>gb|AE016828.2| Coxiella burnetii RSA 493, complete genome
          Length = 1995281

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 145    ttctttgccaccaccatcacgatc 168
              ||||||||||||||| ||||||||
Sbjct: 237761 ttctttgccaccaccgtcacgatc 237738

>ref|XM_600663.2| PREDICTED: Bos taurus similar to nestin (LOC522383), mRNA
          Length = 5383

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 156  caccatcacgatcccaggc 174
            |||||||||||||||||||
Sbjct: 4228 caccatcacgatcccaggc 4210

>emb|AL391688.1| Human DNA sequence from clone RP11-524D16 on chromosome X Contains
           the 3' end of the gene for sushi-repeat protein (SRPUL)
           and the 3' end of the SYTL4 gene for synaptotagmin-like
           4 (granuphilin-a), complete sequence
          Length = 46229

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 145 ttctttgccaccaccatca 163
           |||||||||||||||||||
Sbjct: 283 ttctttgccaccaccatca 265

>gb|AC024073.7| Homo sapiens chromosome 10 clone RP11-394D15, complete sequence
          Length = 172892

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 35    catagcacaaaattaacca 53
             |||||||||||||||||||
Sbjct: 28208 catagcacaaaattaacca 28190

>gb|AC068780.31| Homo sapiens 12 BAC RP11-163B7 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 105836

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 136    ctagataggttctttgcca 154
              |||||||||||||||||||
Sbjct: 101422 ctagataggttctttgcca 101404

>gb|AC092329.3| Homo sapiens chromosome 19 clone RP11-15H20, complete sequence
          Length = 186233

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 67    aatatccattaagtaacaa 85
             |||||||||||||||||||
Sbjct: 98400 aatatccattaagtaacaa 98382

>gb|AC055740.17| Homo sapiens 3 BAC RP11-239J2 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 147634

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 27     ctcttaggcatagcacaaa 45
              |||||||||||||||||||
Sbjct: 109483 ctcttaggcatagcacaaa 109465

>gb|AC027671.9| Homo sapiens chromosome 10 clone RP11-183F21, complete sequence
          Length = 152867

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 35     catagcacaaaattaacca 53
              |||||||||||||||||||
Sbjct: 128245 catagcacaaaattaacca 128227

>ref|NM_012688.1| Rattus norvegicus cholecystokinin A receptor (Cckar), mRNA
          Length = 2720

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 151 gccaccaccatcacgatcccagg 173
           |||||||||||||| ||||||||
Sbjct: 934 gccaccaccatcacaatcccagg 912

>emb|BX649540.7| Zebrafish DNA sequence from clone CH211-229O8 in linkage group 3,
              complete sequence
          Length = 120836

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 38     agcacaaaattaaccagtt 56
              |||||||||||||||||||
Sbjct: 109591 agcacaaaattaaccagtt 109609

>gb|AC139720.1| Homo sapiens BAC clone RP11-223C24 from 4, complete sequence
          Length = 160940

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 144   gttctttgccaccaccatc 162
             |||||||||||||||||||
Sbjct: 77206 gttctttgccaccaccatc 77224

>gb|AC138331.4| Homo sapiens 12 BAC RP11-781A6 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 113301

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 136    ctagataggttctttgcca 154
              |||||||||||||||||||
Sbjct: 108912 ctagataggttctttgcca 108894

>gb|AC112128.4| Homo sapiens 3 BAC RP11-24O5 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 179604

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 27    ctcttaggcatagcacaaa 45
             |||||||||||||||||||
Sbjct: 17876 ctcttaggcatagcacaaa 17858

>gb|AC092580.3| Homo sapiens BAC clone RP11-16D24 from 2, complete sequence
          Length = 120492

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 39    gcacaaaattaaccagttc 57
             |||||||||||||||||||
Sbjct: 84406 gcacaaaattaaccagttc 84424

>emb|BX649348.8| Mouse DNA sequence from clone RP23-359M23 on chromosome 2, complete
              sequence
          Length = 162565

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 137    tagataggttctttgccac 155
              |||||||||||||||||||
Sbjct: 119732 tagataggttctttgccac 119750

>gb|AC103404.13| Mus musculus chromosome 5, clone RP23-21O1, complete sequence
          Length = 251988

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 75     ttaagtaacaagcaaactc 93
              |||||||||||||||||||
Sbjct: 152678 ttaagtaacaagcaaactc 152660

>dbj|D50608.1|RATCCKARA Rattus norvegicus CCKAR gene for cholecystokinin type-A receptor,
             complete cds
          Length = 16109

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 151   gccaccaccatcacgatcccagg 173
             |||||||||||||| ||||||||
Sbjct: 13145 gccaccaccatcacaatcccagg 13123

>gb|M88096.1|RATCCKAR Rat cholecystokinin receptor mRNA, complete cds
          Length = 1506

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 151 gccaccaccatcacgatcccagg 173
           |||||||||||||| ||||||||
Sbjct: 881 gccaccaccatcacaatcccagg 859

>dbj|D50610.1| Rattus norvegicus CCKAR gene for cholecystokinin type-A receptor,
            partial cds
          Length = 11476

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 151  gccaccaccatcacgatcccagg 173
            |||||||||||||| ||||||||
Sbjct: 8512 gccaccaccatcacaatcccagg 8490


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,427,511
Number of Sequences: 3902068
Number of extensions: 1427511
Number of successful extensions: 108278
Number of sequences better than 10.0: 19
Number of HSP's better than 10.0 without gapping: 19
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 108233
Number of HSP's gapped (non-prelim): 45
length of query: 176
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 154
effective length of database: 17,147,199,772
effective search space: 2640668764888
effective search space used: 2640668764888
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)