| Clone Name | rbags23o05 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | gb|CP000089.1| Dechloromonas aromatica RCB, complete genome | 40 | 1.7 | 2 | gb|AC153599.6| Mus musculus 6 BAC RP23-227G6 (Roswell Park Cance... | 38 | 6.9 |
|---|
>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome Length = 4501104 Score = 40.1 bits (20), Expect = 1.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 51 ttcaatgccaatgatcagaccgtt 74 ||||||||||||| |||||||||| Sbjct: 2170655 ttcaatgccaatggtcagaccgtt 2170678
>gb|AC153599.6| Mus musculus 6 BAC RP23-227G6 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 203926 Score = 38.2 bits (19), Expect = 6.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 49 tattcaatgccaatgatca 67 ||||||||||||||||||| Sbjct: 185825 tattcaatgccaatgatca 185807 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 516,394 Number of Sequences: 3902068 Number of extensions: 516394 Number of successful extensions: 24773 Number of sequences better than 10.0: 2 Number of HSP's better than 10.0 without gapping: 2 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 24768 Number of HSP's gapped (non-prelim): 5 length of query: 144 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 123 effective length of database: 17,151,101,840 effective search space: 2109585526320 effective search space used: 2109585526320 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)