>emb|AL356133.17| Human DNA sequence from clone RP11-337A23 on chromosome 9 Contains a
novel gene (FLJ13657), the PLAA gene for phospholipase
A2-activating protein (PLAP), a novel gene, the 5' end of
capillary morphogenesis protein 1 (CMG-1, FLJ22621)(CMG1)
and 3 CpG islands, complete sequence
Length = 187805
Score = 38.2 bits (19), Expect = 9.6
Identities = 25/27 (92%)
Strand = Plus / Minus
Query: 117 tgattatcatcatttcctattctttaa 143
||||||||||||| | |||||||||||
Sbjct: 113944 tgattatcatcatcttctattctttaa 113918
>emb|AL354751.7| Human DNA sequence from clone RP11-100G15 on chromosome 9 Contains the
5' end of the SPTLC1 gene for serine palmitoyltransferase
long chain base subunit 1, a pseudogene similar to part of
ATP synthase 6 (MTATP6), a cytochrome c oxidase III
(MTCO3) pseudogene, pseudogenes for NADH dehydrogenases 3,
4 and 4L (MTND3, MTND4L, MTND4), a protein tyrosine
phosphatase pseudogene, a novel gene (LOC158314), two
novel genes, part of a novel gene and a CpG island,
complete sequence
Length = 104228
Score = 38.2 bits (19), Expect = 9.6
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 127 catttcctattctttaacc 145
|||||||||||||||||||
Sbjct: 19104 catttcctattctttaacc 19122
>gb|AC154774.2| Mus musculus BAC clone RP24-455C12 from chromosome 16, complete sequence
Length = 187085
Score = 38.2 bits (19), Expect = 9.6
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 126 tcatttcctattctttaac 144
|||||||||||||||||||
Sbjct: 133230 tcatttcctattctttaac 133248
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,629,420
Number of Sequences: 3902068
Number of extensions: 1629420
Number of successful extensions: 108872
Number of sequences better than 10.0: 31
Number of HSP's better than 10.0 without gapping: 31
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 108707
Number of HSP's gapped (non-prelim): 165
length of query: 194
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 172
effective length of database: 17,147,199,772
effective search space: 2949318360784
effective search space used: 2949318360784
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)