ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags23k12
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AK071368.1| Oryza sativa (japonica cultivar-group) cDNA clon... 246 8e-62
2gb|AY104441.1| Zea mays PCO109208 mRNA sequence 226 7e-56
3gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 139 1e-29
4gb|AC090484.4| Genomic sequence for Oryza sativa, Nipponbare str... 139 1e-29
5dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 139 1e-29
6emb|AL357566.12| Human DNA sequence from clone RP11-513B7 on chr... 46 0.15
7gb|AC097457.2| Homo sapiens BAC clone RP11-3J1 from 4, complete ... 44 0.58
8gb|CP000020.1| Vibrio fischeri ES114 chromosome I, complete sequ... 44 0.58
9gb|AC108401.19| Mus musculus chromosome 12, clone RP24-98A23, co... 42 2.3
10gb|AC122832.4| Mus musculus BAC clone RP23-179D3 from 12, comple... 42 2.3
11emb|BX294188.11| Zebrafish DNA sequence from clone DKEY-255G14, ... 42 2.3
12gb|AC117535.2| Homo sapiens chromosome 5 clone RP11-937M12, comp... 42 2.3
13gb|AC113401.2| Homo sapiens chromosome 5 clone RP11-454E20, comp... 42 2.3
14gb|AC020616.7| Mus musculus strain C57BL/6J clone RP23-3A24, com... 42 2.3
15gb|AC120983.6| Oryza sativa chromosome 3 BAC OSJNBb0011H13 genom... 42 2.3
16gb|AC009469.4| Homo sapiens BAC clone RP11-20N16 from 2, complet... 42 2.3
17emb|AL845426.9| Mouse DNA sequence from clone RP23-289M11 on chr... 42 2.3
18ref|XM_630227.1| Dictyostelium discoideum hypothetical protein (... 40 9.1
19gb|AC154528.2| Mus musculus BAC clone RP23-460I18 from chromosom... 40 9.1
20ref|XM_646862.1| Entamoeba histolytica HM-1:IMSS hypothetical pr... 40 9.1
21gb|AY887091.1| HIV-1 isolate M12653 from Rwanda gag protein gene... 40 9.1
22emb|AL162388.8| Human DNA sequence from clone RP11-373A6 on chro... 40 9.1
23emb|Z97335.2|ATFCA0 Arabidopsis thaliana DNA chromosome 4, ESSA ... 40 9.1
24emb|AL161538.2|ATCHRIV38 Arabidopsis thaliana DNA chromosome 4, ... 40 9.1
25emb|AJ437053.1|HIM437053 Human immunodeficiency virus type 1 mRN... 40 9.1
26emb|AJ437052.1|HIM437052 Human immunodeficiency virus type 1 mRN... 40 9.1
27emb|AJ437051.1|HIM437051 Human immunodeficiency virus type 1 mRN... 40 9.1
28emb|AJ437050.1|HIM437050 Human immunodeficiency virus type 1 mRN... 40 9.1
29emb|AJ437049.1|HIM437049 Human immunodeficiency virus type 1 mRN... 40 9.1
30emb|AJ437048.1|HIM437048 Human immunodeficiency virus type 1 mRN... 40 9.1
31gb|AC027449.6| Homo sapiens chromosome 18, clone RP11-535A5, com... 40 9.1
32gb|AC009368.8| Drosophila melanogaster 3L BAC RP98-4F7 (Roswell ... 40 9.1
33gb|AC099666.2| Homo sapiens chromosome 3 clone RP11-215K24, comp... 40 9.1
34dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005 40 9.1
35gb|DQ404455.1| Metschnikowia sp. ST-96 26S ribosomal RNA gene, p... 40 9.1
36emb|BX321868.13| Zebrafish DNA sequence from clone RP71-41I21, c... 40 9.1
37gb|AF409870.1|AF409870 HIV-1 isolate NA21LU09c from United Kingd... 40 9.1
38gb|AF409869.1|AF409869 HIV-1 isolate NA21LU10c from United Kingd... 40 9.1
39gb|AF409868.1|AF409868 HIV-1 isolate NA21LU08c from United Kingd... 40 9.1
40gb|AF409867.1|AF409867 HIV-1 isolate NA21LU07c from United Kingd... 40 9.1
41gb|AF409866.1|AF409866 HIV-1 isolate NA21LU06c from United Kingd... 40 9.1
42gb|AF409864.1|AF409864 HIV-1 isolate NA21LU04c from United Kingd... 40 9.1
43gb|AF409863.1|AF409863 HIV-1 isolate NA21LU03c from United Kingd... 40 9.1
44gb|AF409862.1|AF409862 HIV-1 isolate NA21LU02c from United Kingd... 40 9.1
45gb|AF409861.1|AF409861 HIV-1 isolate NA21LU01c from United Kingd... 40 9.1
46gb|AF409860.1|AF409860 HIV-1 isolate NA21LN11c from United Kingd... 40 9.1
47gb|AF409859.1|AF409859 HIV-1 isolate NA21LN10c from United Kingd... 40 9.1
48gb|AF409858.1|AF409858 HIV-1 isolate NA21LN09c from United Kingd... 40 9.1
49gb|AF409857.1|AF409857 HIV-1 isolate NA21LN08c from United Kingd... 40 9.1
50gb|AF409856.1|AF409856 HIV-1 isolate NA21LN07c from United Kingd... 40 9.1
51gb|AF409855.1|AF409855 HIV-1 isolate NA21LN06c from United Kingd... 40 9.1
52gb|AF409854.1|AF409854 HIV-1 isolate NA21LN05c from United Kingd... 40 9.1
53gb|AF409853.1|AF409853 HIV-1 isolate NA21LN04c from United Kingd... 40 9.1
54gb|AF409852.1|AF409852 HIV-1 isolate NA21LN03c from United Kingd... 40 9.1
55gb|AF409851.1|AF409851 HIV-1 isolate NA21LN02c from United Kingd... 40 9.1
56gb|AF409850.1|AF409850 HIV-1 isolate NA21LN01c from United Kingd... 40 9.1
57gb|AF409834.1|AF409834 HIV-1 isolate NA21CO05c from United Kingd... 40 9.1
58gb|AF409830.1|AF409830 HIV-1 isolate NA21CO01c from United Kingd... 40 9.1
59gb|AF409710.1|AF409710 HIV-1 isolate NA284LNG5 from United Kingd... 40 9.1
60gb|AF409709.1|AF409709 HIV-1 isolate NA284LNG4 from United Kingd... 40 9.1
61gb|AF409708.1|AF409708 HIV-1 isolate NA284LNG3 from United Kingd... 40 9.1
62dbj|AK051150.1| Mus musculus 12 days embryo spinal ganglion cDNA... 40 9.1
63gb|AF084741.1|AF084741 HIV-1 pair E, mother, clone 5 p17 matrix ... 40 9.1
64gb|AF281746.1|AF281746 HIV-1 isolate GV-h6 from USA nonfunctiona... 40 9.1
65gb|AF174882.1|AF174882 HIV-1 isolate LN2 patient NA021 from Unit... 40 9.1
66gb|AF174881.1|AF174881 HIV-1 isolate LN1 patient NA021 from Unit... 40 9.1
67gb|AF174870.1|AF174870 HIV-1 isolate LT patient NA021 from Unite... 40 9.1
68dbj|AK034669.1| Mus musculus 12 days embryo embryonic body betwe... 40 9.1
69gb|DQ308160.1| HIV-1 isolate 95DKAY9509CB09 from Denmark gag pro... 40 9.1
70dbj|AK043885.1| Mus musculus 10 days neonate cortex cDNA, RIKEN ... 40 9.1
71dbj|AK053150.1| Mus musculus 0 day neonate lung cDNA, RIKEN full... 40 9.1
72emb|BX004772.17| Zebrafish DNA sequence from clone DKEY-15L1 in ... 40 9.1
73ref|XM_624279.1| PREDICTED: Apis mellifera similar to von Hippel... 40 9.1
74gb|AF051026.1|AF051026 HIV-1 isolate child 3 clone BC3_5D.1 from... 40 9.1
75gb|AC157678.2| Xenopus tropicalis clone ISB1-130B13, complete se... 40 9.1
76gb|BC094331.1| Mus musculus cDNA clone IMAGE:6815606 40 9.1
77gb|AF212293.1| HIV-1 isolate 94RW13 from Rwanda gag protein (gag... 40 9.1
78gb|AF196686.1|AF196686 HIV-1 isolate 94RW13 from Rwanda, gag pro... 40 9.1
79dbj|AK173173.1| Mus musculus mRNA for mKIAA1439 protein 40 9.1
80emb|BX511028.13| Zebrafish DNA sequence from clone DKEY-161N17 i... 40 9.1
81gb|AY103235.1| HIV-1 clone TL-8 from Italy gag protein (gag) gen... 40 9.1
82gb|AY103234.1| HIV-1 clone TL-7 from Italy gag protein (gag) gen... 40 9.1
83gb|AY103233.1| HIV-1 clone TL-6 from Italy gag protein (gag) gen... 40 9.1
84gb|AY103232.1| HIV-1 clone TL-5 from Italy gag protein (gag) gen... 40 9.1
85gb|AY103231.1| HIV-1 clone TL-4 from Italy gag protein (gag) gen... 40 9.1
86gb|AY103230.1| HIV-1 clone TL-3 from Italy gag protein (gag) gen... 40 9.1
87gb|AY103229.1| HIV-1 clone TL-2 from Italy gag protein (gag) gen... 40 9.1
88gb|AY103227.1| HIV-1 clone TL-9 from Italy gag protein (gag) gen... 40 9.1
89emb|BX470120.5| Zebrafish DNA sequence from clone CH211-11I16 in... 40 9.1
90gb|AE003521.3| Drosophila melanogaster chromosome 3L, section 64... 40 9.1
91gb|AY786952.1| HIV-1 clone 1M-1005 from USA gag protein (gag) ge... 40 9.1
92dbj|AB034901.1| Human immunodeficiency virus type 1 subtype B ge... 40 9.1
93dbj|AB044066.1| Human immunodeficiency virus type 1 gene for gag... 40 9.1
94emb|AL670260.10| Mouse DNA sequence from clone RP23-1I17 on chro... 40 9.1 
>dbj|AK071368.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023092E16, full
           insert sequence
          Length = 1374

 Score =  246 bits (124), Expect = 8e-62
 Identities = 297/355 (83%)
 Strand = Plus / Minus

                                                                       
Query: 287 tgaatcctatatgatcatagagcctccgagctggcaagttatccttatgtacatgaatat 346
           |||||||||| ||||||||||||||||||||||| |  ||||||||||| ||||||||||
Sbjct: 981 tgaatcctatctgatcatagagcctccgagctggtagattatccttatgcacatgaatat 922

                                                                       
Query: 347 aaatactttcagcaccatcgagtcttgcggcatcaatggccaataacaacatgttgctgg 406
           |||    ||||||||||| ||||||||| ||||| ||||||| ||||||||| |||||||
Sbjct: 921 aaacttcttcagcaccattgagtcttgcagcatctatggccagtaacaacatattgctgg 862

                                                                       
Query: 407 caatcccttgacgccgtgcatacttagcaacacaaacgttggttaaatatccaaattttg 466
           | |||||||||||||||||||| |||||||||||||| || || | ||| ||||| ||||
Sbjct: 861 cgatcccttgacgccgtgcatatttagcaacacaaacatttgtcagatacccaaactttg 802

                                                                       
Query: 467 gctgatctggctgatagattctagagtaaaatggcatgtttccaggctccgngggatatg 526
           ||||||||||||| || |||||| | | |||||     |||||||||||||  ||| |||
Sbjct: 801 gctgatctggctggtatattctacaatgaaatgatgactttccaggctccgcaggaaatg 742

                                                                       
Query: 527 tctccccatatagaggatgcctgacacacagatctaccgtaccaacaacactattcagca 586
           |||||||||  ||||||||||| | ||| | ||| |  || ||||| || |||||||  |
Sbjct: 741 tctccccatgcagaggatgccttatacaaacatccagggtgccaacgacgctattcaaaa 682

                                                                  
Query: 587 cagtacgtgtaacgtcatcattctttaccgcaacaaaacatgtatacttctctcc 641
           |||| ||  | |  |||||||| |||||||||||||||||  |||||||||||||
Sbjct: 681 cagttcgcttgagatcatcattttttaccgcaacaaaacagatatacttctctcc 627
to top
>gb|AY104441.1| Zea mays PCO109208 mRNA sequence
          Length = 614

 Score =  226 bits (114), Expect = 7e-56
 Identities = 266/317 (83%)
 Strand = Plus / Minus

                                                                       
Query: 324 gttatccttatgtacatgaatataaatactttcagcaccatcgagtcttgcggcatcaat 383
           |||||| ||||| |||||||| |||||| |||||||||| |  ||| |||| ||||| ||
Sbjct: 614 gttatctttatgcacatgaatgtaaatattttcagcaccgttaagttttgcagcatctat 555

                                                                       
Query: 384 ggccaataacaacatgttgctggcaatcccttgacgccgtgcatacttagcaacacaaac 443
           ||||||||||| ||||||||| |||||||||||||||| |||||| ||||||||||| ||
Sbjct: 554 ggccaataacagcatgttgctagcaatcccttgacgccttgcatatttagcaacacatac 495

                                                                       
Query: 444 gttggttaaatatccaaattttggctgatctggctgatagattctagagtaaaatggcat 503
            || |||| ||| ||||||||||||||||| |||||||| |||| | ||| ||  | |  
Sbjct: 494 atttgttacatacccaaattttggctgatcaggctgataaattcgacagtgaagagacgg 435

                                                                       
Query: 504 gtttccaggctccgngggatatgtctccccatatagaggatgcctgacacacagatctac 563
            ||||||||||||   ||| || |||||||||||||||||||||| ||||| | ||||| 
Sbjct: 434 ttttccaggctcctcaggaaatttctccccatatagaggatgccttacacatacatctaa 375

                                                                       
Query: 564 cgtaccaacaacactattcagcacagtacgtgtaacgtcatcattctttaccgcaacaaa 623
            |||||||||||||||||||| ||||| ||  | | |||||| ||||||||||| |||| 
Sbjct: 374 ggtaccaacaacactattcaggacagttcgcctgatgtcatcgttctttaccgcgacaag 315

                            
Query: 624 acatgtatacttctctc 640
           |||  ||||||||||||
Sbjct: 314 acagatatacttctctc 298
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  139 bits (70), Expect = 1e-29
 Identities = 115/130 (88%)
 Strand = Plus / Minus

                                                                           
Query: 360     accatcgagtcttgcggcatcaatggccaataacaacatgttgctggcaatcccttgacg 419
               ||||| ||||||||| ||||| ||||||| ||||||||| |||||||| |||||||||||
Sbjct: 4066044 accattgagtcttgcagcatctatggccagtaacaacatattgctggcgatcccttgacg 4065985

                                                                           
Query: 420     ccgtgcatacttagcaacacaaacgttggttaaatatccaaattttggctgatctggctg 479
               ||||||||| |||||||||||||| || || | ||| ||||| |||||||||||||||||
Sbjct: 4065984 ccgtgcatatttagcaacacaaacatttgtcagatacccaaactttggctgatctggctg 4065925

                         
Query: 480     atagattcta 489
                || ||||||
Sbjct: 4065924 gtatattcta 4065915



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                           
Query: 287     tgaatcctatatgatcatagagcctccgagctggcaagttatccttatgtacatgaatat 346
               |||||||||| ||||||||||||||||||||||| |  ||||||||||| ||||||||||
Sbjct: 4066230 tgaatcctatctgatcatagagcctccgagctggtagattatccttatgcacatgaatat 4066171

                  
Query: 347     aaa 349
               |||
Sbjct: 4066170 aaa 4066168



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                             
Query: 612     taccgcaacaaaacatgtatacttctctcc 641
               |||||||||||||||  |||||||||||||
Sbjct: 4065366 taccgcaacaaaacagatatacttctctcc 4065337



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 32       gttacatatttccttgaaggc 52
                |||||||||||||||||||||
Sbjct: 29503378 gttacatatttccttgaaggc 29503358
to top
>gb|AC090484.4| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0061L19, from chromosome 3, complete sequence
          Length = 153322

 Score =  139 bits (70), Expect = 1e-29
 Identities = 115/130 (88%)
 Strand = Plus / Plus

                                                                         
Query: 360   accatcgagtcttgcggcatcaatggccaataacaacatgttgctggcaatcccttgacg 419
             ||||| ||||||||| ||||| ||||||| ||||||||| |||||||| |||||||||||
Sbjct: 33324 accattgagtcttgcagcatctatggccagtaacaacatattgctggcgatcccttgacg 33383

                                                                         
Query: 420   ccgtgcatacttagcaacacaaacgttggttaaatatccaaattttggctgatctggctg 479
             ||||||||| |||||||||||||| || || | ||| ||||| |||||||||||||||||
Sbjct: 33384 ccgtgcatatttagcaacacaaacatttgtcagatacccaaactttggctgatctggctg 33443

                       
Query: 480   atagattcta 489
              || ||||||
Sbjct: 33444 gtatattcta 33453



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 58/63 (92%)
 Strand = Plus / Plus

                                                                         
Query: 287   tgaatcctatatgatcatagagcctccgagctggcaagttatccttatgtacatgaatat 346
             |||||||||| ||||||||||||||||||||||| |  ||||||||||| ||||||||||
Sbjct: 33138 tgaatcctatctgatcatagagcctccgagctggtagattatccttatgcacatgaatat 33197

                
Query: 347   aaa 349
             |||
Sbjct: 33198 aaa 33200



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 612   taccgcaacaaaacatgtatacttctctcc 641
             |||||||||||||||  |||||||||||||
Sbjct: 34002 taccgcaacaaaacagatatacttctctcc 34031
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  139 bits (70), Expect = 1e-29
 Identities = 115/130 (88%)
 Strand = Plus / Minus

                                                                           
Query: 360     accatcgagtcttgcggcatcaatggccaataacaacatgttgctggcaatcccttgacg 419
               ||||| ||||||||| ||||| ||||||| ||||||||| |||||||| |||||||||||
Sbjct: 4066155 accattgagtcttgcagcatctatggccagtaacaacatattgctggcgatcccttgacg 4066096

                                                                           
Query: 420     ccgtgcatacttagcaacacaaacgttggttaaatatccaaattttggctgatctggctg 479
               ||||||||| |||||||||||||| || || | ||| ||||| |||||||||||||||||
Sbjct: 4066095 ccgtgcatatttagcaacacaaacatttgtcagatacccaaactttggctgatctggctg 4066036

                         
Query: 480     atagattcta 489
                || ||||||
Sbjct: 4066035 gtatattcta 4066026



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                           
Query: 287     tgaatcctatatgatcatagagcctccgagctggcaagttatccttatgtacatgaatat 346
               |||||||||| ||||||||||||||||||||||| |  ||||||||||| ||||||||||
Sbjct: 4066341 tgaatcctatctgatcatagagcctccgagctggtagattatccttatgcacatgaatat 4066282

                  
Query: 347     aaa 349
               |||
Sbjct: 4066281 aaa 4066279



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                             
Query: 612     taccgcaacaaaacatgtatacttctctcc 641
               |||||||||||||||  |||||||||||||
Sbjct: 4065477 taccgcaacaaaacagatatacttctctcc 4065448



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 32       gttacatatttccttgaaggc 52
                |||||||||||||||||||||
Sbjct: 29594800 gttacatatttccttgaaggc 29594780
to top
>emb|AL357566.12| Human DNA sequence from clone RP11-513B7 on chromosome 1, complete
            sequence
          Length = 61004

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 106  gtaacaaaaaatattgaagcatt 128
            |||||||||||||||||||||||
Sbjct: 5724 gtaacaaaaaatattgaagcatt 5702
to top
>gb|AC097457.2| Homo sapiens BAC clone RP11-3J1 from 4, complete sequence
          Length = 120836

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 196   aagtttttatcatgtgcaagat 217
             ||||||||||||||||||||||
Sbjct: 30692 aagtttttatcatgtgcaagat 30713
to top
>gb|CP000020.1| Vibrio fischeri ES114 chromosome I, complete sequence
          Length = 2906179

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 52      ctcacaagtaatgaacccagaa 73
               ||||||||||||||||||||||
Sbjct: 2505317 ctcacaagtaatgaacccagaa 2505296
to top
>gb|AC108401.19| Mus musculus chromosome 12, clone RP24-98A23, complete sequence
          Length = 213381

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 100    tgtacagtaacaaaaaatatt 120
              |||||||||||||||||||||
Sbjct: 196704 tgtacagtaacaaaaaatatt 196724
to top
>gb|AC122832.4| Mus musculus BAC clone RP23-179D3 from 12, complete sequence
          Length = 224056

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 100    tgtacagtaacaaaaaatatt 120
              |||||||||||||||||||||
Sbjct: 178353 tgtacagtaacaaaaaatatt 178333
to top
>emb|BX294188.11| Zebrafish DNA sequence from clone DKEY-255G14, complete sequence
          Length = 261943

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 332    tatgtacatgaatataaatac 352
              |||||||||||||||||||||
Sbjct: 109702 tatgtacatgaatataaatac 109682
to top
>gb|AC117535.2| Homo sapiens chromosome 5 clone RP11-937M12, complete sequence
          Length = 176581

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 331   ttatgtacatgaatataaata 351
             |||||||||||||||||||||
Sbjct: 19939 ttatgtacatgaatataaata 19919
to top
>gb|AC113401.2| Homo sapiens chromosome 5 clone RP11-454E20, complete sequence
          Length = 130491

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 331    ttatgtacatgaatataaata 351
              |||||||||||||||||||||
Sbjct: 100405 ttatgtacatgaatataaata 100385
to top
>gb|AC020616.7| Mus musculus strain C57BL/6J clone RP23-3A24, complete sequence
          Length = 191243

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 99     gtgtacagtaacaaaaaatat 119
              |||||||||||||||||||||
Sbjct: 134413 gtgtacagtaacaaaaaatat 134433
to top
>gb|AC120983.6| Oryza sativa chromosome 3 BAC OSJNBb0011H13 genomic sequence, complete
             sequence
          Length = 132782

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 32    gttacatatttccttgaaggc 52
             |||||||||||||||||||||
Sbjct: 26008 gttacatatttccttgaaggc 25988
to top
>gb|AC009469.4| Homo sapiens BAC clone RP11-20N16 from 2, complete sequence
          Length = 168448

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    agaaccatcagatggggttgc 90
             |||||||||||||||||||||
Sbjct: 81276 agaaccatcagatggggttgc 81256
to top
>emb|AL845426.9| Mouse DNA sequence from clone RP23-289M11 on chromosome 2, complete
             sequence
          Length = 181434

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 99    gtgtacagtaacaaaaaatat 119
             |||||||||||||||||||||
Sbjct: 64462 gtgtacagtaacaaaaaatat 64482
to top
>ref|XM_630227.1| Dictyostelium discoideum hypothetical protein (DDB0183999), partial
           mRNA
          Length = 2085

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 183 ttttgaactttacaagtttt 202
           ||||||||||||||||||||
Sbjct: 674 ttttgaactttacaagtttt 655
to top
>gb|AC154528.2| Mus musculus BAC clone RP23-460I18 from chromosome 14, complete sequence
          Length = 207430

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 208    tgtgcaagatagtaaaatgt 227
              ||||||||||||||||||||
Sbjct: 118983 tgtgcaagatagtaaaatgt 119002
to top
>ref|XM_646862.1| Entamoeba histolytica HM-1:IMSS hypothetical protein (139.t00019)
           partial mRNA
          Length = 1560

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 107 taacaaaaaatattgaagca 126
           ||||||||||||||||||||
Sbjct: 17  taacaaaaaatattgaagca 36
to top
>gb|AY887091.1| HIV-1 isolate M12653 from Rwanda gag protein gene, partial cds
          Length = 1505

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 396 aattttggctgatctggctg 377
to top
>emb|AL162388.8| Human DNA sequence from clone RP11-373A6 on chromosome 9 Contains a NHP2
              non-histone chromosome protein 2-like 1 (S. cerevisiae)
              (NHP2L1) pseudogene and 2 CpG islands, complete sequence
          Length = 173881

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 186    tgaactttacaagtttttatcatg 209
              |||||||||| |||||||||||||
Sbjct: 119315 tgaactttaccagtttttatcatg 119338
to top
>emb|Z97335.2|ATFCA0 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 0
          Length = 200576

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 183   ttttgaactttacaagtttt 202
             ||||||||||||||||||||
Sbjct: 75575 ttttgaactttacaagtttt 75556
to top
>emb|AL161538.2|ATCHRIV38 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 38
          Length = 198944

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 183   ttttgaactttacaagtttt 202
             ||||||||||||||||||||
Sbjct: 15123 ttttgaactttacaagtttt 15104
to top
>emb|AJ437053.1|HIM437053 Human immunodeficiency virus type 1 mRNA for gag polyprotein (gag
           gene), clone g28s3
          Length = 1530

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 409 aattttggctgatctggctg 390
to top
>emb|AJ437052.1|HIM437052 Human immunodeficiency virus type 1 mRNA for gag polyprotein (gag
           gene), clone g28s2
          Length = 1530

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 409 aattttggctgatctggctg 390
to top
>emb|AJ437051.1|HIM437051 Human immunodeficiency virus type 1 mRNA for gag polyprotein (gag
           gene), clone g28s1
          Length = 1530

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 409 aattttggctgatctggctg 390
to top
>emb|AJ437050.1|HIM437050 Human immunodeficiency virus type 1 mRNA for gag polyprotein (gag
           gene), clone g27s3
          Length = 1512

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 409 aattttggctgatctggctg 390
to top
>emb|AJ437049.1|HIM437049 Human immunodeficiency virus type 1 mRNA for gag polyprotein (gag
           gene), clone g27s2
          Length = 1512

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 409 aattttggctgatctggctg 390
to top
>emb|AJ437048.1|HIM437048 Human immunodeficiency virus type 1 mRNA for gag polyprotein (gag
           gene), clone g27s1
          Length = 1512

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 409 aattttggctgatctggctg 390
to top
>gb|AC027449.6| Homo sapiens chromosome 18, clone RP11-535A5, complete sequence
          Length = 149660

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 462   ttttggctgatctggctgat 481
             ||||||||||||||||||||
Sbjct: 50680 ttttggctgatctggctgat 50699
to top
>gb|AC009368.8| Drosophila melanogaster 3L BAC RP98-4F7 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 158816

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 183   ttttgaactttacaagtttt 202
             ||||||||||||||||||||
Sbjct: 33756 ttttgaactttacaagtttt 33737
to top
>gb|AC099666.2| Homo sapiens chromosome 3 clone RP11-215K24, complete sequence
          Length = 152755

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 382    atggccaataacaacatgttgctg 405
              |||| |||||||||||||||||||
Sbjct: 145913 atggacaataacaacatgttgctg 145890
to top
>dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005
          Length = 4429080

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 336     tacatgaatataaatacttt 355
               ||||||||||||||||||||
Sbjct: 1000034 tacatgaatataaatacttt 1000015
to top
>gb|DQ404455.1| Metschnikowia sp. ST-96 26S ribosomal RNA gene, partial sequence
          Length = 479

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 133 tgaaaagcccccacacacat 152
           ||||||||||||||||||||
Sbjct: 77  tgaaaagcccccacacacat 96
to top
>emb|BX321868.13| Zebrafish DNA sequence from clone RP71-41I21, complete sequence
          Length = 135717

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 145   acacacatcaacaacattcc 164
             ||||||||||||||||||||
Sbjct: 96598 acacacatcaacaacattcc 96579
to top
>gb|AF409870.1|AF409870 HIV-1 isolate NA21LU09c from United Kingdom gag protein (gag) gene,
           partial cds
          Length = 420

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 355 aattttggctgatctggctg 336
to top
>gb|AF409869.1|AF409869 HIV-1 isolate NA21LU10c from United Kingdom gag protein (gag) gene,
           partial cds
          Length = 420

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 355 aattttggctgatctggctg 336
to top
>gb|AF409868.1|AF409868 HIV-1 isolate NA21LU08c from United Kingdom gag protein (gag) gene,
           partial cds
          Length = 420

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 355 aattttggctgatctggctg 336
to top
>gb|AF409867.1|AF409867 HIV-1 isolate NA21LU07c from United Kingdom gag protein (gag) gene,
           partial cds
          Length = 420

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 355 aattttggctgatctggctg 336
to top
>gb|AF409866.1|AF409866 HIV-1 isolate NA21LU06c from United Kingdom gag protein (gag) gene,
           partial cds
          Length = 420

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 355 aattttggctgatctggctg 336
to top
>gb|AF409864.1|AF409864 HIV-1 isolate NA21LU04c from United Kingdom gag protein (gag) gene,
           partial cds
          Length = 420

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 355 aattttggctgatctggctg 336
to top
>gb|AF409863.1|AF409863 HIV-1 isolate NA21LU03c from United Kingdom gag protein (gag) gene,
           partial cds
          Length = 420

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 355 aattttggctgatctggctg 336
to top
>gb|AF409862.1|AF409862 HIV-1 isolate NA21LU02c from United Kingdom gag protein (gag) gene,
           partial cds
          Length = 420

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 355 aattttggctgatctggctg 336
to top
>gb|AF409861.1|AF409861 HIV-1 isolate NA21LU01c from United Kingdom gag protein (gag) gene,
           partial cds
          Length = 420

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 355 aattttggctgatctggctg 336
to top
>gb|AF409860.1|AF409860 HIV-1 isolate NA21LN11c from United Kingdom gag protein (gag) gene,
           partial cds
          Length = 420

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 355 aattttggctgatctggctg 336
to top
>gb|AF409859.1|AF409859 HIV-1 isolate NA21LN10c from United Kingdom gag protein (gag) gene,
           partial cds
          Length = 420

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 355 aattttggctgatctggctg 336
to top
>gb|AF409858.1|AF409858 HIV-1 isolate NA21LN09c from United Kingdom gag protein (gag) gene,
           partial cds
          Length = 420

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 355 aattttggctgatctggctg 336
to top
>gb|AF409857.1|AF409857 HIV-1 isolate NA21LN08c from United Kingdom gag protein (gag) gene,
           partial cds
          Length = 420

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 355 aattttggctgatctggctg 336
to top
>gb|AF409856.1|AF409856 HIV-1 isolate NA21LN07c from United Kingdom gag protein (gag) gene,
           partial cds
          Length = 420

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 355 aattttggctgatctggctg 336
to top
>gb|AF409855.1|AF409855 HIV-1 isolate NA21LN06c from United Kingdom gag protein (gag) gene,
           partial cds
          Length = 420

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 355 aattttggctgatctggctg 336
to top
>gb|AF409854.1|AF409854 HIV-1 isolate NA21LN05c from United Kingdom gag protein (gag) gene,
           partial cds
          Length = 420

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 355 aattttggctgatctggctg 336
to top
>gb|AF409853.1|AF409853 HIV-1 isolate NA21LN04c from United Kingdom gag protein (gag) gene,
           partial cds
          Length = 420

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 355 aattttggctgatctggctg 336
to top
>gb|AF409852.1|AF409852 HIV-1 isolate NA21LN03c from United Kingdom gag protein (gag) gene,
           partial cds
          Length = 420

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 355 aattttggctgatctggctg 336
to top
>gb|AF409851.1|AF409851 HIV-1 isolate NA21LN02c from United Kingdom gag protein (gag) gene,
           partial cds
          Length = 420

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 355 aattttggctgatctggctg 336
to top
>gb|AF409850.1|AF409850 HIV-1 isolate NA21LN01c from United Kingdom gag protein (gag) gene,
           partial cds
          Length = 420

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 355 aattttggctgatctggctg 336
to top
>gb|AF409834.1|AF409834 HIV-1 isolate NA21CO05c from United Kingdom gag protein (gag) gene,
           partial cds
          Length = 420

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 355 aattttggctgatctggctg 336
to top
>gb|AF409830.1|AF409830 HIV-1 isolate NA21CO01c from United Kingdom gag protein (gag) gene,
           partial cds
          Length = 420

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 355 aattttggctgatctggctg 336
to top
>gb|AF409710.1|AF409710 HIV-1 isolate NA284LNG5 from United Kingdom gag protein (gag) gene,
           partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 325 aattttggctgatctggctg 306
to top
>gb|AF409709.1|AF409709 HIV-1 isolate NA284LNG4 from United Kingdom gag protein (gag) gene,
           partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 325 aattttggctgatctggctg 306
to top
>gb|AF409708.1|AF409708 HIV-1 isolate NA284LNG3 from United Kingdom gag protein (gag) gene,
           partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 325 aattttggctgatctggctg 306
to top
>dbj|AK051150.1| Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length
            enriched library, clone:D130006O04
            product:unclassifiable, full insert sequence
          Length = 1721

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 539  gaggatgcctgacacacaga 558
            ||||||||||||||||||||
Sbjct: 1135 gaggatgcctgacacacaga 1116
to top
>gb|AF084741.1|AF084741 HIV-1 pair E, mother, clone 5 p17 matrix (gag) gene, partial cds
          Length = 402

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 400 aattttggctgatctggctg 381
to top
>gb|AF281746.1|AF281746 HIV-1 isolate GV-h6 from USA nonfunctional gag polyprotein (gag)
           gene, partial sequence
          Length = 1195

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 394 aattttggctgatctggctg 375
to top
>gb|AF174882.1|AF174882 HIV-1 isolate LN2 patient NA021 from United Kingdom gag protein
           (gag) gene, partial cds
          Length = 412

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 355 aattttggctgatctggctg 336
to top
>gb|AF174881.1|AF174881 HIV-1 isolate LN1 patient NA021 from United Kingdom gag protein
           (gag) gene, partial cds
          Length = 396

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 355 aattttggctgatctggctg 336
to top
>gb|AF174870.1|AF174870 HIV-1 isolate LT patient NA021 from United Kingdom gag protein
           (gag) gene, partial cds
          Length = 396

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 355 aattttggctgatctggctg 336
to top
>dbj|AK034669.1| Mus musculus 12 days embryo embryonic body between diaphragm region
            and neck cDNA, RIKEN full-length enriched library,
            clone:9430022M17 product:unclassifiable, full insert
            sequence
          Length = 2849

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 539  gaggatgcctgacacacaga 558
            ||||||||||||||||||||
Sbjct: 1856 gaggatgcctgacacacaga 1837
to top
>gb|DQ308160.1| HIV-1 isolate 95DKAY9509CB09 from Denmark gag protein (gag) gene,
           partial cds
          Length = 363

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 304 aattttggctgatctggctg 285
to top
>dbj|AK043885.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length enriched
            library, clone:A830046G01 product:unclassifiable, full
            insert sequence
          Length = 2270

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 539  gaggatgcctgacacacaga 558
            ||||||||||||||||||||
Sbjct: 1608 gaggatgcctgacacacaga 1589
to top
>dbj|AK053150.1| Mus musculus 0 day neonate lung cDNA, RIKEN full-length enriched
            library, clone:E030017B05 product:hypothetical protein,
            full insert sequence
          Length = 2549

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 539  gaggatgcctgacacacaga 558
            ||||||||||||||||||||
Sbjct: 1555 gaggatgcctgacacacaga 1536
to top
>emb|BX004772.17| Zebrafish DNA sequence from clone DKEY-15L1 in linkage group 7, complete
              sequence
          Length = 210545

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 9      tacagatgtttgcaagcatg 28
              ||||||||||||||||||||
Sbjct: 158968 tacagatgtttgcaagcatg 158949
to top
>ref|XM_624279.1| PREDICTED: Apis mellifera similar to von Hippel-Lindau binding
           protein 1 (LOC551893), mRNA
          Length = 795

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 107 taacaaaaaatattgaagca 126
           ||||||||||||||||||||
Sbjct: 437 taacaaaaaatattgaagca 456
to top
>gb|AF051026.1|AF051026 HIV-1 isolate child 3 clone BC3_5D.1 from United Kingdom MA-p17
           (gag) gene, partial cds
          Length = 366

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 326 aattttggctgatctggctg 307
to top
>gb|AC157678.2| Xenopus tropicalis clone ISB1-130B13, complete sequence
          Length = 143383

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 96     aaagtgtacagtaacaaaaa 115
              ||||||||||||||||||||
Sbjct: 122075 aaagtgtacagtaacaaaaa 122056
to top
>gb|BC094331.1| Mus musculus cDNA clone IMAGE:6815606
          Length = 2306

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 539  gaggatgcctgacacacaga 558
            ||||||||||||||||||||
Sbjct: 1258 gaggatgcctgacacacaga 1239
to top
>gb|AF212293.1| HIV-1 isolate 94RW13 from Rwanda gag protein (gag) and pol protein
           (pol) genes, partial cds
          Length = 2561

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 328 aattttggctgatctggctg 309
to top
>gb|AF196686.1|AF196686 HIV-1 isolate 94RW13 from Rwanda, gag protein (gag) gene, partial
           cds
          Length = 732

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 328 aattttggctgatctggctg 309
to top
>dbj|AK173173.1| Mus musculus mRNA for mKIAA1439 protein
          Length = 6197

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 539  gaggatgcctgacacacaga 558
            ||||||||||||||||||||
Sbjct: 5173 gaggatgcctgacacacaga 5154
to top
>emb|BX511028.13| Zebrafish DNA sequence from clone DKEY-161N17 in linkage group 20,
             complete sequence
          Length = 225010

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 145   acacacatcaacaacattcc 164
             ||||||||||||||||||||
Sbjct: 76753 acacacatcaacaacattcc 76734
to top
>gb|AY103235.1| HIV-1 clone TL-8 from Italy gag protein (gag) gene, partial cds
          Length = 426

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 349 aattttggctgatctggctg 330
to top
>gb|AY103234.1| HIV-1 clone TL-7 from Italy gag protein (gag) gene, partial cds
          Length = 426

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 349 aattttggctgatctggctg 330
to top
>gb|AY103233.1| HIV-1 clone TL-6 from Italy gag protein (gag) gene, partial cds
          Length = 426

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 349 aattttggctgatctggctg 330
to top
>gb|AY103232.1| HIV-1 clone TL-5 from Italy gag protein (gag) gene, partial cds
          Length = 426

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 349 aattttggctgatctggctg 330
to top
>gb|AY103231.1| HIV-1 clone TL-4 from Italy gag protein (gag) gene, partial cds
          Length = 426

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 349 aattttggctgatctggctg 330
to top
>gb|AY103230.1| HIV-1 clone TL-3 from Italy gag protein (gag) gene, partial cds
          Length = 426

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 349 aattttggctgatctggctg 330
to top
>gb|AY103229.1| HIV-1 clone TL-2 from Italy gag protein (gag) gene, partial cds
          Length = 426

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 349 aattttggctgatctggctg 330
to top
>gb|AY103227.1| HIV-1 clone TL-9 from Italy gag protein (gag) gene, partial cds
          Length = 426

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 349 aattttggctgatctggctg 330
to top
>emb|BX470120.5| Zebrafish DNA sequence from clone CH211-11I16 in linkage group 7,
             complete sequence
          Length = 164968

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 9     tacagatgtttgcaagcatg 28
             ||||||||||||||||||||
Sbjct: 80949 tacagatgtttgcaagcatg 80968
to top
>gb|AE003521.3| Drosophila melanogaster chromosome 3L, section 64 of 83 of the complete
              sequence
          Length = 271237

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 183    ttttgaactttacaagtttt 202
              ||||||||||||||||||||
Sbjct: 227702 ttttgaactttacaagtttt 227683
to top
>gb|AY786952.1| HIV-1 clone 1M-1005 from USA gag protein (gag) gene, complete cds
          Length = 1506

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 394 aattttggctgatctggctg 375
to top
>dbj|AB034901.1| Human immunodeficiency virus type 1 subtype B gene for gag
           polyprotein p17 region, isolate:HCM312
          Length = 453

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 391 aattttggctgatctggctg 372
to top
>dbj|AB044066.1| Human immunodeficiency virus type 1 gene for gag polyprotein, p17
           region, isolate:HCM312
          Length = 429

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 460 aattttggctgatctggctg 479
           ||||||||||||||||||||
Sbjct: 391 aattttggctgatctggctg 372
to top
>emb|AL670260.10| Mouse DNA sequence from clone RP23-1I17 on chromosome 4, complete
            sequence
          Length = 147052

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 539  gaggatgcctgacacacaga 558
            ||||||||||||||||||||
Sbjct: 7981 gaggatgcctgacacacaga 7962


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,679,922
Number of Sequences: 3902068
Number of extensions: 6679922
Number of successful extensions: 132955
Number of sequences better than 10.0: 94
Number of HSP's better than 10.0 without gapping: 96
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 132578
Number of HSP's gapped (non-prelim): 376
length of query: 664
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 641
effective length of database: 17,143,297,704
effective search space: 10988853828264
effective search space used: 10988853828264
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top