ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags24d22
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC117602.9| Mus musculus chromosome 5, clone RP23-462C22, com... 42 0.80
2gb|AC090503.12| Homo sapiens 12q BAC RP11-314D7 (Roswell Park Ca... 42 0.80
3emb|AL365260.11| Human DNA sequence from clone RP11-433J22 on ch... 40 3.2
4dbj|AK080537.1| Mus musculus 7 days neonate cerebellum cDNA, RIK... 40 3.2
5dbj|AK034797.1| Mus musculus 12 days embryo embryonic body betwe... 40 3.2
6dbj|AK078563.1| Mus musculus 11 days embryo gonad cDNA, RIKEN fu... 40 3.2
7emb|CR388420.19| Zebrafish DNA sequence from clone DKEY-37H18 in... 40 3.2
8emb|AL731772.9| Mouse DNA sequence from clone RP23-273F8 on chro... 40 3.2
9emb|AL772282.9| Mouse DNA sequence from clone RP23-328F3 on chro... 40 3.2

>gb|AC117602.9| Mus musculus chromosome 5, clone RP23-462C22, complete sequence
          Length = 205604

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 174    cccagcacaaacacacaaaac 194
              |||||||||||||||||||||
Sbjct: 128157 cccagcacaaacacacaaaac 128137



to top

>gb|AC090503.12| Homo sapiens 12q BAC RP11-314D7 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 221074

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 169   gtgttcccagcacaaacacacaaaa 193
             |||||| ||||||||||||||||||
Sbjct: 95987 gtgttctcagcacaaacacacaaaa 95963



to top

>emb|AL365260.11| Human DNA sequence from clone RP11-433J22 on chromosome 1 Contains the
             GJA5 gene for gap junction protein, alpha 5, 40kDa
             (connexin 40) protein, complete sequence
          Length = 114412

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 180   acaaacacacaaaaccatac 199
             ||||||||||||||||||||
Sbjct: 39792 acaaacacacaaaaccatac 39811



to top

>dbj|AK080537.1| Mus musculus 7 days neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:A730079H24
           product:bromodomain-containing 3, full insert sequence
          Length = 988

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 115 actcactctacacatgccca 134
           ||||||||||||||||||||
Sbjct: 125 actcactctacacatgccca 106



to top

>dbj|AK034797.1| Mus musculus 12 days embryo embryonic body between diaphragm region
           and neck cDNA, RIKEN full-length enriched library,
           clone:9430040A05 product:bromodomain-containing 3, full
           insert sequence
          Length = 1774

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 115 actcactctacacatgccca 134
           ||||||||||||||||||||
Sbjct: 913 actcactctacacatgccca 894



to top

>dbj|AK078563.1| Mus musculus 11 days embryo gonad cDNA, RIKEN full-length enriched
           library, clone:7030403M22 product:bromodomain-containing
           3, full insert sequence
          Length = 913

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 115 actcactctacacatgccca 134
           ||||||||||||||||||||
Sbjct: 69  actcactctacacatgccca 50



to top

>emb|CR388420.19| Zebrafish DNA sequence from clone DKEY-37H18 in linkage group 13,
             complete sequence
          Length = 121689

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 182   aaacacacaaaaccatacaa 201
             ||||||||||||||||||||
Sbjct: 98342 aaacacacaaaaccatacaa 98361



to top

>emb|AL731772.9| Mouse DNA sequence from clone RP23-273F8 on chromosome 2, complete
             sequence
          Length = 99258

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 179   cacaaacacacaaaaccata 198
             ||||||||||||||||||||
Sbjct: 45714 cacaaacacacaaaaccata 45733



to top

>emb|AL772282.9| Mouse DNA sequence from clone RP23-328F3 on chromosome 2, complete
             sequence
          Length = 188624

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 115   actcactctacacatgccca 134
             ||||||||||||||||||||
Sbjct: 23111 actcactctacacatgccca 23130


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,108,266
Number of Sequences: 3902068
Number of extensions: 2108266
Number of successful extensions: 51531
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 51515
Number of HSP's gapped (non-prelim): 16
length of query: 246
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 224
effective length of database: 17,147,199,772
effective search space: 3840972748928
effective search space used: 3840972748928
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top