ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags23j03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X07851.1|TARSBA Wheat mRNA for Rubisco subunit binding-prote... 868 0.0
2dbj|AK120503.1| Oryza sativa (japonica cultivar-group) cDNA clon... 268 2e-68
3dbj|AK119223.1| Oryza sativa (japonica cultivar-group) cDNA clon... 268 2e-68
4dbj|AK100602.1| Oryza sativa (japonica cultivar-group) cDNA clon... 268 2e-68
5dbj|AK061410.1| Oryza sativa (japonica cultivar-group) cDNA clon... 268 2e-68
6emb|AJ234407.1|HVU234407 Hordeum vulgare partial mRNA; clone cMW... 262 1e-66
7dbj|AK119217.1| Oryza sativa (japonica cultivar-group) cDNA clon... 260 5e-66
8gb|BT024101.1| Zea mays clone EL01N0524E01 mRNA sequence 254 3e-64
9gb|AY108518.1| Zea mays PCO123570 mRNA sequence 238 2e-59
10dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 180 3e-42
11gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 180 3e-42
12emb|AL935069.5|CNS08CCL Oryza sativa chromosome 12, . BAC OSJNBb... 180 3e-42
13gb|AY108560.1| Zea mays PCO140434 mRNA sequence 121 3e-24
14ref|XM_470503.1| Oryza sativa (japonica cultivar-group), mRNA 82 2e-12
15dbj|AK061901.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 2e-12
16gb|BT014158.1| Lycopersicon esculentum clone 133278F, mRNA sequence 80 9e-12
17gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 72 2e-09
18gb|AC092263.7| Oryza sativa chromosome 3 BAC OSJNBa0033P04 genom... 72 2e-09
19dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 72 2e-09
20gb|DQ295240.1| Uncultured marine bacterium Ant29B7, partial geno... 58 3e-05
21ref|XM_814415.1| Trypanosoma cruzi strain CL Brener chaperonin H... 54 5e-04
22emb|X95971.1|SLGROEL2G S.lividans groEL2 gene 54 5e-04
23emb|X67473.1|TCHSP60 T.cruzi hsp60 gene 54 5e-04
24gb|L08791.1|TRBHSP60A Trypanosoma cruzi heat shock protein 60 mR... 54 5e-04
25gb|M76658.1|STMGROELY Streptomyces albus open reading frame (GRO... 54 5e-04
26gb|AY389619.1| Hyacinthus orientalis chaperonin groEL mRNA, part... 48 0.032
27gb|BT013144.1| Lycopersicon esculentum clone 134139R, mRNA sequence 46 0.13
28ref|XM_814413.1| Trypanosoma cruzi strain CL Brener chaperonin H... 46 0.13
29ref|XM_814417.1| Trypanosoma cruzi strain CL Brener chaperonin H... 46 0.13
30ref|NM_128359.3| Arabidopsis thaliana CPN60A; ATP binding / prot... 44 0.50
31gb|BT008784.1| Arabidopsis thaliana At2g28000 gene, complete cds 44 0.50
32emb|Z27222.1|BNPLCAS B.napus mRNA for plastid chaperonin-60 alph... 44 0.50
33emb|X95992.1|EGHSP60GN E.gracilis mRNA for heat shock protein 60 44 0.50
34gb|AC006929.4| Arabidopsis thaliana chromosome 2 clone T1E2 map ... 44 0.50
35dbj|AK222126.1| Arabidopsis thaliana mRNA for putative rubisco s... 44 0.50
36dbj|AK222099.1| Arabidopsis thaliana mRNA for putative rubisco s... 44 0.50
37gb|U49357.1|ATU49357 Arabidopsis thaliana chaperonin-60 alpha su... 44 0.50
38emb|BX819680.1|CNS0A9ZT Arabidopsis thaliana Full-length cDNA Co... 44 0.50
39gb|AY086555.1| Arabidopsis thaliana clone 25773 mRNA, complete s... 44 0.50
40gb|BT002441.1| Arabidopsis thaliana putative rubisco subunit bin... 44 0.50
41gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome 42 2.0
42gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, co... 42 2.0
43gb|BT013632.1| Lycopersicon esculentum clone 132434F, mRNA sequence 42 2.0
44gb|AY545024.1| Burkholderia pseudomallei clone BPtf0037 putative... 42 2.0
45emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromos... 42 2.0
46emb|BX569694.1| Synechococcus sp. WH8102 complete genome; segmen... 42 2.0
47dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 42 2.0
48gb|CP000123.1| Mycoplasma capricolum subsp. capricolum ATCC 2734... 42 2.0
49gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, comp... 42 2.0
50dbj|AK047518.1| Mus musculus 10 days neonate cerebellum cDNA, RI... 42 2.0
51gb|U21105.1|PSU21105 Pisum sativum alphacpn60 precursor (alphacp... 42 2.0
52gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 42 2.0
53gb|AC115740.8| Mus musculus chromosome 3, clone RP23-476G18, com... 42 2.0
54dbj|AB039274.1| Propionibacterium granulosum hsp60 gene for 60 k... 42 2.0
55gb|AY780524.1| Ictalurus punctatus heat shock protein 60-like mR... 40 7.9
56gb|AC137713.8| Mus musculus chromosome 15, clone RP24-468P6, com... 40 7.9
57gb|AC129290.4| Mus musculus BAC clone RP24-489L4 from chromosome... 40 7.9
58emb|BX572599.1| Rhodopseudomonas palustris CGA009 complete genom... 40 7.9
59gb|AC105337.7| Homo sapiens chromosome 17, clone CTD-2116F7, com... 40 7.9
60dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c... 40 7.9
61gb|AY688374.2| Lates calcarifer parvalbumin beta-1 gene, complet... 40 7.9
62gb|AC138405.6| Mus musculus chromosome 1, clone RP24-280N11, com... 40 7.9
63dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 7.9
64dbj|BA000035.2| Corynebacterium efficiens YS-314 DNA, complete g... 40 7.9
65emb|AJ338304.1|HSA338304 Homo sapiens genomic sequence surroundi... 40 7.9
66gb|AC147627.6| Mus musculus BAC clone RP24-382F19 from Y, comple... 40 7.9
67gb|AF062920.1|AF062920 Thermus aquaticus DNA polymerase III (dna... 40 7.9
68gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete... 40 7.9
69gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, co... 40 7.9
70gb|AC173476.2| Mus musculus BAC clone RP24-335D7 from chromosome... 40 7.9
71gb|U57000.1|TVU57000 Trichomonas vaginalis chaperonin 60 (cpn60)... 40 7.9
72gb|L27472.1|CRECPN1B Chlamydomonas reinhardtii chaperonin alpha-... 40 7.9
73emb|AL591762.13| Mouse DNA sequence from clone RP23-465I6 on chr... 40 7.9

>emb|X07851.1|TARSBA Wheat mRNA for Rubisco subunit binding-protein alpha subunit
          Length = 1834

 Score =  868 bits (438), Expect = 0.0
 Identities = 554/589 (94%), Gaps = 14/589 (2%)
 Strand = Plus / Minus

                                                                        
Query: 1    ggcgaggaaggttacctttcgattcgcaaaaatggcaatcctactct------agacctt 54
            |||||||||||||||| ||||||||||||||||||||||||||||||      |||||||
Sbjct: 1792 ggcgaggaaggttaccgttcgattcgcaaaaatggcaatcctactcttactctagacctt 1733

                                                                        
Query: 55   tttcactttcaattgatctcaaccaaaattctactgcttggcctgaactgaagcatctaa 114
            |  |||||||| |||||||||||| |||||||||||||||||||||||||| ||||||||
Sbjct: 1732 t--cactttcagttgatctcaaccgaaattctactgcttggcctgaactgaggcatctaa 1675

                                                                        
Query: 115  aaaacacggacgaggcctgaagag--ctttacag---gctcgatcagacggagagctgcc 169
            |||| ||||| |||||||||||||  |||||||    |||||||||||||||||||||||
Sbjct: 1674 aaaa-acggaggaggcctgaagagagctttacatacagctcgatcagacggagagctgcc 1616

                                                                        
Query: 170  cctccgctggctccgcgaccttagccttcggcttgggcttctcgacgacgatcgcttgcg 229
            ||||||||||||| |||||||| | ||| |||||||||||||||||||||||||||||||
Sbjct: 1615 cctccgctggctcggcgaccttgggcttgggcttgggcttctcgacgacgatcgcttgcg 1556

                                                                        
Query: 230  tggtgaggaccattccggacaccgaggcggcgttctggagcgcgcatctcgtcaccttgg 289
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1555 tggtgaggaccattccggacaccgaggcggcgttctggagcgcgcatctcgtcaccttgg 1496

                                                                        
Query: 290  cggggtcgatgacacccgactcgatcaggttctcgtacttgtctgtcatcgcgttgtaac 349
            ||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||||||
Sbjct: 1495 cggggtcgatgacgcccgactcgatcaggttctcgtacttgtcggtcattgcgttgtaac 1436

                                                                        
Query: 350  ccatctcccactcgctatccttgatcttctcgatcacaacttccccttccactccagcgt 409
            |||||||||||||||| ||||||||||||||||||||||| |||||||||||||| ||||
Sbjct: 1435 ccatctcccactcgctctccttgatcttctcgatcacaacctccccttccactccggcgt 1376

                                                                        
Query: 410  tgttggcgatcagcgatgccggtgcttgcaatgccttctgaatgatgtcagcaccaaggc 469
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1375 tgttggcgatcagcgatgccggtgcttgcaatgccttctgaatgatgtcagcaccaaggc 1316

                                                                        
Query: 470  gctcgtcgtggtcttcaattgtttctttgatcgcagggacataggtagataggtgcacat 529
            |||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 1315 gctcgtcgtggtcttcgattgtttctttgatcgcagggacataggtagacaggtgcacat 1256

                                                             
Query: 530  atgccgcaccaccaccgggaacaatgccctcctcgatggcagcgaaagt 578
            | ||||| |||||||||||||||||||||||||||||||| ||||||||
Sbjct: 1255 acgccgcgccaccaccgggaacaatgccctcctcgatggctgcgaaagt 1207



to top

>dbj|AK120503.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013122K17, full
            insert sequence
          Length = 2070

 Score =  268 bits (135), Expect = 2e-68
 Identities = 324/387 (83%)
 Strand = Plus / Minus

                                                                        
Query: 192  agccttcggcttgggcttctcgacgacgatcgcttgcgtggtgaggaccattccggacac 251
            |||||| ||||| ||||||||||| || || || || ||||| ||||||||||| | |||
Sbjct: 1785 agccttgggcttcggcttctcgacaacaatggcctgtgtggtaaggaccattccagccac 1726

                                                                        
Query: 252  cgaggcggcgttctggagcgcgcatctcgtcaccttggcggggtcgatgacacccgactc 311
            ||||||||| |||||||||||||||||||||||||| || ||||| || ||||||| |||
Sbjct: 1725 cgaggcggcattctggagcgcgcatctcgtcaccttagctgggtcaataacacccgcctc 1666

                                                                        
Query: 312  gatcaggttctcgtacttgtctgtcatcgcgttgtaacccatctcccactcgctatcctt 371
             |||| |||||| ||||||||  ||||||| ||||| || |  ||||||||||  |||||
Sbjct: 1665 aatcaagttctcatacttgtcgttcatcgcattgtacccgacttcccactcgccgtcctt 1606

                                                                        
Query: 372  gatcttctcgatcacaacttccccttccactccagcgttgttggcgatcagcgatgccgg 431
            ||||||||| |  || |||||||||||||||||||| |||| ||| ||||| || || ||
Sbjct: 1605 gatcttctcaactaccacttccccttccactccagcattgtgggcaatcagtgaagcggg 1546

                                                                        
Query: 432  tgcttgcaatgccttctgaatgatgtcagcaccaaggcgctcgtcgtggtcttcaattgt 491
             |||  ||| ||||| ||||| ||||| |||||||||||||| || |||||||| |||||
Sbjct: 1545 agctaccaacgccttttgaataatgtctgcaccaaggcgctcatcatggtcttcgattgt 1486

                                                                        
Query: 492  ttctttgatcgcagggacataggtagataggtgcacatatgccgcaccaccaccgggaac 551
            ||||||||||||||||||    || || || |||||||| || | |||||| || |||||
Sbjct: 1485 ttctttgatcgcagggacggtagttgaaagatgcacatacgctgtaccacctccaggaac 1426

                                       
Query: 552  aatgccctcctcgatggcagcgaaagt 578
            |||||||||||| || || ||||||||
Sbjct: 1425 aatgccctcctcaatagctgcgaaagt 1399



to top

>dbj|AK119223.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-100-D06, full
           insert sequence
          Length = 1119

 Score =  268 bits (135), Expect = 2e-68
 Identities = 324/387 (83%)
 Strand = Plus / Minus

                                                                       
Query: 192 agccttcggcttgggcttctcgacgacgatcgcttgcgtggtgaggaccattccggacac 251
           |||||| ||||| ||||||||||| || || || || ||||| ||||||||||| | |||
Sbjct: 854 agccttgggcttcggcttctcgacaacaatggcctgtgtggtaaggaccattccagccac 795

                                                                       
Query: 252 cgaggcggcgttctggagcgcgcatctcgtcaccttggcggggtcgatgacacccgactc 311
           ||||||||| |||||||||||||||||||||||||| || ||||| || ||||||| |||
Sbjct: 794 cgaggcggcattctggagcgcgcatctcgtcaccttagctgggtcaataacacccgcctc 735

                                                                       
Query: 312 gatcaggttctcgtacttgtctgtcatcgcgttgtaacccatctcccactcgctatcctt 371
            |||| |||||| ||||||||  ||||||| ||||| || |  ||||||||||  |||||
Sbjct: 734 aatcaagttctcatacttgtcgttcatcgcattgtacccgacttcccactcgccgtcctt 675

                                                                       
Query: 372 gatcttctcgatcacaacttccccttccactccagcgttgttggcgatcagcgatgccgg 431
           ||||||||| |  || |||||||||||||||||||| |||| ||| ||||| || || ||
Sbjct: 674 gatcttctcaactaccacttccccttccactccagcattgtgggcaatcagtgaagcggg 615

                                                                       
Query: 432 tgcttgcaatgccttctgaatgatgtcagcaccaaggcgctcgtcgtggtcttcaattgt 491
            |||  ||| ||||| ||||| ||||| |||||||||||||| || |||||||| |||||
Sbjct: 614 agctaccaacgccttttgaataatgtctgcaccaaggcgctcatcatggtcttcgattgt 555

                                                                       
Query: 492 ttctttgatcgcagggacataggtagataggtgcacatatgccgcaccaccaccgggaac 551
           ||||||||||||||||||    || || || |||||||| || | |||||| || |||||
Sbjct: 554 ttctttgatcgcagggacggtagttgaaagatgcacatacgctgtaccacctccaggaac 495

                                      
Query: 552 aatgccctcctcgatggcagcgaaagt 578
           |||||||||||| || || ||||||||
Sbjct: 494 aatgccctcctcaatagctgcgaaagt 468



to top

>dbj|AK100602.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023107D12, full
            insert sequence
          Length = 1985

 Score =  268 bits (135), Expect = 2e-68
 Identities = 324/387 (83%)
 Strand = Plus / Minus

                                                                        
Query: 192  agccttcggcttgggcttctcgacgacgatcgcttgcgtggtgaggaccattccggacac 251
            |||||| ||||| ||||||||||| || || || || ||||| ||||||||||| | |||
Sbjct: 1783 agccttgggcttcggcttctcgacaacaatggcctgtgtggtaaggaccattccagccac 1724

                                                                        
Query: 252  cgaggcggcgttctggagcgcgcatctcgtcaccttggcggggtcgatgacacccgactc 311
            ||||||||| |||||||||||||||||||||||||| || ||||| || ||||||| |||
Sbjct: 1723 cgaggcggcattctggagcgcgcatctcgtcaccttagctgggtcaataacacccgcctc 1664

                                                                        
Query: 312  gatcaggttctcgtacttgtctgtcatcgcgttgtaacccatctcccactcgctatcctt 371
             |||| |||||| ||||||||  ||||||| ||||| || |  ||||||||||  |||||
Sbjct: 1663 aatcaagttctcatacttgtcgttcatcgcattgtacccgacttcccactcgccgtcctt 1604

                                                                        
Query: 372  gatcttctcgatcacaacttccccttccactccagcgttgttggcgatcagcgatgccgg 431
            ||||||||| |  || |||||||||||||||||||| |||| ||| ||||| || || ||
Sbjct: 1603 gatcttctcaactaccacttccccttccactccagcattgtgggcaatcagtgaagcggg 1544

                                                                        
Query: 432  tgcttgcaatgccttctgaatgatgtcagcaccaaggcgctcgtcgtggtcttcaattgt 491
             |||  ||| ||||| ||||| ||||| |||||||||||||| || |||||||| |||||
Sbjct: 1543 agctaccaacgccttttgaataatgtctgcaccaaggcgctcatcatggtcttcgattgt 1484

                                                                        
Query: 492  ttctttgatcgcagggacataggtagataggtgcacatatgccgcaccaccaccgggaac 551
            ||||||||||||||||||    || || || |||||||| || | |||||| || |||||
Sbjct: 1483 ttctttgatcgcagggacggtagttgaaagatgcacatacgctgtaccacctccaggaac 1424

                                       
Query: 552  aatgccctcctcgatggcagcgaaagt 578
            |||||||||||| || || ||||||||
Sbjct: 1423 aatgccctcctcaatagctgcgaaagt 1397



to top

>dbj|AK061410.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-B08, full
           insert sequence
          Length = 1087

 Score =  268 bits (135), Expect = 2e-68
 Identities = 324/387 (83%)
 Strand = Plus / Minus

                                                                       
Query: 192 agccttcggcttgggcttctcgacgacgatcgcttgcgtggtgaggaccattccggacac 251
           |||||| ||||| ||||||||||| || || || || ||||| ||||||||||| | |||
Sbjct: 802 agccttgggcttcggcttctcgacaacaatggcctgtgtggtaaggaccattccagccac 743

                                                                       
Query: 252 cgaggcggcgttctggagcgcgcatctcgtcaccttggcggggtcgatgacacccgactc 311
           ||||||||| |||||||||||||||||||||||||| || ||||| || ||||||| |||
Sbjct: 742 cgaggcggcattctggagcgcgcatctcgtcaccttagctgggtcaataacacccgcctc 683

                                                                       
Query: 312 gatcaggttctcgtacttgtctgtcatcgcgttgtaacccatctcccactcgctatcctt 371
            |||| |||||| ||||||||  ||||||| ||||| || |  ||||||||||  |||||
Sbjct: 682 aatcaagttctcatacttgtcgttcatcgcattgtacccgacttcccactcgccgtcctt 623

                                                                       
Query: 372 gatcttctcgatcacaacttccccttccactccagcgttgttggcgatcagcgatgccgg 431
           ||||||||| |  || |||||||||||||||||||| |||| ||| ||||| || || ||
Sbjct: 622 gatcttctcaactaccacttccccttccactccagcattgtgggcaatcagtgaagcggg 563

                                                                       
Query: 432 tgcttgcaatgccttctgaatgatgtcagcaccaaggcgctcgtcgtggtcttcaattgt 491
            |||  ||| ||||| ||||| ||||| |||||||||||||| || |||||||| |||||
Sbjct: 562 agctaccaacgccttttgaataatgtctgcaccaaggcgctcatcatggtcttcgattgt 503

                                                                       
Query: 492 ttctttgatcgcagggacataggtagataggtgcacatatgccgcaccaccaccgggaac 551
           ||||||||||||||||||    || || || |||||||| || | |||||| || |||||
Sbjct: 502 ttctttgatcgcagggacggtagttgaaagatgcacatacgctgtaccacctccaggaac 443

                                      
Query: 552 aatgccctcctcgatggcagcgaaagt 578
           |||||||||||| || || ||||||||
Sbjct: 442 aatgccctcctcaatagctgcgaaagt 416



to top

>emb|AJ234407.1|HVU234407 Hordeum vulgare partial mRNA; clone cMWG0655
          Length = 247

 Score =  262 bits (132), Expect = 1e-66
 Identities = 140/145 (96%)
 Strand = Plus / Plus

                                                                       
Query: 434 cttgcaatgccttctgaatgatgtcagcaccaaggcgctcgtcgtggtcttcaattgttt 493
           ||||||||||||||||||||||||||||||||||  ||||| ||||||||||||||||||
Sbjct: 1   cttgcaatgccttctgaatgatgtcagcaccaagnvgctcgbcgtggtcttcaattgttt 60

                                                                       
Query: 494 ctttgatcgcagggacataggtagataggtgcacatatgccgcaccaccaccgggaacaa 553
           ||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctttgatcgmaggaacataggtagataggtgcacatatgccgcaccaccaccgggaacaa 120

                                    
Query: 554 tgccctcctcgatggcagcgaaagt 578
           |||||||||||||||||||||||||
Sbjct: 121 tgccctcctcgatggcagcgaaagt 145



to top

>dbj|AK119217.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-E10, full
            insert sequence
          Length = 1543

 Score =  260 bits (131), Expect = 5e-66
 Identities = 323/387 (83%)
 Strand = Plus / Minus

                                                                        
Query: 192  agccttcggcttgggcttctcgacgacgatcgcttgcgtggtgaggaccattccggacac 251
            |||||| | ||| ||||||||||| || || || || ||||| ||||||||||| | |||
Sbjct: 1312 agccttggacttcggcttctcgacaacaatggcctgtgtggtaaggaccattccagccac 1253

                                                                        
Query: 252  cgaggcggcgttctggagcgcgcatctcgtcaccttggcggggtcgatgacacccgactc 311
            ||||||||| |||||||||||||||||||||||||| || ||||| || ||||||| |||
Sbjct: 1252 cgaggcggcattctggagcgcgcatctcgtcaccttagctgggtcaataacacccgcctc 1193

                                                                        
Query: 312  gatcaggttctcgtacttgtctgtcatcgcgttgtaacccatctcccactcgctatcctt 371
             |||| |||||| ||||||||  ||||||| ||||| || |  ||||||||||  |||||
Sbjct: 1192 aatcaagttctcatacttgtcgttcatcgcattgtacccgacttcccactcgccgtcctt 1133

                                                                        
Query: 372  gatcttctcgatcacaacttccccttccactccagcgttgttggcgatcagcgatgccgg 431
            ||||||||| |  || |||||||||||||||||||| |||| ||| ||||| || || ||
Sbjct: 1132 gatcttctcaactaccacttccccttccactccagcattgtgggcaatcagtgaagcggg 1073

                                                                        
Query: 432  tgcttgcaatgccttctgaatgatgtcagcaccaaggcgctcgtcgtggtcttcaattgt 491
             |||  ||| ||||| ||||| ||||| |||||||||||||| || |||||||| |||||
Sbjct: 1072 agctaccaacgccttttgaataatgtctgcaccaaggcgctcatcatggtcttcgattgt 1013

                                                                        
Query: 492  ttctttgatcgcagggacataggtagataggtgcacatatgccgcaccaccaccgggaac 551
            ||||||||||||||||||    || || || |||||||| || | |||||| || |||||
Sbjct: 1012 ttctttgatcgcagggacggtagttgaaagatgcacatacgctgtaccacctccaggaac 953

                                       
Query: 552  aatgccctcctcgatggcagcgaaagt 578
            |||||||||||| || || ||||||||
Sbjct: 952  aatgccctcctcaatagctgcgaaagt 926



to top

>gb|BT024101.1| Zea mays clone EL01N0524E01 mRNA sequence
          Length = 2106

 Score =  254 bits (128), Expect = 3e-64
 Identities = 330/396 (83%), Gaps = 1/396 (0%)
 Strand = Plus / Minus

                                                                        
Query: 169  ccctccgctggctccgcgaccttagccttcggcttgggcttctcgacgacgatcgcttgc 228
            ||||||| |||||| || || | || ||||||||| |||||||| || || || || |||
Sbjct: 1812 ccctccggtggctctgccacttgaggcttcggctttggcttctcaacaacaatggcctgc 1753

                                                                        
Query: 229  gtggtgaggaccattccggacaccgaggcggcgttctggagcgcgcatctcgtcaccttg 288
            ||||| ||||||||||| |  || ||||| || ||||||||||| || || |||||||||
Sbjct: 1752 gtggttaggaccattccagctactgaggccgcattctggagcgcacacctggtcaccttg 1693

                                                                        
Query: 289  gcggggtcgatgacacccgactcgatcaggttctcgtacttgtctgtcatcgcgttgtaa 348
            || |||||||| ||||| | ||| |||||||||||||||||||| ||||| || ||||| 
Sbjct: 1692 gcagggtcgatcacaccagcctccatcaggttctcgtacttgtcagtcattgcattgtag 1633

                                                                        
Query: 349  cccatctcccactcgctatccttgatcttctcgatcacaacttc-cccttccactccagc 407
            |||| |||||| ||||| ||||||||||||||||  || ||||| |||||| ||||||||
Sbjct: 1632 cccacctcccaatcgctctccttgatcttctcgacaaccacttcacccttctactccagc 1573

                                                                        
Query: 408  gttgttggcgatcagcgatgccggtgcttgcaatgccttctgaatgatgtcagcaccaag 467
             ||||  || ||||  || || ||||||  ||||||||| ||||| || ||||| |||||
Sbjct: 1572 attgtgtgcaatcaatgaagcaggtgctaccaatgccttttgaataatatcagcgccaag 1513

                                                                        
Query: 468  gcgctcgtcgtggtcttcaattgtttctttgatcgcagggacataggtagataggtgcac 527
             ||||| ||  |||| ||||||| ||||||||||  |||||||   ||||||||||||||
Sbjct: 1512 acgctcatcagggtcctcaattgcttctttgatcttagggacaaccgtagataggtgcac 1453

                                                
Query: 528  atatgccgcaccaccaccgggaacaatgccctcctc 563
            ||||||||||||||| || |||||||||||||||||
Sbjct: 1452 atatgccgcaccacctcctggaacaatgccctcctc 1417



to top

>gb|AY108518.1| Zea mays PCO123570 mRNA sequence
          Length = 1387

 Score =  238 bits (120), Expect = 2e-59
 Identities = 328/396 (82%), Gaps = 1/396 (0%)
 Strand = Plus / Minus

                                                                        
Query: 169  ccctccgctggctccgcgaccttagccttcggcttgggcttctcgacgacgatcgcttgc 228
            ||||||| |||||| || || | || ||||||||| |||||||| || || || || |||
Sbjct: 1071 ccctccggtggctctgccacttgaggcttcggctttggcttctcaacaacaatggcctgc 1012

                                                                        
Query: 229  gtggtgaggaccattccggacaccgaggcggcgttctggagcgcgcatctcgtcaccttg 288
            ||||| ||||||||||| |  || ||||| || ||||||||||| || || |||||||||
Sbjct: 1011 gtggttaggaccattccagctactgaggccgcattctggagcgcacacctggtcaccttg 952

                                                                        
Query: 289  gcggggtcgatgacacccgactcgatcaggttctcgtacttgtctgtcatcgcgttgtaa 348
            || |||||||| ||||| | ||| |||||||||||||||||||| ||||| || ||||| 
Sbjct: 951  gcagggtcgatcacaccagcctccatcaggttctcgtacttgtcagtcattgcattgtag 892

                                                                        
Query: 349  cccatctcccactcgctat-ccttgatcttctcgatcacaacttccccttccactccagc 407
            |||| |||||| ||||| | |||||||||||||||  || ||||| || || ||||||||
Sbjct: 891  cccacctcccaatcgctctgccttgatcttctcgacaaccacttcaccctctactccagc 832

                                                                        
Query: 408  gttgttggcgatcagcgatgccggtgcttgcaatgccttctgaatgatgtcagcaccaag 467
             ||||  || ||||  || || ||||||  ||||||||| ||||| || ||||| |||||
Sbjct: 831  attgtgtgcaatcaatgaagcaggtgctaccaatgccttttgaataatatcagcgccaag 772

                                                                        
Query: 468  gcgctcgtcgtggtcttcaattgtttctttgatcgcagggacataggtagataggtgcac 527
             ||||| ||  |||| ||||||| ||||||||||  |||||||   ||||||||||||||
Sbjct: 771  ccgctcatcagggtcctcaattgcttctttgatcttagggacaaccgtagataggtgcac 712

                                                
Query: 528  atatgccgcaccaccaccgggaacaatgccctcctc 563
            ||||||||||||||| || |||||||||||||||||
Sbjct: 711  atatgccgcaccacctcctggaacaatgccctcctc 676



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score =  180 bits (91), Expect = 3e-42
 Identities = 196/231 (84%)
 Strand = Plus / Minus

                                                                            
Query: 192      agccttcggcttgggcttctcgacgacgatcgcttgcgtggtgaggaccattccggacac 251
                |||||| ||||| ||||||||||| || || || || ||||| ||||||||||| | |||
Sbjct: 10296639 agccttgggcttcggcttctcgacaacaatggcctgtgtggtaaggaccattccagccac 10296580

                                                                            
Query: 252      cgaggcggcgttctggagcgcgcatctcgtcaccttggcggggtcgatgacacccgactc 311
                ||||||||| |||||||||||||||||||||||||| || ||||| || ||||||| |||
Sbjct: 10296579 cgaggcggcattctggagcgcgcatctcgtcaccttagctgggtcaataacacccgcctc 10296520

                                                                            
Query: 312      gatcaggttctcgtacttgtctgtcatcgcgttgtaacccatctcccactcgctatcctt 371
                 |||| |||||| ||||||||  ||||||| ||||| || |  ||||||||||  |||||
Sbjct: 10296519 aatcaagttctcatacttgtcgttcatcgcattgtacccgacttcccactcgccgtcctt 10296460

                                                                   
Query: 372      gatcttctcgatcacaacttccccttccactccagcgttgttggcgatcag 422
                ||||||||| |  || |||||||||||||||||||| |||| ||| |||||
Sbjct: 10296459 gatcttctcaactaccacttccccttccactccagcattgtgggcaatcag 10296409



 Score =  103 bits (52), Expect = 6e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                            
Query: 443      ccttctgaatgatgtcagcaccaaggcgctcgtcgtggtcttcaattgtttctttgatcg 502
                |||| ||||| ||||| |||||||||||||| || |||||||| ||||||||||||||||
Sbjct: 10296118 ccttttgaataatgtctgcaccaaggcgctcatcatggtcttcgattgtttctttgatcg 10296059

                                                                            
Query: 503      cagggacataggtagataggtgcacatatgccgcaccaccaccgggaacaatgccctcct 562
                |||||||    || || || |||||||| || | |||||| || ||||||||||||||||
Sbjct: 10296058 cagggacggtagttgaaagatgcacatacgctgtaccacctccaggaacaatgccctcct 10295999

                                
Query: 563      cgatggcagcgaaagt 578
                | || || ||||||||
Sbjct: 10295998 caatagctgcgaaagt 10295983



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  180 bits (91), Expect = 3e-42
 Identities = 196/231 (84%)
 Strand = Plus / Minus

                                                                            
Query: 192      agccttcggcttgggcttctcgacgacgatcgcttgcgtggtgaggaccattccggacac 251
                |||||| ||||| ||||||||||| || || || || ||||| ||||||||||| | |||
Sbjct: 10296521 agccttgggcttcggcttctcgacaacaatggcctgtgtggtaaggaccattccagccac 10296462

                                                                            
Query: 252      cgaggcggcgttctggagcgcgcatctcgtcaccttggcggggtcgatgacacccgactc 311
                ||||||||| |||||||||||||||||||||||||| || ||||| || ||||||| |||
Sbjct: 10296461 cgaggcggcattctggagcgcgcatctcgtcaccttagctgggtcaataacacccgcctc 10296402

                                                                            
Query: 312      gatcaggttctcgtacttgtctgtcatcgcgttgtaacccatctcccactcgctatcctt 371
                 |||| |||||| ||||||||  ||||||| ||||| || |  ||||||||||  |||||
Sbjct: 10296401 aatcaagttctcatacttgtcgttcatcgcattgtacccgacttcccactcgccgtcctt 10296342

                                                                   
Query: 372      gatcttctcgatcacaacttccccttccactccagcgttgttggcgatcag 422
                ||||||||| |  || |||||||||||||||||||| |||| ||| |||||
Sbjct: 10296341 gatcttctcaactaccacttccccttccactccagcattgtgggcaatcag 10296291



 Score =  103 bits (52), Expect = 6e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                            
Query: 443      ccttctgaatgatgtcagcaccaaggcgctcgtcgtggtcttcaattgtttctttgatcg 502
                |||| ||||| ||||| |||||||||||||| || |||||||| ||||||||||||||||
Sbjct: 10296000 ccttttgaataatgtctgcaccaaggcgctcatcatggtcttcgattgtttctttgatcg 10295941

                                                                            
Query: 503      cagggacataggtagataggtgcacatatgccgcaccaccaccgggaacaatgccctcct 562
                |||||||    || || || |||||||| || | |||||| || ||||||||||||||||
Sbjct: 10295940 cagggacggtagttgaaagatgcacatacgctgtaccacctccaggaacaatgccctcct 10295881

                                
Query: 563      cgatggcagcgaaagt 578
                | || || ||||||||
Sbjct: 10295880 caatagctgcgaaagt 10295865



to top

>emb|AL935069.5|CNS08CCL Oryza sativa chromosome 12, . BAC OSJNBb0115B15 of library OSJNBb from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 135439

 Score =  180 bits (91), Expect = 3e-42
 Identities = 196/231 (84%)
 Strand = Plus / Minus

                                                                         
Query: 192   agccttcggcttgggcttctcgacgacgatcgcttgcgtggtgaggaccattccggacac 251
             |||||| ||||| ||||||||||| || || || || ||||| ||||||||||| | |||
Sbjct: 59558 agccttgggcttcggcttctcgacaacaatggcctgtgtggtaaggaccattccagccac 59499

                                                                         
Query: 252   cgaggcggcgttctggagcgcgcatctcgtcaccttggcggggtcgatgacacccgactc 311
             ||||||||| |||||||||||||||||||||||||| || ||||| || ||||||| |||
Sbjct: 59498 cgaggcggcattctggagcgcgcatctcgtcaccttagctgggtcaataacacccgcctc 59439

                                                                         
Query: 312   gatcaggttctcgtacttgtctgtcatcgcgttgtaacccatctcccactcgctatcctt 371
              |||| |||||| ||||||||  ||||||| ||||| || |  ||||||||||  |||||
Sbjct: 59438 aatcaagttctcatacttgtcgttcatcgcattgtacccgacttcccactcgccgtcctt 59379

                                                                
Query: 372   gatcttctcgatcacaacttccccttccactccagcgttgttggcgatcag 422
             ||||||||| |  || |||||||||||||||||||| |||| ||| |||||
Sbjct: 59378 gatcttctcaactaccacttccccttccactccagcattgtgggcaatcag 59328



 Score =  103 bits (52), Expect = 6e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                         
Query: 443   ccttctgaatgatgtcagcaccaaggcgctcgtcgtggtcttcaattgtttctttgatcg 502
             |||| ||||| ||||| |||||||||||||| || |||||||| ||||||||||||||||
Sbjct: 59037 ccttttgaataatgtctgcaccaaggcgctcatcatggtcttcgattgtttctttgatcg 58978

                                                                         
Query: 503   cagggacataggtagataggtgcacatatgccgcaccaccaccgggaacaatgccctcct 562
             |||||||    || || || |||||||| || | |||||| || ||||||||||||||||
Sbjct: 58977 cagggacggtagttgaaagatgcacatacgctgtaccacctccaggaacaatgccctcct 58918

                             
Query: 563   cgatggcagcgaaagt 578
             | || || ||||||||
Sbjct: 58917 caatagctgcgaaagt 58902



to top

>gb|AY108560.1| Zea mays PCO140434 mRNA sequence
          Length = 2143

 Score =  121 bits (61), Expect = 3e-24
 Identities = 220/273 (80%)
 Strand = Plus / Minus

                                                                        
Query: 201  cttgggcttctcgacgacgatcgcttgcgtggtgaggaccattccggacaccgaggcggc 260
            |||||||||||| || ||||| ||||| || || || |||||||| | ||| ||||| ||
Sbjct: 1849 cttgggcttctccacaacgattgcttgggtagtcagcaccattccagccacggaggcagc 1790

                                                                        
Query: 261  gttctggagcgcgcatctcgtcaccttggcggggtcgatgacacccgactcgatcaggtt 320
            |||||| || ||||| || ||||| ||||| |||||||| ||||| | ||| | ||||||
Sbjct: 1789 gttctgcagggcgcacctagtcactttggcagggtcgatcacaccagcctccaccaggtt 1730

                                                                        
Query: 321  ctcgtacttgtctgtcatcgcgttgtaacccatctcccactcgctatccttgatcttctc 380
            ||||| |||||| | ||| ||||||||||| | |||||||||||| |||  ||| || ||
Sbjct: 1729 ctcgtgcttgtccgccatggcgttgtaaccgaactcccactcgctttcccggattttatc 1670

                                                                        
Query: 381  gatcacaacttccccttccactccagcgttgttggcgatcagcgatgccggtgcttgcaa 440
             |  |  || || |||||||| ||||| || | ||| ||||||| ||| |||||   |||
Sbjct: 1669 cacaatcacctcaccttccaccccagcattatgggctatcagcgctgcaggtgccaccaa 1610

                                             
Query: 441  tgccttctgaatgatgtcagcaccaaggcgctc 473
             |||||||||||||| |||||||| ||||||||
Sbjct: 1609 agccttctgaatgatatcagcacctaggcgctc 1577



to top

>ref|XM_470503.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1998

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 212/269 (78%)
 Strand = Plus / Minus

                                                                        
Query: 205  ggcttctcgacgacgatcgcttgcgtggtgaggaccattccggacaccgaggcggcgttc 264
            |||||||| || ||||| ||||||||||| || |||||||| | ||||||||| ||||| 
Sbjct: 1777 ggcttctccacaacgatggcttgcgtggttagtaccattccagccaccgaggctgcgttt 1718

                                                                        
Query: 265  tggagcgcgcatctcgtcaccttggcggggtcgatgacacccgactcgatcaggttctcg 324
            || | ||| ||||| |||||||| || ||||| || ||||| | ||  | || |||||||
Sbjct: 1717 tgcaacgcacatcttgtcacctttgcagggtcaatcacaccagcctgtaccaagttctcg 1658

                                                                        
Query: 325  tacttgtctgtcatcgcgttgtaacccatctcccactcgctatccttgatcttctcgatc 384
            |   |||| | |||||| ||||| || | |||||| || || ||||||||||| || |  
Sbjct: 1657 tgtctgtcagccatcgcattgtagccaacctcccattcactctccttgatcttttctaca 1598

                                                                        
Query: 385  acaacttccccttccactccagcgttgttggcgatcagcgatgccggtgcttgcaatgcc 444
            |  ||||||||||| |||||||| ||||  || || || | |||||||||    |  |||
Sbjct: 1597 atcacttccccttcaactccagcattgtgtgctattagtgctgccggtgccactagagcc 1538

                                         
Query: 445  ttctgaatgatgtcagcaccaaggcgctc 473
            || |||||||| |||||||||||||||||
Sbjct: 1537 ttttgaatgatatcagcaccaaggcgctc 1509



to top

>dbj|AK061901.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-041-H05, full
           insert sequence
          Length = 1107

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 212/269 (78%)
 Strand = Plus / Minus

                                                                       
Query: 205 ggcttctcgacgacgatcgcttgcgtggtgaggaccattccggacaccgaggcggcgttc 264
           |||||||| || ||||| ||||||||||| || |||||||| | ||||||||| ||||| 
Sbjct: 886 ggcttctccacaacgatggcttgcgtggttagtaccattccagccaccgaggctgcgttt 827

                                                                       
Query: 265 tggagcgcgcatctcgtcaccttggcggggtcgatgacacccgactcgatcaggttctcg 324
           || | ||| ||||| |||||||| || ||||| || ||||| | ||  | || |||||||
Sbjct: 826 tgcaacgcacatcttgtcacctttgcagggtcaatcacaccagcctgtaccaagttctcg 767

                                                                       
Query: 325 tacttgtctgtcatcgcgttgtaacccatctcccactcgctatccttgatcttctcgatc 384
           |   |||| | |||||| ||||| || | |||||| || || ||||||||||| || |  
Sbjct: 766 tgtctgtcagccatcgcattgtagccaacctcccattcactctccttgatcttttctaca 707

                                                                       
Query: 385 acaacttccccttccactccagcgttgttggcgatcagcgatgccggtgcttgcaatgcc 444
           |  ||||||||||| |||||||| ||||  || || || | |||||||||    |  |||
Sbjct: 706 atcacttccccttcaactccagcattgtgtgctattagtgctgccggtgccactagagcc 647

                                        
Query: 445 ttctgaatgatgtcagcaccaaggcgctc 473
           || |||||||| |||||||||||||||||
Sbjct: 646 ttttgaatgatatcagcaccaaggcgctc 618



to top

>gb|BT014158.1| Lycopersicon esculentum clone 133278F, mRNA sequence
          Length = 2098

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 211/268 (78%)
 Strand = Plus / Minus

                                                                        
Query: 194  ccttcggcttgggcttctcgacgacgatcgcttgcgtggtgaggaccattccggacaccg 253
            |||| ||||| ||||||||||| || || ||||| ||||| || |||||||| || || |
Sbjct: 1795 ccttaggctttggcttctcgaccactatggcttgtgtggtcagcaccattcctgaaactg 1736

                                                                        
Query: 254  aggcggcgttctggagcgcgcatctcgtcaccttggcggggtcgatgacacccgactcga 313
            | || |  ||||| |  || ||||| ||||||||||| || |||||||| || |  || |
Sbjct: 1735 atgctgaattctgcaaggcacatcttgtcaccttggctggatcgatgactccagcttcca 1676

                                                                        
Query: 314  tcaggttctcgtacttgtctgtcatcgcgttgtaacccatctcccactcgctatccttga 373
              || |||||||| | ||||||||||||||| |||||||||||||| |||   ||||| |
Sbjct: 1675 cgagattctcgtattggtctgtcatcgcgttataacccatctcccattcggcttccttca 1616

                                                                        
Query: 374  tcttctcgatcacaacttccccttccactccagcgttgttggcgatcagcgatgccggtg 433
             |||||| |  || ||||| ||||| ||||| || || | ||| ||||  ||||| || |
Sbjct: 1615 ccttctccacgactacttctccttcaactccggcattttgggctatcaaagatgctgggg 1556

                                        
Query: 434  cttgcaatgccttctgaatgatgtcagc 461
            ||  ||||||||| ||||||||||||||
Sbjct: 1555 ctaccaatgccttttgaatgatgtcagc 1528



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 165/208 (79%)
 Strand = Plus / Plus

                                                                            
Query: 205      ggcttctcgacgacgatcgcttgcgtggtgaggaccattccggacaccgaggcggcgttc 264
                |||||||| || ||||| ||||||||||| || |||||||| | ||||||||| ||||| 
Sbjct: 35977733 ggcttctccacaacgatggcttgcgtggttagtaccattccagccaccgaggctgcgttt 35977792

                                                                            
Query: 265      tggagcgcgcatctcgtcaccttggcggggtcgatgacacccgactcgatcaggttctcg 324
                || | ||| ||||| |||||||| || ||||| || ||||| | ||  | || |||||||
Sbjct: 35977793 tgcaacgcacatcttgtcacctttgcagggtcaatcacaccagcctgtaccaagttctcg 35977852

                                                                            
Query: 325      tacttgtctgtcatcgcgttgtaacccatctcccactcgctatccttgatcttctcgatc 384
                |   |||| | |||||| ||||| || | |||||| || || ||||||||||| || |  
Sbjct: 35977853 tgtctgtcagccatcgcattgtagccaacctcccattcactctccttgatcttttctaca 35977912

                                            
Query: 385      acaacttccccttccactccagcgttgt 412
                |  ||||||||||| |||||||| ||||
Sbjct: 35977913 atcacttccccttcaactccagcattgt 35977940



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                               
Query: 443      ccttctgaatgatgtcagcaccaaggcgctc 473
                |||| |||||||| |||||||||||||||||
Sbjct: 35978185 ccttttgaatgatatcagcaccaaggcgctc 35978215



to top

>gb|AC092263.7| Oryza sativa chromosome 3 BAC OSJNBa0033P04 genomic sequence, complete
             sequence
          Length = 164179

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 165/208 (79%)
 Strand = Plus / Plus

                                                                         
Query: 205   ggcttctcgacgacgatcgcttgcgtggtgaggaccattccggacaccgaggcggcgttc 264
             |||||||| || ||||| ||||||||||| || |||||||| | ||||||||| ||||| 
Sbjct: 39244 ggcttctccacaacgatggcttgcgtggttagtaccattccagccaccgaggctgcgttt 39303

                                                                         
Query: 265   tggagcgcgcatctcgtcaccttggcggggtcgatgacacccgactcgatcaggttctcg 324
             || | ||| ||||| |||||||| || ||||| || ||||| | ||  | || |||||||
Sbjct: 39304 tgcaacgcacatcttgtcacctttgcagggtcaatcacaccagcctgtaccaagttctcg 39363

                                                                         
Query: 325   tacttgtctgtcatcgcgttgtaacccatctcccactcgctatccttgatcttctcgatc 384
             |   |||| | |||||| ||||| || | |||||| || || ||||||||||| || |  
Sbjct: 39364 tgtctgtcagccatcgcattgtagccaacctcccattcactctccttgatcttttctaca 39423

                                         
Query: 385   acaacttccccttccactccagcgttgt 412
             |  ||||||||||| |||||||| ||||
Sbjct: 39424 atcacttccccttcaactccagcattgt 39451



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 443   ccttctgaatgatgtcagcaccaaggcgctc 473
             |||| |||||||| |||||||||||||||||
Sbjct: 39696 ccttttgaatgatatcagcaccaaggcgctc 39726



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 165/208 (79%)
 Strand = Plus / Plus

                                                                            
Query: 205      ggcttctcgacgacgatcgcttgcgtggtgaggaccattccggacaccgaggcggcgttc 264
                |||||||| || ||||| ||||||||||| || |||||||| | ||||||||| ||||| 
Sbjct: 36067807 ggcttctccacaacgatggcttgcgtggttagtaccattccagccaccgaggctgcgttt 36067866

                                                                            
Query: 265      tggagcgcgcatctcgtcaccttggcggggtcgatgacacccgactcgatcaggttctcg 324
                || | ||| ||||| |||||||| || ||||| || ||||| | ||  | || |||||||
Sbjct: 36067867 tgcaacgcacatcttgtcacctttgcagggtcaatcacaccagcctgtaccaagttctcg 36067926

                                                                            
Query: 325      tacttgtctgtcatcgcgttgtaacccatctcccactcgctatccttgatcttctcgatc 384
                |   |||| | |||||| ||||| || | |||||| || || ||||||||||| || |  
Sbjct: 36067927 tgtctgtcagccatcgcattgtagccaacctcccattcactctccttgatcttttctaca 36067986

                                            
Query: 385      acaacttccccttccactccagcgttgt 412
                |  ||||||||||| |||||||| ||||
Sbjct: 36067987 atcacttccccttcaactccagcattgt 36068014



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                               
Query: 443      ccttctgaatgatgtcagcaccaaggcgctc 473
                |||| |||||||| |||||||||||||||||
Sbjct: 36068259 ccttttgaatgatatcagcaccaaggcgctc 36068289



to top

>gb|DQ295240.1| Uncultured marine bacterium Ant29B7, partial genomic sequence
          Length = 40351

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                  
Query: 536   caccaccaccgggaacaatgccctcctcgatggcagc 572
             ||||||| ||||||||||| |||||||||||||||||
Sbjct: 26691 caccaccgccgggaacaataccctcctcgatggcagc 26655



to top

>ref|XM_814415.1| Trypanosoma cruzi strain CL Brener chaperonin HSP60, mitochondrial
            precursor (Tc00.1047053507641.290) partial mRNA
          Length = 1680

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                       
Query: 536  caccaccaccgggaacaatgccctcct 562
            |||||||||||||||||||||||||||
Sbjct: 1279 caccaccaccgggaacaatgccctcct 1253



to top

>emb|X95971.1|SLGROEL2G S.lividans groEL2 gene
          Length = 2192

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                       
Query: 256  gcggcgttctggagcgcgcatctcgtcaccttggcggggtcga 298
            |||||||||||||||||| | | |||||||||||| |||||||
Sbjct: 1992 gcggcgttctggagcgcggaacgcgtcaccttggccgggtcga 1950



to top

>emb|X67473.1|TCHSP60 T.cruzi hsp60 gene
          Length = 2100

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                       
Query: 536  caccaccaccgggaacaatgccctcct 562
            |||||||||||||||||||||||||||
Sbjct: 1686 caccaccaccgggaacaatgccctcct 1660



to top

>gb|L08791.1|TRBHSP60A Trypanosoma cruzi heat shock protein 60 mRNA, complete cds and
            flanking regions
          Length = 2020

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                       
Query: 536  caccaccaccgggaacaatgccctcct 562
            |||||||||||||||||||||||||||
Sbjct: 1424 caccaccaccgggaacaatgccctcct 1398



to top

>gb|M76658.1|STMGROELY Streptomyces albus open reading frame (GROEL2) gene, complete cds
          Length = 1814

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                       
Query: 256  gcggcgttctggagcgcgcatctcgtcaccttggcggggtcga 298
            |||||||||||||||||| | | |||||||||||| |||||||
Sbjct: 1614 gcggcgttctggagcgcggaacgcgtcaccttggccgggtcga 1572



to top

>gb|AY389619.1| Hyacinthus orientalis chaperonin groEL mRNA, partial cds
          Length = 313

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                       
Query: 195 cttcggcttgggcttctcgacgacgatcgcttgcgtggtgaggaccattccggacaccga 254
           |||||||||||||||||| || || || ||||| || || ||||||||||| | ||||||
Sbjct: 101 cttcggcttgggcttctccaccacaatggcttgtgttgttaggaccattccagccaccga 42



to top

>gb|BT013144.1| Lycopersicon esculentum clone 134139R, mRNA sequence
          Length = 2052

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                        
Query: 325  tacttgtctgtcatcgcgttgtaacccatctcccactcgctatccttgatcttctcgatc 384
            |||||||| ||||| || ||||||||||||| ||| | |||  |||| |||||||| |  
Sbjct: 1676 tacttgtcggtcattgcattgtaacccatcttccatttgctgccctttatcttctccact 1617

                                   
Query: 385  acaacttccccttccactccagc 407
            || ||||||||||| || |||||
Sbjct: 1616 actacttccccttcaaccccagc 1594



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                        
Query: 535  gcaccaccaccgggaacaatgccctcctcgatggcagcgaaagt 578
            ||||||||||| || ||||| ||||| || || |||||||||||
Sbjct: 1466 gcaccaccaccaggtacaattccctcttcaattgcagcgaaagt 1423



to top

>ref|XM_814413.1| Trypanosoma cruzi strain CL Brener chaperonin HSP60, mitochondrial
            precursor (Tc00.1047053507641.280) partial mRNA
          Length = 1683

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 536  caccaccaccgggaacaatgccctcct 562
            ||||||||||||||||||| |||||||
Sbjct: 1273 caccaccaccgggaacaataccctcct 1247



to top

>ref|XM_814417.1| Trypanosoma cruzi strain CL Brener chaperonin HSP60, mitochondrial
           precursor (Tc00.1047053507641.300) partial mRNA
          Length = 787

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 536 caccaccaccgggaacaatgccctcct 562
           ||||||||||||||||||| |||||||
Sbjct: 377 caccaccaccgggaacaataccctcct 351



to top

>ref|NM_128359.3| Arabidopsis thaliana CPN60A; ATP binding / protein binding AT2G28000
            (CPN60A) mRNA, complete cds
          Length = 2103

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 535  gcaccaccaccgggaacaatgccctcctcgatggcagc 572
            ||||||||||| ||||| ||||| |||||||| |||||
Sbjct: 1519 gcaccaccacctggaactatgccttcctcgatagcagc 1482



to top

>gb|BT008784.1| Arabidopsis thaliana At2g28000 gene, complete cds
          Length = 1761

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 535  gcaccaccaccgggaacaatgccctcctcgatggcagc 572
            ||||||||||| ||||| ||||| |||||||| |||||
Sbjct: 1382 gcaccaccacctggaactatgccttcctcgatagcagc 1345



to top

>emb|Z27222.1|BNPLCAS B.napus mRNA for plastid chaperonin-60 alpha subunit
          Length = 1975

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 373  atcttctcgatcacaacttccccttccactccagcgtt 410
            |||||||| | ||||||||||||||| | |||||||||
Sbjct: 1588 atcttctccaccacaacttccccttcgattccagcgtt 1551



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 538  ccaccaccgggaacaatgccctcctcgatggcagcgaa 575
            |||||||||||||| || || |||||||| ||||||||
Sbjct: 1426 ccaccaccgggaactattccttcctcgatagcagcgaa 1389



to top

>emb|X95992.1|EGHSP60GN E.gracilis mRNA for heat shock protein 60
          Length = 1946

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 535  gcaccaccaccgggaacaatgccctc 560
            ||||||||||||||||| ||||||||
Sbjct: 1297 gcaccaccaccgggaacgatgccctc 1272



to top

>gb|AC006929.4| Arabidopsis thaliana chromosome 2 clone T1E2 map mi54, complete
             sequence
          Length = 94884

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                   
Query: 535   gcaccaccaccgggaacaatgccctcctcgatggcagc 572
             ||||||||||| ||||| ||||| |||||||| |||||
Sbjct: 32299 gcaccaccacctggaactatgccttcctcgatagcagc 32336



to top

>dbj|AK222126.1| Arabidopsis thaliana mRNA for putative rubisco subunit
           binding-protein alpha subunit, partial cds, clone:
           RAFL22-94-G01
          Length = 1181

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 535 gcaccaccaccgggaacaatgccctcctcgatggcagc 572
           ||||||||||| ||||| ||||| |||||||| |||||
Sbjct: 623 gcaccaccacctggaactatgccttcctcgatagcagc 586



to top

>dbj|AK222099.1| Arabidopsis thaliana mRNA for putative rubisco subunit
           binding-protein alpha subunit, partial cds, clone:
           RAFL22-88-A01
          Length = 645

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 535 gcaccaccaccgggaacaatgccctcctcgatggcagc 572
           ||||||||||| ||||| ||||| |||||||| |||||
Sbjct: 110 gcaccaccacctggaactatgccttcctcgatagcagc 73



to top

>gb|U49357.1|ATU49357 Arabidopsis thaliana chaperonin-60 alpha subunit gene, nuclear gene
            encoding plastid protein, complete cds
          Length = 4365

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 535  gcaccaccaccgggaacaatgccctcctcgatggcagc 572
            ||||||||||| ||||| ||||| |||||||| |||||
Sbjct: 2774 gcaccaccacctggaactatgccttcctcgatagcagc 2737



to top

>emb|BX819680.1|CNS0A9ZT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS16ZF10 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 2019

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 535  gcaccaccaccgggaacaatgccctcctcgatggcagc 572
            ||||||||||| ||||| ||||| |||||||| |||||
Sbjct: 1448 gcaccaccacctggaactatgccttcctcgatagcagc 1411



to top

>gb|AY086555.1| Arabidopsis thaliana clone 25773 mRNA, complete sequence
          Length = 1996

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 535  gcaccaccaccgggaacaatgccctcctcgatggcagc 572
            ||||||||||| ||||| ||||| |||||||| |||||
Sbjct: 1459 gcaccaccacctggaactatgccttcctcgatagcagc 1422



to top

>gb|BT002441.1| Arabidopsis thaliana putative rubisco subunit binding-protein alpha
            subunit (At2g28000) mRNA, complete cds
          Length = 2020

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 535  gcaccaccaccgggaacaatgccctcctcgatggcagc 572
            ||||||||||| ||||| ||||| |||||||| |||||
Sbjct: 1464 gcaccaccacctggaactatgccttcctcgatagcagc 1427



to top

>gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome
          Length = 3345170

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 282    caccttggcggggtcgatgacacccgact 310
              |||||| || |||||||||||||||||||
Sbjct: 423825 caccttcgccgggtcgatgacacccgact 423853



to top

>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence
          Length = 3181762

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 255    ggcggcgttctggagcgcgca 275
              |||||||||||||||||||||
Sbjct: 752794 ggcggcgttctggagcgcgca 752774



to top

>gb|BT013632.1| Lycopersicon esculentum clone 132434F, mRNA sequence
          Length = 2127

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 536  caccaccaccgggaacaatgccctc 560
            |||||||||| ||||||||||||||
Sbjct: 1435 caccaccacctggaacaatgccctc 1411



to top

>gb|AY545024.1| Burkholderia pseudomallei clone BPtf0037 putative AraC/XylS family
           transcription factor gene, complete cds
          Length = 984

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 255 ggcggcgttctggagcgcgca 275
           |||||||||||||||||||||
Sbjct: 69  ggcggcgttctggagcgcgca 89



to top

>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence
          Length = 3173005

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 255     ggcggcgttctggagcgcgca 275
               |||||||||||||||||||||
Sbjct: 2073040 ggcggcgttctggagcgcgca 2073020



to top

>emb|BX569694.1| Synechococcus sp. WH8102 complete genome; segment 6/7
          Length = 349122

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 538   ccaccaccgggaacaatgccctcctcgat 566
             |||||||||||||||||||| || |||||
Sbjct: 29709 ccaccaccgggaacaatgccttcttcgat 29681



to top

>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 365   tatccttgatcttctcgatca 385
             |||||||||||||||||||||
Sbjct: 69531 tatccttgatcttctcgatca 69511



to top

>gb|CP000123.1| Mycoplasma capricolum subsp. capricolum ATCC 27343, complete genome
          Length = 1010023

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 50     acctttttcactttcaattga 70
              |||||||||||||||||||||
Sbjct: 146204 acctttttcactttcaattga 146184



to top

>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence
          Length = 2325379

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 255     ggcggcgttctggagcgcgca 275
               |||||||||||||||||||||
Sbjct: 1647447 ggcggcgttctggagcgcgca 1647427



to top

>dbj|AK047518.1| Mus musculus 10 days neonate cerebellum cDNA, RIKEN full-length
            enriched library, clone:B930082I23
            product:unclassifiable, full insert sequence
          Length = 3307

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 478  tggtcttcaattgtttctttg 498
            |||||||||||||||||||||
Sbjct: 2488 tggtcttcaattgtttctttg 2508



to top

>gb|U21105.1|PSU21105 Pisum sativum alphacpn60 precursor (alphacpn60) mRNA, complete cds;
            nuclear gene for mitochondrial product
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                             
Query: 199  ggcttgggcttctcgacgacgatcgcttgcgtggtgaggaccattccgg 247
            ||||||||||| ||||||||||| || || ||||| | |||||| ||||
Sbjct: 1751 ggcttgggcttttcgacgacgatggcctgtgtggttaagaccatcccgg 1703



to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 249     caccgaggcggcgttctggagcgcg 273
               |||||| ||||||||||||||||||
Sbjct: 2700886 caccgacgcggcgttctggagcgcg 2700910



to top

>gb|AC115740.8| Mus musculus chromosome 3, clone RP23-476G18, complete sequence
          Length = 226125

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 478    tggtcttcaattgtttctttg 498
              |||||||||||||||||||||
Sbjct: 150239 tggtcttcaattgtttctttg 150259



to top

>dbj|AB039274.1| Propionibacterium granulosum hsp60 gene for 60 kDa heat shock
            protein, partial cds
          Length = 1688

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                             
Query: 253  gaggcggcgttctggagcgcgcatctcgtcaccttggcggggtcgatga 301
            |||| ||||||||| || ||| | | |||||||||||| ||||||||||
Sbjct: 1606 gaggaggcgttctgcagggcggaacgcgtcaccttggccgggtcgatga 1558



to top

>gb|AY780524.1| Ictalurus punctatus heat shock protein 60-like mRNA, partial
           sequence
          Length = 186

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 538 ccaccaccgggaacaatgccctcctcga 565
           ||||| ||||||||||||||||| ||||
Sbjct: 59  ccacctccgggaacaatgccctcttcga 32



to top

>gb|AC137713.8| Mus musculus chromosome 15, clone RP24-468P6, complete sequence
          Length = 155341

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 504    agggacataggtagataggt 523
              ||||||||||||||||||||
Sbjct: 126402 agggacataggtagataggt 126383



to top

>gb|AC129290.4| Mus musculus BAC clone RP24-489L4 from chromosome 6, complete sequence
          Length = 188132

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 96     cctgaactgaagcatctaaa 115
              ||||||||||||||||||||
Sbjct: 123998 cctgaactgaagcatctaaa 124017



to top

>emb|BX572599.1| Rhodopseudomonas palustris CGA009 complete genome; segment 7/16
          Length = 349142

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 249    caccgaggcggcgttctgga 268
              ||||||||||||||||||||
Sbjct: 344526 caccgaggcggcgttctgga 344545



to top

>gb|AC105337.7| Homo sapiens chromosome 17, clone CTD-2116F7, complete sequence
          Length = 126083

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 434  cttgcaatgccttctgaatg 453
            ||||||||||||||||||||
Sbjct: 9004 cttgcaatgccttctgaatg 9023



to top

>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome
          Length = 4940217

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 198     cggcttgggcttctcgacga 217
               ||||||||||||||||||||
Sbjct: 2275572 cggcttgggcttctcgacga 2275553



to top

>gb|AY688374.2| Lates calcarifer parvalbumin beta-1 gene, complete cds
          Length = 2749

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 445  ttctgaatgatgtcagcacc 464
            ||||||||||||||||||||
Sbjct: 1748 ttctgaatgatgtcagcacc 1767



to top

>gb|AC138405.6| Mus musculus chromosome 1, clone RP24-280N11, complete sequence
          Length = 151783

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 190    ttagccttcggcttgggctt 209
              ||||||||||||||||||||
Sbjct: 147389 ttagccttcggcttgggctt 147408



to top

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 282     caccttggcggggtcgatga 301
               ||||||||||||||||||||
Sbjct: 8267338 caccttggcggggtcgatga 8267319



to top

>dbj|BA000035.2| Corynebacterium efficiens YS-314 DNA, complete genome
          Length = 3147090

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 283    accttggcggggtcgatgacaccc 306
              |||||| |||||||||||||||||
Sbjct: 639066 accttgacggggtcgatgacaccc 639043



to top

>emb|AJ338304.1|HSA338304 Homo sapiens genomic sequence surrounding NotI site, clone
           NR1-PA22RS
          Length = 717

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 477 gtggtcttcaattgtttctt 496
           ||||||||||||||||||||
Sbjct: 522 gtggtcttcaattgtttctt 541



to top

>gb|AC147627.6| Mus musculus BAC clone RP24-382F19 from Y, complete sequence
          Length = 226237

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 99     gaactgaagcatctaaaaaa 118
              ||||||||||||||||||||
Sbjct: 206536 gaactgaagcatctaaaaaa 206517



to top

>gb|AF062920.1|AF062920 Thermus aquaticus DNA polymerase III (dnaE) gene, complete cds
          Length = 4526

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 253  gaggcggcgttctggagcgcgcatctcgtcaccttggcggggtc 296
            |||||||||||||| || ||| | |  |||||||||||||||||
Sbjct: 4104 gaggcggcgttctgcagggcggagcgggtcaccttggcggggtc 4147



to top

>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome
          Length = 4941439

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 198     cggcttgggcttctcgacga 217
               ||||||||||||||||||||
Sbjct: 2297918 cggcttgggcttctcgacga 2297899



to top

>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence
          Length = 2914771

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 256    gcggcgttctggagcgcgca 275
              ||||||||||||||||||||
Sbjct: 995302 gcggcgttctggagcgcgca 995321



to top

>gb|AC173476.2| Mus musculus BAC clone RP24-335D7 from chromosome 12, complete sequence
          Length = 182245

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 99     gaactgaagcatctaaaaaa 118
              ||||||||||||||||||||
Sbjct: 115349 gaactgaagcatctaaaaaa 115330



to top

>gb|U57000.1|TVU57000 Trichomonas vaginalis chaperonin 60 (cpn60) mRNA, partial cds
          Length = 1678

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 537  accaccaccgggaacaatgccctcctcgatggcagc 572
            ||||||||| | ||| ||||| ||||||||||||||
Sbjct: 1252 accaccaccagcaacgatgccttcctcgatggcagc 1217



to top

>gb|L27472.1|CRECPN1B Chlamydomonas reinhardtii chaperonin alpha-like subunit, complete cds
          Length = 2420

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 280  gtcaccttggcggggtcgat 299
            ||||||||||||||||||||
Sbjct: 1609 gtcaccttggcggggtcgat 1590



to top

>emb|AL591762.13| Mouse DNA sequence from clone RP23-465I6 on chromosome 2, complete
              sequence
          Length = 137773

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 434    cttgcaatgccttctgaatg 453
              ||||||||||||||||||||
Sbjct: 109544 cttgcaatgccttctgaatg 109563


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,006,005
Number of Sequences: 3902068
Number of extensions: 4006005
Number of successful extensions: 79888
Number of sequences better than 10.0: 74
Number of HSP's better than 10.0 without gapping: 74
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 79065
Number of HSP's gapped (non-prelim): 799
length of query: 578
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 555
effective length of database: 17,143,297,704
effective search space: 9514530225720
effective search space used: 9514530225720
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top