ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags24e18
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC101844.7| Mus musculus chromosome 7, clone RP23-257M22, com... 40 2.4
2emb|BX294101.5| Mouse DNA sequence from clone RP24-370E7 on chro... 40 2.4
3emb|CR933731.5| Mouse DNA sequence from clone DN-160I24 on chrom... 40 2.4
4gb|AC102313.8| Mus musculus chromosome 1, clone RP24-435B20, com... 40 2.4
5dbj|AP001485.5| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 2.4
6dbj|AP001930.4| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 2.4
7gb|AC164522.2| Mus musculus chromosome 1, clone RP23-148N9, comp... 40 2.4
8gb|AC161284.2| Pan troglodytes BAC clone CH251-341A21 from chrom... 38 9.6
9ref|XM_848181.1| PREDICTED: Canis familiaris hypothetical protei... 38 9.6
10emb|AL356133.17| Human DNA sequence from clone RP11-337A23 on ch... 38 9.6
11emb|AL354751.7| Human DNA sequence from clone RP11-100G15 on chr... 38 9.6
12emb|CR626927.1| Bacteroides fragilis NCTC 9343, complete genome 38 9.6
13gb|AC165950.1| Mus musculus BAC clone RP24-235L20 from chromosom... 38 9.6
14emb|BX510938.11| Zebrafish DNA sequence from clone DKEY-92K1 in ... 38 9.6
15gb|AC079336.5| Homo sapiens chromosome 17, clone RP11-466A19, co... 38 9.6
16gb|AC007953.21| Homo sapiens 3 BAC RP11-2L8 (Roswell Park Cancer... 38 9.6
17gb|AC087638.7| Homo sapiens chromosome 15, clone RP11-655F8, com... 38 9.6
18gb|AC010639.5| Homo sapiens chromosome 5 clone CTD-2358I2, compl... 38 9.6
19gb|AC103549.6| Homo sapiens 3 BAC RP11-795G18 (Roswell Park Canc... 38 9.6
20gb|AC007718.12| Homo sapiens chromosome 8, clone RP11-29A2, comp... 38 9.6
21gb|AC026414.6| Homo sapiens chromosome 5 clone CTD-2036A18, comp... 38 9.6
22dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 38 9.6
23gb|AC079354.4| Homo sapiens BAC clone RP11-1145F21 from 2, compl... 38 9.6
24gb|AC066691.3|AC066691 Arabidopsis thaliana chromosome 1 BAC T6J... 38 9.6
25gb|AC012003.9| Homo sapiens BAC clone RP11-498P13 from 2, comple... 38 9.6
26dbj|AP006841.1| Bacteroides fragilis YCH46 DNA, complete genome 38 9.6
27dbj|AP003619.3| Oryza sativa (japonica cultivar-group) genomic D... 38 9.6
28emb|AL929331.15| Zebrafish DNA sequence from clone DKEY-16O9, co... 38 9.6
29dbj|AK121512.1| Oryza sativa (japonica cultivar-group) cDNA clon... 38 9.6
30gb|AC103897.3| Papio anubis clone RP41-461D5, complete sequence 38 9.6
31gb|AC154774.2| Mus musculus BAC clone RP24-455C12 from chromosom... 38 9.6

>gb|AC101844.7| Mus musculus chromosome 7, clone RP23-257M22, complete sequence
          Length = 197827

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 121    tatcatcatttcctattctt 140
              ||||||||||||||||||||
Sbjct: 130872 tatcatcatttcctattctt 130891



to top

>emb|BX294101.5| Mouse DNA sequence from clone RP24-370E7 on chromosome 11 Contains
            the 3' end of the Alox12e gene for epidermal arachidonate
            lipoxygenase, complete sequence
          Length = 12474

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 122  atcatcatttcctattcttt 141
            ||||||||||||||||||||
Sbjct: 5833 atcatcatttcctattcttt 5814



to top

>emb|CR933731.5| Mouse DNA sequence from clone DN-160I24 on chromosome 11, complete
              sequence
          Length = 212982

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 122    atcatcatttcctattcttt 141
              ||||||||||||||||||||
Sbjct: 158221 atcatcatttcctattcttt 158202



to top

>gb|AC102313.8| Mus musculus chromosome 1, clone RP24-435B20, complete sequence
          Length = 143900

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 69    gttacttggacaaattctga 88
             ||||||||||||||||||||
Sbjct: 20248 gttacttggacaaattctga 20267



to top

>dbj|AP001485.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-681H10, complete
              sequence
          Length = 158577

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 133    ctattctttaaccagaagcatatt 156
              ||||||| ||||||||||||||||
Sbjct: 147967 ctattctgtaaccagaagcatatt 147990



to top

>dbj|AP001930.4| Homo sapiens genomic DNA, chromosome 11q clone:RP11-669L23, complete
             sequences
          Length = 167117

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 133   ctattctttaaccagaagcatatt 156
             ||||||| ||||||||||||||||
Sbjct: 19008 ctattctgtaaccagaagcatatt 19031



to top

>gb|AC164522.2| Mus musculus chromosome 1, clone RP23-148N9, complete sequence
          Length = 183664

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 69     gttacttggacaaattctga 88
              ||||||||||||||||||||
Sbjct: 107831 gttacttggacaaattctga 107850



to top

>gb|AC161284.2| Pan troglodytes BAC clone CH251-341A21 from chromosome 7, complete
             sequence
          Length = 153042

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 58    ccaagaattcagttacttg 76
             |||||||||||||||||||
Sbjct: 75023 ccaagaattcagttacttg 75005



to top

>ref|XM_848181.1| PREDICTED: Canis familiaris hypothetical protein LOC610644
            (LOC610644), mRNA
          Length = 2109

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 123  tcatcatttcctattcttt 141
            |||||||||||||||||||
Sbjct: 1028 tcatcatttcctattcttt 1010



to top

>emb|AL356133.17| Human DNA sequence from clone RP11-337A23 on chromosome 9 Contains a
              novel gene (FLJ13657), the PLAA gene for phospholipase
              A2-activating protein (PLAP), a novel gene, the 5' end of
              capillary morphogenesis protein 1 (CMG-1, FLJ22621)(CMG1)
              and 3 CpG islands, complete sequence
          Length = 187805

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                         
Query: 117    tgattatcatcatttcctattctttaa 143
              ||||||||||||| | |||||||||||
Sbjct: 113944 tgattatcatcatcttctattctttaa 113918



to top

>emb|AL354751.7| Human DNA sequence from clone RP11-100G15 on chromosome 9 Contains the
             5' end of the SPTLC1 gene for serine palmitoyltransferase
             long chain base subunit 1, a pseudogene similar to part of
             ATP synthase 6 (MTATP6), a cytochrome c oxidase III
             (MTCO3) pseudogene, pseudogenes for NADH dehydrogenases 3,
             4 and 4L (MTND3, MTND4L, MTND4), a protein tyrosine
             phosphatase pseudogene, a novel gene (LOC158314), two
             novel genes, part of a novel gene and a CpG island,
             complete sequence
          Length = 104228

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 127   catttcctattctttaacc 145
             |||||||||||||||||||
Sbjct: 19104 catttcctattctttaacc 19122



to top

>emb|CR626927.1| Bacteroides fragilis NCTC 9343, complete genome
          Length = 5205140

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                      
Query: 144     ccagaagcatattcataaagatc 166
               |||||||||||||| ||||||||
Sbjct: 2088319 ccagaagcatattcgtaaagatc 2088341



to top

>gb|AC165950.1| Mus musculus BAC clone RP24-235L20 from chromosome 13, complete
             sequence
          Length = 178927

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                        
Query: 120   ttatcatcatttcctattctttaacca 146
             ||||||||||||| | |||||||||||
Sbjct: 89040 ttatcatcatttctttttctttaacca 89014



to top

>emb|BX510938.11| Zebrafish DNA sequence from clone DKEY-92K1 in linkage group 21, complete
              sequence
          Length = 230957

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 38     atgatacaaaccatgcata 56
              |||||||||||||||||||
Sbjct: 178940 atgatacaaaccatgcata 178922



 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 38     atgatacaaaccatgcata 56
              |||||||||||||||||||
Sbjct: 177893 atgatacaaaccatgcata 177875



 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 38     atgatacaaaccatgcata 56
              |||||||||||||||||||
Sbjct: 175963 atgatacaaaccatgcata 175945



 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 38     atgatacaaaccatgcata 56
              |||||||||||||||||||
Sbjct: 171187 atgatacaaaccatgcata 171169



 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 38     atgatacaaaccatgcata 56
              |||||||||||||||||||
Sbjct: 169532 atgatacaaaccatgcata 169514



to top

>gb|AC079336.5| Homo sapiens chromosome 17, clone RP11-466A19, complete sequence
          Length = 168851

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 127   catttcctattctttaacc 145
             |||||||||||||||||||
Sbjct: 56716 catttcctattctttaacc 56734



to top

>gb|AC007953.21| Homo sapiens 3 BAC RP11-2L8 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 152210

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 114    tactgattatcatcatttcctat 136
              ||||||| |||||||||||||||
Sbjct: 100733 tactgataatcatcatttcctat 100755



to top

>gb|AC087638.7| Homo sapiens chromosome 15, clone RP11-655F8, complete sequence
          Length = 173062

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 130    ttcctattctttaaccaga 148
              |||||||||||||||||||
Sbjct: 117357 ttcctattctttaaccaga 117339



to top

>gb|AC010639.5| Homo sapiens chromosome 5 clone CTD-2358I2, complete sequence
          Length = 76171

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 144   ccagaagcatattcataaa 162
             |||||||||||||||||||
Sbjct: 53361 ccagaagcatattcataaa 53343



to top

>gb|AC103549.6| Homo sapiens 3 BAC RP11-795G18 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 165139

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 114    tactgattatcatcatttcctat 136
              ||||||| |||||||||||||||
Sbjct: 113892 tactgataatcatcatttcctat 113870



to top

>gb|AC007718.12| Homo sapiens chromosome 8, clone RP11-29A2, complete sequence
          Length = 149965

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 159   taaagatcagcttcggcaa 177
             |||||||||||||||||||
Sbjct: 64273 taaagatcagcttcggcaa 64255



to top

>gb|AC026414.6| Homo sapiens chromosome 5 clone CTD-2036A18, complete sequence
          Length = 148065

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 144    ccagaagcatattcataaa 162
              |||||||||||||||||||
Sbjct: 143323 ccagaagcatattcataaa 143341



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                       
Query: 52       gcatatccaagaattcagttact 74
                |||||||||||||| ||||||||
Sbjct: 12955605 gcatatccaagaatgcagttact 12955583



to top

>gb|AC079354.4| Homo sapiens BAC clone RP11-1145F21 from 2, complete sequence
          Length = 162554

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 125   atcatttcctattctttaa 143
             |||||||||||||||||||
Sbjct: 90058 atcatttcctattctttaa 90040



to top

>gb|AC066691.3|AC066691 Arabidopsis thaliana chromosome 1 BAC T6J19 genomic sequence, complete
             sequence
          Length = 43666

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 62    gaattcagttacttggacaaatt 84
             ||||||||||||||||| |||||
Sbjct: 20953 gaattcagttacttggaaaaatt 20931



to top

>gb|AC012003.9| Homo sapiens BAC clone RP11-498P13 from 2, complete sequence
          Length = 195950

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 44     caaaccatgcatatccaag 62
              |||||||||||||||||||
Sbjct: 161649 caaaccatgcatatccaag 161667



to top

>dbj|AP006841.1| Bacteroides fragilis YCH46 DNA, complete genome
          Length = 5277274

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                      
Query: 144     ccagaagcatattcataaagatc 166
               |||||||||||||| ||||||||
Sbjct: 1994946 ccagaagcatattcgtaaagatc 1994924



to top

>dbj|AP003619.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0577H07
          Length = 126757

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 52    gcatatccaagaattcagttact 74
             |||||||||||||| ||||||||
Sbjct: 37982 gcatatccaagaatgcagttact 37960



to top

>emb|AL929331.15| Zebrafish DNA sequence from clone DKEY-16O9, complete sequence
          Length = 221062

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 136   ttctttaaccagaagcata 154
             |||||||||||||||||||
Sbjct: 94507 ttctttaaccagaagcata 94489



to top

>dbj|AK121512.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033024N17, full
            insert sequence
          Length = 5989

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 52   gcatatccaagaattcagttact 74
            |||||||||||||| ||||||||
Sbjct: 1110 gcatatccaagaatgcagttact 1132



to top

>gb|AC103897.3| Papio anubis clone RP41-461D5, complete sequence
          Length = 156269

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 58    ccaagaattcagttacttg 76
             |||||||||||||||||||
Sbjct: 53832 ccaagaattcagttacttg 53814



to top

>gb|AC154774.2| Mus musculus BAC clone RP24-455C12 from chromosome 16, complete sequence
          Length = 187085

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 126    tcatttcctattctttaac 144
              |||||||||||||||||||
Sbjct: 133230 tcatttcctattctttaac 133248


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,629,420
Number of Sequences: 3902068
Number of extensions: 1629420
Number of successful extensions: 108872
Number of sequences better than 10.0: 31
Number of HSP's better than 10.0 without gapping: 31
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 108707
Number of HSP's gapped (non-prelim): 165
length of query: 194
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 172
effective length of database: 17,147,199,772
effective search space: 2949318360784
effective search space used: 2949318360784
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top