccaggacctcagc 270 Query: 420 agcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggc 479 ||||||||||||||||||||||| ||| | ||||| ||||| | ||| |||||||| || Sbjct: 269 ggcgaggtactcgaggacggcggccaggaacacgggagcgcccgtgcccacgcgctgcgc 210 Query: 480 gtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagcccggcctt 539 ||| || || ||||| ||||| || ||||||||||| |||||||| ||||||||||||| Sbjct: 209 gtaccgccctttcttcaggtaccgtccgatgcggcccacggggaaaaggagcccggcctt 150
>dbj|AK071511.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023096P04, full insert sequence Length = 824 Score = 204 bits (103), Expect = 3e-49 Identities = 190/219 (86%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| ||||| |||||| |||||||||| ||||| |||||||| | |||||| Sbjct: 454 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 395 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||| || |||||| | | ||||||||| | |||||| ||||||||||||| Sbjct: 394 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 335 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 | | |||||||| ||||| |||||||||| |||||| ||||||||||||||||||||||| Sbjct: 334 cctcgccgcgttcccggcgagctccagcacctcggcggcgaggtactcgaggacggcggc 275 Query: 444 gaggtagacgggggcgccggagccgacgcgctgggcgta 482 |||||||||||| ||||||| ||||||||||| |||||| Sbjct: 274 gaggtagacgggagcgccggcgccgacgcgctcggcgta 236
>dbj|AK058913.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-009-A01, full insert sequence Length = 733 Score = 204 bits (103), Expect = 3e-49 Identities = 190/219 (86%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| ||||| |||||| |||||||||| ||||| |||||||| | |||||| Sbjct: 453 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 394 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||| || |||||| | | ||||||||| | |||||| ||||||||||||| Sbjct: 393 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 334 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 | | |||||||| ||||| |||||||||| |||||| ||||||||||||||||||||||| Sbjct: 333 cctcgccgcgttcccggcgagctccagcacctcggcggcgaggtactcgaggacggcggc 274 Query: 444 gaggtagacgggggcgccggagccgacgcgctgggcgta 482 |||||||||||| ||||||| ||||||||||| |||||| Sbjct: 273 gaggtagacgggagcgccggcgccgacgcgctcggcgta 235
>dbj|AK121752.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087P07, full insert sequence Length = 747 Score = 192 bits (97), Expect = 1e-45 Identities = 214/253 (84%) Strand = Plus / Minus Query: 288 ggcgatggtgacgccggcgagcagccttccgagctcctggtcgttgcggacggcgagcag 347 ||||||||||||| || |||||||||| | ||||||| ||||||||| || || ||| | Sbjct: 431 ggcgatggtgacggcgccgagcagcctgctcagctcctcgtcgttgcgcaccgccagctg 372 Query: 348 caggtggcgcgggatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctc 407 | ||| | ||| | ||| ||| |||||||||||||| | |||||||| || || ||||| Sbjct: 371 gatgtgcctcggcacgatccggttcttcttgttgtccctcgccgcgttccccgccagctc 312 Query: 408 cagcagctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggagcc 467 ||||| |||||| |||||||||||||||||||||| |||||||||||||||||||| ||| Sbjct: 311 cagcacctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgcc 252 Query: 468 gacgcgctgggcgtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactg 527 |||||||| |||||| ||| ||||||||| | |||||||||||||||||||||| Sbjct: 251 gacgcgctcggcgtacttgccggccttgaggtacctggcgatgcggccgacggggaactg 192 Query: 528 gagcccggccttg 540 ||| ||||||||| Sbjct: 191 gaggccggccttg 179
>gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1525_A02, complete sequence Length = 93826 Score = 188 bits (95), Expect = 2e-44 Identities = 137/151 (90%) Strand = Plus / Plus Query: 414 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcg 473 |||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| ||| Sbjct: 7627 ctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcg 7686 Query: 474 ctgggcgtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagccc 533 ||||| ||| ||||| | ||||||||| || ||||| ||||||||||||||||||||||| Sbjct: 7687 ctgggagtagcggccttgcttgaggtagcggccgatacggccgacggggaactggagccc 7746 Query: 534 ggccttgacggacctggtcaccgccttcttc 564 |||||||||||| | || ||||| ||||||| Sbjct: 7747 ggccttgacggagcgggacaccggcttcttc 7777 Score = 129 bits (65), Expect = 1e-26 Identities = 146/173 (84%) Strand = Plus / Plus Query: 240 cttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgac 299 |||||| ||||| || || | |||||||||||| | || |||||||| ||||||||||| Sbjct: 7377 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 7436 Query: 300 gccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcgg 359 |||||| |||||| | |||||||||| ||||||||||| || ||||||| ||| ||||| Sbjct: 7437 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 7496 Query: 360 gatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagca 412 |||||| ||| |||||||||||||| |||||||| || |||||||| |||| Sbjct: 7497 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagca 7549
>gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1281_H05, complete sequence Length = 163130 Score = 188 bits (95), Expect = 2e-44 Identities = 137/151 (90%) Strand = Plus / Plus Query: 414 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcg 473 |||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| ||| Sbjct: 101984 ctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcg 102043 Query: 474 ctgggcgtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagccc 533 ||||| ||| ||||| | ||||||||| || ||||| ||||||||||||||||||||||| Sbjct: 102044 ctgggagtagcggccttgcttgaggtagcggccgatacggccgacggggaactggagccc 102103 Query: 534 ggccttgacggacctggtcaccgccttcttc 564 |||||||||||| | || ||||| ||||||| Sbjct: 102104 ggccttgacggagcgggacaccggcttcttc 102134 Score = 129 bits (65), Expect = 1e-26 Identities = 146/173 (84%) Strand = Plus / Plus Query: 240 cttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgac 299 |||||| ||||| || || | |||||||||||| | || |||||||| ||||||||||| Sbjct: 101734 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 101793 Query: 300 gccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcgg 359 |||||| |||||| | |||||||||| ||||||||||| || ||||||| ||| ||||| Sbjct: 101794 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 101853 Query: 360 gatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagca 412 |||||| ||| |||||||||||||| |||||||| || |||||||| |||| Sbjct: 101854 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagca 101906
>ref|XM_482492.1| Oryza sativa (japonica cultivar-group), mRNA Length = 405 Score = 184 bits (93), Expect = 2e-43 Identities = 231/277 (83%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| ||||| ||||||| ||||||||||||| || ||||||| | ||||| Sbjct: 339 gatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagctc 280 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||| ||||||||| | | ||| | ||| | ||| || ||||||||||||| Sbjct: 279 ctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttgtc 220 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 | |||||||| ||||| ||||| || | |||||| ||||||||||||||||||||||| Sbjct: 219 ccgcgccgcgttcccggcgagctcaagaacctcggcggcgaggtactcgaggacggcggc 160 Query: 444 gaggtagacgggggcgccggagccgacgcgctgggcgtaacggcccttcttgaggtaacg 503 |||||||||||||||||||| ||||||||||| |||||| ||| ||||||| | || Sbjct: 159 gaggtagacgggggcgccggcgccgacgcgctcggcgtacttgccggccttgaggaagcg 100 Query: 504 cccgatgcggccgacggggaactggagcccggccttg 540 |||| | |||||||||||||||||||||||||||| Sbjct: 99 ggcgatcctgccgacggggaactggagcccggccttg 63
>dbj|AK064299.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-107-A07, full insert sequence Length = 724 Score = 184 bits (93), Expect = 2e-43 Identities = 150/169 (88%) Strand = Plus / Minus Query: 371 tcttcttgttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtact 430 |||||||||||||| | |||||||| ||||| |||||||||| |||||| |||||||||| Sbjct: 345 tcttcttgttgtccctcgccgcgttcccggccagctccagcacctcggcggcgaggtact 286 Query: 431 cgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggcgtaacggccct 490 |||||||||||| |||||||||||||||||||| ||||||||||| ||||| ||| Sbjct: 285 cgaggacggcggagaggtagacgggggcgccggcgccgacgcgctccgcgtacttgccgg 226 Query: 491 tcttgaggtaacgcccgatgcggccgacggggaactggagcccggcctt 539 ||||||||| || |||||||||||||||||||||||||||||||||| Sbjct: 225 ccttgaggtagcgggcgatgcggccgacggggaactggagcccggcctt 177
>dbj|D38089.1|WHTPH2AC Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-4 Length = 725 Score = 176 bits (89), Expect = 6e-41 Identities = 230/277 (83%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| |||||||||||| |||||| ||||| | ||||||| | |||||| Sbjct: 421 gatgttgggcatgacaccgccgctggcgattgtgaccatgccgagcaggcgggagagctc 362 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||||||||||| | | ||||||||| | ||||||| ||||||||||||| Sbjct: 361 ctcgtcgttgcggacggcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 302 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 | | |||||||| ||||| | |||||| | ||| || ||||| ||||| || |||||||| Sbjct: 301 cctcgccgcgttcccggccaactccagaacctcagcggcgagatactccagcacggcggc 242 Query: 444 gaggtagacgggggcgccggagccgacgcgctgggcgtaacggcccttcttgaggtaacg 503 |||||||||||||||||||| |||||| | || |||||| ||| ||||||| | || Sbjct: 241 gaggtagacgggggcgccggcgccgaccctctcggcgtacttgccggccttgaggaaccg 182 Query: 504 cccgatgcggccgacggggaactggagcccggccttg 540 | |||| | |||||||||||||||||||||||||||| Sbjct: 181 cgcgatcctgccgacggggaactggagcccggccttg 145
>ref|XM_478632.1| Oryza sativa (japonica cultivar-group), mRNA Length = 823 Score = 172 bits (87), Expect = 9e-40 Identities = 186/219 (84%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| || || |||||| |||||||||| ||||| |||||||| | | ||| Sbjct: 488 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 429 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||| || |||||| | | ||||||||| | ||||||| ||||||||||||| Sbjct: 428 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 369 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 | | |||||||| ||||| ||||| |||| ||| || ||||||||||||||||||||||| Sbjct: 368 cctcgccgcgttcccggcgagctcgagcacctcagcggcgaggtactcgaggacggcggc 309 Query: 444 gaggtagacgggggcgccggagccgacgcgctgggcgta 482 ||||||||||||||| |||| ||||||||||| |||||| Sbjct: 308 gaggtagacgggggccccggcgccgacgcgctcggcgta 270
>dbj|AK099888.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013112I10, full insert sequence Length = 823 Score = 172 bits (87), Expect = 9e-40 Identities = 186/219 (84%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| || || |||||| |||||||||| ||||| |||||||| | | ||| Sbjct: 488 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 429 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||| || |||||| | | ||||||||| | ||||||| ||||||||||||| Sbjct: 428 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 369 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 | | |||||||| ||||| ||||| |||| ||| || ||||||||||||||||||||||| Sbjct: 368 cctcgccgcgttcccggcgagctcgagcacctcagcggcgaggtactcgaggacggcggc 309 Query: 444 gaggtagacgggggcgccggagccgacgcgctgggcgta 482 ||||||||||||||| |||| ||||||||||| |||||| Sbjct: 308 gaggtagacgggggccccggcgccgacgcgctcggcgta 270
>dbj|AK058540.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-017-B06, full insert sequence Length = 1718 Score = 172 bits (87), Expect = 9e-40 Identities = 186/219 (84%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| || || |||||| |||||||||| ||||| |||||||| | | ||| Sbjct: 489 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 430 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||| || |||||| | | ||||||||| | ||||||| ||||||||||||| Sbjct: 429 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 370 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 | | |||||||| ||||| ||||| |||| ||| || ||||||||||||||||||||||| Sbjct: 369 cctcgccgcgttcccggcgagctcgagcacctcagcggcgaggtactcgaggacggcggc 310 Query: 444 gaggtagacgggggcgccggagccgacgcgctgggcgta 482 ||||||||||||||| |||| ||||||||||| |||||| Sbjct: 309 gaggtagacgggggccccggcgccgacgcgctcggcgta 271
>dbj|D38091.1|WHTPH2AE Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-10 Length = 691 Score = 172 bits (87), Expect = 9e-40 Identities = 189/223 (84%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||||||||||| | | ||||||||| | ||||||| ||||||| Sbjct: 369 gagctcctcgtcgttgcggacggcgagctggatgtggcgcggcacgatgcgggtcttctt 310 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 ||||||| | |||||||| ||||| | |||||| | ||| || ||||| ||||| || || Sbjct: 309 gttgtccctcgccgcgttcccggccaactccagaacctcagcggcgagatactccagcac 250 Query: 438 ggcggcgaggtagacgggggcgccggagccgacgcgctgggcgtaacggcccttcttgag 497 |||||||||||||||||||||||||| |||||| | || |||||| ||| |||||| Sbjct: 249 ggcggcgaggtagacgggggcgccggcgccgaccctctcggcgtacttgccggccttgag 190 Query: 498 gtaacgcccgatgcggccgacggggaactggagcccggccttg 540 | | ||| |||| | |||||||||||||||||||||||||||| Sbjct: 189 gaaccgcgcgatcctgccgacggggaactggagcccggccttg 147
>gb|AY108339.1| Zea mays PCO070432 mRNA sequence Length = 811 Score = 153 bits (77), Expect = 8e-34 Identities = 134/153 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||||||||||| | | ||||||||||| ||||||| ||||||| Sbjct: 395 gagctcctcgtcgttgcggacggcgagctggatgtggcgcgggacgatgcgggtcttctt 336 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 ||||||| |||||||| ||||||||||| || | ||| ||||| || |||||||| || Sbjct: 335 gttgtcccgagccgcgttcccggcaagctcgagaacctcagcagcaagatactcgagcac 276 Query: 438 ggcggcgaggtagacgggggcgccggagccgac 470 ||| |||||||||||||||||||||| |||||| Sbjct: 275 ggcagcgaggtagacgggggcgccggcgccgac 243 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 520 gggaactggagcccggccttg 540 ||||||||||||||||||||| Sbjct: 193 gggaactggagcccggccttg 173
>ref|XM_525084.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC469700), mRNA Length = 393 Score = 147 bits (74), Expect = 5e-32 Identities = 137/158 (86%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| ||||||||||||||||||||||| | |||||||| ||||||||||| || Sbjct: 222 gttgtcgcgcgccgcgttgccggcaagctccaggatctcggcagtcaggtactcgagcac 163 Query: 438 ggcggcgaggtagacgggggcgccggagccgacgcgct 475 ||||| || ||||| |||||||||| ||| ||||||| Sbjct: 162 cgcggccagatagaccggggcgccggcgcccacgcgct 125
>gb|AY110108.1| Zea mays CL14299_1 mRNA sequence Length = 712 Score = 145 bits (73), Expect = 2e-31 Identities = 208/253 (82%) Strand = Plus / Plus Query: 288 ggcgatggtgacgccggcgagcagccttccgagctcctggtcgttgcggacggcgagcag 347 |||||||||||| | |||||||| | | ||| |||| ||||||||| ||||||||| | Sbjct: 320 ggcgatggtgacagctccgagcagcttgctgagttcctcgtcgttgcgcacggcgagctg 379 Query: 348 caggtggcgcgggatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctc 407 | ||| ||||| | ||||||| ||||||||||||| ||||||||||| || || || Sbjct: 380 gatgtgacgcggcacgatgcggttcttcttgttgtcgcgcgccgcgttgcccgccagttc 439 Query: 408 cagcagctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggagcc 467 || || ||| || ||||| |||||||||||||||| |||||||||||| || || ||| Sbjct: 440 caacacctctgccgcgagatactcgaggacggcggagaggtagacgggcgcaccaccgcc 499 Query: 468 gacgcgctgggcgtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactg 527 |||||||| |||||| ||| ||||||||| ||| |||||||||||||||||||||| Sbjct: 500 gacgcgctcggcgtacttgccggccttgaggtagcgcgcgatgcggccgacggggaactg 559 Query: 528 gagcccggccttg 540 |||||||||||| Sbjct: 560 cagcccggccttg 572
>ref|XM_478633.1| Oryza sativa (japonica cultivar-group), mRNA Length = 830 Score = 143 bits (72), Expect = 8e-31 Identities = 132/152 (86%) Strand = Plus / Minus Query: 319 agctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttg 378 ||||||| ||||||||||||||||||| | | |||||| || | |||||| |||||||| Sbjct: 439 agctcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttg 380 Query: 379 ttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacg 438 |||||| | |||||||| ||||| ||||| || | ||| || |||||||||||||||||| Sbjct: 379 ttgtccctcgccgcgttcccggcgagctcaagaacctcagcggcgaggtactcgaggacg 320 Query: 439 gcggcgaggtagacgggggcgccggagccgac 470 |||||||||||||| |||||||||| |||||| Sbjct: 319 gcggcgaggtagaccggggcgccggcgccgac 288 Score = 48.1 bits (24), Expect = 0.036 Identities = 24/24 (100%) Strand = Plus / Minus Query: 517 acggggaactggagcccggccttg 540 |||||||||||||||||||||||| Sbjct: 241 acggggaactggagcccggccttg 218
>dbj|AK059228.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-024-D11, full insert sequence Length = 830 Score = 143 bits (72), Expect = 8e-31 Identities = 132/152 (86%) Strand = Plus / Minus Query: 319 agctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttg 378 ||||||| ||||||||||||||||||| | | |||||| || | |||||| |||||||| Sbjct: 439 agctcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttg 380 Query: 379 ttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacg 438 |||||| | |||||||| ||||| ||||| || | ||| || |||||||||||||||||| Sbjct: 379 ttgtccctcgccgcgttcccggcgagctcaagaacctcagcggcgaggtactcgaggacg 320 Query: 439 gcggcgaggtagacgggggcgccggagccgac 470 |||||||||||||| |||||||||| |||||| Sbjct: 319 gcggcgaggtagaccggggcgccggcgccgac 288 Score = 48.1 bits (24), Expect = 0.036 Identities = 24/24 (100%) Strand = Plus / Minus Query: 517 acggggaactggagcccggccttg 540 |||||||||||||||||||||||| Sbjct: 241 acggggaactggagcccggccttg 218
>gb|AF377946.3| Oryza sativa (japonica cultivar-group) chromosome 3, BAC clone OSJNBa0031O09, complete sequence Length = 161339 Score = 141 bits (71), Expect = 3e-30 Identities = 113/127 (88%) Strand = Plus / Minus Query: 414 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcg 473 |||||| |||||||||||||||||||||| |||||||||||||||||||| ||||||||| Sbjct: 38206 ctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacgcg 38147 Query: 474 ctgggcgtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagccc 533 || ||||| ||| ||||||||| || |||||||||||||||||||||||||||| Sbjct: 38146 ctccgcgtacttgccggccttgaggtagcgggcgatgcggccgacggggaactggagccc 38087 Query: 534 ggccttg 540 ||||||| Sbjct: 38086 ggccttg 38080 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 371 tcttcttgttgtccttggccgcgttgccggcaagctccagca 412 |||||||||||||| | |||||||| ||||| |||||||||| Sbjct: 38353 tcttcttgttgtccctcgccgcgttcccggccagctccagca 38312
>gb|AC146936.4| Oryza sativa (japonica cultivar-group) chromosome 3 clone B1154F06 map near C10769, complete sequence Length = 194856 Score = 141 bits (71), Expect = 3e-30 Identities = 113/127 (88%) Strand = Plus / Plus Query: 414 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcg 473 |||||| |||||||||||||||||||||| |||||||||||||||||||| ||||||||| Sbjct: 141226 ctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacgcg 141285 Query: 474 ctgggcgtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagccc 533 || ||||| ||| ||||||||| || |||||||||||||||||||||||||||| Sbjct: 141286 ctccgcgtacttgccggccttgaggtagcgggcgatgcggccgacggggaactggagccc 141345 Query: 534 ggccttg 540 ||||||| Sbjct: 141346 ggccttg 141352 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 371 tcttcttgttgtccttggccgcgttgccggcaagctccagca 412 |||||||||||||| | |||||||| ||||| |||||||||| Sbjct: 141079 tcttcttgttgtccctcgccgcgttcccggccagctccagca 141120
>gb|AC147426.2| Oryza sativa chromosome 3 B1377B10 genomic sequence, complete sequence Length = 184366 Score = 141 bits (71), Expect = 3e-30 Identities = 113/127 (88%) Strand = Plus / Minus Query: 414 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcg 473 |||||| |||||||||||||||||||||| |||||||||||||||||||| ||||||||| Sbjct: 181360 ctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacgcg 181301 Query: 474 ctgggcgtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagccc 533 || ||||| ||| ||||||||| || |||||||||||||||||||||||||||| Sbjct: 181300 ctccgcgtacttgccggccttgaggtagcgggcgatgcggccgacggggaactggagccc 181241 Query: 534 ggccttg 540 ||||||| Sbjct: 181240 ggccttg 181234 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 371 tcttcttgttgtccttggccgcgttgccggcaagctccagca 412 |||||||||||||| | |||||||| ||||| |||||||||| Sbjct: 181507 tcttcttgttgtccctcgccgcgttcccggccagctccagca 181466
>gb|BC010336.1| Mus musculus H2A histone family, member X, mRNA (cDNA clone MGC:11561 IMAGE:3156946), complete cds Length = 1414 Score = 141 bits (71), Expect = 3e-30 Identities = 182/219 (83%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||||| | |||||| | |||||| Sbjct: 383 gatgttgggcaggacgccgccctgcgcgatggtcacgccgcccagcagcttgttgagctc 324 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 323 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 264 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||||| |||||||||||| || || || Sbjct: 263 gcgggccgcgttgcccgccagctccaggatctcggcagtgaggtactcgagcaccgctgc 204 Query: 444 gaggtagacgggggcgccggagccgacgcgctgggcgta 482 ||||| || || ||||| | ||| ||||||| |||||| Sbjct: 203 caggtacaccggcgcgcctgcgcccacgcgctcggcgta 165
>gb|AC122428.4| Mus musculus BAC clone RP24-175C20 from chromosome 9, complete sequence Length = 185902 Score = 141 bits (71), Expect = 3e-30 Identities = 182/219 (83%) Strand = Plus / Plus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||||| | |||||| | |||||| Sbjct: 149678 gatgttgggcaggacgccgccctgcgcgatggtcacgccgcccagcagcttgttgagctc 149737 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 149738 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 149797 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||||| |||||||||||| || || || Sbjct: 149798 gcgggccgcgttgcccgccagctccaggatctcggcagtgaggtactcgagcaccgctgc 149857 Query: 444 gaggtagacgggggcgccggagccgacgcgctgggcgta 482 ||||| || || ||||| | ||| ||||||| |||||| Sbjct: 149858 caggtacaccggcgcgcctgcgcccacgcgctcggcgta 149896
>ref|NM_010436.2| Mus musculus H2A histone family, member X (H2afx), mRNA Length = 1414 Score = 141 bits (71), Expect = 3e-30 Identities = 182/219 (83%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||||| | |||||| | |||||| Sbjct: 383 gatgttgggcaggacgccgccctgcgcgatggtcacgccgcccagcagcttgttgagctc 324 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 323 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 264 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||||| |||||||||||| || || || Sbjct: 263 gcgggccgcgttgcccgccagctccaggatctcggcagtgaggtactcgagcaccgctgc 204 Query: 444 gaggtagacgggggcgccggagccgacgcgctgggcgta 482 ||||| || || ||||| | ||| ||||||| |||||| Sbjct: 203 caggtacaccggcgcgcctgcgcccacgcgctcggcgta 165
>emb|Z35401.1|MMHISTH2A M.musculus C3H gene for histone H2A.X Length = 2166 Score = 141 bits (71), Expect = 3e-30 Identities = 182/219 (83%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||||| | |||||| | |||||| Sbjct: 962 gatgttgggcaggacgccgccctgcgcgatggtcacgccgcccagcagcttgttgagctc 903 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 902 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 843 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||||| |||||||||||| || || || Sbjct: 842 gcgggccgcgttgcccgccagctccaggatctcggcagtgaggtactcgagcaccgctgc 783 Query: 444 gaggtagacgggggcgccggagccgacgcgctgggcgta 482 ||||| || || ||||| | ||| ||||||| |||||| Sbjct: 782 caggtacaccggcgcgcctgcgcccacgcgctcggcgta 744
>gb|BC005468.1| Mus musculus H2A histone family, member X, mRNA (cDNA clone MGC:6616 IMAGE:3490058), complete cds Length = 1367 Score = 141 bits (71), Expect = 3e-30 Identities = 182/219 (83%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||||| | |||||| | |||||| Sbjct: 377 gatgttgggcaggacgccgccctgcgcgatggtcacgccgcccagcagcttgttgagctc 318 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 317 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 258 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||||| |||||||||||| || || || Sbjct: 257 gcgggccgcgttgcccgccagctccaggatctcggcagtgaggtactcgagcaccgctgc 198 Query: 444 gaggtagacgggggcgccggagccgacgcgctgggcgta 482 ||||| || || ||||| | ||| ||||||| |||||| Sbjct: 197 caggtacaccggcgcgcctgcgcccacgcgctcggcgta 159
>gb|BC001193.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC:3165 IMAGE:3355200), complete cds Length = 897 Score = 139 bits (70), Expect = 1e-29 Identities = 136/158 (86%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 324 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 265 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| ||||||||||||||||||||||| | |||||||| | ||||||||| || Sbjct: 264 gttgtcgcgcgccgcgttgccggcaagctccaggatctcggcagtcaagtactcgagcac 205 Query: 438 ggcggcgaggtagacgggggcgccggagccgacgcgct 475 ||||| || ||||| |||||||||| ||| ||||||| Sbjct: 204 cgcggccagatagaccggggcgccggcgcccacgcgct 167
>gb|BC082269.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC:99456 IMAGE:6671338), complete cds Length = 889 Score = 139 bits (70), Expect = 1e-29 Identities = 136/158 (86%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 314 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 255 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| ||||||||||||||||||||||| | |||||||| | ||||||||| || Sbjct: 254 gttgtcgcgcgccgcgttgccggcaagctccaggatctcggcagtcaagtactcgagcac 195 Query: 438 ggcggcgaggtagacgggggcgccggagccgacgcgct 475 ||||| || ||||| |||||||||| ||| ||||||| Sbjct: 194 cgcggccagatagaccggggcgccggcgcccacgcgct 157
>ref|NM_033445.2| Homo sapiens histone 3, H2a (HIST3H2A), mRNA Length = 496 Score = 139 bits (70), Expect = 1e-29 Identities = 136/158 (86%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 324 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 265 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| ||||||||||||||||||||||| | |||||||| | ||||||||| || Sbjct: 264 gttgtcgcgcgccgcgttgccggcaagctccaggatctcggcagtcaagtactcgagcac 205 Query: 438 ggcggcgaggtagacgggggcgccggagccgacgcgct 475 ||||| || ||||| |||||||||| ||| ||||||| Sbjct: 204 cgcggccagatagaccggggcgccggcgcccacgcgct 167
>emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chromosome 1q42.11-42.3, complete sequence Length = 151563 Score = 139 bits (70), Expect = 1e-29 Identities = 136/158 (86%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 100829 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 100770 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| ||||||||||||||||||||||| | |||||||| | ||||||||| || Sbjct: 100769 gttgtcgcgcgccgcgttgccggcaagctccaggatctcggcagtcaagtactcgagcac 100710 Query: 438 ggcggcgaggtagacgggggcgccggagccgacgcgct 475 ||||| || ||||| |||||||||| ||| ||||||| Sbjct: 100709 cgcggccagatagaccggggcgccggcgcccacgcgct 100672
>gb|AY131974.1| Homo sapiens histone H2A (HIST3H2A) gene, complete cds Length = 1173 Score = 139 bits (70), Expect = 1e-29 Identities = 136/158 (86%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 674 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 615 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| ||||||||||||||||||||||| | |||||||| | ||||||||| || Sbjct: 614 gttgtcgcgcgccgcgttgccggcaagctccaggatctcggcagtcaagtactcgagcac 555 Query: 438 ggcggcgaggtagacgggggcgccggagccgacgcgct 475 ||||| || ||||| |||||||||| ||| ||||||| Sbjct: 554 cgcggccagatagaccggggcgccggcgcccacgcgct 517
>ref|NM_178185.1| Mus musculus histone 1, H2ao (Hist1h2ao), mRNA Length = 393 Score = 135 bits (68), Expect = 2e-28 Identities = 176/212 (83%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 157 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 |||||||| |||||||||| ||| ||||||| Sbjct: 156 caggtagaccggggcgccggcgcccacgcgct 125
>ref|XM_978341.1| PREDICTED: Mus musculus similar to histone 2a, transcript variant 2 (LOC665433), mRNA Length = 465 Score = 135 bits (68), Expect = 2e-28 Identities = 176/212 (83%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 368 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 309 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 308 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 249 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 248 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 189 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 |||||||| |||||||||| ||| ||||||| Sbjct: 188 caggtagaccggggcgccggcgcccacgcgct 157
>ref|XM_978296.1| PREDICTED: Mus musculus similar to histone 2a, transcript variant 1 (LOC665433), mRNA Length = 467 Score = 135 bits (68), Expect = 2e-28 Identities = 176/212 (83%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 370 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 311 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 310 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 251 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 250 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 191 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 |||||||| |||||||||| ||| ||||||| Sbjct: 190 caggtagaccggggcgccggcgcccacgcgct 159
>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a novel gene, the genes for three H1, four H2a, five H2b, four H3 and four H4 histone family members, the 3' end of a variant of the Hfe gene for hemochromatosis protein (Mr2) and ten CpG islands, complete sequence Length = 184730 Score = 135 bits (68), Expect = 2e-28 Identities = 176/212 (83%) Strand = Plus / Plus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 163997 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 164056 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 164057 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 164116 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 164117 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 164176 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 |||||||| |||||||||| ||| ||||||| Sbjct: 164177 caggtagaccggggcgccggcgcccacgcgct 164208 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 55412 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 55353 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 55352 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 55293 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 55292 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 55233 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 55232 caggtacaccggggcgccggcgcccacgcgct 55201 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Plus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 51379 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 51438 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 51439 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 51498 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 51499 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 51558 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 51559 caggtacaccggggcgccggcgcccacgcgct 51590 Score = 123 bits (62), Expect = 7e-25 Identities = 134/158 (84%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 14794 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 14735 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| |||||||||||| || |||||||| | |||||| | |||||||| || || Sbjct: 14734 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 14675 Query: 438 ggcggcgaggtagacgggggcgccggagccgacgcgct 475 ||| || ||||| || |||||||||| ||| ||||||| Sbjct: 14674 ggccgccaggtacaccggggcgccggcgcccacgcgct 14637
>ref|NM_178189.2| Mus musculus histone 1, H2ac (Hist1h2ac), mRNA Length = 2493 Score = 135 bits (68), Expect = 2e-28 Identities = 176/212 (83%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 380 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 321 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 320 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 261 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 260 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 201 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 |||||||| |||||||||| ||| ||||||| Sbjct: 200 caggtagaccggggcgccggcgcccacgcgct 169
>emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chromosome 13 Contains the genes for H2b histone family member A, two H2a, two H4 and an H2b histone family member, a serine/threonine protein kinase pseudogene, a novel pseudogene, a novel gene (4930500C15Rik), the gene for a novel KRAB box and C2H2 Zinc Finger containing protein, a ribosomal protein L21 (RPL21) pseudogene, a TU mitochondrial translation elongation factor (tufa) pseudogene, the 5' end of the gene for a novel protein similar to nuclear envelope pore membrane protein POM121 and four CpG islands, complete sequence Length = 182817 Score = 135 bits (68), Expect = 2e-28 Identities = 176/212 (83%) Strand = Plus / Plus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 33307 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 33366 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 33367 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 33426 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 33427 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 33486 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 |||||||| |||||||||| ||| ||||||| Sbjct: 33487 caggtagaccggggcgccggcgcccacgcgct 33518 Score = 135 bits (68), Expect = 2e-28 Identities = 176/212 (83%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 10969 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 10910 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 10909 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 10850 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 10849 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 10790 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 |||||||| |||||||||| ||| ||||||| Sbjct: 10789 caggtagaccggggcgccggcgcccacgcgct 10758
>emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chromosome 13 Contains the 3' end of the gene for a novel protein similar to nuclear envelope pore membrane protein POM121, the Prss16 gene for thymus serine protease16, three novel genes, the genes for two H2a, two H2b and one H4 histone family members, a ribosomal protein L37A (Rpl37a) pseudogene, a novel pseudogene, three genes for novel vomeronasal 1 receptor H (V1rh) family members, the gene for a novel vomeronasal 1 receptor I (V1ri) family member, six V1ri pseudogenes, a V1rh pseudogene and six CpG islands, complete sequence Length = 210845 Score = 135 bits (68), Expect = 2e-28 Identities = 176/212 (83%) Strand = Plus / Plus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 59948 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 60007 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 60008 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 60067 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 60068 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 60127 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 |||||||| |||||||||| ||| ||||||| Sbjct: 60128 caggtagaccggggcgccggcgcccacgcgct 60159 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Plus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 52573 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 52632 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 52633 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 52692 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 52693 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 52752 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 52753 caggtacaccggggcgccggcgcccacgcgct 52784
>gb|BC065803.1| Mus musculus histone 1, H2ag, mRNA (cDNA clone MGC:73771 IMAGE:1263745), complete cds Length = 527 Score = 135 bits (68), Expect = 2e-28 Identities = 176/212 (83%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 358 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 299 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 298 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 239 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 238 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 179 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 |||||||| |||||||||| ||| ||||||| Sbjct: 178 caggtagaccggggcgccggcgcccacgcgct 147
>dbj|AK145443.1| Mus musculus 5 days embryo whole body cDNA, RIKEN full-length enriched library, clone:I0C0045N09 product:histone 1, H2ad, full insert sequence Length = 446 Score = 135 bits (68), Expect = 2e-28 Identities = 176/212 (83%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 369 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 310 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 309 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 250 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 249 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 190 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 |||||||| |||||||||| ||| ||||||| Sbjct: 189 caggtagaccggggcgccggcgcccacgcgct 158
>dbj|AK146846.1| Mus musculus 17 days embryo heart cDNA, RIKEN full-length enriched library, clone:I920064A15 product:histone 1, H2ad, full insert sequence Length = 445 Score = 135 bits (68), Expect = 2e-28 Identities = 176/212 (83%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 367 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 308 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 307 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 248 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 247 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 188 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 |||||||| |||||||||| ||| ||||||| Sbjct: 187 caggtagaccggggcgccggcgcccacgcgct 156
>gb|BC062251.1| Mus musculus cDNA clone MGC:73635 IMAGE:1224905, complete cds Length = 444 Score = 135 bits (68), Expect = 2e-28 Identities = 176/212 (83%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 348 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 289 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 288 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 229 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 228 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 169 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 |||||||| |||||||||| ||| ||||||| Sbjct: 168 caggtagaccggggcgccggcgcccacgcgct 137
>ref|NM_178186.2| Mus musculus histone 1, H2ag (Hist1h2ag), mRNA Length = 527 Score = 135 bits (68), Expect = 2e-28 Identities = 176/212 (83%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 358 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 299 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 298 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 239 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 238 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 179 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 |||||||| |||||||||| ||| ||||||| Sbjct: 178 caggtagaccggggcgccggcgcccacgcgct 147
>dbj|AK088040.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN full-length enriched library, clone:E430002L09 product:H2A histone family, member X, full insert sequence Length = 1379 Score = 135 bits (68), Expect = 2e-28 Identities = 183/220 (83%), Gaps = 1/220 (0%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||||| | |||||| | |||||| Sbjct: 406 gatgttgggcaggacgccgccctgcgcgatggtcacgccgcccagcagcttgttgagctc 347 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 346 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 287 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||||| |||||||||||| || || || Sbjct: 286 gcgggccgcgttgcccgccagctccaggatctcggcagtgaggtactcgagcaccgctgc 227 Query: 444 gaggtagacg-ggggcgccggagccgacgcgctgggcgta 482 ||||| ||| || ||||| | ||| ||||||| |||||| Sbjct: 226 caggtacacgcggcgcgcctgcgcccacgcgctcggcgta 187
>dbj|AK033518.1| Mus musculus adult male colon cDNA, RIKEN full-length enriched library, clone:9030420B16 product:histone 1, H2ac, full insert sequence Length = 2493 Score = 135 bits (68), Expect = 2e-28 Identities = 176/212 (83%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 380 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 321 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 320 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 261 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 260 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 201 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 |||||||| |||||||||| ||| ||||||| Sbjct: 200 caggtagaccggggcgccggcgcccacgcgct 169
>gb|AY158919.1| Mus musculus histone protein Hist1h2ac gene, complete cds Length = 1390 Score = 135 bits (68), Expect = 2e-28 Identities = 176/212 (83%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 836 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 777 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 776 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 717 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 716 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 657 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 |||||||| |||||||||| ||| ||||||| Sbjct: 656 caggtagaccggggcgccggcgcccacgcgct 625
>gb|AY158915.1| Mus musculus histone protein Hist1h2ag gene, complete cds Length = 1392 Score = 135 bits (68), Expect = 2e-28 Identities = 176/212 (83%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 835 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 776 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 775 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 716 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 715 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 656 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 |||||||| |||||||||| ||| ||||||| Sbjct: 655 caggtagaccggggcgccggcgcccacgcgct 624
>gb|AY158913.1| Mus musculus histone protein Hist1h2ao gene, complete cds Length = 1390 Score = 135 bits (68), Expect = 2e-28 Identities = 176/212 (83%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 836 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 777 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 776 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 717 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 716 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 657 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 |||||||| |||||||||| ||| ||||||| Sbjct: 656 caggtagaccggggcgccggcgcccacgcgct 625
>gb|AY389588.1| Hyacinthus orientalis histone H2A mRNA, complete cds Length = 643 Score = 133 bits (67), Expect = 8e-28 Identities = 148/175 (84%) Strand = Plus / Minus Query: 371 tcttcttgttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtact 430 ||||||| |||||| | |||||||| ||||| | ||||| | ||| ||||||||||||| Sbjct: 283 tcttcttattgtccctcgccgcgtttccggccaactccaatacctcagcagcgaggtact 224 Query: 431 cgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggcgtaacggccct 490 | | |||||||||||||||||| || || |||| |||||| ||||| ||||| | ||||| Sbjct: 223 ccaagacggcggcgaggtagaccggagctccggtgccgacacgctgagcgtacctgccct 164 Query: 491 tcttgaggtaacgcccgatgcggccgacggggaactggagcccggccttgacgga 545 |||| | ||| || |||| ||||| ||||||||||||||||||||||||||||| Sbjct: 163 tcttcaagtatcggccgagacggccaacggggaactggagcccggccttgacgga 109
>emb|X58069.1|MMH2AX Mouse mRNA for Histone H2A.X Length = 1359 Score = 133 bits (67), Expect = 8e-28 Identities = 181/219 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||||| | |||||| | |||||| Sbjct: 387 gatgttgggcaggacgccgccctgcgcgatggtcacgccgcccagcagcttgttgagctc 328 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||| ||||||||||| ||||||||||||| Sbjct: 327 ctcgtcgttgcggatggccagctgcaggtggcgagggatgatgcgcgtcttcttgttgtc 268 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||||| |||||||||||| || || || Sbjct: 267 gcgggccgcgttgcccgccagctccaggatctcggcagtgaggtactcgagcaccgctgc 208 Query: 444 gaggtagacgggggcgccggagccgacgcgctgggcgta 482 ||||| || || ||||| | ||| ||||||| |||||| Sbjct: 207 caggtacaccggcgcgcctgcgcccacgcgctcggcgta 169
>gb|AF255739.1|AF255739 Bufo bufo gagarizans replication-dependent histone H2A gene, complete cds Length = 2120 Score = 133 bits (67), Expect = 8e-28 Identities = 181/219 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| || || |||||||||||||||||| | |||||| | |||||| Sbjct: 1141 gatgttgggcaggacgcctccctgggcgatggtgacgccgcccagcagcttgttgagctc 1082 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||| ||||| ||| ||||||| || |||||||||||| ||||||||||||| Sbjct: 1081 ctcgtcgttgcgcacggccagctgcaggtgacgggggatgatgcgggtcttcttgttgtc 1022 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 ||| || |||||||| |||||||| | |||||| | ||| |||||||| || ||||| Sbjct: 1021 gcgggcggcattgccggccagctccaggatctcggcggtgagatactcgagcacagcggc 962 Query: 444 gaggtagacgggggcgccggagccgacgcgctgggcgta 482 | ||||||||| ||||||| ||| || | ||||||||| Sbjct: 961 caagtagacgggagcgccggcgcccaccctctgggcgta 923
>dbj|AK008124.1| Mus musculus adult male small intestine cDNA, RIKEN full-length enriched library, clone:2010005I09 product:H2A histone family, member X, full insert sequence Length = 564 Score = 133 bits (67), Expect = 8e-28 Identities = 145/171 (84%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||||| | |||||| | |||||| Sbjct: 403 gatgttgggcaggacgccgccctgcgcgatggtcacgccgcccagcagcttgttgagctc 344 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 343 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 284 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgag 434 |||||||||||| || |||||||| | |||||||| |||||||||||| Sbjct: 283 gcgggccgcgttgcccgccagctccaggatctcggcagtgaggtactcgag 233
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 133 bits (67), Expect = 8e-28 Identities = 112/127 (88%) Strand = Plus / Plus Query: 414 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcg 473 |||||| |||||||||||||||||||||| |||||||||||||||||||| ||||||||| Sbjct: 20924705 ctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacgcg 20924764 Query: 474 ctgggcgtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagccc 533 || |||||| ||| ||||||||| | ||||||||||||||||||||||||| || Sbjct: 20924765 ctcggcgtacttgccggccttgaggtacctggcgatgcggccgacggggaactggaggcc 20924824 Query: 534 ggccttg 540 ||||||| Sbjct: 20924825 ggccttg 20924831 Score = 105 bits (53), Expect = 2e-19 Identities = 65/69 (94%) Strand = Plus / Plus Query: 414 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcg 473 |||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||| Sbjct: 14468902 ctcggcggcgaggtactcgaggacggcggcgaggtagacgggagcgccggcgccgacgcg 14468961 Query: 474 ctgggcgta 482 || |||||| Sbjct: 14468962 ctcggcgta 14468970 Score = 105 bits (53), Expect = 2e-19 Identities = 125/149 (83%) Strand = Plus / Plus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| ||||| |||||| |||||||||| ||||| |||||||| | |||||| Sbjct: 14468549 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 14468608 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||| || |||||| | | ||||||||| | |||||| ||||||||||||| Sbjct: 14468609 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 14468668 Query: 384 cttggccgcgttgccggcaagctccagca 412 | | |||||||| ||||| |||||||||| Sbjct: 14468669 cctcgccgcgttcccggcgagctccagca 14468697 Score = 65.9 bits (33), Expect = 2e-07 Identities = 102/125 (81%) Strand = Plus / Plus Query: 288 ggcgatggtgacgccggcgagcagccttccgagctcctggtcgttgcggacggcgagcag 347 ||||||||||||| || |||||||||| | ||||||| ||||||||| || || ||| | Sbjct: 20924481 ggcgatggtgacggcgccgagcagcctgctcagctcctcgtcgttgcgcaccgccagctg 20924540 Query: 348 caggtggcgcgggatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctc 407 | ||| | ||| | ||| ||| |||||||||||||| | |||||||| || || ||||| Sbjct: 20924541 gatgtgcctcggcacgatccggttcttcttgttgtccctcgccgcgttccccgccagctc 20924600 Query: 408 cagca 412 ||||| Sbjct: 20924601 cagca 20924605
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 133 bits (67), Expect = 8e-28 Identities = 112/127 (88%) Strand = Plus / Minus Query: 414 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcg 473 |||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 20566248 ctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggcgccgacgcg 20566189 Query: 474 ctgggcgtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagccc 533 || |||||| ||| ||||||| | || |||| | ||||||||||||||||||||| Sbjct: 20566188 ctcggcgtacttgccggccttgaggaagcgggcgatcctgccgacggggaactggagccc 20566129 Query: 534 ggccttg 540 ||||||| Sbjct: 20566128 ggccttg 20566122 Score = 67.9 bits (34), Expect = 4e-08 Identities = 99/122 (81%), Gaps = 9/122 (7%) Strand = Plus / Plus Query: 424 aggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggcgtaa 483 |||||| |||||||||| |||||||||||||||| ||| | ||||||||| || |||| Sbjct: 11503423 aggtacccgaggacggcagcgaggtagacgggggtgccagtgccgacgcgttgcgcgtgc 11503482 Query: 484 cggcccttcttgaggtaacgcccgatgcggccgacggggaactggagcccggccttgacg 543 ||||| |||| |||||| ||||| ||| ||||||||||||||||||||||| Sbjct: 11503483 cggccgttctcgaggta---------gcggcttacgaggaactggagcccggccttgacg 11503533 Query: 544 ga 545 || Sbjct: 11503534 ga 11503535 Score = 63.9 bits (32), Expect = 6e-07 Identities = 116/144 (80%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| ||||| ||||||| ||||||||||||| || ||||||| | ||||| Sbjct: 20566495 gatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagctc 20566436 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||| ||||||||| | | ||| | ||| | ||| || ||||||||||||| Sbjct: 20566435 ctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttgtc 20566376 Query: 384 cttggccgcgttgccggcaagctc 407 | |||||||| ||||| ||||| Sbjct: 20566375 ccgcgccgcgttcccggcgagctc 20566352
>dbj|AP005734.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBb0032E15 Length = 120419 Score = 133 bits (67), Expect = 8e-28 Identities = 112/127 (88%) Strand = Plus / Minus Query: 414 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcg 473 |||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 70209 ctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggcgccgacgcg 70150 Query: 474 ctgggcgtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagccc 533 || |||||| ||| ||||||| | || |||| | ||||||||||||||||||||| Sbjct: 70149 ctcggcgtacttgccggccttgaggaagcgggcgatcctgccgacggggaactggagccc 70090 Query: 534 ggccttg 540 ||||||| Sbjct: 70089 ggccttg 70083 Score = 63.9 bits (32), Expect = 6e-07 Identities = 116/144 (80%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| ||||| ||||||| ||||||||||||| || ||||||| | ||||| Sbjct: 70456 gatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagctc 70397 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||| ||||||||| | | ||| | ||| | ||| || ||||||||||||| Sbjct: 70396 ctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttgtc 70337 Query: 384 cttggccgcgttgccggcaagctc 407 | |||||||| ||||| ||||| Sbjct: 70336 ccgcgccgcgttcccggcgagctc 70313
>dbj|AP003898.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1663_D06 Length = 139103 Score = 133 bits (67), Expect = 8e-28 Identities = 112/127 (88%) Strand = Plus / Minus Query: 414 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcg 473 |||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 40620 ctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggcgccgacgcg 40561 Query: 474 ctgggcgtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagccc 533 || |||||| ||| ||||||| | || |||| | ||||||||||||||||||||| Sbjct: 40560 ctcggcgtacttgccggccttgaggaagcgggcgatcctgccgacggggaactggagccc 40501 Query: 534 ggccttg 540 ||||||| Sbjct: 40500 ggccttg 40494 Score = 63.9 bits (32), Expect = 6e-07 Identities = 116/144 (80%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| ||||| ||||||| ||||||||||||| || ||||||| | ||||| Sbjct: 40867 gatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagctc 40808 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||| ||||||||| | | ||| | ||| | ||| || ||||||||||||| Sbjct: 40807 ctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttgtc 40748 Query: 384 cttggccgcgttgccggcaagctc 407 | |||||||| ||||| ||||| Sbjct: 40747 ccgcgccgcgttcccggcgagctc 40724
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 133 bits (67), Expect = 8e-28 Identities = 112/127 (88%) Strand = Plus / Plus Query: 414 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcg 473 |||||| |||||||||||||||||||||| |||||||||||||||||||| ||||||||| Sbjct: 20850919 ctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacgcg 20850978 Query: 474 ctgggcgtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagccc 533 || |||||| ||| ||||||||| | ||||||||||||||||||||||||| || Sbjct: 20850979 ctcggcgtacttgccggccttgaggtacctggcgatgcggccgacggggaactggaggcc 20851038 Query: 534 ggccttg 540 ||||||| Sbjct: 20851039 ggccttg 20851045 Score = 105 bits (53), Expect = 2e-19 Identities = 65/69 (94%) Strand = Plus / Plus Query: 414 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcg 473 |||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||| Sbjct: 14423186 ctcggcggcgaggtactcgaggacggcggcgaggtagacgggagcgccggcgccgacgcg 14423245 Query: 474 ctgggcgta 482 || |||||| Sbjct: 14423246 ctcggcgta 14423254 Score = 105 bits (53), Expect = 2e-19 Identities = 125/149 (83%) Strand = Plus / Plus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| ||||| |||||| |||||||||| ||||| |||||||| | |||||| Sbjct: 14422833 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 14422892 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||| || |||||| | | ||||||||| | |||||| ||||||||||||| Sbjct: 14422893 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 14422952 Query: 384 cttggccgcgttgccggcaagctccagca 412 | | |||||||| ||||| |||||||||| Sbjct: 14422953 cctcgccgcgttcccggcgagctccagca 14422981 Score = 65.9 bits (33), Expect = 2e-07 Identities = 102/125 (81%) Strand = Plus / Plus Query: 288 ggcgatggtgacgccggcgagcagccttccgagctcctggtcgttgcggacggcgagcag 347 ||||||||||||| || |||||||||| | ||||||| ||||||||| || || ||| | Sbjct: 20850695 ggcgatggtgacggcgccgagcagcctgctcagctcctcgtcgttgcgcaccgccagctg 20850754 Query: 348 caggtggcgcgggatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctc 407 | ||| | ||| | ||| ||| |||||||||||||| | |||||||| || || ||||| Sbjct: 20850755 gatgtgcctcggcacgatccggttcttcttgttgtccctcgccgcgttccccgccagctc 20850814 Query: 408 cagca 412 ||||| Sbjct: 20850815 cagca 20850819
>emb|AL713943.3|CNS07YPC Oryza sativa chromosome 12, . BAC OSJNBa0030G16 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 182172 Score = 133 bits (67), Expect = 8e-28 Identities = 112/127 (88%) Strand = Plus / Plus Query: 414 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcg 473 |||||| |||||||||||||||||||||| |||||||||||||||||||| ||||||||| Sbjct: 10195 ctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacgcg 10254 Query: 474 ctgggcgtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagccc 533 || |||||| ||| ||||||||| | ||||||||||||||||||||||||| || Sbjct: 10255 ctcggcgtacttgccggccttgaggtacctggcgatgcggccgacggggaactggaggcc 10314 Query: 534 ggccttg 540 ||||||| Sbjct: 10315 ggccttg 10321 Score = 65.9 bits (33), Expect = 2e-07 Identities = 102/125 (81%) Strand = Plus / Plus Query: 288 ggcgatggtgacgccggcgagcagccttccgagctcctggtcgttgcggacggcgagcag 347 ||||||||||||| || |||||||||| | ||||||| ||||||||| || || ||| | Sbjct: 9971 ggcgatggtgacggcgccgagcagcctgctcagctcctcgtcgttgcgcaccgccagctg 10030 Query: 348 caggtggcgcgggatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctc 407 | ||| | ||| | ||| ||| |||||||||||||| | |||||||| || || ||||| Sbjct: 10031 gatgtgcctcggcacgatccggttcttcttgttgtccctcgccgcgttccccgccagctc 10090 Query: 408 cagca 412 ||||| Sbjct: 10091 cagca 10095
>emb|AL731880.3|CNS08C8J Oryza sativa chromosome 12, . BAC OSJNBa0035E02 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 107819 Score = 133 bits (67), Expect = 8e-28 Identities = 112/127 (88%) Strand = Plus / Minus Query: 414 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcg 473 |||||| |||||||||||||||||||||| |||||||||||||||||||| ||||||||| Sbjct: 34290 ctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacgcg 34231 Query: 474 ctgggcgtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggagccc 533 || |||||| ||| ||||||||| | ||||||||||||||||||||||||| || Sbjct: 34230 ctcggcgtacttgccggccttgaggtacctggcgatgcggccgacggggaactggaggcc 34171 Query: 534 ggccttg 540 ||||||| Sbjct: 34170 ggccttg 34164 Score = 65.9 bits (33), Expect = 2e-07 Identities = 102/125 (81%) Strand = Plus / Minus Query: 288 ggcgatggtgacgccggcgagcagccttccgagctcctggtcgttgcggacggcgagcag 347 ||||||||||||| || |||||||||| | ||||||| ||||||||| || || ||| | Sbjct: 34514 ggcgatggtgacggcgccgagcagcctgctcagctcctcgtcgttgcgcaccgccagctg 34455 Query: 348 caggtggcgcgggatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctc 407 | ||| | ||| | ||| ||| |||||||||||||| | |||||||| || || ||||| Sbjct: 34454 gatgtgcctcggcacgatccggttcttcttgttgtccctcgccgcgttccccgccagctc 34395 Query: 408 cagca 412 ||||| Sbjct: 34394 cagca 34390
>gb|AY104828.1| Zea mays PCO072413 mRNA sequence Length = 741 Score = 131 bits (66), Expect = 3e-27 Identities = 183/222 (82%) Strand = Plus / Minus Query: 319 agctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttg 378 ||||||| ||||||||| || || ||| | | ||||||||| | |||||| |||||||| Sbjct: 341 agctcctcgtcgttgcgcacagcaagctggatgtggcgcggcacaatgcgggtcttcttg 282 Query: 379 ttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacg 438 |||||| | || ||||| |||||||| || || | ||| || |||||||||||||||||| Sbjct: 281 ttgtccctcgcggcgttcccggcaagttcgagaacctcagccgcgaggtactcgaggacg 222 Query: 439 gcggcgaggtagacgggggcgccggagccgacgcgctgggcgtaacggcccttcttgagg 498 ||||||||||| ||||||||||||| ||||||||||| ||||| |||| ||||||| Sbjct: 221 gcggcgaggtacacgggggcgccggcgccgacgcgctccgcgtacttgcccgccttgagg 162 Query: 499 taacgcccgatgcggccgacggggaactggagcccggccttg 540 | | | || | |||||||||||||||||| ||||||||| Sbjct: 161 aacctggcaatcctgccgacggggaactggagtccggccttg 120
>ref|XM_576399.1| PREDICTED: Rattus norvegicus similar to Histone H2A.x (H2a/x) (LOC500987), mRNA Length = 1569 Score = 129 bits (65), Expect = 1e-26 Identities = 185/225 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || ||||| || |||||| | |||||| | |||||| Sbjct: 615 gatgttgggcaggacgccgccctgcgcgatagtcacgccgcccagcagcttgttgagctc 556 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| || ||| |||||||||||||||| ||||| ||||||||||||| Sbjct: 555 ctcgtcgttgcggatagccagctgcaggtggcgcgggataatgcgcgtcttcttgttgtc 496 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 | ||||||||||| || |||||||| | |||||||| |||||||||||| || || || Sbjct: 495 ccgagccgcgttgcccgccagctccaggatctcggcagtgaggtactcgagcaccgccgc 436 Query: 444 gaggtagacgggggcgccggagccgacgcgctgggcgtaacggcc 488 ||||| ||||| ||||| | ||| ||||||| ||||||| |||| Sbjct: 435 caggtacacgggcgcgcctgcgcccacgcgctcggcgtaatggcc 391
>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence Length = 209720 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 64605 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 64546 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 64545 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 64486 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 64485 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 64426 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 64425 caggtacaccggggcgccggcgcccacgcgct 64394 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Plus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 60572 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 60631 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 60632 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 60691 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 60692 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 60751 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 60752 caggtacaccggggcgccggcgcccacgcgct 60783 Score = 123 bits (62), Expect = 7e-25 Identities = 134/158 (84%) Strand = Plus / Plus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 101186 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 101245 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| |||||||||||| || |||||||| | |||||| | |||||||| || || Sbjct: 101246 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 101305 Query: 438 ggcggcgaggtagacgggggcgccggagccgacgcgct 475 ||| || ||||| || |||||||||| ||| ||||||| Sbjct: 101306 ggccgccaggtacaccggggcgccggcgcccacgcgct 101343
>ref|NG_002734.1| Mus musculus histone 1, H2aj (Hist1h2aj) pseudogene on chromosome 13 Length = 1357 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 818 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 759 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 758 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 699 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 698 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 639 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 638 caggtacaccggggcgccggcgcccacgcgct 607
>gb|BC058544.1| Mus musculus cDNA clone IMAGE:5711765, with apparent retained intron Length = 497 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 367 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 308 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 307 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 248 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 247 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 188 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 187 caggtacaccggggcgccggcgcccacgcgct 156
>emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B) Length = 1826 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 1284 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 1225 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 1224 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 1165 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 1164 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 1105 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 1104 caggtacaccggggcgccggcgcccacgcgct 1073
>emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A) Length = 1797 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 1285 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 1226 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 1225 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 1166 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 1165 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 1106 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 1105 caggtacaccggggcgccggcgcccacgcgct 1074
>gb|BC099406.1| Mus musculus histone 1, H2ac, mRNA (cDNA clone MGC:117571 IMAGE:30789778), complete cds Length = 1075 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 346 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 287 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 286 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 227 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 226 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 167 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 166 caggtacaccggggcgccggcgcccacgcgct 135
>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five genes for olfactory receptors, a novel gene, the H1f5 gene for H1 histone family member 5, three genes and one pseudogene for H2a histone family members, four genes for H2b, two genes for H4, and two genes for H3 histone family members and seven CpG islands, complete sequence Length = 222823 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Plus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 207873 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 207932 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 207933 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 207992 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 207993 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 208052 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 208053 caggtacaccggggcgccggcgcccacgcgct 208084 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Plus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 142474 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 142533 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 142534 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 142593 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 142594 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 142653 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 142654 caggtacaccggggcgccggcgcccacgcgct 142685 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 137747 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 137688 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 137687 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 137628 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 137627 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 137568 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 137567 caggtacaccggggcgccggcgcccacgcgct 137536 Score = 119 bits (60), Expect = 1e-23 Identities = 174/212 (82%) Strand = Plus / Plus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 174482 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 174541 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||| ||||| ||||||||||||| Sbjct: 174542 ctcgtcgttgcggatggccagctgcaggtggcgcgggataatgcgcgtcttcttgttgtc 174601 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 174602 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactctagcacggctgc 174661 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 174662 caggtacaccggggcgccggcgcccacgcgct 174693
>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the Slc17a1 gene for solute carrier family 17 (vesicular glutamate transporter) member 1, two genes for novel solute carrier family 17 (Slc17) members, two novel genes, the gene for a novel C3HC4 type zinc finger (ring finger) protein, the gene for an H2a, an H2b, two genes for H3 and two genes for H4 histone family members, a H2a histone family pseudogene, the H1f1 and H1f2 genes for H1 histone family members 1 and 2, the H3f2 gene for H3 histone family, member 2 (H3.2), a novel pseudogene, the Hfe gene for hemochromatosis protein (Mr2) and two CpG islands, complete sequence Length = 186062 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Plus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 136910 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 136969 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 136970 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 137029 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 137030 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 137089 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 137090 caggtacaccggggcgccggcgcccacgcgct 137121 Score = 99.6 bits (50), Expect = 1e-17 Identities = 122/146 (83%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 142156 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 142097 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 142096 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 142037 Query: 384 cttggccgcgttgccggcaagctcca 409 |||||||||||| || ||||||| Sbjct: 142036 gcgggccgcgttgcccgccagctcca 142011
>gb|BC076498.1| Mus musculus histone 1, H2ae, mRNA (cDNA clone MGC:90847 IMAGE:5713252), complete cds Length = 492 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 366 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 307 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 306 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 247 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 246 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 187 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 186 caggtacaccggggcgccggcgcccacgcgct 155
>dbj|AK146117.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library, clone:I730004H15 product:histone 1, H2ai, full insert sequence Length = 1396 Score = 127 bits (64), Expect = 5e-26 Identities = 176/212 (83%), Gaps = 1/212 (0%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| ||| |||||| | |||||| Sbjct: 347 gatgttgggcaggacgccgccctgcgcgatggtcacgc-ggccagcagcttgttgagctc 289 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 288 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 229 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 228 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 169 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 168 caggtacaccggggcgccggcgcccacgcgct 137
>ref|NM_175660.2| Mus musculus histone 1, H2ab (Hist1h2ab), mRNA Length = 506 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 381 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 322 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 321 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 262 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 261 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 202 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 201 caggtacaccggggcgccggcgcccacgcgct 170
>gb|BC090402.1| Mus musculus cDNA clone MGC:103288 IMAGE:5150365, complete cds Length = 447 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 348 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 289 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 288 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 229 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 228 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 169 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 168 caggtacaccggggcgccggcgcccacgcgct 137
>gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016 Length = 2110 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 606 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 547 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 546 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 487 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 486 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 427 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 426 caggtacaccggggcgccggcgcccacgcgct 395
>gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108 Length = 2221 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 604 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 545 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 544 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 485 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 484 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 425 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 424 caggtacaccggggcgccggcgcccacgcgct 393
>ref|NM_178187.2| Mus musculus histone 1, H2ae (Hist1h2ae), mRNA Length = 705 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 449 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 390 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 389 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 330 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 329 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 270 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 269 caggtacaccggggcgccggcgcccacgcgct 238
>ref|NM_178188.3| Mus musculus histone 1, H2ad (Hist1h2ad), mRNA Length = 393 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 157 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 156 caggtacaccggggcgccggcgcccacgcgct 125
>gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone H2a.1-F (H2a-F), histone H2b-F (H2b-F) genes, complete cds Length = 2822 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Plus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 1493 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 1552 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 1553 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 1612 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 1613 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 1672 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 1673 caggtacaccggggcgccggcgcccacgcgct 1704
>dbj|AK028026.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length enriched library, clone:1190022L06 product:HISTONE H2A homolog [Homo sapiens], full insert sequence Length = 705 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 449 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 390 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 389 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 330 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 329 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 270 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 269 caggtacaccggggcgccggcgcccacgcgct 238
>ref|NM_178184.1| Mus musculus histone 1, H2an (Hist1h2an), mRNA Length = 393 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 157 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 156 caggtacaccggggcgccggcgcccacgcgct 125
>ref|NM_178182.1| Mus musculus histone 1, H2ai (Hist1h2ai), mRNA Length = 393 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 157 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 156 caggtacaccggggcgccggcgcccacgcgct 125
>gb|AY158920.1| Mus musculus histone protein Hist1h2ab gene, complete cds Length = 1390 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 836 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 777 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 776 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 717 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 716 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 657 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 656 caggtacaccggggcgccggcgcccacgcgct 625
>gb|AY158918.1| Mus musculus histone protein Hist1h2ad gene, complete cds Length = 1390 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 836 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 777 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 776 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 717 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 716 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 657 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 656 caggtacaccggggcgccggcgcccacgcgct 625
>gb|AY158917.1| Mus musculus histone protein Hist1h2ae gene, complete cds Length = 1390 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 836 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 777 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 776 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 717 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 716 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 657 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 656 caggtacaccggggcgccggcgcccacgcgct 625
>gb|AY158914.1| Mus musculus histone protein Hist1h2ah gene, complete cds Length = 1381 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 833 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 774 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 773 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 714 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 713 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 654 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 653 caggtacaccggggcgccggcgcccacgcgct 622
>gb|AY158912.1| Mus musculus histone protein Hist1h2an gene, complete cds Length = 1390 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 836 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 777 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 776 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 717 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 716 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 657 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 656 caggtacaccggggcgccggcgcccacgcgct 625
>gb|AY158910.1| Mus musculus histone protein Hist1h2aj pseudogene, partial sequence Length = 1357 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 818 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 759 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 758 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 699 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 698 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 639 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 638 caggtacaccggggcgccggcgcccacgcgct 607
>gb|AY158909.1| Mus musculus histone protein Hist1h2ai gene, complete cds Length = 1387 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 833 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 774 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 773 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 714 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 713 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 654 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 653 caggtacaccggggcgccggcgcccacgcgct 622
>ref|NM_175659.1| Mus musculus histone 1, H2ah (Hist1h2ah), mRNA Length = 387 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 157 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 156 caggtacaccggggcgccggcgcccacgcgct 125
>gb|AY104826.1| Zea mays PCO099353 mRNA sequence Length = 793 Score = 127 bits (64), Expect = 5e-26 Identities = 139/164 (84%) Strand = Plus / Minus Query: 319 agctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttg 378 ||||||| ||||||||| ||||||||| | | ||| ||||| | ||||||| |||||||| Sbjct: 383 agctcctcgtcgttgcgcacggcgagctggatgtgacgcggcacgatgcgggtcttcttg 324 Query: 379 ttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacg 438 || ||| | || ||||| || ||||||||||| | ||| || ||||||||||||||||| Sbjct: 323 ttatccctcgctgcgttcccagcaagctccaggacctcagcggcgaggtactcgaggaca 264 Query: 439 gcggcgaggtagacgggggcgccggagccgacgcgctgggcgta 482 || ||||||||||| |||||||||| ||| ||||||| |||||| Sbjct: 263 gctgcgaggtagacaggggcgccggcgcccacgcgctcggcgta 220
>gb|M37736.1|MUSHIS2AR Mouse replication-dependent histone H2A.1 gene Length = 668 Score = 127 bits (64), Expect = 5e-26 Identities = 175/212 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 459 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 400 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 399 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 340 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 339 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 280 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 279 caggtacaccggggcgccggcgcccacgcgct 248
>gb|AY158916.1| Mus musculus histone protein Hist1h2af gene, complete cds Length = 1390 Score = 123 bits (62), Expect = 7e-25 Identities = 134/158 (84%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 806 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 747 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| |||||||||||| || |||||||| | |||||| | |||||||| || || Sbjct: 746 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 687 Query: 438 ggcggcgaggtagacgggggcgccggagccgacgcgct 475 ||| || ||||| || |||||||||| ||| ||||||| Sbjct: 686 ggccgccaggtacaccggggcgccggcgcccacgcgct 649
>ref|NM_175661.1| Mus musculus histone 1, H2af (Hist1h2af), mRNA Length = 393 Score = 123 bits (62), Expect = 7e-25 Identities = 134/158 (84%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| |||||||||||| || |||||||| | |||||| | |||||||| || || Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 163 Query: 438 ggcggcgaggtagacgggggcgccggagccgacgcgct 475 ||| || ||||| || |||||||||| ||| ||||||| Sbjct: 162 ggccgccaggtacaccggggcgccggcgcccacgcgct 125
>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and histone H2A genes, complete cds Length = 4358 Score = 123 bits (62), Expect = 7e-25 Identities = 182/222 (81%) Strand = Plus / Minus Query: 319 agctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttg 378 ||||||| ||||||||||| ||| ||| | | |||||| || | ||||||| |||||||| Sbjct: 4081 agctcctcgtcgttgcggatggccagctggatgtggcggggcacgatgcggttcttcttg 4022 Query: 379 ttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacg 438 ||||| ||| ||||||||||| |||||||||| ||| || | |||||||| || || Sbjct: 4021 ttgtcgcgggcggcgttgccggccagctccagcacctcagcggtcaggtactccagcaca 3962 Query: 439 gcggcgaggtagacgggggcgccggagccgacgcgctgggcgtaacggcccttcttgagg 498 ||||| ||||| ||||| ||||||| |||| ||||| |||||| ||||||||| ||| Sbjct: 3961 gcggccaggtacacgggcgcgccggcaccgatgcgctcggcgtacttgcccttcttcagg 3902 Query: 499 taacgcccgatgcggccgacggggaactggagcccggccttg 540 || ||| | |||||||| ||||||||||| || ||||||||| Sbjct: 3901 tagcgcgcaatgcggccaacggggaactgcaggccggccttg 3860
>gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, complete cds Length = 2132 Score = 123 bits (62), Expect = 7e-25 Identities = 182/222 (81%) Strand = Plus / Plus Query: 319 agctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttg 378 ||||||| ||||||||||| ||||||| | | ||||||||||| ||||||| |||||||| Sbjct: 550 agctcctcgtcgttgcggatggcgagctggatgtggcgcgggacgatgcggttcttcttg 609 Query: 379 ttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacg 438 ||||| |||||||||||| || |||||||| | ||| |||| |||||||| || || Sbjct: 610 ttgtcgcgggccgcgttgccagccagctccagaacctcagcagtcaggtactccagcaca 669 Query: 439 gcggcgaggtagacgggggcgccggagccgacgcgctgggcgtaacggcccttcttgagg 498 ||||| ||||||||||||||||| | |||| ||||| ||| || ||||||||| | | Sbjct: 670 gcggccaggtagacgggggcgccagcaccgatgcgctcggcatacttgcccttcttcaag 729 Query: 499 taacgcccgatgcggccgacggggaactggagcccggccttg 540 ||||| | |||||||| || |||||||| || || |||||| Sbjct: 730 taacgagcaatgcggcccacagggaactgcagaccagccttg 771
>ref|NM_178183.1| Mus musculus histone 1, H2ak (Hist1h2ak), mRNA Length = 393 Score = 119 bits (60), Expect = 1e-23 Identities = 174/212 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||| ||||| ||||||||||||| Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggataatgcgcgtcttcttgttgtc 217 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactctagcacggctgc 157 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 156 caggtacaccggggcgccggcgcccacgcgct 125
>ref|XM_225386.2| PREDICTED: Rattus norvegicus histone 1, H2an (predicted) (Hist1h2an_predicted), mRNA Length = 546 Score = 119 bits (60), Expect = 1e-23 Identities = 165/200 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 336 gatgttgggcaggacgccgccctgtgcgatggtcacgcggcccagcagcttgttgagctc 277 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 | | || |||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 216 cctcgctgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 157 Query: 444 gaggtagacgggggcgccgg 463 ||||| || |||||||||| Sbjct: 156 caggtacaccggggcgccgg 137
>ref|XM_225372.2| PREDICTED: Rattus norvegicus similar to Histone H2A.1 (LOC306962), mRNA Length = 437 Score = 119 bits (60), Expect = 1e-23 Identities = 156/188 (82%) Strand = Plus / Minus Query: 276 gacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctcctggtcgttgcg 335 ||||||||| || |||||||| |||| | | |||||| | |||||||| ||||||||| Sbjct: 338 gacaccgccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcg 279 Query: 336 gacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttggccgcgtt 395 || ||| ||| |||||||||||||||||||||| |||||||||||||| | |||||||| Sbjct: 278 gatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtccctcgccgcgtt 219 Query: 396 gccggcaagctccagcagctcggcagcgaggtactcgaggacggcggcgaggtagacggg 455 ||| || |||||||| | |||||| | |||||||| || ||||| || || || || || Sbjct: 218 gcccgccagctccaggatctcggccgtcaggtactccagcacggccgccagatacactgg 159 Query: 456 ggcgccgg 463 |||||||| Sbjct: 158 ggcgccgg 151
>gb|AY158911.1| Mus musculus histone protein Hist1h2ak gene, complete cds Length = 1201 Score = 119 bits (60), Expect = 1e-23 Identities = 174/212 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 870 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 811 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||| ||||| ||||||||||||| Sbjct: 810 ctcgtcgttgcggatggccagctgcaggtggcgcgggataatgcgcgtcttcttgttgtc 751 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 750 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactctagcacggctgc 691 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 690 caggtacaccggggcgccggcgcccacgcgct 659
>gb|U95111.1|MSU95111 Mus spretus histone H2a pseudogene, complete sequence Length = 567 Score = 119 bits (60), Expect = 1e-23 Identities = 174/212 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 399 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 340 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 | ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 339 cacgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 280 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 279 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 220 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 219 caggtacaccggggcgccggcgcccacgcgct 188
>ref|XM_848163.1| PREDICTED: Canis familiaris similar to Histone H2A.x (H2a/x) (LOC489372), mRNA Length = 841 Score = 117 bits (59), Expect = 5e-23 Identities = 146/175 (83%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||| ||||||||||| ||||||| Sbjct: 579 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 520 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| |||||||||||| || |||||||| | |||||| | ||||||||||| || Sbjct: 519 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactcgagcac 460 Query: 438 ggcggcgaggtagacgggggcgccggagccgacgcgctgggcgtaacggcccttc 492 ||| || ||||| || || ||||||| ||| || |||| |||||| |||||||| Sbjct: 459 ggccgccaggtacaccggcgcgccggcgcccacccgctcggcgtagtggcccttc 405
>gb|U70133.1|BBU70133 Bufo bufo gagarizans replication-dependent histone H2A mRNA, complete cds Length = 466 Score = 117 bits (59), Expect = 5e-23 Identities = 179/219 (81%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| || || |||||||||||||| ||| | |||||| | |||||| Sbjct: 357 gatgttgggcaggacccccccctgggcgatggtgactccgcccagcagcttgttgagctc 298 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||| ||||| ||| ||||||| || ||||||||||| ||||||||||||| Sbjct: 297 ctcgtcgttgcgcacggccagctgcaggtgacgggggatgatgcgagtcttcttgttgtc 238 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 ||| || |||||||| |||||||| | |||||| | ||| |||||||| || ||||| Sbjct: 237 gcgggcggcattgccggccagctccaggatctcggcggtgagatactcgagcacagcggc 178 Query: 444 gaggtagacgggggcgccggagccgacgcgctgggcgta 482 | ||||||||| ||||||| ||| || | ||||||||| Sbjct: 177 caagtagacgggagcgccggcgcccaccctctgggcgta 139
>gb|DQ214188.1| Taeniopygia guttata clone 0058P0024E05 histone 1 H2ai-like mRNA, complete sequence Length = 786 Score = 115 bits (58), Expect = 2e-22 Identities = 133/158 (84%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||||||| |||||||||| ||||||||||| ||||||| Sbjct: 365 gagctcctcgtcgttgcggatggcgagctgcaggtggcgggggatgatgcgcgtcttctt 306 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| |||||||||||| || |||||||| | |||||| | |||||||| || || Sbjct: 305 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 246 Query: 438 ggcggcgaggtagacgggggcgccggagccgacgcgct 475 ||| || ||||| || || ||||||| ||| ||||||| Sbjct: 245 ggccgccaggtacaccggcgcgccggcgcccacgcgct 208 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 510 gcggccgacggggaactggagcccggcc 537 |||||| ||||||||||| ||||||||| Sbjct: 173 gcggcccacggggaactgcagcccggcc 146
>gb|DQ214187.1| Taeniopygia guttata clone 0058P0044E04 histone 1 H2ai-like mRNA, complete sequence Length = 786 Score = 115 bits (58), Expect = 2e-22 Identities = 133/158 (84%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||||||| |||||||||| ||||||||||| ||||||| Sbjct: 365 gagctcctcgtcgttgcggatggcgagctgcaggtggcgggggatgatgcgcgtcttctt 306 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| |||||||||||| || |||||||| | |||||| | |||||||| || || Sbjct: 305 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 246 Query: 438 ggcggcgaggtagacgggggcgccggagccgacgcgct 475 ||| || ||||| || || ||||||| ||| ||||||| Sbjct: 245 ggccgccaggtacaccggcgcgccggcgcccacgcgct 208 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 510 gcggccgacggggaactggagcccggcc 537 |||||| ||||||||||| ||||||||| Sbjct: 173 gcggcccacggggaactgcagcccggcc 146
>gb|BT016168.1| Zea mays clone Contig1 mRNA sequence Length = 676 Score = 115 bits (58), Expect = 2e-22 Identities = 157/190 (82%) Strand = Plus / Minus Query: 351 gtggcgcgggatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccag 410 ||||||||| | ||| ||| |||||||||||||| || ||||| ||||| |||||||| Sbjct: 350 gtggcgcggcacgatacggttcttcttgttgtcccgagcagcgttcccggccagctccag 291 Query: 411 cagctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgac 470 || |||||| ||||| |||||||| ||||||| |||||| |||||||| |||| |||||| Sbjct: 290 cacctcggcggcgagatactcgagaacggcggagaggtacacgggggccccggcgccgac 231 Query: 471 gcgctgggcgtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggag 530 ||||| || || || ||||||||| ||| ||||||| |||||||||||||| || Sbjct: 230 gcgctccgcatacttcccggccttgaggtaccgcgcgatgcgaccgacggggaactgaag 171 Query: 531 cccggccttg 540 ||| |||||| Sbjct: 170 cccagccttg 161
>ref|XM_577577.1| PREDICTED: Rattus norvegicus similar to Histone H2A.1 (LOC502129), mRNA Length = 393 Score = 115 bits (58), Expect = 2e-22 Identities = 124/146 (84%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 ||||||| | || |||||||| || |||||||| | |||||| | |||||||| || || Sbjct: 222 gttgtccctcgctgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 163 Query: 438 ggcggcgaggtagacgggggcgccgg 463 ||| || ||||| || |||||||||| Sbjct: 162 ggccgccaggtacaccggggcgccgg 137
>gb|AY105006.1| Zea mays PCO108932 mRNA sequence Length = 841 Score = 115 bits (58), Expect = 2e-22 Identities = 157/190 (82%) Strand = Plus / Minus Query: 351 gtggcgcgggatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccag 410 ||||||||| | ||| ||| |||||||||||||| || ||||| ||||| |||||||| Sbjct: 338 gtggcgcggcacgatacggttcttcttgttgtcccgagcagcgttcccggccagctccag 279 Query: 411 cagctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgac 470 || |||||| ||||| |||||||| ||||||| |||||| |||||||| |||| |||||| Sbjct: 278 cacctcggcggcgagatactcgagaacggcggagaggtacacgggggccccggcgccgac 219 Query: 471 gcgctgggcgtaacggcccttcttgaggtaacgcccgatgcggccgacggggaactggag 530 ||||| || || || ||||||||| ||| ||||||| |||||||||||||| || Sbjct: 218 gcgctccgcatacttcccggccttgaggtaccgcgcgatgcgaccgacggggaactgaag 159 Query: 531 cccggccttg 540 ||| |||||| Sbjct: 158 cccagccttg 149
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 113 bits (57), Expect = 7e-22 Identities = 72/77 (93%) Strand = Plus / Minus Query: 490 ttcttgaggtaacgcccgatgcggccgacggggaactggagcccggccttgacggacctg 549 ||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| | Sbjct: 7800552 ttcttgaggtagcgcccgatacggccgacggggaactggagcccggccttgacggagcgt 7800493 Query: 550 gtcaccgccttcttcct 566 ||||||||||||||||| Sbjct: 7800492 gtcaccgccttcttcct 7800476 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 228 ggcggcggtggacttcttcg 247 |||||||||||||||||||| Sbjct: 28448813 ggcggcggtggacttcttcg 28448794
>gb|AY158937.1| Mus musculus histone protein Hist1h2bc gene, complete cds Length = 1401 Score = 113 bits (57), Expect = 7e-22 Identities = 123/145 (84%) Strand = Plus / Plus Query: 331 ttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttggcc 390 ||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| |||| Sbjct: 1 ttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtcgcgggcc 60 Query: 391 gcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggcgaggtag 450 |||||||| || |||||||| | |||||| | |||||||| || ||||| || |||||| Sbjct: 61 gcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgccaggtag 120 Query: 451 acgggggcgccggagccgacgcgct 475 || |||||||||| ||| ||||||| Sbjct: 121 accggggcgccggcgcccacgcgct 145
>dbj|AP005107.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0431E05 Length = 146091 Score = 113 bits (57), Expect = 7e-22 Identities = 72/77 (93%) Strand = Plus / Minus Query: 490 ttcttgaggtaacgcccgatgcggccgacggggaactggagcccggccttgacggacctg 549 ||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| | Sbjct: 14934 ttcttgaggtagcgcccgatacggccgacggggaactggagcccggccttgacggagcgt 14875 Query: 550 gtcaccgccttcttcct 566 ||||||||||||||||| Sbjct: 14874 gtcaccgccttcttcct 14858
>dbj|AP004651.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0091G06 Length = 161851 Score = 113 bits (57), Expect = 7e-22 Identities = 72/77 (93%) Strand = Plus / Minus Query: 490 ttcttgaggtaacgcccgatgcggccgacggggaactggagcccggccttgacggacctg 549 ||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| | Sbjct: 113050 ttcttgaggtagcgcccgatacggccgacggggaactggagcccggccttgacggagcgt 112991 Query: 550 gtcaccgccttcttcct 566 ||||||||||||||||| Sbjct: 112990 gtcaccgccttcttcct 112974
>gb|AY104637.1| Zea mays PCO070433 mRNA sequence Length = 767 Score = 113 bits (57), Expect = 7e-22 Identities = 129/153 (84%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||| | ||||||||||||||||||| | | ||||||||| | ||||||| ||||||| Sbjct: 395 gagctcttcgtcgttgcggacggcgagctggatgtggcgcggtacgatgcgggtcttctt 336 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| ||||| |||||||| ||||| || | ||| ||||| || |||||||| || Sbjct: 335 gttgtcacgtgccgcattgccggccagctcaagaacctcagcagcaagatactcgagcac 276 Query: 438 ggcggcgaggtagacgggggcgccggagccgac 470 ||| ||||||||||| |||||||||| |||||| Sbjct: 275 ggcagcgaggtagacaggggcgccggcgccgac 243
>emb|CR700361.2|CNS0G3CL Tetraodon nigroviridis full-length cDNA Length = 547 Score = 111 bits (56), Expect = 3e-21 Identities = 137/164 (83%) Strand = Plus / Minus Query: 319 agctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttg 378 ||||||| ||||||||| ||||| ||| ||||||| ||||||||||| | | |||||||| Sbjct: 310 agctcctcgtcgttgcgcacggccagctgcaggtgccgcgggatgatcctggtcttcttg 251 Query: 379 ttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacg 438 ||||| ||| ||||| ||||| |||||||| | ||| || | |||||||| || ||| Sbjct: 250 ttgtcgcgggcggcgttcccggccagctccaggatctcagcggtcaggtactccagcacg 191 Query: 439 gcggcgaggtagacgggggcgccggagccgacgcgctgggcgta 482 || || |||||||| |||||||||| |||||| ||||||||||| Sbjct: 190 gccgccaggtagaccggggcgccggcgccgacacgctgggcgta 147
>gb|U95110.1|MMU95110 Mus macedonicus histone H2a pseudogene, complete sequence Length = 571 Score = 111 bits (56), Expect = 3e-21 Identities = 173/212 (81%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 403 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 344 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| ||||||||| |||||||||||| | ||||||||||| Sbjct: 343 ctcgtcgttgcggatggccagctgcaggtggcacgggatgatgcgcgttttcttgttgtc 284 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 283 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 224 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 223 caggtacaccggggcgccggcgcccacgcgct 192
>gb|U95109.1|MSU95109 Mus spicilegus histone H2a pseudogene, complete sequence Length = 531 Score = 111 bits (56), Expect = 3e-21 Identities = 164/200 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 363 gatgttgggcacgacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 304 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 303 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 244 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| | |||||||| | |||||| | |||||||| || ||||| || Sbjct: 243 gcgggccgcgttgccctccagctccaggatctcggccgtcaggtactccagcacggccgc 184 Query: 444 gaggtagacgggggcgccgg 463 ||||| || |||||||||| Sbjct: 183 caggtacaccggggcgccgg 164
>gb|M33988.1|MUSH2AX1 Mouse histone H2A.1 gene, complete cds Length = 929 Score = 111 bits (56), Expect = 3e-21 Identities = 173/212 (81%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 499 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 440 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 439 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 380 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||| ||||| || |||||||| | |||||| | |||||||| || || || || Sbjct: 379 gcgggccgcattgcccgccagctccaggatctcggccgtcaggtactccagcacagccgc 320 Query: 444 gaggtagacgggggcgccggagccgacgcgct 475 ||||| || |||||||||| ||| ||||||| Sbjct: 319 caggtacaccggggcgccggcgcccacgcgct 288
>ref|XM_425469.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427895), mRNA Length = 390 Score = 107 bits (54), Expect = 4e-20 Identities = 123/146 (84%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||| ||||||||||| ||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 223 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| |||||||||||| || |||||||| | |||||| | |||||||| || || Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 163 Query: 438 ggcggcgaggtagacgggggcgccgg 463 ||| || ||||| || |||||||||| Sbjct: 162 ggccgccaggtacaccggggcgccgg 137 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 510 gcggccgacggggaactggagcccggcc 537 |||||| ||||||||||| ||||||||| Sbjct: 90 gcggcccacggggaactgcagcccggcc 63
>ref|XM_425467.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427893), mRNA Length = 390 Score = 107 bits (54), Expect = 4e-20 Identities = 123/146 (84%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||| ||||||||||| ||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 223 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| |||||||||||| || |||||||| | |||||| | |||||||| || || Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 163 Query: 438 ggcggcgaggtagacgggggcgccgg 463 ||| || ||||| || |||||||||| Sbjct: 162 ggccgccaggtacaccggggcgccgg 137 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 510 gcggccgacggggaactggagcccggcc 537 |||||| ||||||||||| ||||||||| Sbjct: 90 gcggcccacggggaactgcagcccggcc 63
>ref|XM_425465.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427891), mRNA Length = 390 Score = 107 bits (54), Expect = 4e-20 Identities = 123/146 (84%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||| ||||||||||| ||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 223 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| |||||||||||| || |||||||| | |||||| | |||||||| || || Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 163 Query: 438 ggcggcgaggtagacgggggcgccgg 463 ||| || ||||| || |||||||||| Sbjct: 162 ggccgccaggtacaccggggcgccgg 137 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 510 gcggccgacggggaactggagcccggcc 537 |||||| ||||||||||| ||||||||| Sbjct: 90 gcggcccacggggaactgcagcccggcc 63
>ref|XM_425459.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427885), mRNA Length = 918 Score = 107 bits (54), Expect = 4e-20 Identities = 123/146 (84%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||| ||||||||||| ||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 223 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| |||||||||||| || |||||||| | |||||| | |||||||| || || Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 163 Query: 438 ggcggcgaggtagacgggggcgccgg 463 ||| || ||||| || |||||||||| Sbjct: 162 ggccgccaggtacaccggggcgccgg 137 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 510 gcggccgacggggaactggagcccggcc 537 |||||| ||||||||||| ||||||||| Sbjct: 90 gcggcccacggggaactgcagcccggcc 63
>ref|XM_425455.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427881), mRNA Length = 534 Score = 107 bits (54), Expect = 4e-20 Identities = 123/146 (84%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||| ||||||||||| ||||||| Sbjct: 426 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 367 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| |||||||||||| || |||||||| | |||||| | |||||||| || || Sbjct: 366 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 307 Query: 438 ggcggcgaggtagacgggggcgccgg 463 ||| || ||||| || |||||||||| Sbjct: 306 ggccgccaggtacaccggggcgccgg 281 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 510 gcggccgacggggaactggagcccggcc 537 |||||| ||||||||||| ||||||||| Sbjct: 234 gcggcccacggggaactgcagcccggcc 207
>ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC417955), mRNA Length = 1220 Score = 107 bits (54), Expect = 4e-20 Identities = 123/146 (84%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||| ||||||||||| ||||||| Sbjct: 1112 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 1053 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| |||||||||||| || |||||||| | |||||| | |||||||| || || Sbjct: 1052 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 993 Query: 438 ggcggcgaggtagacgggggcgccgg 463 ||| || ||||| || |||||||||| Sbjct: 992 ggccgccaggtacaccggggcgccgg 967 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 510 gcggccgacggggaactggagcccggcc 537 |||||| ||||||||||| ||||||||| Sbjct: 920 gcggcccacggggaactgcagcccggcc 893
>ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1 (LOC417953), mRNA Length = 2271 Score = 107 bits (54), Expect = 4e-20 Identities = 123/146 (84%) Strand = Plus / Plus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||| ||||||||||| ||||||| Sbjct: 1249 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 1308 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| |||||||||||| || |||||||| | |||||| | |||||||| || || Sbjct: 1309 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 1368 Query: 438 ggcggcgaggtagacgggggcgccgg 463 ||| || ||||| || |||||||||| Sbjct: 1369 ggccgccaggtacaccggggcgccgg 1394 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 510 gcggccgacggggaactggagcccggcc 537 |||||| ||||||||||| ||||||||| Sbjct: 1441 gcggcccacggggaactgcagcccggcc 1468
>ref|XM_416192.1| PREDICTED: Gallus gallus similar to germinal histone H4 gene (LOC417952), mRNA Length = 1374 Score = 107 bits (54), Expect = 4e-20 Identities = 123/146 (84%) Strand = Plus / Plus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||| ||||||||||| ||||||| Sbjct: 808 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 867 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| |||||||||||| || |||||||| | |||||| | |||||||| || || Sbjct: 868 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 927 Query: 438 ggcggcgaggtagacgggggcgccgg 463 ||| || ||||| || |||||||||| Sbjct: 928 ggccgccaggtacaccggggcgccgg 953 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 510 gcggccgacggggaactggagcccggcc 537 |||||| ||||||||||| ||||||||| Sbjct: 1000 gcggcccacggggaactgcagcccggcc 1027
>ref|XM_545430.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488308), mRNA Length = 456 Score = 107 bits (54), Expect = 4e-20 Identities = 153/186 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 399 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 340 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 339 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 280 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 279 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 220 Query: 444 gaggta 449 ||||| Sbjct: 219 caggta 214 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 510 gcggccgacggggaactggagcccggcc 537 |||||| || |||||||||||||||||| Sbjct: 153 gcggcccaccgggaactggagcccggcc 126
>ref|XM_849168.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC611496), mRNA Length = 393 Score = 107 bits (54), Expect = 4e-20 Identities = 153/186 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 157 Query: 444 gaggta 449 ||||| Sbjct: 156 caggta 151 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 510 gcggccgacggggaactggagcccggcc 537 |||||| || |||||||||||||||||| Sbjct: 90 gcggcccaccgggaactggagcccggcc 63
>ref|XM_545413.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488291), mRNA Length = 387 Score = 107 bits (54), Expect = 4e-20 Identities = 153/186 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 157 Query: 444 gaggta 449 ||||| Sbjct: 156 caggta 151
>ref|XM_545411.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488289), mRNA Length = 393 Score = 107 bits (54), Expect = 4e-20 Identities = 153/186 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 157 Query: 444 gaggta 449 ||||| Sbjct: 156 caggta 151 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 510 gcggccgacggggaactggagcccggcc 537 |||||| || |||||||||||||||||| Sbjct: 90 gcggcccactgggaactggagcccggcc 63
>ref|XM_545400.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488278), mRNA Length = 576 Score = 107 bits (54), Expect = 4e-20 Identities = 153/186 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 157 Query: 444 gaggta 449 ||||| Sbjct: 156 caggta 151 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 510 gcggccgacggggaactggagcccggcc 537 |||||| || |||||||||||||||||| Sbjct: 90 gcggcccaccgggaactggagcccggcc 63
>ref|XM_545394.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488272), mRNA Length = 393 Score = 107 bits (54), Expect = 4e-20 Identities = 153/186 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 157 Query: 444 gaggta 449 ||||| Sbjct: 156 caggta 151 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 510 gcggccgacggggaactggagcccggcc 537 |||||| || |||||||||||||||||| Sbjct: 90 gcggcccaccgggaactggagcccggcc 63
>ref|XM_848774.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC611132), mRNA Length = 393 Score = 107 bits (54), Expect = 4e-20 Identities = 153/186 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 157 Query: 444 gaggta 449 ||||| Sbjct: 156 caggta 151
>ref|XM_848759.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488270), mRNA Length = 462 Score = 107 bits (54), Expect = 4e-20 Identities = 153/186 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 405 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 346 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 345 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 286 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 285 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 226 Query: 444 gaggta 449 ||||| Sbjct: 225 caggta 220 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 510 gcggccgacggggaactggagcccggcc 537 |||||| || |||||||||||||||||| Sbjct: 159 gcggcccaccgggaactggagcccggcc 132
>ref|XM_545384.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488262), mRNA Length = 393 Score = 107 bits (54), Expect = 4e-20 Identities = 153/186 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 157 Query: 444 gaggta 449 ||||| Sbjct: 156 caggta 151 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 510 gcggccgacggggaactggagcccggcc 537 |||||| || |||||||||||||||||| Sbjct: 90 gcggcccaccgggaactggagcccggcc 63
>ref|XM_848716.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC611082), mRNA Length = 393 Score = 107 bits (54), Expect = 4e-20 Identities = 153/186 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 157 Query: 444 gaggta 449 ||||| Sbjct: 156 caggta 151
>ref|XM_545376.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488254), mRNA Length = 417 Score = 107 bits (54), Expect = 4e-20 Identities = 153/186 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 360 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 301 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 300 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 241 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 240 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 181 Query: 444 gaggta 449 ||||| Sbjct: 180 caggta 175 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 510 gcggccgacggggaactggagcccggcc 537 |||||| || |||||||||||||||||| Sbjct: 114 gcggcccaccgggaactggagcccggcc 87
>ref|XM_545373.1| PREDICTED: Canis familiaris similar to histone H2A (LOC488251), mRNA Length = 396 Score = 107 bits (54), Expect = 4e-20 Identities = 153/186 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 157 Query: 444 gaggta 449 ||||| Sbjct: 156 caggta 151
>ref|XM_854341.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l), transcript variant 2 (LOC488268), mRNA Length = 402 Score = 107 bits (54), Expect = 4e-20 Identities = 153/186 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 157 Query: 444 gaggta 449 ||||| Sbjct: 156 caggta 151
>ref|XM_545390.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l), transcript variant 1 (LOC488268), mRNA Length = 393 Score = 107 bits (54), Expect = 4e-20 Identities = 153/186 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 157 Query: 444 gaggta 449 ||||| Sbjct: 156 caggta 151
>ref|XM_539322.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC482203), mRNA Length = 393 Score = 107 bits (54), Expect = 4e-20 Identities = 153/186 (82%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 157 Query: 444 gaggta 449 ||||| Sbjct: 156 caggta 151
>emb|X07763.1|GGH2AB8 Chicken DNA for pCH3.5E histone H2A/H2B sequence Length = 1017 Score = 107 bits (54), Expect = 4e-20 Identities = 123/146 (84%) Strand = Plus / Plus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||| ||||||||||| ||||||| Sbjct: 25 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 84 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| |||||||||||| || |||||||| | |||||| | |||||||| || || Sbjct: 85 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 144 Query: 438 ggcggcgaggtagacgggggcgccgg 463 ||| || ||||| || |||||||||| Sbjct: 145 ggccgccaggtacaccggggcgccgg 170 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 510 gcggccgacggggaactggagcccggcc 537 |||||| ||||||||||| ||||||||| Sbjct: 217 gcggcccacggggaactgcagcccggcc 244
>emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4 and a histone H3 gene Length = 8384 Score = 107 bits (54), Expect = 4e-20 Identities = 123/146 (84%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||| ||||||||||| ||||||| Sbjct: 5213 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 5154 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| |||||||||||| || |||||||| | |||||| | |||||||| || || Sbjct: 5153 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 5094 Query: 438 ggcggcgaggtagacgggggcgccgg 463 ||| || ||||| || |||||||||| Sbjct: 5093 ggccgccaggtacaccggggcgccgg 5068 Score = 107 bits (54), Expect = 4e-20 Identities = 123/146 (84%) Strand = Plus / Plus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||| ||||||||||| ||||||| Sbjct: 2231 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 2290 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| |||||||||||| || |||||||| | |||||| | |||||||| || || Sbjct: 2291 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 2350 Query: 438 ggcggcgaggtagacgggggcgccgg 463 ||| || ||||| || |||||||||| Sbjct: 2351 ggccgccaggtacaccggggcgccgg 2376 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 510 gcggccgacggggaactggagcccggcc 537 |||||| ||||||||||| ||||||||| Sbjct: 5021 gcggcccacggggaactgcagcccggcc 4994 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 510 gcggccgacggggaactggagcccggcc 537 |||||| ||||||||||| ||||||||| Sbjct: 2423 gcggcccacggggaactgcagcccggcc 2450
>dbj|D11055.1|CHKH2A4H Gallus gallus gene for H2A histone, complete cds Length = 1028 Score = 107 bits (54), Expect = 4e-20 Identities = 123/146 (84%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||| ||||||||||| ||||||| Sbjct: 613 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 554 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| |||||||||||| || |||||||| | |||||| | |||||||| || || Sbjct: 553 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 494 Query: 438 ggcggcgaggtagacgggggcgccgg 463 ||| || ||||| || |||||||||| Sbjct: 493 ggccgccaggtacaccggggcgccgg 468 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 510 gcggccgacggggaactggagcccggcc 537 |||||| ||||||||||| ||||||||| Sbjct: 421 gcggcccacggggaactgcagcccggcc 394
>gb|U38933.1|GGU38933 Gallus gallus histone H2A (H2A-VIII) gene, complete cds Length = 740 Score = 107 bits (54), Expect = 4e-20 Identities = 123/146 (84%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||| ||||||||||| ||||||| Sbjct: 460 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 401 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| |||||||||||| || |||||||| | |||||| | |||||||| || || Sbjct: 400 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 341 Query: 438 ggcggcgaggtagacgggggcgccgg 463 ||| || ||||| || |||||||||| Sbjct: 340 ggccgccaggtacaccggggcgccgg 315 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 510 gcggccgacggggaactggagcccggcc 537 |||||| ||||||||||| ||||||||| Sbjct: 268 gcggcccacggggaactgcagcccggcc 241
>gb|U38932.1|GGU38932 Gallus gallus histone H2A (H2A-VII) gene, complete cds Length = 827 Score = 107 bits (54), Expect = 4e-20 Identities = 123/146 (84%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||| ||||||||||| ||||||| Sbjct: 443 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 384 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| |||||||||||| || |||||||| | |||||| | |||||||| || || Sbjct: 383 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 324 Query: 438 ggcggcgaggtagacgggggcgccgg 463 ||| || ||||| || |||||||||| Sbjct: 323 ggccgccaggtacaccggggcgccgg 298 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 510 gcggccgacggggaactggagcccggcc 537 |||||| ||||||||||| ||||||||| Sbjct: 251 gcggcccacggggaactgcagcccggcc 224
>gb|U38931.1|GGU38931 Gallus gallus histone H2A (H2A-VI) gene, complete cds Length = 743 Score = 107 bits (54), Expect = 4e-20 Identities = 123/146 (84%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||| ||||||||||| ||||||| Sbjct: 305 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 246 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| |||||||||||| || |||||||| | |||||| | |||||||| || || Sbjct: 245 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 186 Query: 438 ggcggcgaggtagacgggggcgccgg 463 ||| || ||||| || |||||||||| Sbjct: 185 ggccgccaggtacaccggggcgccgg 160 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 510 gcggccgacggggaactggagcccggcc 537 |||||| ||||||||||| ||||||||| Sbjct: 113 gcggcccacggggaactgcagcccggcc 86
>gb|U16726.1|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1), histone H2A (ch2a-IV), and histone H2B (ch2b-IV) genes, complete cds Length = 4502 Score = 107 bits (54), Expect = 4e-20 Identities = 180/222 (81%) Strand = Plus / Plus Query: 319 agctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttg 378 ||||||| |||||||||| ||| ||| | | |||||| || | |||||| |||||||| Sbjct: 3194 agctcctcatcgttgcggatggccagctggatgtggcgaggcacaatgcggttcttcttg 3253 Query: 379 ttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacg 438 ||||| ||| ||||||||||| |||||||||| ||| || | |||||||| || ||| Sbjct: 3254 ttgtcgcgggcggcgttgccggccagctccagcacctcagcggtcaggtactccagcacg 3313 Query: 439 gcggcgaggtagacgggggcgccggagccgacgcgctgggcgtaacggcccttcttgagg 498 ||||| ||||| ||||| ||||||| |||| ||||| |||||| ||||||||| ||| Sbjct: 3314 gcggccaggtacacgggcgcgccggcaccgatgcgctcggcgtacttgcccttcttcagg 3373 Query: 499 taacgcccgatgcggccgacggggaactggagcccggccttg 540 || ||| | |||||||| || |||||||| || ||||||||| Sbjct: 3374 tagcgcgcaatgcggcccacagggaactgcaggccggccttg 3415
>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II), histone H2B (ch2b-II) and histone H2A (ch2a-II) genes, complete cds Length = 3777 Score = 107 bits (54), Expect = 4e-20 Identities = 180/222 (81%) Strand = Plus / Minus Query: 319 agctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttg 378 ||||||| |||||||||| ||| ||| | | |||||| || | ||||||| |||||||| Sbjct: 3500 agctcctcatcgttgcggatggccagctggatgtggcggggcacgatgcggttcttcttg 3441 Query: 379 ttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacg 438 ||||| ||| ||||||||||| |||||||||| ||| || | ||||||||||| || Sbjct: 3440 ttgtcgcgggcggcgttgccggccagctccagcacctcagcggtcaggtactcgagcaca 3381 Query: 439 gcggcgaggtagacgggggcgccggagccgacgcgctgggcgtaacggcccttcttgagg 498 ||||| ||||| ||||| ||||||| |||| ||||| |||||| ||||||||| ||| Sbjct: 3380 gcggccaggtacacgggcgcgccggcaccgatgcgctcggcgtacttgcccttcttcagg 3321 Query: 499 taacgcccgatgcggccgacggggaactggagcccggccttg 540 || || | |||||||| || |||||||| || ||||||||| Sbjct: 3320 tagcgtgcaatgcggcccacagggaactgcaggccggccttg 3279
>gb|J00864.1|CHKH2A2B Chicken histone H2A/H2B gene pair and flanks Length = 1564 Score = 107 bits (54), Expect = 4e-20 Identities = 123/146 (84%) Strand = Plus / Plus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||| ||||||||||| ||||||| Sbjct: 364 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 423 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| |||||||||||| || |||||||| | |||||| | |||||||| || || Sbjct: 424 gttgtcgcgggccgcgttgcccgctagctccaggatctcggccgtcaggtactccagcac 483 Query: 438 ggcggcgaggtagacgggggcgccgg 463 ||| || ||||| || |||||||||| Sbjct: 484 ggccgctaggtacaccggggcgccgg 509
>gb|AF255740.1|AF255740 Bufo bufo gagarizans histone H1 (H1) and histone H2A variant (H2AInr) genes, complete cds Length = 2396 Score = 105 bits (53), Expect = 2e-19 Identities = 178/219 (81%), Gaps = 3/219 (1%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| |||||||||||||| ||| | |||||| | |||||| Sbjct: 1560 gatgttgggcaggacgccgccctgggcgatggtgactccgcccagcagcttgttgagctc 1501 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||| ||||| ||| ||||||| || |||||||||||| |||||||||| Sbjct: 1500 ctcgtcgttgcgcacggccagctgcaggtgacgggggatgatgcgg---gtcttgttgtc 1444 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 ||| || |||||||| |||||||| | |||||| | ||| |||||||| || ||||| Sbjct: 1443 gcgggcggcattgccggccagctccaggatctcggcggtgagatactcgagcacagcggc 1384 Query: 444 gaggtagacgggggcgccggagccgacgcgctgggcgta 482 | ||||||||| ||||||| ||| || | ||||||||| Sbjct: 1383 caagtagacgggagcgccggcgcccaccctctgggcgta 1345
>gb|AC119796.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1172F09, complete sequence Length = 106057 Score = 105 bits (53), Expect = 2e-19 Identities = 71/77 (92%) Strand = Plus / Minus Query: 490 ttcttgaggtaacgcccgatgcggccgacggggaactggagcccggccttgacggacctg 549 ||||||||||| |||||||| |||||||||||||| |||||||||||||||||||| | Sbjct: 36517 ttcttgaggtagcgcccgatacggccgacggggaattggagcccggccttgacggagcgc 36458 Query: 550 gtcaccgccttcttcct 566 ||||||||||||||||| Sbjct: 36457 gtcaccgccttcttcct 36441
>emb|AL731753.2|CNS08C82 Oryza sativa chromosome 12, . BAC OJ1112_B07 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 118101 Score = 105 bits (53), Expect = 2e-19 Identities = 125/149 (83%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| ||||| |||||| |||||||||| ||||| |||||||| | |||||| Sbjct: 48743 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 48684 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||| || |||||| | | ||||||||| | |||||| ||||||||||||| Sbjct: 48683 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 48624 Query: 384 cttggccgcgttgccggcaagctccagca 412 | | |||||||| ||||| |||||||||| Sbjct: 48623 cctcgccgcgttcccggcgagctccagca 48595 Score = 105 bits (53), Expect = 2e-19 Identities = 65/69 (94%) Strand = Plus / Minus Query: 414 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcg 473 |||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||| Sbjct: 48390 ctcggcggcgaggtactcgaggacggcggcgaggtagacgggagcgccggcgccgacgcg 48331 Query: 474 ctgggcgta 482 || |||||| Sbjct: 48330 ctcggcgta 48322
>gb|AY389592.1| Hyacinthus orientalis histone H2A mRNA, complete cds Length = 635 Score = 103 bits (52), Expect = 7e-19 Identities = 142/172 (82%) Strand = Plus / Minus Query: 371 tcttcttgttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtact 430 ||||||||||||| | |||||||| ||||| | ||||| | ||| || || ||||||| Sbjct: 268 tcttcttgttgtctctcgccgcgtttccggccaactccaatacctctgcggctaggtact 209 Query: 431 cgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggcgtaacggccct 490 ||||||||||||| |||||||| || || |||| ||||| ||||| ||||| | ||||| Sbjct: 208 cgaggacggcggcaaggtagaccggagctccggtaccgacacgctgagcgtacctgccct 149 Query: 491 tcttgaggtaacgcccgatgcggccgacggggaactggagcccggccttgac 542 |||| | ||| || |||| || ||||||||||||||||| ||||||||||| Sbjct: 148 tcttcaagtatcggccgagacgaccgacggggaactggaggccggccttgac 97
>ref|XM_545426.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488304), mRNA Length = 588 Score = 103 bits (52), Expect = 7e-19 Identities = 112/132 (84%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 429 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 370 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| |||||||||||| || |||||||| | |||||| | |||||||| || || Sbjct: 369 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 310 Query: 438 ggcggcgaggta 449 ||| || ||||| Sbjct: 309 ggccgccaggta 298 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 510 gcggccgacggggaactggagcccggcc 537 |||||| || |||||||||||||||||| Sbjct: 237 gcggcccaccgggaactggagcccggcc 210
>ref|XM_545421.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488299), mRNA Length = 387 Score = 103 bits (52), Expect = 7e-19 Identities = 112/132 (84%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| |||||||||||| || |||||||| | |||||| | |||||||| || || Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 163 Query: 438 ggcggcgaggta 449 ||| || ||||| Sbjct: 162 ggccgccaggta 151 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 510 gcggccgacggggaactggagcccggcc 537 |||||| || |||||||||||||||||| Sbjct: 90 gcggcccaccgggaactggagcccggcc 63
>ref|XM_545419.2| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488297), mRNA Length = 393 Score = 103 bits (52), Expect = 7e-19 Identities = 112/132 (84%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| |||||||||||| || |||||||| | |||||| | |||||||| || || Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 163 Query: 438 ggcggcgaggta 449 ||| || ||||| Sbjct: 162 ggccgccaggta 151
>ref|XM_540292.2| PREDICTED: Canis familiaris similar to histone 2, H2ac (LOC483174), mRNA Length = 485 Score = 103 bits (52), Expect = 7e-19 Identities = 163/200 (81%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| |||||||||||||| | | |||||| | |||||| Sbjct: 393 gatgttgggcaggacgccgccctgggcgatggtgaccttgcccagcagcttgttgagctc 334 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||| |||||||| || ||||||||||||| Sbjct: 333 ctcgtcgttgcggatggccagctgcaggtggcgggggatgatacgcgtcttcttgttgtc 274 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 273 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 214 Query: 444 gaggtagacgggggcgccgg 463 | ||||||||| ||||||| Sbjct: 213 catgtagacgggagcgccgg 194
>ref|XM_845715.1| PREDICTED: Canis familiaris similar to Histone H2A.o (H2A/o) (H2A.2) (H2a-615) (LOC608631), mRNA Length = 534 Score = 103 bits (52), Expect = 7e-19 Identities = 163/200 (81%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| |||||||||||||| | | |||||| | |||||| Sbjct: 371 gatgttgggcaggacgccgccctgggcgatggtgaccttgcccagcagcttgttgagctc 312 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||| |||||||| || ||||||||||||| Sbjct: 311 ctcgtcgttgcggatggccagctgcaggtggcgggggatgatacgcgtcttcttgttgtc 252 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 251 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 192 Query: 444 gaggtagacgggggcgccgg 463 | ||||||||| ||||||| Sbjct: 191 catgtagacgggagcgccgg 172
>ref|XM_540286.2| PREDICTED: Canis familiaris similar to Histone H2A.o (H2A/o) (H2A.2) (H2a-615) (LOC483168), mRNA Length = 534 Score = 103 bits (52), Expect = 7e-19 Identities = 163/200 (81%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| |||||||||||||| | | |||||| | |||||| Sbjct: 371 gatgttgggcaggacgccgccctgggcgatggtgaccttgcccagcagcttgttgagctc 312 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||| |||||||| || ||||||||||||| Sbjct: 311 ctcgtcgttgcggatggccagctgcaggtggcgggggatgatacgcgtcttcttgttgtc 252 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | |||||| | |||||||| || ||||| || Sbjct: 251 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 192 Query: 444 gaggtagacgggggcgccgg 463 | ||||||||| ||||||| Sbjct: 191 catgtagacgggagcgccgg 172
>ref|XM_954349.1| Neurospora crassa OR74A hypothetical protein (NCU02437.1) partial mRNA Length = 405 Score = 101 bits (51), Expect = 3e-18 Identities = 129/155 (83%) Strand = Plus / Minus Query: 328 tcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttg 387 |||||||||| ||||||| | ||||| || || ||||| || ||||||||||||| Sbjct: 278 tcgttgcggatggcgagctgaaggtgacggggaatgatacgagtcttcttgttgtcgcga 219 Query: 388 gccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggcgagg 447 || |||||||| |||||||| || | |||||||||||||||||||| || ||||||||| Sbjct: 218 gcagcgttgccagcaagctcaagaatttcggcagcgaggtactcgagaacagcggcgagg 159 Query: 448 tagacgggggcgccggagccgacgcgctgggcgta 482 |||||||| ||||||| || || ||||||||||| Sbjct: 158 tagacgggagcgccggcaccaacacgctgggcgta 124
>ref|XM_331212.1| Neurospora crassa OR74A hypothetical protein (NCU02437.1) partial mRNA Length = 405 Score = 101 bits (51), Expect = 3e-18 Identities = 129/155 (83%) Strand = Plus / Minus Query: 328 tcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttg 387 |||||||||| ||||||| | ||||| || || ||||| || ||||||||||||| Sbjct: 278 tcgttgcggatggcgagctgaaggtgacggggaatgatacgagtcttcttgttgtcgcga 219 Query: 388 gccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggcgagg 447 || |||||||| |||||||| || | |||||||||||||||||||| || ||||||||| Sbjct: 218 gcagcgttgccagcaagctcaagaatttcggcagcgaggtactcgagaacagcggcgagg 159 Query: 448 tagacgggggcgccggagccgacgcgctgggcgta 482 |||||||| ||||||| || || ||||||||||| Sbjct: 158 tagacgggagcgccggcaccaacacgctgggcgta 124
>gb|AY062171.1| Neurospora crassa histone H2A (hh2A) and histone H2B (hh2B) genes, complete cds Length = 6309 Score = 101 bits (51), Expect = 3e-18 Identities = 129/155 (83%) Strand = Plus / Plus Query: 328 tcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttg 387 |||||||||| ||||||| | ||||| || || ||||| || ||||||||||||| Sbjct: 694 tcgttgcggatggcgagctgaaggtgacggggaatgatacgagtcttcttgttgtcgcga 753 Query: 388 gccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggcgagg 447 || |||||||| |||||||| || | |||||||||||||||||||| || ||||||||| Sbjct: 754 gcagcgttgccagcaagctcaagaatttcggcagcgaggtactcgagaacagcggcgagg 813 Query: 448 tagacgggggcgccggagccgacgcgctgggcgta 482 |||||||| ||||||| || || ||||||||||| Sbjct: 814 tagacgggagcgccggcaccaacacgctgggcgta 848
>gb|M11085.1|SUPHIS2A2 Sea urchin (P.miliaris) late histone H2A-2 late mRNA, complete cds Length = 430 Score = 101 bits (51), Expect = 3e-18 Identities = 177/219 (80%) Strand = Plus / Minus Query: 240 cttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgac 299 |||||| |||||||| |||| | ||||||||||| |||||| || || ||||||||||| Sbjct: 372 cttcttggggagaaggacagcctggatgttggggaggacaccaccctgagcgatggtgac 313 Query: 300 gccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcgg 359 || |||| ||| | |||||||| |||||||||||| || | | | || || || || Sbjct: 312 tcctccgagaagcttgttgagctcctcgtcgttgcggacagccaactgaagatgacgggg 253 Query: 360 gatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| | ||||||||||||||| ||| ||||||||||| ||||| || | ||| || Sbjct: 252 gatgatcctgctcttcttgttgtcgcgggcggcgttgccggcgagctcgaggatctcagc 193 Query: 420 agcgaggtactcgaggacggcggcgaggtagacgggggc 458 | |||||||||||||||||| |||||||| || ||||| Sbjct: 192 ggtgaggtactcgaggacggctgcgaggtacactggggc 154
>gb|M14141.1|SUPH2A2 P.miliaris histone H2A-2.2 gene, complete cds Length = 375 Score = 101 bits (51), Expect = 3e-18 Identities = 159/195 (81%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||||| |||||| || || ||||||||||| || | || ||| | |||||| Sbjct: 333 gatgttggggaggacaccaccctgagcgatggtgactcctcctagaagcttgttgagctc 274 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || |||||||||||| || ||| | || ||||| |||||||| | ||||||||||||||| Sbjct: 273 ctcgtcgttgcggacagccagctgaagatggcgggggatgatcctgctcttcttgttgtc 214 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 ||| ||||||||||| ||||| || | ||| || | |||||||||||||||||| || Sbjct: 213 gcgggcggcgttgccggcgagctcgaggatctcagcggtgaggtactcgaggacggctgc 154 Query: 444 gaggtagacgggggc 458 |||||| || ||||| Sbjct: 153 gaggtacactggggc 139
>ref|NM_175662.1| Mus musculus histone 2, H2ac (Hist2h2ac), mRNA Length = 390 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181
>ref|NM_013549.1| Mus musculus histone 2, H2aa1 (Hist2h2aa1), mRNA Length = 578 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 325 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 266 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 265 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 224
>gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339 Length = 2972 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 309 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 250 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 249 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 208
>ref|XM_865148.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC613926), mRNA Length = 393 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| ||| ||| ||||||||||||||| ||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaagtgacgcgggatgatgcgggtcttctt 223 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 ||||||| |||||||||||| || |||||||| | |||||| Sbjct: 222 gttgtcccgggccgcgttgcccgccagctccaggatctcggc 181
>gb|BC010564.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone IMAGE:3582122), partial cds Length = 543 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 309 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 250 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 249 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 208
>ref|XM_868899.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC616790), mRNA Length = 413 Score = 99.6 bits (50), Expect = 1e-17 Identities = 80/90 (88%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| ||||||| ||||||||||||||| ||||||| Sbjct: 302 gagctcctcgtcgttgcggatggccagctgcaggtgacgcgggatgatgcgggtcttctt 243 Query: 378 gttgtccttggccgcgttgccggcaagctc 407 ||||||| |||||||||||| || ||||| Sbjct: 242 gttgtcccgggccgcgttgcccgccagctc 213 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Minus Query: 511 cggccgacggggaactggagcccggcc 537 ||||| ||||||||||||||||||||| Sbjct: 109 cggcctacggggaactggagcccggcc 83
>ref|NM_178213.2| Mus musculus histone 2, H2ab (Hist2h2ab), mRNA Length = 390 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181
>ref|XM_981616.1| PREDICTED: Mus musculus similar to H2A histone family, member O (LOC670497), mRNA Length = 3003 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 288 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 229 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 228 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 187
>ref|XM_992084.1| PREDICTED: Mus musculus similar to H2A histone family, member O (LOC667728), mRNA Length = 3054 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 339 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 280 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 279 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 238
>ref|XM_994730.1| PREDICTED: Mus musculus similar to H2A histone family, member O (LOC677006), mRNA Length = 2991 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 276 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 217 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 216 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 175
>ref|XM_906486.2| PREDICTED: Mus musculus similar to H2A histone family, member J (LOC632401), mRNA Length = 1833 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||| ||||||||||| ||||||| Sbjct: 378 gagctcctcgtcgttgcggatggccagctgcaggtggcgagggatgatgcgcgtcttctt 319 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 ||||||| | ||||||||||| || |||||||| | |||||| Sbjct: 318 gttgtccctcgccgcgttgcccgccagctccaggatctcggc 277
>ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h3c1), mRNA Length = 2956 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 309 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 250 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 249 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 208
>gb|BC064002.1| Mus musculus cDNA clone IMAGE:6823756, partial cds Length = 819 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 308 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 249 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 248 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 207
>gb|AY158922.2| Mus musculus histone protein Hist2h2ab gene, complete cds Length = 1680 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 490 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 431 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 430 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 389 Score = 65.9 bits (33), Expect = 2e-07 Identities = 63/73 (86%) Strand = Plus / Plus Query: 347 gcaggtggcgcgggatgatgcggctcttcttgttgtccttggccgcgttgccggcaagct 406 |||| ||||||||||||||||| ||||||||||||| |||||||||||| || |||| Sbjct: 885 gcagatggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagct 944 Query: 407 ccagcagctcggc 419 |||| | |||||| Sbjct: 945 ccaggatctcggc 957 Score = 40.1 bits (20), Expect = 8.7 Identities = 29/32 (90%) Strand = Plus / Plus Query: 268 ttggggatgacaccgccgtgggcgatggtgac 299 ||||||| ||| ||||| |||||||||||||| Sbjct: 806 ttggggaggaccccgccctgggcgatggtgac 837
>emb|Z30940.1|MDH2AHIST M.domesticus (CD-1) mRNA for histone H2A (partial) Length = 523 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 304 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 245 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 244 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 203
>emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23 Length = 2724 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 1098 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1039 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 1038 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 997
>emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143 Length = 3210 Score = 99.6 bits (50), Expect = 1e-17 Identities = 122/146 (83%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| ||||| || |||||||| |||| | | |||||| | |||||| Sbjct: 1909 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 1850 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 1849 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 1790 Query: 384 cttggccgcgttgccggcaagctcca 409 |||||||||||| || ||||||| Sbjct: 1789 gcgggccgcgttgcccgccagctcca 1764
>emb|X16148.1|MMHIS2A3 Mouse H2a and H3 histone genes Length = 3098 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 1139 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1080 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 1079 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 1038
>emb|X14730.1|CMHIST2A Duck H2A histone gene Length = 845 Score = 99.6 bits (50), Expect = 1e-17 Identities = 122/146 (83%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||| ||||||||||| ||||||| Sbjct: 432 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 373 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| |||||||||||| || ||||| || | |||||| | |||||||| || || Sbjct: 372 gttgtcgcgggccgcgttgcccgctagctctaggatctcggccgttaggtactccagtac 313 Query: 438 ggcggcgaggtagacgggggcgccgg 463 ||| || ||||| || |||||||||| Sbjct: 312 ggccgccaggtacaccggggcgccgg 287 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 510 gcggccgacggggaactggagcccggcc 537 |||||| ||||||||||| ||||||||| Sbjct: 240 gcggcccacggggaactgcagcccggcc 213
>emb|V00413.1|GGH2AX Chicken gene for histone H2A with flanking regions Length = 843 Score = 99.6 bits (50), Expect = 1e-17 Identities = 122/146 (83%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||| ||||||||||| ||||||| Sbjct: 615 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 556 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| |||||||||||| || |||||||| | |||||| | |||||||| || || Sbjct: 555 gttgtcgcgggccgcgttgcccgctagctccaggatctcggccgtcaggtactccagcac 496 Query: 438 ggcggcgaggtagacgggggcgccgg 463 ||| || ||||| | |||||||||| Sbjct: 495 ggccgctaggtacagcggggcgccgg 470 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 510 gcggccgacggggaactggagcccggcc 537 |||||| ||||||||||| ||||||||| Sbjct: 423 gcggcccacggggaactgcagcccggcc 396
>dbj|AK158457.1| Mus musculus adult inner ear cDNA, RIKEN full-length enriched library, clone:F930118D21 product:unclassifiable, full insert sequence Length = 2833 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Plus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 520 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 579 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 580 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 621
>dbj|AK006728.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:1700048I17 product:histone gene complex 2, full insert sequence Length = 578 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 325 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 266 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 265 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 224
>dbj|AK077055.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4932439K17 product:histone gene complex 2, full insert sequence Length = 2876 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 140 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 81 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 80 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 39
>dbj|AK002725.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched library, clone:0610031H01 product:histone gene complex 2, full insert sequence Length = 545 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 326 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 267 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 266 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 225
>dbj|AK016171.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4930558E18 product:histone gene complex 2, full insert sequence Length = 1059 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Plus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 100 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 159 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 160 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 201
>gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615), and histone H3.2-615 (H3-615) genes, complete cds Length = 2997 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 1288 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1229 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 1228 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 1187
>gb|U62673.1|MMU62673 Mus musculus histone H2a(A)-613, histone H2a(B)-613, and histone H2b-613 (H2b) genes, complete cds Length = 2618 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Plus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 1311 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1370 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 1371 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 1412 Score = 65.9 bits (33), Expect = 2e-07 Identities = 63/73 (86%) Strand = Plus / Minus Query: 347 gcaggtggcgcgggatgatgcggctcttcttgttgtccttggccgcgttgccggcaagct 406 |||| ||||||||||||||||| ||||||||||||| |||||||||||| || |||| Sbjct: 916 gcagatggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagct 857 Query: 407 ccagcagctcggc 419 |||| | |||||| Sbjct: 856 ccaggatctcggc 844 Score = 40.1 bits (20), Expect = 8.7 Identities = 29/32 (90%) Strand = Plus / Minus Query: 268 ttggggatgacaccgccgtgggcgatggtgac 299 ||||||| ||| ||||| |||||||||||||| Sbjct: 995 ttggggaggaccccgccctgggcgatggtgac 964
>dbj|AK028129.1| Mus musculus adult male stomach cDNA, RIKEN full-length enriched library, clone:2210403F13 product:histone gene complex 2, full insert sequence Length = 2428 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Plus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 578 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 637 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 638 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 679
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 99.6 bits (50), Expect = 1e-17 Identities = 59/62 (95%) Strand = Plus / Minus Query: 421 gcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggcg 480 |||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |||| Sbjct: 21536570 gcgaggtactcgaggacggcggcgaggtagacgggggccccggcgccgacgcgctcggcg 21536511 Query: 481 ta 482 || Sbjct: 21536510 ta 21536509 Score = 97.6 bits (49), Expect = 4e-17 Identities = 70/77 (90%) Strand = Plus / Plus Query: 490 ttcttgaggtaacgcccgatgcggccgacggggaactggagcccggccttgacggacctg 549 ||||||||||| |||||||| |||| |||||| ||||||||||||||||||||||| | Sbjct: 22313886 ttcttgaggtagcgcccgatacggctgacgggcaactggagcccggccttgacggagcgc 22313945 Query: 550 gtcaccgccttcttcct 566 ||||||||||||||||| Sbjct: 22313946 gtcaccgccttcttcct 22313962 Score = 83.8 bits (42), Expect = 6e-13 Identities = 48/50 (96%) Strand = Plus / Minus Query: 421 gcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgac 470 |||||||||||||||||||||||||||||||| |||||||||| |||||| Sbjct: 21539250 gcgaggtactcgaggacggcggcgaggtagaccggggcgccggcgccgac 21539201 Score = 81.8 bits (41), Expect = 3e-12 Identities = 122/149 (81%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| || || |||||| |||||||||| ||||| |||||||| | | ||| Sbjct: 21537003 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 21536944 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||| || |||||| | | ||||||||| | ||||||| ||||||||||||| Sbjct: 21536943 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 21536884 Query: 384 cttggccgcgttgccggcaagctccagca 412 | | |||||||| ||||| ||||| |||| Sbjct: 21536883 cctcgccgcgttcccggcgagctcgagca 21536855 Score = 73.8 bits (37), Expect = 6e-10 Identities = 76/89 (85%) Strand = Plus / Minus Query: 319 agctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttg 378 ||||||| ||||||||||||||||||| | | |||||| || | |||||| |||||||| Sbjct: 21539587 agctcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttg 21539528 Query: 379 ttgtccttggccgcgttgccggcaagctc 407 |||||| | |||||||| ||||| ||||| Sbjct: 21539527 ttgtccctcgccgcgttcccggcgagctc 21539499 Score = 48.1 bits (24), Expect = 0.036 Identities = 24/24 (100%) Strand = Plus / Minus Query: 517 acggggaactggagcccggccttg 540 |||||||||||||||||||||||| Sbjct: 21539154 acggggaactggagcccggccttg 21539131 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 cggcgggggccttcttcttgg 178 ||||||||||||||||||||| Sbjct: 29547683 cggcgggggccttcttcttgg 29547663
>ref|NM_178212.1| Mus musculus histone 2, H2aa2 (Hist2h2aa2), mRNA Length = 393 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181
>gb|AY158953.1| Mus musculus histone protein Hist2h3c2 gene, complete cds Length = 1440 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Plus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 502 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 561 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 562 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 603
>gb|AY158925.1| Mus musculus histone protein Hist2h2aa1 gene, complete cds Length = 1387 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 779 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 720 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 719 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 678
>gb|AY158924.1| Mus musculus histone protein Hist2h2aa2 gene, complete cds Length = 1387 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 779 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 720 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 719 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 678
>gb|AY158923.1| Mus musculus histone protein Hist2h2ac gene, complete cds Length = 1200 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 590 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 531 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 530 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 489 Score = 65.9 bits (33), Expect = 2e-07 Identities = 63/73 (86%) Strand = Plus / Plus Query: 347 gcaggtggcgcgggatgatgcggctcttcttgttgtccttggccgcgttgccggcaagct 406 |||| ||||||||||||||||| ||||||||||||| |||||||||||| || |||| Sbjct: 985 gcagatggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagct 1044 Query: 407 ccagcagctcggc 419 |||| | |||||| Sbjct: 1045 ccaggatctcggc 1057 Score = 40.1 bits (20), Expect = 8.7 Identities = 29/32 (90%) Strand = Plus / Plus Query: 268 ttggggatgacaccgccgtgggcgatggtgac 299 ||||||| ||| ||||| |||||||||||||| Sbjct: 906 ttggggaggaccccgccctgggcgatggtgac 937
>dbj|AP003838.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1582_D10 Length = 103475 Score = 99.6 bits (50), Expect = 1e-17 Identities = 59/62 (95%) Strand = Plus / Minus Query: 421 gcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggcg 480 |||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |||| Sbjct: 74354 gcgaggtactcgaggacggcggcgaggtagacgggggccccggcgccgacgcgctcggcg 74295 Query: 481 ta 482 || Sbjct: 74294 ta 74293 Score = 83.8 bits (42), Expect = 6e-13 Identities = 48/50 (96%) Strand = Plus / Minus Query: 421 gcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgac 470 |||||||||||||||||||||||||||||||| |||||||||| |||||| Sbjct: 77034 gcgaggtactcgaggacggcggcgaggtagaccggggcgccggcgccgac 76985 Score = 81.8 bits (41), Expect = 3e-12 Identities = 122/149 (81%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| || || |||||| |||||||||| ||||| |||||||| | | ||| Sbjct: 74787 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 74728 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||| || |||||| | | ||||||||| | ||||||| ||||||||||||| Sbjct: 74727 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 74668 Query: 384 cttggccgcgttgccggcaagctccagca 412 | | |||||||| ||||| ||||| |||| Sbjct: 74667 cctcgccgcgttcccggcgagctcgagca 74639 Score = 73.8 bits (37), Expect = 6e-10 Identities = 76/89 (85%) Strand = Plus / Minus Query: 319 agctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttg 378 ||||||| ||||||||||||||||||| | | |||||| || | |||||| |||||||| Sbjct: 77371 agctcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttg 77312 Query: 379 ttgtccttggccgcgttgccggcaagctc 407 |||||| | |||||||| ||||| ||||| Sbjct: 77311 ttgtccctcgccgcgttcccggcgagctc 77283 Score = 48.1 bits (24), Expect = 0.036 Identities = 24/24 (100%) Strand = Plus / Minus Query: 517 acggggaactggagcccggccttg 540 |||||||||||||||||||||||| Sbjct: 76938 acggggaactggagcccggccttg 76915
>gb|BC062255.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone MGC:73680 IMAGE:1448126), complete cds Length = 552 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 309 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 250 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 249 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 208
>gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, complete sequence Length = 200326 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 70501 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 70442 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 70441 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 70400 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Plus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 64608 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 64667 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 64668 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 64709 Score = 91.7 bits (46), Expect = 3e-15 Identities = 88/102 (86%) Strand = Plus / Plus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||| ||||||||||||||||| ||||||| Sbjct: 45202 gagctcctcgtcgttgcggatggccagctgcagatggcgcgggatgatgcgcgtcttctt 45261 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 45262 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 45303 Score = 65.9 bits (33), Expect = 2e-07 Identities = 63/73 (86%) Strand = Plus / Minus Query: 347 gcaggtggcgcgggatgatgcggctcttcttgttgtccttggccgcgttgccggcaagct 406 |||| ||||||||||||||||| ||||||||||||| |||||||||||| || |||| Sbjct: 44807 gcagatggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagct 44748 Query: 407 ccagcagctcggc 419 |||| | |||||| Sbjct: 44747 ccaggatctcggc 44735 Score = 40.1 bits (20), Expect = 8.7 Identities = 29/32 (90%) Strand = Plus / Minus Query: 268 ttggggatgacaccgccgtgggcgatggtgac 299 ||||||| ||| ||||| |||||||||||||| Sbjct: 44886 ttggggaggaccccgccctgggcgatggtgac 44855
>gb|BC024397.1| Mus musculus H2A histone family, member J, mRNA (cDNA clone MGC:36202 IMAGE:5055276), complete cds Length = 550 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||| ||||||||||| ||||||| Sbjct: 334 gagctcctcgtcgttgcggatggccagctgcaggtggcgagggatgatgcgcgtcttctt 275 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 ||||||| | ||||||||||| || |||||||| | |||||| Sbjct: 274 gttgtccctcgccgcgttgcccgccagctccaggatctcggc 233
>dbj|D11054.1|CHKH2A3H Gallus gallus gene for H2A histone, complete cds Length = 1495 Score = 99.6 bits (50), Expect = 1e-17 Identities = 122/146 (83%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||| ||||||||||| ||||||| Sbjct: 635 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 576 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| ||||| |||||| || |||||||| | |||||| | |||||||| || || Sbjct: 575 gttgtcgcgggccgggttgcccgccagctccaggatctcggccgtcaggtactccagcac 516 Query: 438 ggcggcgaggtagacgggggcgccgg 463 ||| || ||||| || |||||||||| Sbjct: 515 ggccgccaggtacaccggggcgccgg 490 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 510 gcggccgacggggaactggagcccggcc 537 |||||| ||||||||||| ||||||||| Sbjct: 443 gcggcccacggggaactgcagcccggcc 416
>gb|AC157656.3| Mus musculus BAC clone RP23-406A5 from chromosome 13, complete sequence Length = 189500 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 132628 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 132569 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 132568 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 132527
>gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, complete sequence Length = 166720 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 36085 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 36026 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 36025 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 35984 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Plus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 30192 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 30251 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 30252 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 30293 Score = 91.7 bits (46), Expect = 3e-15 Identities = 88/102 (86%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||| ||||||||||||||||| ||||||| Sbjct: 55491 gagctcctcgtcgttgcggatggccagctgcagatggcgcgggatgatgcgcgtcttctt 55432 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 55431 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 55390 Score = 65.9 bits (33), Expect = 2e-07 Identities = 63/73 (86%) Strand = Plus / Plus Query: 347 gcaggtggcgcgggatgatgcggctcttcttgttgtccttggccgcgttgccggcaagct 406 |||| ||||||||||||||||| ||||||||||||| |||||||||||| || |||| Sbjct: 55886 gcagatggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagct 55945 Query: 407 ccagcagctcggc 419 |||| | |||||| Sbjct: 55946 ccaggatctcggc 55958 Score = 40.1 bits (20), Expect = 8.7 Identities = 29/32 (90%) Strand = Plus / Plus Query: 268 ttggggatgacaccgccgtgggcgatggtgac 299 ||||||| ||| ||||| |||||||||||||| Sbjct: 55807 ttggggaggaccccgccctgggcgatggtgac 55838
>gb|BC053966.1| Mus musculus histone 2, H2aa2, mRNA (cDNA clone IMAGE:1349026) Length = 570 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 318 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 259 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 258 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 217
>ref|XM_667061.1| Plasmodium berghei strain ANKA histone h2a (PB300144.00.0), partial mRNA Length = 378 Score = 99.6 bits (50), Expect = 1e-17 Identities = 125/150 (83%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 267 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 208 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 |||||| |||||||||||| || |||||||| | |||||| | |||||||| || || Sbjct: 207 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgttaggtactccagcac 148 Query: 438 ggcggcgaggtagacgggggcgccggagcc 467 || || | ||| || || ||||||||||| Sbjct: 147 cgccgccatgtataccggcgcgccggagcc 118
>gb|BC089519.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone MGC:107211 IMAGE:6771160), complete cds Length = 637 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 366 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 307 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 306 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 265
>gb|AC160122.2| Mus musculus BAC clone RP23-390G1 from chromosome 13, complete sequence Length = 208856 Score = 99.6 bits (50), Expect = 1e-17 Identities = 89/102 (87%) Strand = Plus / Plus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| |||||||||||||||||||||| ||||||| Sbjct: 184237 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 184296 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggc 419 |||||| |||||||||||| || |||||||| | |||||| Sbjct: 184297 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 184338
>ref|XM_522264.1| PREDICTED: Pan troglodytes similar to Histone H2A.x (H2a/x) (LOC466864), mRNA Length = 432 Score = 97.6 bits (49), Expect = 4e-17 Identities = 184/229 (80%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| || || |||||||| || |||||| | |||||| | |||||| Sbjct: 336 gatgttgggcaggacgcctccctgggcgatcgtcacgccgcccagcagcttgttgagctc 277 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||| |||||||| || ||||||||||||| Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgggggatgattcgcgtcttcttgttgtc 217 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||| ||||| || |||||||| | ||| || | ||||||||| || || || || Sbjct: 216 gcgggccgcattgcccgccagctccaggatctcagcggtgaggtactccagcactgccgc 157 Query: 444 gaggtagacgggggcgccggagccgacgcgctgggcgtaacggcccttc 492 ||||| || || ||||||| ||| ||||||| |||||| |||||||| Sbjct: 156 caggtacactggcgcgccggcgccaacgcgctcggcgtagtggcccttc 108
>ref|XM_602496.2| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC524176), mRNA Length = 449 Score = 97.6 bits (49), Expect = 4e-17 Identities = 136/165 (82%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| ||||||| |||||||| ||||| ||||||| Sbjct: 283 gagctcctcgtcgttgcggatggccagctgcaggtgacgcgggataatgcgcgtcttctt 224 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 ||||||| |||||||||||| || |||||||| | |||||| | |||||||| || || Sbjct: 223 gttgtcccgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 164 Query: 438 ggcggcgaggtagacgggggcgccggagccgacgcgctgggcgta 482 || || ||||| || ||||| |||| ||||| |||| |||||| Sbjct: 163 cgccgccaggtacaccggggccccggccccgacccgctcggcgta 119
>gb|BC004915.2| Homo sapiens H2A histone family, member X, mRNA (cDNA clone MGC:4759 IMAGE:3537648), complete cds Length = 1580 Score = 97.6 bits (49), Expect = 4e-17 Identities = 184/229 (80%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| || || |||||||| || |||||| | |||||| | |||||| Sbjct: 379 gatgttgggcaggacgcctccctgggcgatcgtcacgccgcccagcagcttgttgagctc 320 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||| |||||||| || ||||||||||||| Sbjct: 319 ctcgtcgttgcggatggccagctgcaggtggcgggggatgattcgcgtcttcttgttgtc 260 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||| ||||| || |||||||| | ||| || | ||||||||| || || || || Sbjct: 259 gcgggccgcattgcccgccagctccaggatctcagcggtgaggtactccagcactgccgc 200 Query: 444 gaggtagacgggggcgccggagccgacgcgctgggcgtaacggcccttc 492 ||||| || || ||||||| ||| ||||||| |||||| |||||||| Sbjct: 199 caggtacactggcgcgccggcgccaacgcgctcggcgtagtggcccttc 151
>ref|XM_869001.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC616875), mRNA Length = 449 Score = 97.6 bits (49), Expect = 4e-17 Identities = 136/165 (82%) Strand = Plus / Minus Query: 318 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 377 |||||||| ||||||||||| ||| ||| ||||||| || ||||||||||| ||||||| Sbjct: 283 gagctcctcgtcgttgcggatggccagctgcaggtgacgagggatgatgcgcgtcttctt 224 Query: 378 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 437 ||||||| |||||||||||| || |||||||| | |||||| | |||||||| || || Sbjct: 223 gttgtcccgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 164 Query: 438 ggcggcgaggtagacgggggcgccggagccgacgcgctgggcgta 482 || || ||||| || ||||| |||| ||||| |||| |||||| Sbjct: 163 cgccgccaggtacaccggggccccggccccgacccgctcggcgta 119
>ref|NM_002105.2| Homo sapiens H2A histone family, member X (H2AFX), mRNA Length = 1651 Score = 97.6 bits (49), Expect = 4e-17 Identities = 184/229 (80%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| || || |||||||| || |||||| | |||||| | |||||| Sbjct: 409 gatgttgggcaggacgcctccctgggcgatcgtcacgccgcccagcagcttgttgagctc 350 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||| |||||||| || ||||||||||||| Sbjct: 349 ctcgtcgttgcggatggccagctgcaggtggcgggggatgattcgcgtcttcttgttgtc 290 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||| ||||| || |||||||| | ||| || | ||||||||| || || || || Sbjct: 289 gcgggccgcattgcccgccagctccaggatctcagcggtgaggtactccagcactgccgc 230 Query: 444 gaggtagacgggggcgccggagccgacgcgctgggcgtaacggcccttc 492 ||||| || || ||||||| ||| ||||||| |||||| |||||||| Sbjct: 229 caggtacactggcgcgccggcgccaacgcgctcggcgtagtggcccttc 181
>emb|X80330.1|CLH2A232 C.longicaudatus genes for histones H2a.2 and H3.2 Length = 2927 Score = 97.6 bits (49), Expect = 4e-17 Identities = 82/93 (88%) Strand = Plus / Minus Query: 327 gtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtcctt 386 ||||||||||| ||| ||| ||||||||||||||||||||||| ||||||||||||| Sbjct: 1273 gtcgttgcggatggccagctgcaggtggcgcgggatgatgcgggtcttcttgttgtcgcg 1214 Query: 387 ggccgcgttgccggcaagctccagcagctcggc 419 |||||||||||| || |||||||| | |||||| Sbjct: 1213 ggccgcgttgcccgccagctccaggatctcggc 1181
>emb|X14850.1|HSH2AX Human H2A.X mRNA encoding histone H2A.X Length = 1585 Score = 97.6 bits (49), Expect = 4e-17 Identities = 184/229 (80%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| || || |||||||| || |||||| | |||||| | |||||| Sbjct: 409 gatgttgggcaggacgcctccctgggcgatcgtcacgccgcccagcagcttgttgagctc 350 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||| |||||||| || ||||||||||||| Sbjct: 349 ctcgtcgttgcggatggccagctgcaggtggcgggggatgattcgcgtcttcttgttgtc 290 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||| ||||| || |||||||| | ||| || | ||||||||| || || || || Sbjct: 289 gcgggccgcattgcccgccagctccaggatctcagcggtgaggtactccagcactgccgc 230 Query: 444 gaggtagacgggggcgccggagccgacgcgctgggcgtaacggcccttc 492 ||||| || || ||||||| ||| ||||||| |||||| |||||||| Sbjct: 229 caggtacactggcgcgccggcgccaacgcgctcggcgtagtggcccttc 181
>gb|BC013416.2| Homo sapiens H2A histone family, member X, mRNA (cDNA clone MGC:4703 IMAGE:3534359), complete cds Length = 1616 Score = 97.6 bits (49), Expect = 4e-17 Identities = 184/229 (80%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| || || |||||||| || |||||| | |||||| | |||||| Sbjct: 374 gatgttgggcaggacgcctccctgggcgatcgtcacgccgcccagcagcttgttgagctc 315 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||| |||||||| || ||||||||||||| Sbjct: 314 ctcgtcgttgcggatggccagctgcaggtggcgggggatgattcgcgtcttcttgttgtc 255 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||| ||||| || |||||||| | ||| || | ||||||||| || || || || Sbjct: 254 gcgggccgcattgcccgccagctccaggatctcagcggtgaggtactccagcactgccgc 195 Query: 444 gaggtagacgggggcgccggagccgacgcgctgggcgtaacggcccttc 492 ||||| || || ||||||| ||| ||||||| |||||| |||||||| Sbjct: 194 caggtacactggcgcgccggcgccaacgcgctcggcgtagtggcccttc 146
>emb|CR605072.1| full-length cDNA clone CS0DD007YB20 of Neuroblastoma Cot 50-normalized of Homo sapiens (human) Length = 1373 Score = 97.6 bits (49), Expect = 4e-17 Identities = 184/229 (80%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| || || |||||||| || |||||| | |||||| | |||||| Sbjct: 391 gatgttgggcaggacgcctccctgggcgatcgtcacgccgcccagcagcttgttgagctc 332 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||| |||||||| || ||||||||||||| Sbjct: 331 ctcgtcgttgcggatggccagctgcaggtggcgggggatgattcgcgtcttcttgttgtc 272 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||| ||||| || |||||||| | ||| || | ||||||||| || || || || Sbjct: 271 gcgggccgcattgcccgccagctccaggatctcagcggtgaggtactccagcactgccgc 212 Query: 444 gaggtagacgggggcgccggagccgacgcgctgggcgtaacggcccttc 492 ||||| || || ||||||| ||| ||||||| |||||| |||||||| Sbjct: 211 caggtacactggcgcgccggcgccaacgcgctcggcgtagtggcccttc 163
>gb|AY760064.1| Muntiacus muntjak vaginalis H2A histone family member X (H2AX) mRNA, partial cds Length = 300 Score = 97.6 bits (49), Expect = 4e-17 Identities = 184/229 (80%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| || || |||||||| || |||||| | |||||| | |||||| Sbjct: 297 gatgttgggcaggacgcctccctgggcgatcgtcacgccgcccagcagcttgttgagctc 238 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||| ||||| || || ||||||||||||| Sbjct: 237 ctcgtcgttgcggatggccagctgcaggtggcgggggattatccgcgtcttcttgttgtc 178 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||||||||| || |||||||| | ||| || | |||||||||||| || || || Sbjct: 177 gcgggccgcgttgcccgccagctccaggatctcagcggtgaggtactcgagtaccgccgc 118 Query: 444 gaggtagacgggggcgccggagccgacgcgctgggcgtaacggcccttc 492 |||||||| || ||||||| ||| || | || |||||| |||||||| Sbjct: 117 caggtagaccggcgcgccggcgcccaccctctcggcgtagtggcccttc 69
>gb|DQ015918.1| Homo sapiens H2A histone family, member X (H2AFX) gene, complete cds Length = 5462 Score = 97.6 bits (49), Expect = 4e-17 Identities = 184/229 (80%) Strand = Plus / Minus Query: 264 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 323 ||||||||| | ||| || || |||||||| || |||||| | |||||| | |||||| Sbjct: 2407 gatgttgggcaggacgcctccctgggcgatcgtcacgccgcccagcagcttgttgagctc 2348 Query: 324 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 383 || ||||||||||| ||| ||| |||||||||| |||||||| || ||||||||||||| Sbjct: 2347 ctcgtcgttgcggatggccagctgcaggtggcgggggatgattcgcgtcttcttgttgtc 2288 Query: 384 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 443 |||||| ||||| || |||||||| | ||| || | ||||||||| || || || || Sbjct: 2287 gcgggccgcattgcccgccagctccaggatctcagcggtgaggtactccagcactgccgc 2228 Query: 444 gaggtagacgggggcgccggagccgacgcgctgggcgtaacggcccttc 492 ||||| || || ||||||| ||| ||||||| |||||| |||||||| Sbjct: 2227 caggtacactggcgcgccggcgccaacgcgctcggcgtagtggcccttc 2179
>ref|XM_345255.2| PREDICTED: Rattus norvegicus histone 2, H2aa (predicted) (Hist2h2aa_predicted), mRNA Length = 591 Score = 97.6 bits (49), Expect = 4e-17 Identities = 82/93 (88%) Strand = Plus / Minus Query: 327 gtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtcctt 386 ||||||||||| ||| ||| ||||||||||||||||||||||| ||||||||||||| Sbjct: 471 gtcgttgcggatggccagctgcaggtggcgcgggatgatgcgggtcttcttgttgtcgcg 412 Query: 387 ggccgcgttgccggcaagctccagcagctcggc 419 |||||||||||| || |||||||| | |||||| Sbjct: 411 ggccgcgttgcccgccagctccaggatctcggc 379
>ref|XM_574998.1| PREDICTED: Rattus norvegicus similar to Hist2h2aa1 protein (LOC499676), mRNA Length = 675 Score = 97.6 bits (49), Expect = 4e-17 Identities = 82/93 (88%) Strand = Plus / Minus Query: 327 gtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtcctt 386 ||||||||||| ||| ||| ||||||||||||||||||||||| ||||||||||||| Sbjct: 546 gtcgttgcggatggccagctgcaggtggcgcgggatgatgcgggtcttcttgttgtcgcg 487 Query: 387 ggccgcgttgccggcaagctccagcagctcggc 419 |||||||||||| || |||||||| | |||||| Sbjct: 486 ggccgcgttgcccgccagctccaggatctcggc 454 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,416,916 Number of Sequences: 3902068 Number of extensions: 5416916 Number of successful extensions: 128598 Number of sequences better than 10.0: 767 Number of HSP's better than 10.0 without gapping: 776 Number of HSP's successfully gapped in prelim test: 12 Number of HSP's that attempted gapping in prelim test: 120018 Number of HSP's gapped (non-prelim): 8496 length of query: 635 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 612 effective length of database: 17,143,297,704 effective search space: 10491698194848 effective search space used: 10491698194848 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
