ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags24d16
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AY123420.1| Triticum aestivum putative 40S ribosomal protein ... 353 2e-94
2gb|AF479033.1| Triticum aestivum 40S ribosomal protein mRNA, par... 252 6e-64
3ref|XM_463024.1| Oryza sativa (japonica cultivar-group), OSJNBa0... 117 2e-23
4gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 117 2e-23
5dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 117 2e-23
6gb|AC146468.1| Oryza sativa (japonica cultivar-group) chromosome... 117 2e-23
7dbj|AK099146.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 2e-23
8dbj|AK061051.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 2e-23
9gb|AY107461.1| Zea mays PCO108959 mRNA sequence 117 2e-23
10ref|NM_122944.2| Arabidopsis thaliana structural constituent of ... 82 1e-12
11gb|AY098949.1| Arabidopsis thaliana AT5g35530/MOK9_14 mRNA, comp... 82 1e-12
12gb|AY058057.1| Arabidopsis thaliana AT5g35530/MOK9_14 mRNA, comp... 82 1e-12
13gb|AY084320.1| Arabidopsis thaliana clone 10394 mRNA, complete s... 82 1e-12
14dbj|AB015477.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 82 1e-12
15dbj|AB091077.1| Zinnia elegans ZeRPS3 mRNA for putative ribosoma... 78 2e-11
16emb|BX831845.1|CNS0A14G Arabidopsis thaliana Full-length cDNA Co... 68 2e-08
17gb|AY106013.1| Zea mays PCO066457 mRNA sequence 62 1e-06
18dbj|AP004944.1| Lotus japonicus genomic DNA, chromosome 1, clone... 62 1e-06
19ref|NM_128718.3| Arabidopsis thaliana structural constituent of ... 60 5e-06
20gb|AY091208.1| Arabidopsis thaliana putative 40S ribosomal prote... 60 5e-06
21gb|AY046041.1| Arabidopsis thaliana putative 40S ribosomal prote... 60 5e-06
22gb|AC007071.7| Arabidopsis thaliana chromosome 2 clone T9H9 map ... 60 5e-06
23gb|AY081517.1| Arabidopsis thaliana 40S ribosomal protein; conta... 60 5e-06
24gb|AY054622.1| Arabidopsis thaliana 40S ribosomal protein (At2g3... 60 5e-06
25gb|AY052749.1| Arabidopsis thaliana At2g31610/T9H9.13 mRNA, comp... 60 5e-06
26gb|AF378887.1|AF378887 Arabidopsis thaliana At2g31610/T9H9.13 mR... 60 5e-06
27emb|BX819975.1|CNS0A8H0 Arabidopsis thaliana Full-length cDNA Co... 60 5e-06
28ref|NM_115247.2| Arabidopsis thaliana nucleic acid binding / str... 56 7e-05
29gb|AY059090.1| Arabidopsis thaliana putative ribosomal protein S... 56 7e-05
30gb|AY035022.1| Arabidopsis thaliana putative ribosomal protein S... 56 7e-05
31emb|AL132960.2|ATF5K20 Arabidopsis thaliana DNA chromosome 3, BA... 56 7e-05
32gb|AF428405.1|AF428405 Arabidopsis thaliana AT3g53870/F5K20_170 ... 56 7e-05
33emb|BX824880.1|CNS0A5OP Arabidopsis thaliana Full-length cDNA Co... 56 7e-05
34emb|BX823126.1|CNS0A5V8 Arabidopsis thaliana Full-length cDNA Co... 56 7e-05
35gb|AY088808.1| Arabidopsis thaliana clone 9568 mRNA, complete se... 56 7e-05
36emb|BX820098.1|CNS0A8HS Arabidopsis thaliana Full-length cDNA Co... 54 3e-04
37gb|DQ294256.1| Solanum tuberosum clone 084G12 40S ribosomal prot... 54 3e-04
38gb|DQ241842.1| Solanum tuberosum clone 182H03 unknown mRNA 54 3e-04
39gb|BT012908.1| Lycopersicon esculentum clone 114026F, mRNA sequence 50 0.004
40ref|XM_479106.1| Oryza sativa (japonica cultivar-group), mRNA 48 0.017
41gb|AC079038.3|AC079038 Oryza sativa chromosome 7 clone OSJNBb002... 48 0.017
42dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.017
43dbj|AP006458.4| Oryza sativa (japonica cultivar-group) genomic D... 48 0.017
44dbj|AP005895.3| Oryza sativa (japonica cultivar-group) genomic D... 48 0.017
45dbj|AK066905.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.017
46ref|XM_754010.1| Ustilago maydis 521 hypothetical protein (UM029... 44 0.27
47gb|AF402810.1| Ictalurus punctatus 40S ribosomal protein S3 mRNA... 42 1.1
48dbj|D38596.1|RICRPS3A Oryza sativa mRNA, partial homologous to ... 42 1.1
49gb|DQ206605.1| Monosiga brevicollis isolate TOA26 ribosomal prot... 42 1.1
50gb|AY394937.1| Danio rerio clone RK045A1H03 ribosomal protein S3... 40 4.2
51ref|XM_593742.2| PREDICTED: Bos taurus similar to serologically ... 40 4.2
52ref|XM_745219.1| Aspergillus fumigatus Af293 40s ribosomal prote... 40 4.2
53gb|AC093458.6| Homo sapiens BAC clone RP11-445N20 from 7, comple... 40 4.2
54ref|XM_784326.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 4.2
55gb|AC134516.1| Oryza sativa (japonica cultivar-group) chromosome... 40 4.2
56ref|XM_788097.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 4.2
57emb|BX842627.1| Neurospora crassa DNA linkage group I BAC clone ... 40 4.2
58gb|AC116926.1| Genomic sequence for Oryza sativa (japonica culti... 40 4.2
59dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.2
60ref|NM_201153.1| Danio rerio ribosomal protein S3 (rps3), mRNA 40 4.2
61emb|CR555302.7| Zebrafish DNA sequence from clone CH211-212C19 i... 40 4.2
62gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 40 4.2
63emb|AL928672.14| Zebrafish DNA sequence from clone CH211-136O4, ... 40 4.2
64gb|BC045902.1| Danio rerio ribosomal protein S3, mRNA (cDNA clon... 40 4.2 
>gb|AY123420.1| Triticum aestivum putative 40S ribosomal protein S3 mRNA, complete
           cds
          Length = 1004

 Score =  353 bits (178), Expect = 2e-94
 Identities = 232/249 (93%), Gaps = 2/249 (0%)
 Strand = Plus / Minus

                                                                       
Query: 73  aggtaaccaaacgttgcatagcccac--ttgtcacaaggataggaaacaagctaggacca 130
           |||||||||| ||||||||||||| |  || ||||| |||||| |||| ||||| |||||
Sbjct: 873 aggtaaccaagcgttgcatagccctcgcttatcacagggatagaaaactagctacgacca 814

                                                                       
Query: 131 aaatgatgtgccgtttcatggtctgcttgcactactgggagtttagacctcaatcaaagc 190
           |||||||||| ||||||||||||||||||| ||||||||| |||||||||||| ||||||
Sbjct: 813 aaatgatgtgacgtttcatggtctgcttgctctactgggactttagacctcaaccaaagc 754

                                                                       
Query: 191 cggggggcgcagctcgtcctcctccttcggggggtggatggtgacgaggtcaggcagggg 250
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 753 cggggggcgcagctcgttctcctccttcggggggtggatggtgacgaggtcaggcagcgg 694

                                                                       
Query: 251 ggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatacc 310
            |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 693 agtggtagggccaagcttgcccttggggtcccagtcaagcataatcttcaccttgatacc 634

                    
Query: 311 aagaacgcc 319
           |||||||||
Sbjct: 633 aagaacgcc 625
to top
>gb|AF479033.1| Triticum aestivum 40S ribosomal protein mRNA, partial cds
          Length = 240

 Score =  252 bits (127), Expect = 6e-64
 Identities = 142/147 (96%)
 Strand = Plus / Minus

                                                                       
Query: 173 ttagacctcaatcaaagccggggggcgcagctcgtcctcctccttcggggggtggatggt 232
           ||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 240 ttagacctcaaccaaagccggtgggcgcagctcgtcctcctccttcggggggtggatggt 181

                                                                       
Query: 233 gacgaggtcaggcaggggggtggtagggccaagtttgcccttggggtcccagtcaagcat 292
           ||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 180 gacaaggtcaggcagcggggtggtagggccaagcttgcccttggggtcccagtcaagcat 121

                                      
Query: 293 aatcttcaccttgataccaagaacgcc 319
           |||||||||||||||||||||||||||
Sbjct: 120 aatcttcaccttgataccaagaacgcc 94
to top
>ref|XM_463024.1| Oryza sativa (japonica cultivar-group), OSJNBa0008D12.4 mRNA
          Length = 1112

 Score =  117 bits (59), Expect = 2e-23
 Identities = 110/127 (86%)
 Strand = Plus / Minus

                                                                       
Query: 190 ccggggggcgcagctcgtcctcctccttcggggggtggatggtgacgaggtcaggcaggg 249
           |||| ||||||||||| ||||||||||| || |  |||||||| || || || ||||| |
Sbjct: 780 ccggagggcgcagctcctcctcctccttgggagcatggatggttacaagatccggcagag 721

                                                                       
Query: 250 gggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatac 309
           ||||||| |||||||  |||||||||||||||||||| ||||| |||||||||||||| |
Sbjct: 720 gggtggtcgggccaaccttgcccttggggtcccagtcgagcatgatcttcaccttgatgc 661

                  
Query: 310 caagaac 316
           |||||||
Sbjct: 660 caagaac 654
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  117 bits (59), Expect = 2e-23
 Identities = 110/127 (86%)
 Strand = Plus / Plus

                                                                            
Query: 190      ccggggggcgcagctcgtcctcctccttcggggggtggatggtgacgaggtcaggcaggg 249
                |||| ||||||||||| ||||||||||| || |  |||||||| || || || ||||| |
Sbjct: 20905760 ccggagggcgcagctcctcctcctccttgggagcatggatggttacaagatccggcagag 20905819

                                                                            
Query: 250      gggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatac 309
                ||||||| |||||||  |||||||||||||||||||| ||||| |||||||||||||| |
Sbjct: 20905820 gggtggtcgggccaaccttgcccttggggtcccagtcgagcatgatcttcaccttgatgc 20905879

                       
Query: 310      caagaac 316
                |||||||
Sbjct: 20905880 caagaac 20905886
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  117 bits (59), Expect = 2e-23
 Identities = 110/127 (86%)
 Strand = Plus / Plus

                                                                            
Query: 190      ccggggggcgcagctcgtcctcctccttcggggggtggatggtgacgaggtcaggcaggg 249
                |||| ||||||||||| ||||||||||| || |  |||||||| || || || ||||| |
Sbjct: 20898789 ccggagggcgcagctcctcctcctccttgggagcatggatggttacaagatccggcagag 20898848

                                                                            
Query: 250      gggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatac 309
                ||||||| |||||||  |||||||||||||||||||| ||||| |||||||||||||| |
Sbjct: 20898849 gggtggtcgggccaaccttgcccttggggtcccagtcgagcatgatcttcaccttgatgc 20898908

                       
Query: 310      caagaac 316
                |||||||
Sbjct: 20898909 caagaac 20898915
to top
>gb|AC146468.1| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0008D12
             map MAP_LOC, complete sequence
          Length = 167323

 Score =  117 bits (59), Expect = 2e-23
 Identities = 110/127 (86%)
 Strand = Plus / Minus

                                                                         
Query: 190   ccggggggcgcagctcgtcctcctccttcggggggtggatggtgacgaggtcaggcaggg 249
             |||| ||||||||||| ||||||||||| || |  |||||||| || || || ||||| |
Sbjct: 17163 ccggagggcgcagctcctcctcctccttgggagcatggatggttacaagatccggcagag 17104

                                                                         
Query: 250   gggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatac 309
             ||||||| |||||||  |||||||||||||||||||| ||||| |||||||||||||| |
Sbjct: 17103 gggtggtcgggccaaccttgcccttggggtcccagtcgagcatgatcttcaccttgatgc 17044

                    
Query: 310   caagaac 316
             |||||||
Sbjct: 17043 caagaac 17037
to top
>dbj|AK099146.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023061B16, full
           insert sequence
          Length = 1054

 Score =  117 bits (59), Expect = 2e-23
 Identities = 110/127 (86%)
 Strand = Plus / Minus

                                                                       
Query: 190 ccggggggcgcagctcgtcctcctccttcggggggtggatggtgacgaggtcaggcaggg 249
           |||| ||||||||||| ||||||||||| || |  |||||||| || || || ||||| |
Sbjct: 790 ccggagggcgcagctcctcctcctccttgggagcatggatggttacaagatccggcagag 731

                                                                       
Query: 250 gggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatac 309
           ||||||| |||||||  |||||||||||||||||||| ||||| |||||||||||||| |
Sbjct: 730 gggtggtcgggccaaccttgcccttggggtcccagtcgagcatgatcttcaccttgatgc 671

                  
Query: 310 caagaac 316
           |||||||
Sbjct: 670 caagaac 664
to top
>dbj|AK061051.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-G04, full
           insert sequence
          Length = 1084

 Score =  117 bits (59), Expect = 2e-23
 Identities = 110/127 (86%)
 Strand = Plus / Minus

                                                                       
Query: 190 ccggggggcgcagctcgtcctcctccttcggggggtggatggtgacgaggtcaggcaggg 249
           |||| ||||||||||| ||||||||||| || |  |||||||| || || || ||||| |
Sbjct: 792 ccggagggcgcagctcctcctcctccttgggagcatggatggttacaagatccggcagag 733

                                                                       
Query: 250 gggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatac 309
           ||||||| |||||||  |||||||||||||||||||| ||||| |||||||||||||| |
Sbjct: 732 gggtggtcgggccaaccttgcccttggggtcccagtcgagcatgatcttcaccttgatgc 673

                  
Query: 310 caagaac 316
           |||||||
Sbjct: 672 caagaac 666
to top
>gb|AY107461.1| Zea mays PCO108959 mRNA sequence
          Length = 794

 Score =  117 bits (59), Expect = 2e-23
 Identities = 110/127 (86%)
 Strand = Plus / Minus

                                                                       
Query: 190 ccggggggcgcagctcgtcctcctccttcggggggtggatggtgacgaggtcaggcaggg 249
           |||| |||||| |||||||||| |||||||||| ||||||||| || ||||| || || |
Sbjct: 478 ccggagggcgcggctcgtcctcgtccttcggggtgtggatggtcaccaggtccggaagag 419

                                                                       
Query: 250 gggtggtagggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgatac 309
           | ||| | |||||||  |||||||| ||||||||||||||||| ||||||||||||||||
Sbjct: 418 gagtgatcgggccaaccttgcccttcgggtcccagtcaagcatgatcttcaccttgatac 359

                  
Query: 310 caagaac 316
           | |||||
Sbjct: 358 cgagaac 352
to top
>ref|NM_122944.2| Arabidopsis thaliana structural constituent of ribosome AT5G35530
           mRNA, complete cds
          Length = 1028

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 47/49 (95%)
 Strand = Plus / Minus

                                                            
Query: 265 gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaag 313
           |||||||||||||||||||||||||||| ||||||||||||| ||||||
Sbjct: 657 gtttgcccttggggtcccagtcaagcatgatcttcaccttgagaccaag 609
to top
>gb|AY098949.1| Arabidopsis thaliana AT5g35530/MOK9_14 mRNA, complete cds
          Length = 747

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 47/49 (95%)
 Strand = Plus / Minus

                                                            
Query: 265 gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaag 313
           |||||||||||||||||||||||||||| ||||||||||||| ||||||
Sbjct: 592 gtttgcccttggggtcccagtcaagcatgatcttcaccttgagaccaag 544
to top
>gb|AY058057.1| Arabidopsis thaliana AT5g35530/MOK9_14 mRNA, complete cds
          Length = 955

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 47/49 (95%)
 Strand = Plus / Minus

                                                            
Query: 265 gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaag 313
           |||||||||||||||||||||||||||| ||||||||||||| ||||||
Sbjct: 656 gtttgcccttggggtcccagtcaagcatgatcttcaccttgagaccaag 608
to top
>gb|AY084320.1| Arabidopsis thaliana clone 10394 mRNA, complete sequence
          Length = 985

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 47/49 (95%)
 Strand = Plus / Minus

                                                            
Query: 265 gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaag 313
           |||||||||||||||||||||||||||| ||||||||||||| ||||||
Sbjct: 657 gtttgcccttggggtcccagtcaagcatgatcttcaccttgagaccaag 609
to top
>dbj|AB015477.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOK9
          Length = 87459

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 47/49 (95%)
 Strand = Plus / Plus

                                                              
Query: 265   gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaag 313
             |||||||||||||||||||||||||||| ||||||||||||| ||||||
Sbjct: 49326 gtttgcccttggggtcccagtcaagcatgatcttcaccttgagaccaag 49374
to top
>dbj|AB091077.1| Zinnia elegans ZeRPS3 mRNA for putative ribosomal protein S3,
           partial cds
          Length = 509

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                      
Query: 258 gggccaagtttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaac 316
           ||||||||||||||  | ||||||||||||||||| ||||| |||||||||||||||||
Sbjct: 172 gggccaagtttgccagtcgggtcccagtcaagcatgatcttaaccttgataccaagaac 114
to top
>emb|BX831845.1|CNS0A14G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH33ZB11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 972

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 265 gtttgcccttggggtcccagtcaagcataatcttcaccttga 306
           ||||||||||||||||||||| |||||| |||||||||||||
Sbjct: 642 gtttgcccttggggtcccagtaaagcatgatcttcaccttga 601
to top
>gb|AY106013.1| Zea mays PCO066457 mRNA sequence
          Length = 819

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 267 ttgcccttggggtcccagtcaagcataatcttcaccttgataccaag 313
           |||||||| || |||||||| ||||||||||| ||||||||||||||
Sbjct: 643 ttgccctttggatcccagtccagcataatcttaaccttgataccaag 597
to top
>dbj|AP004944.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT43B20, TM0117a,
             complete sequence
          Length = 33359

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                                
Query: 279   tcccagtcaagcataatcttcaccttgataccaag 313
             |||||||||||||||||||| ||||||||||||||
Sbjct: 28359 tcccagtcaagcataatcttaaccttgataccaag 28393
to top
>ref|NM_128718.3| Arabidopsis thaliana structural constituent of ribosome AT2G31610
           mRNA, complete cds
          Length = 1077

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 266 tttgcccttggggtcccagtcaagcataatcttcaccttgat 307
           ||||||| | ||||||||||||||||| ||||||||||||||
Sbjct: 662 tttgcccgtagggtcccagtcaagcatgatcttcaccttgat 621
to top
>gb|AY091208.1| Arabidopsis thaliana putative 40S ribosomal protein (At2g31610)
           mRNA, complete cds
          Length = 784

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 266 tttgcccttggggtcccagtcaagcataatcttcaccttgat 307
           ||||||| | ||||||||||||||||| ||||||||||||||
Sbjct: 591 tttgcccgtagggtcccagtcaagcatgatcttcaccttgat 550
to top
>gb|AY046041.1| Arabidopsis thaliana putative 40S ribosomal protein; contains
           C-terminal domain (At2g31610) mRNA, complete cds
          Length = 987

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 266 tttgcccttggggtcccagtcaagcataatcttcaccttgat 307
           ||||||| | ||||||||||||||||| ||||||||||||||
Sbjct: 662 tttgcccgtagggtcccagtcaagcatgatcttcaccttgat 621
to top
>gb|AC007071.7| Arabidopsis thaliana chromosome 2 clone T9H9 map nga361, complete
             sequence
          Length = 79734

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                       
Query: 266   tttgcccttggggtcccagtcaagcataatcttcaccttgat 307
             ||||||| | ||||||||||||||||| ||||||||||||||
Sbjct: 40251 tttgcccgtagggtcccagtcaagcatgatcttcaccttgat 40210
to top
>gb|AY081517.1| Arabidopsis thaliana 40S ribosomal protein; contains C-terminal
           domain (At2g31610) mRNA, complete cds
          Length = 863

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 266 tttgcccttggggtcccagtcaagcataatcttcaccttgat 307
           ||||||| | ||||||||||||||||| ||||||||||||||
Sbjct: 591 tttgcccgtagggtcccagtcaagcatgatcttcaccttgat 550
to top
>gb|AY054622.1| Arabidopsis thaliana 40S ribosomal protein (At2g31610; T9H9.13)
           mRNA, complete cds
          Length = 992

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 266 tttgcccttggggtcccagtcaagcataatcttcaccttgat 307
           ||||||| | ||||||||||||||||| ||||||||||||||
Sbjct: 662 tttgcccgtagggtcccagtcaagcatgatcttcaccttgat 621
to top
>gb|AY052749.1| Arabidopsis thaliana At2g31610/T9H9.13 mRNA, complete cds
          Length = 753

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 266 tttgcccttggggtcccagtcaagcataatcttcaccttgat 307
           ||||||| | ||||||||||||||||| ||||||||||||||
Sbjct: 591 tttgcccgtagggtcccagtcaagcatgatcttcaccttgat 550
to top
>gb|AF378887.1|AF378887 Arabidopsis thaliana At2g31610/T9H9.13 mRNA, complete cds
          Length = 956

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 266 tttgcccttggggtcccagtcaagcataatcttcaccttgat 307
           ||||||| | ||||||||||||||||| ||||||||||||||
Sbjct: 662 tttgcccgtagggtcccagtcaagcatgatcttcaccttgat 621
to top
>emb|BX819975.1|CNS0A8H0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS55ZF11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1056

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 266 tttgcccttggggtcccagtcaagcataatcttcaccttgat 307
           ||||||| | ||||||||||||||||| ||||||||||||||
Sbjct: 640 tttgcccgtagggtcccagtcaagcatgatcttcaccttgat 599
to top
>ref|NM_115247.2| Arabidopsis thaliana nucleic acid binding / structural constituent
           of ribosome AT3G53870 mRNA, complete cds
          Length = 976

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 268 tgcccttggggtcccagtcaagcataatcttcaccttgat 307
           ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 642 tgcccttagggtcccaatcaagcataaccttcaccttgat 603
to top
>gb|AY059090.1| Arabidopsis thaliana putative ribosomal protein S3a homolog
           (At3g53870) mRNA, complete cds
          Length = 781

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 268 tgcccttggggtcccagtcaagcataatcttcaccttgat 307
           ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 589 tgcccttagggtcccaatcaagcataaccttcaccttgat 550
to top
>gb|AY035022.1| Arabidopsis thaliana putative ribosomal protein S3a homolog
           (At3g53870) mRNA, complete cds
          Length = 957

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 268 tgcccttggggtcccagtcaagcataatcttcaccttgat 307
           ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 642 tgcccttagggtcccaatcaagcataaccttcaccttgat 603
to top
>emb|AL132960.2|ATF5K20 Arabidopsis thaliana DNA chromosome 3, BAC clone F5K20
          Length = 119407

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                     
Query: 268   tgcccttggggtcccagtcaagcataatcttcaccttgat 307
             ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 55130 tgcccttagggtcccaatcaagcataaccttcaccttgat 55091
to top
>gb|AF428405.1|AF428405 Arabidopsis thaliana AT3g53870/F5K20_170 mRNA, complete cds
          Length = 926

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 268 tgcccttggggtcccagtcaagcataatcttcaccttgat 307
           ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 642 tgcccttagggtcccaatcaagcataaccttcaccttgat 603
to top
>emb|BX824880.1|CNS0A5OP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH7ZC06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 883

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 268 tgcccttggggtcccagtcaagcataatcttcaccttgat 307
           ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 622 tgcccttagggtcccaatcaagcataaccttcaccttgat 583
to top
>emb|BX823126.1|CNS0A5V8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB91ZH06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 907

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 268 tgcccttggggtcccagtcaagcataatcttcaccttgat 307
           ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 625 tgcccttagggtcccaatcaagcataaccttcaccttgat 586
to top
>gb|AY088808.1| Arabidopsis thaliana clone 9568 mRNA, complete sequence
          Length = 970

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 268 tgcccttggggtcccagtcaagcataatcttcaccttgat 307
           ||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 643 tgcccttagggtcccaatcaagcataaccttcaccttgat 604
to top
>emb|BX820098.1|CNS0A8HS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS73ZG08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1228

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 277 ggtcccagtcaagcataatcttcaccttgat 307
           |||||||||||||||| ||||||||||||||
Sbjct: 916 ggtcccagtcaagcatgatcttcaccttgat 886
to top
>gb|DQ294256.1| Solanum tuberosum clone 084G12 40S ribosomal protein-like protein
           mRNA, complete cds
          Length = 968

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 265 gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgcc 319
           |||| ||||| || |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 631 gtttacccttaggatcccagtcaagcatgatcttgactttgataccaagcacgcc 577
to top
>gb|DQ241842.1| Solanum tuberosum clone 182H03 unknown mRNA
          Length = 938

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 265 gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaagaacgcc 319
           |||| ||||| || |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 628 gtttacccttaggatcccagtcaagcatgatcttgactttgataccaagcacgcc 574
to top
>gb|BT012908.1| Lycopersicon esculentum clone 114026F, mRNA sequence
          Length = 999

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 265 gtttgcccttggggtcccagtcaagcataatcttcaccttgataccaag 313
           |||| ||||| || |||||||||||||| ||||| || |||||||||||
Sbjct: 678 gtttacccttaggatcccagtcaagcatgatcttgactttgataccaag 630
to top
>ref|XM_479106.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 926

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 267 ttgcccttggggtcccagtcaagcataatcttcaccttgatacc 310
           |||||||| || ||||| |||||||||||||| ||||| |||||
Sbjct: 678 ttgcccttcggatcccaatcaagcataatcttgaccttaatacc 635
to top
>gb|AC079038.3|AC079038 Oryza sativa chromosome 7 clone OSJNBb0024A20, complete sequence
          Length = 129838

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                          
Query: 267    ttgcccttggggtcccagtcaagcataatcttcaccttgatacc 310
              |||||||| || ||||| |||||||||||||| ||||| |||||
Sbjct: 122878 ttgcccttcggatcccaatcaagcataatcttgaccttaatacc 122835
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                            
Query: 267      ttgcccttggggtcccagtcaagcataatcttcaccttgatacc 310
                |||||||| || ||||| |||||||||||||| ||||| |||||
Sbjct: 24966275 ttgcccttcggatcccaatcaagcataatcttgaccttaatacc 24966318
to top
>dbj|AP006458.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OSJNBa0072I06
          Length = 162411

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                          
Query: 267    ttgcccttggggtcccagtcaagcataatcttcaccttgatacc 310
              |||||||| || ||||| |||||||||||||| ||||| |||||
Sbjct: 149907 ttgcccttcggatcccaatcaagcataatcttgaccttaatacc 149950
to top
>dbj|AP005895.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
            clone:OSJNBb0018L13
          Length = 131155

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 267  ttgcccttggggtcccagtcaagcataatcttcaccttgatacc 310
            |||||||| || ||||| |||||||||||||| ||||| |||||
Sbjct: 6955 ttgcccttcggatcccaatcaagcataatcttgaccttaatacc 6998
to top
>dbj|AK066905.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013092O21, full
           insert sequence
          Length = 926

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 267 ttgcccttggggtcccagtcaagcataatcttcaccttgatacc 310
           |||||||| || ||||| |||||||||||||| ||||| |||||
Sbjct: 678 ttgcccttcggatcccaatcaagcataatcttgaccttaatacc 635
to top
>ref|XM_754010.1| Ustilago maydis 521 hypothetical protein (UM02956.1) partial mRNA
          Length = 720

 Score = 44.1 bits (22), Expect = 0.27
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 275 ggggtcccagtcaagcataatcttcaccttgataccaagaac 316
           |||||||||| |  |||| ||||| |||||||||||||||||
Sbjct: 552 ggggtcccagccctgcatgatcttgaccttgataccaagaac 511
to top
>gb|AF402810.1| Ictalurus punctatus 40S ribosomal protein S3 mRNA, complete cds
          Length = 799

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 274 tggggtcccagtcaagcataatcttcaccttgatacc 310
           |||||||||||  |||||| ||||| |||||||||||
Sbjct: 588 tggggtcccagggaagcatgatcttaaccttgatacc 552
to top
>dbj|D38596.1|RICRPS3A Oryza sativa mRNA, partial  homologous to ribosomal protein S3
           coding sequence
          Length = 368

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 271 ccttggggtcccagtcaagcataatcttc 299
           |||||||||||||||| ||||| ||||||
Sbjct: 346 ccttggggtcccagtcgagcatgatcttc 318
to top
>gb|DQ206605.1| Monosiga brevicollis isolate TOA26 ribosomal protein 3 small
           subunit mRNA, partial cds
          Length = 572

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 288 agcataatcttcaccttgataccaa 312
           ||||||||||| |||||||||||||
Sbjct: 488 agcataatcttgaccttgataccaa 464
to top
>gb|AY394937.1| Danio rerio clone RK045A1H03 ribosomal protein S3 mRNA, complete
           cds
          Length = 821

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 274 tggggtcccagtcaagcataatcttcaccttgataccaag 313
           |||| ||||||  |||||| |||||||||||||| |||||
Sbjct: 584 tgggatcccagggaagcatgatcttcaccttgattccaag 545
to top
>ref|XM_593742.2| PREDICTED: Bos taurus similar to serologically defined colon cancer
            antigen 33 like (LOC515677), partial mRNA
          Length = 3176

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 200  cagctcgtcctcctccttcggggg 223
            ||||| ||||||||||||||||||
Sbjct: 1934 cagcttgtcctcctccttcggggg 1911
to top
>ref|XM_745219.1| Aspergillus fumigatus Af293 40s ribosomal protein S3 (Afu1g05630)
           partial mRNA
          Length = 801

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 289 gcataatcttcaccttgataccaagaac 316
           |||| ||||| |||||||||||||||||
Sbjct: 577 gcatgatcttgaccttgataccaagaac 550
to top
>gb|AC093458.6| Homo sapiens BAC clone RP11-445N20 from 7, complete sequence
          Length = 16677

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 220   gggggtggatggtgacgaggtcag 243
             |||||||||||||| |||||||||
Sbjct: 12587 gggggtggatggtgccgaggtcag 12610
to top
>ref|XM_784326.1| PREDICTED: Strongylocentrotus purpuratus similar to cytosolic
           sialic acid 9-O-acetylesterase homolog (LOC584468),
           partial mRNA
          Length = 1182

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 288 agcataatcttcaccttgatacca 311
           ||||| ||||||||||||||||||
Sbjct: 714 agcattatcttcaccttgatacca 691
to top
>gb|AC134516.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone OJA1208D02,
             complete sequence
          Length = 131922

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 112   aggaaacaagctaggaccaa 131
             ||||||||||||||||||||
Sbjct: 85738 aggaaacaagctaggaccaa 85719
to top
>ref|XM_788097.1| PREDICTED: Strongylocentrotus purpuratus similar to Sialate
           O-acetylesterase precursor (Sialic acid-specific
           9-O-acetylesterase) (Yolk sac protein 2) (LOC588411),
           mRNA
          Length = 1101

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 288 agcataatcttcaccttgatacca 311
           ||||| ||||||||||||||||||
Sbjct: 354 agcattatcttcaccttgatacca 331
to top
>emb|BX842627.1| Neurospora crassa DNA linkage group I BAC clone B8J22
          Length = 75335

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 110  ataggaaacaagctaggacc 129
            ||||||||||||||||||||
Sbjct: 7696 ataggaaacaagctaggacc 7677
to top
>gb|AC116926.1| Genomic sequence for Oryza sativa (japonica cultivar-group) cultivar
             Nipponbare clone OJ1341F06, from chromosome 10, complete
             sequence
          Length = 102520

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 112   aggaaacaagctaggaccaa 131
             ||||||||||||||||||||
Sbjct: 88705 aggaaacaagctaggaccaa 88724
to top
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 112      aggaaacaagctaggaccaa 131
                ||||||||||||||||||||
Sbjct: 11277750 aggaaacaagctaggaccaa 11277731
to top
>ref|NM_201153.1| Danio rerio ribosomal protein S3 (rps3), mRNA
          Length = 850

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 274 tggggtcccagtcaagcataatcttcaccttgataccaag 313
           |||| ||||||  |||||| |||||||||||||| |||||
Sbjct: 610 tgggatcccagggaagcatgatcttcaccttgattccaag 571
to top
>emb|CR555302.7| Zebrafish DNA sequence from clone CH211-212C19 in linkage group 10,
              complete sequence
          Length = 202469

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 21     attaaaatggcagcataaca 40
              ||||||||||||||||||||
Sbjct: 151367 attaaaatggcagcataaca 151386
to top
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 112      aggaaacaagctaggaccaa 131
                ||||||||||||||||||||
Sbjct: 11284190 aggaaacaagctaggaccaa 11284171
to top
>emb|AL928672.14| Zebrafish DNA sequence from clone CH211-136O4, complete sequence
          Length = 187939

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 21    attaaaatggcagcataaca 40
             ||||||||||||||||||||
Sbjct: 56077 attaaaatggcagcataaca 56096
to top
>gb|BC045902.1| Danio rerio ribosomal protein S3, mRNA (cDNA clone MGC:56088
           IMAGE:5410588), complete cds
          Length = 850

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 274 tggggtcccagtcaagcataatcttcaccttgataccaag 313
           |||| ||||||  |||||| |||||||||||||| |||||
Sbjct: 610 tgggatcccagggaagcatgatcttcaccttgattccaag 571


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,410,836
Number of Sequences: 3902068
Number of extensions: 2410836
Number of successful extensions: 43089
Number of sequences better than 10.0: 64
Number of HSP's better than 10.0 without gapping: 64
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 42931
Number of HSP's gapped (non-prelim): 157
length of query: 319
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 297
effective length of database: 17,147,199,772
effective search space: 5092718332284
effective search space used: 5092718332284
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top