ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags23h04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT016462.1| Zea mays clone Contig295 mRNA sequence 276 8e-71
2gb|AY914601.1| Zea mays heat shock protein 70 mRNA, partial cds 276 8e-71
3gb|AY109330.1| Zea mays CL45_1 mRNA sequence 276 8e-71
4gb|BT016812.1| Zea mays clone Contig645 mRNA sequence 268 2e-68
5emb|X78415.1|ZMHSP705 Z.mays (cv DH5xDH7) hsp70-5 mRNA for heat ... 260 5e-66
6gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome... 258 2e-65
7dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 258 2e-65
8ref|XM_475365.1| Oryza sativa (japonica cultivar-group), predic... 254 3e-64
9gb|AC134045.2| Oryza sativa (japonica cultivar-group) chromosome... 240 4e-60
10emb|X67711.2|OSHSC70A O.sativa hsp70 gene for heat shock protein 70 240 4e-60
11dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 240 4e-60
12dbj|AK119710.1| Oryza sativa (japonica cultivar-group) cDNA clon... 240 4e-60
13dbj|AK119255.1| Oryza sativa (japonica cultivar-group) cDNA clon... 240 4e-60
14dbj|AK065431.1| Oryza sativa (japonica cultivar-group) cDNA clon... 240 4e-60
15gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 240 4e-60
16emb|X78414.1|ZMHSP704 Z.mays (cv DH5xDH7) hsp70-4 mRNA for heat ... 226 6e-56
17gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 216 6e-53
18gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare str... 216 6e-53
19dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 216 6e-53
20gb|AC137698.1| Genomic sequence for Oryza sativa, Nipponbare str... 216 6e-53
21dbj|AK109474.1| Oryza sativa (japonica cultivar-group) cDNA clon... 216 6e-53
22dbj|AK099275.1| Oryza sativa (japonica cultivar-group) cDNA clon... 216 6e-53
23dbj|AK072830.1| Oryza sativa (japonica cultivar-group) cDNA clon... 216 6e-53
24ref|XM_470141.1| Oryza sativa (japonica cultivar-group), mRNA 210 4e-51
25gb|AC104433.8| Oryza sativa chromosome 3 BAC OJ1754_E06 genomic ... 210 4e-51
26dbj|AK102784.1| Oryza sativa (japonica cultivar-group) cDNA clon... 210 4e-51
27dbj|AK069740.1| Oryza sativa (japonica cultivar-group) cDNA clon... 210 4e-51
28ref|NM_190528.1| Oryza sativa (japonica cultivar-group), predic... 208 1e-50
29dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 208 1e-50
30dbj|AP003241.3| Oryza sativa (japonica cultivar-group) genomic D... 208 1e-50
31dbj|AP003231.3| Oryza sativa (japonica cultivar-group) genomic D... 208 1e-50
32gb|U41653.1|SBU41653 Sorghum bicolor heat shock protein 70 (hsp7... 186 5e-44
33gb|AF005993.1|AF005993 Triticum aestivum 70 kDa heat shock prote... 174 2e-40
34gb|BT016692.1| Zea mays clone Contig525 mRNA sequence 167 5e-38
35gb|BT018649.1| Zea mays clone EL01N0505F04.d mRNA sequence 167 5e-38
36emb|X03697.1|ZMHSP702 Maize gene for heat shock protein 70 exon ... 161 3e-36
37gb|AF479058.1| Sandersonia aurantiaca 70 kDa heat shock protein ... 161 3e-36
38gb|AY104350.1| Zea mays PCO083553 mRNA sequence 159 1e-35
39emb|X61491.1|SOSCE70 S.oleracea sce70 mRNA for 70 kDa heat shock... 141 3e-30
40gb|AF034618.1|AF034618 Spinacia oleracea cytosolic heat shock 70... 141 3e-30
41gb|L26243.1|SPIC70A Spinacia oleracea heat shock C70 protein mRN... 141 3e-30
42gb|AY106152.1| Zea mays PCO094428 mRNA sequence 129 1e-26
43emb|AJ249331.1|CSA249331 Cucumis sativus mRNA for heat shock pro... 127 4e-26
44gb|AY257488.1| Lycopersicon esculentum HSC2-like mRNA, partial s... 123 7e-25
45gb|AF161180.1|AF161180 Malus domestica high molecular weight hea... 123 7e-25
46dbj|AB012716.1| Salix gilgiana Hsc70 mRNA for heat shock protein... 119 1e-23
47gb|AF527796.1| Cucurbita maxima cell-autonomous heat shock cogna... 115 2e-22
48gb|AF033852.1|AF033852 Spinacia oleracea cytosolic heat shock 70... 105 2e-19
49gb|AF034617.1|AF034617 Spinacia oleracea cytosolic heat shock 70... 105 2e-19
50gb|AF034616.1|AF034616 Spinacia oleracea cytosolic heat shock 70... 105 2e-19
51gb|AF527795.1| Cucurbita maxima non-cell-autonomous heat shock c... 101 2e-18
52dbj|AB112816.1| Nicotiana benthamiana Hsp70 mRNA for heat shock ... 100 1e-17
53gb|AF509339.1| Saussurea medusa heat shock protein 70 (HSP70) mR... 98 4e-17
54gb|AC150776.2| Medicago truncatula chromosome 7 BAC clone mte1-4... 98 4e-17
55gb|AF527794.1| Cucurbita maxima non-cell-autonomous heat shock c... 98 4e-17
56dbj|AB105430.2| Nicotiana benthamiana Hsp70 mRNA for heat shock ... 98 4e-17
57dbj|AB112814.1| Nicotiana benthamiana Hsp70 mRNA for heat shock ... 98 4e-17
58gb|AF002667.1|SCAF002667 Solanum commersonii heat shock cognate ... 98 4e-17
59gb|AY694190.1| Camellia sinensis HSP70 (hsp70) mRNA, partial cds 96 2e-16
60gb|AY836799.1| Saussurea medusa heat shock protein hsp70 gene, c... 90 9e-15
61gb|AY372071.1| Nicotiana tabacum heat shock protein 70-3 (HSP70-... 90 9e-15
62gb|AY253326.1| Nicotiana tabacum heat shock protein 70 (Hsp70) m... 90 9e-15
63gb|AF509336.1| Saussurea medusa heat shock protein 70 (HSP70) mR... 90 9e-15
64gb|AY485986.1| Vigna radiata 70 kDa heat shock cognate protein 1... 84 6e-13
65gb|AY261674.1| Citrus x paradisi HSP70 mRNA, partial cds 84 6e-13
66gb|AF035414.1|AF035414 Brassica napus heat shock cognate protein... 84 6e-13
67gb|BT013586.1| Lycopersicon esculentum clone 132340F, mRNA sequence 82 2e-12
68emb|X54029.1|LEHSC170 Lycopersicon esculentum hsc-1 mRNA for hea... 82 2e-12
69gb|DQ124007.1| Coffea arabica x Coffea canephora clone HT-SSH4-F... 82 2e-12
70gb|AY830127.1| Medicago sativa heat shock protein 70 (HSP70-1) m... 78 4e-11
71gb|AC146757.19| Medicago truncatula clone mth2-16n21, complete s... 78 4e-11
72gb|AC147536.12| Medicago truncatula clone mth2-9l3, complete seq... 78 4e-11
73ref|NM_120328.2| Arabidopsis thaliana HSC70-1; ATP binding AT5G0... 74 6e-10
74emb|X99197.1|MS70KDHSP M.sativa mRNA for 70 kD heat shock protein 74 6e-10
75emb|X77199.1|ATHSC701 A.thaliana hsc70-1 gene 74 6e-10
76emb|X74604.1|ATHSC70 A.thaliana hsc70 mRNA for heat shock cognat... 74 6e-10
77gb|AY035123.1| Arabidopsis thaliana putative dnaK-type molecular... 74 6e-10
78emb|AL162971.1|ATT22P11 Arabidopsis thaliana DNA chromosome 5, B... 74 6e-10
79gb|AY120747.1| Arabidopsis thaliana DnaK-type molecular chaperon... 74 6e-10
80gb|AY057481.1| Arabidopsis thaliana AT5g02500/T22P11_90 mRNA, co... 74 6e-10
81emb|BX832460.1|CNS0A1Q8 Arabidopsis thaliana Full-length cDNA Co... 74 6e-10
82gb|BT002754.1| Arabidopsis thaliana clone C104920 putative dnaK-... 74 6e-10
83gb|AY929184.1| Latimeria chalumnae heat shock protein 70 (Hsp70)... 74 6e-10
84emb|X54030.1|LEHSC270 Lycopersicon esculentum hsc-2 mRNA for hea... 72 2e-09
85gb|DQ324856.1| Haliotis discus hannai heat shock protein 70 mRNA... 72 2e-09
86gb|S85730.1| hsc71=major heat-shock-protein-like gene [rainbow t... 68 3e-08
87dbj|AB196460.1| Oncorhynchus mykiss HSC70A mRNA for heat shock 7... 68 3e-08
88gb|AY485987.1| Vigna radiata 70 kDa heat shock cognate protein 2... 66 1e-07
89emb|X62799.1|GMHSP70 Glycine max hsp 70 gene 66 1e-07
90gb|DQ295224.1| Malawimonas jakobiformis cytosolic heat shock pro... 66 1e-07
91gb|L41253.1|TOMHSC70A Lycopersicon esculentum Hsc70 gene, comple... 66 1e-07
92dbj|AB112815.1| Nicotiana benthamiana Hsp70 mRNA for heat shock ... 66 1e-07
93ref|NM_120327.3| Arabidopsis thaliana ATP binding AT5G02490 mRNA... 64 5e-07
94gb|BC077998.1| Xenopus laevis cDNA clone MGC:82390 IMAGE:4406669... 64 5e-07
95gb|BT008411.1| Arabidopsis thaliana At5g02490 gene, complete cds 64 5e-07
96gb|AY093152.1| Arabidopsis thaliana DnaK-type molecular chaperon... 64 5e-07
97emb|Y08892.1|ATHSC70G8 A.thaliana mRNA for Hsc70-G8 protein, par... 64 5e-07
98gb|DQ059998.1| Volvox carteri f. nagariensis heat-shock inducibl... 62 2e-06
99gb|DQ059999.1| Volvox carteri f. nagariensis heat-shock inducibl... 62 2e-06
100ref|NM_104519.1| Arabidopsis thaliana HSP70T-1; ATP binding AT1G... 60 8e-06
101gb|DQ446367.1| Arabidopsis thaliana clone pENTR221-At1g56410 hea... 60 8e-06
102emb|X51765.1|LPHSP70 L.polyphyllus mRNA for heat schock protein 70 60 8e-06
103gb|AC058785.8|AC058785 Arabidopsis thaliana chromosome 1 BAC F13... 60 8e-06
104emb|CR735051.2|CNS0GTY2 Tetraodon nigroviridis full-length cDNA 58 3e-05
105emb|CR734665.2|CNS0GTNC Tetraodon nigroviridis full-length cDNA 58 3e-05
106emb|CR732389.2|CNS0GS22 Tetraodon nigroviridis full-length cDNA 58 3e-05
107emb|CR731254.2|CNS0GR6J Tetraodon nigroviridis full-length cDNA 58 3e-05
108emb|CR730967.2|CNS0GQYK Tetraodon nigroviridis full-length cDNA 58 3e-05
109emb|CR730283.2|CNS0GQFK Tetraodon nigroviridis full-length cDNA 58 3e-05
110emb|CR729311.2|CNS0GPOL Tetraodon nigroviridis full-length cDNA 58 3e-05
111emb|CR725754.2|CNS0GMXS Tetraodon nigroviridis full-length cDNA 58 3e-05
112emb|CR724374.2|CNS0GLVG Tetraodon nigroviridis full-length cDNA 58 3e-05
113emb|CR722706.2|CNS0GKL4 Tetraodon nigroviridis full-length cDNA 58 3e-05
114emb|CR719367.2|CNS0GI0D Tetraodon nigroviridis full-length cDNA 58 3e-05
115emb|CR716753.2|CNS0GFZU Tetraodon nigroviridis full-length cDNA 58 3e-05
116emb|CR711358.2|CNS0GBU2 Tetraodon nigroviridis full-length cDNA 58 3e-05
117emb|CR703631.2|CNS0G5VF Tetraodon nigroviridis full-length cDNA 58 3e-05
118emb|CR699773.2|CNS0G2W9 Tetraodon nigroviridis full-length cDNA 58 3e-05
119emb|CR700210.2|CNS0G38E Tetraodon nigroviridis full-length cDNA 58 3e-05
120emb|CR699628.2|CNS0G2S8 Tetraodon nigroviridis full-length cDNA 58 3e-05
121emb|CR699327.2|CNS0G2JV Tetraodon nigroviridis full-length cDNA 58 3e-05
122emb|CR698441.2|CNS0G1V9 Tetraodon nigroviridis full-length cDNA 58 3e-05
123emb|CR696974.2|CNS0G0QI Tetraodon nigroviridis full-length cDNA 58 3e-05
124emb|CR696115.2|CNS0G02N Tetraodon nigroviridis full-length cDNA 58 3e-05
125emb|CR694651.2|CNS0FYXZ Tetraodon nigroviridis full-length cDNA 58 3e-05
126emb|CR693639.2|CNS0FY5V Tetraodon nigroviridis full-length cDNA 58 3e-05
127emb|CR691059.2|CNS0FW67 Tetraodon nigroviridis full-length cDNA 58 3e-05
128emb|CR688768.2|CNS0FUEK Tetraodon nigroviridis full-length cDNA 58 3e-05
129emb|CR688743.2|CNS0FUDV Tetraodon nigroviridis full-length cDNA 58 3e-05
130emb|CR688098.2|CNS0FTVY Tetraodon nigroviridis full-length cDNA 58 3e-05
131emb|CR685229.2|CNS0FRO9 Tetraodon nigroviridis full-length cDNA 58 3e-05
132emb|CR684600.2|CNS0FR6S Tetraodon nigroviridis full-length cDNA 58 3e-05
133emb|CR682045.2|CNS0FP7T Tetraodon nigroviridis full-length cDNA 58 3e-05
134emb|CR682007.2|CNS0FP6R Tetraodon nigroviridis full-length cDNA 58 3e-05
135emb|CR681947.2|CNS0FP53 Tetraodon nigroviridis full-length cDNA 58 3e-05
136emb|CR681557.2|CNS0FOU9 Tetraodon nigroviridis full-length cDNA 58 3e-05
137emb|CR680840.2|CNS0FOAC Tetraodon nigroviridis full-length cDNA 58 3e-05
138emb|CR680599.1|CNS0FO3N Tetraodon nigroviridis full-length cDNA 58 3e-05
139emb|CR674390.2|CNS0FJBW Tetraodon nigroviridis full-length cDNA 58 3e-05
140emb|CR673444.2|CNS0FILM Tetraodon nigroviridis full-length cDNA 58 3e-05
141emb|CR668849.2|CNS0FF1Z Tetraodon nigroviridis full-length cDNA 58 3e-05
142emb|CR668292.2|CNS0FEMI Tetraodon nigroviridis full-length cDNA 58 3e-05
143emb|CR666588.2|CNS0FDB6 Tetraodon nigroviridis full-length cDNA 58 3e-05
144emb|CR664947.2|CNS0FC1L Tetraodon nigroviridis full-length cDNA 58 3e-05
145emb|CR664739.2|CNS0FBVT Tetraodon nigroviridis full-length cDNA 58 3e-05
146emb|CR664071.2|CNS0FBD9 Tetraodon nigroviridis full-length cDNA 58 3e-05
147emb|CR663097.2|CNS0FAM7 Tetraodon nigroviridis full-length cDNA 58 3e-05
148emb|CR662148.2|CNS0F9VU Tetraodon nigroviridis full-length cDNA 58 3e-05
149emb|CR657309.2|CNS0F65F Tetraodon nigroviridis full-length cDNA 58 3e-05
150emb|CR656869.2|CNS0F5T7 Tetraodon nigroviridis full-length cDNA 58 3e-05
151emb|CR655448.1|CNS0F4PQ Tetraodon nigroviridis full-length cDNA 58 3e-05
152emb|CR656433.1|CNS0F5H3 Tetraodon nigroviridis full-length cDNA 58 3e-05
153emb|CR656379.1|CNS0F5FL Tetraodon nigroviridis full-length cDNA 58 3e-05
154emb|CR656173.1|CNS0F59V Tetraodon nigroviridis full-length cDNA 58 3e-05
155emb|CR655567.2|CNS0F4T1 Tetraodon nigroviridis full-length cDNA 58 3e-05
156emb|CR654938.1|CNS0F4BK Tetraodon nigroviridis full-length cDNA 58 3e-05
157emb|CR654405.2|CNS0F3WR Tetraodon nigroviridis full-length cDNA 58 3e-05
158emb|CR654109.2|CNS0F3OJ Tetraodon nigroviridis full-length cDNA 58 3e-05
159emb|CR654231.1|CNS0F3RX Tetraodon nigroviridis full-length cDNA 58 3e-05
160emb|CR651953.2|CNS0F20N Tetraodon nigroviridis full-length cDNA 58 3e-05
161emb|CR651660.2|CNS0F1SI Tetraodon nigroviridis full-length cDNA 58 3e-05
162emb|CR651251.2|CNS0F1H5 Tetraodon nigroviridis full-length cDNA 58 3e-05
163emb|CR650378.1|CNS0F0SW Tetraodon nigroviridis full-length cDNA 58 3e-05
164emb|CR649698.2|CNS0F0A0 Tetraodon nigroviridis full-length cDNA 58 3e-05
165emb|CR648821.2|CNS0EZLN Tetraodon nigroviridis full-length cDNA 58 3e-05
166emb|CR643803.1|CNS0EVQ9 Tetraodon nigroviridis full-length cDNA 58 3e-05
167emb|CR641941.2|CNS0EUAJ Tetraodon nigroviridis full-length cDNA 58 3e-05
168emb|CR638956.2|CNS0ERZM Tetraodon nigroviridis full-length cDNA 58 3e-05
169emb|CR633864.2|CNS0EO26 Tetraodon nigroviridis full-length cDNA 58 3e-05
170emb|Z32537.1|PSHSC71R P.sativum (little marvel) HSC71.0 mRNA 58 3e-05
171emb|X13301.1|PHHSP70R Petunia mRNA for heat shock protein hsp70 58 3e-05
172emb|X06932.1|PHHSP70G Petunia hsp70 gene 58 3e-05
173ref|XM_686300.1| PREDICTED: Danio rerio similar to heat shock co... 58 3e-05
174dbj|AK222068.1| Arabidopsis thaliana mRNA for dnaK-type molecula... 58 3e-05
175gb|BC091445.1| Danio rerio cDNA clone IMAGE:7286763, containing ... 58 3e-05
176emb|AJ249330.1|CSA249330 Cucumis sativus mRNA for heat shock pro... 56 1e-04
177emb|CR734111.2|CNS0GT7Y Tetraodon nigroviridis full-length cDNA 56 1e-04
178emb|CR728102.2|CNS0GOR0 Tetraodon nigroviridis full-length cDNA 56 1e-04
179emb|CR703946.1|CNS0G646 Tetraodon nigroviridis full-length cDNA 56 1e-04
180emb|CR683400.2|CNS0FQ9G Tetraodon nigroviridis full-length cDNA 56 1e-04
181emb|CR656537.1|CNS0F5JZ Tetraodon nigroviridis full-length cDNA 56 1e-04
182gb|U23504.1|TNU23504 Trichoplusia ni HSC70 mRNA, complete cds 56 1e-04
183ref|NM_112093.1| Arabidopsis thaliana HSP70; ATP binding AT3G125... 54 5e-04
184emb|CR626889.13| Zebrafish DNA sequence from clone DKEY-4P15 in ... 54 5e-04
185gb|AY762969.1| Acanthopagrus schlegelii HSC70 (HSC70) mRNA, comp... 54 5e-04
186emb|AJ002551.1|ATAJ2551 Arabidopsis thaliana mRNA for heat shock... 54 5e-04
187gb|M76725.2| Chlamydomonas reinhardtii 70 kDa heat shock protein... 54 5e-04
188gb|AY029210.1| Ambystoma mexicanum heat shock protein 70 (HSP70)... 54 5e-04
189gb|AY059885.1| Arabidopsis thaliana 70 kDa heat shock protein (T... 54 5e-04
190gb|AY054190.1| Arabidopsis thaliana AT3g12580/T2E22_110 mRNA, co... 54 5e-04
191gb|AY054183.1| Arabidopsis thaliana AT3g12580/T2E22_110 mRNA, co... 54 5e-04
192gb|AC069474.4|AC069474 Arabidopsis thaliana chromosome 3 BAC T2E... 54 5e-04
193gb|AY436786.1| Rhabdosargus sarba heat shock cognate 70 (hsc70) ... 54 5e-04
194dbj|AP002055.2| Arabidopsis thaliana genomic DNA, chromosome 3, ... 54 5e-04
195gb|AY456093.1| Phytophthora nicotianae heat shock protein 70 (Hs... 52 0.002
196gb|AY219845.1| Cyprinus carpio constitutive heat shock protein H... 52 0.002
197dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c... 52 0.002
198dbj|AB196461.1| Oncorhynchus mykiss HSC70B mRNA for heat shock 7... 52 0.002
199gb|AF194819.1|AF194819 Manduca sexta heat shock cognate 70 prote... 52 0.002
200dbj|AB092840.1| Carassius auratus HSC70 mRNA for heat shock cogn... 52 0.002
201gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete... 52 0.002
202gb|AY485988.1| Vigna radiata 70 kDa heat shock cognate protein 3... 50 0.008
203gb|AY423868.1| Leishmania tarentolae 70 kDa heat shock protein (... 50 0.008
204gb|AY078499.4| Dunaliella salina heat shock protein 70a (HSP70) ... 50 0.008
205emb|X52314.1|LDHSP70 Leishmania hsp70 gene for heat shock protei... 50 0.008
206emb|BX833094.1|CNS0A0GB Arabidopsis thaliana Full-length cDNA Co... 50 0.008
207emb|Z30176.1|TRMHSP70 T.repens (Huia) mRNA for heat shock protei... 50 0.008
208gb|U26448.1|EGU26448 Echinococcus granulosus heat shock 70 kDa p... 50 0.008
209gb|U08820.1|PSU08820 Pisum sativum HSP70b mRNA, partial cds 50 0.008
210gb|BT023894.1| Drosophila melanogaster LP19893 full insert cDNA 48 0.032
211ref|XM_882866.1| PREDICTED: Bos taurus similar to Rab GTPase bin... 48 0.032
212ref|XM_882853.1| PREDICTED: Bos taurus similar to Rab GTPase bin... 48 0.032
213ref|XM_882846.1| PREDICTED: Bos taurus similar to Rab GTPase bin... 48 0.032
214ref|XM_869715.1| PREDICTED: Bos taurus similar to Rab GTPase bin... 48 0.032
215gb|AY913842.2| Leishmania donovani strain DD8 heat shock protein... 48 0.032
216gb|AY524794.1| Thellungiella halophila heat shock cognate protei... 48 0.032
217emb|CR723474.2|CNS0GL6G Tetraodon nigroviridis full-length cDNA 48 0.032
218ref|XM_797036.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.032
219ref|XM_797035.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.032
220ref|XM_797034.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.032
221ref|XM_776060.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.032
222ref|XM_797027.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.032
223ref|XM_797023.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.032
224emb|Y08020.1|LIHSP706 L.infantum hsp70 gene, clone B2g6 48 0.032
225emb|AJ004940.1|GGAJ4940 Gallus gallus mRNA for heat shock cognat... 48 0.032
226emb|Y08019.1|LIHSP701 L.infantum hsp70 gene, clone B2g1 48 0.032
227ref|NM_176503.1| Drosophila melanogaster Heat shock protein cogn... 48 0.032
228ref|NM_176502.1| Drosophila melanogaster Heat shock protein cogn... 48 0.032
229ref|NM_169627.1| Drosophila melanogaster Heat shock protein cogn... 48 0.032
230ref|NM_169626.1| Drosophila melanogaster Heat shock protein cogn... 48 0.032
231ref|NM_169625.1| Drosophila melanogaster Heat shock protein cogn... 48 0.032
232dbj|AB167744.1| Numida meleagris hspa8 mRNA for heat shock prote... 48 0.032
233ref|NM_079632.4| Drosophila melanogaster Heat shock protein cogn... 48 0.032
234gb|AY084193.1| Drosophila melanogaster RH04426 full insert cDNA 48 0.032
235ref|XM_694544.1| PREDICTED: Danio rerio similar to Splicing fact... 48 0.032
236ref|XM_691025.1| PREDICTED: Danio rerio similar to Splicing fact... 48 0.032
237gb|L19533.1|CRUU14HS Cricetulus griseus heat resistant protein gene 48 0.032
238gb|AC009904.7| Drosophila melanogaster, chromosome 3R, region 88... 48 0.032
239emb|CR386963.1| Gallus gallus finished cDNA, clone ChEST104m7 48 0.032
240gb|AC007648.6|AC007648 Drosophila melanogaster, chromosome 3R, r... 48 0.032
241ref|NM_205003.1| Gallus gallus heat shock cognate 70 (HSC70), mRNA 48 0.032
242emb|X95688.1|ACHSP70HM A.cepa mRNA for heat shock protein 70-lik... 48 0.032
243gb|AE003708.3| Drosophila melanogaster chromosome 3R, section 46... 48 0.032
244gb|U64207.1|PCU64207 Penicillium citrinum heat shock protein 70 ... 48 0.032
245gb|M34561.1|CRUHSP70A Chinese hamster heat shock protein (cognat... 48 0.032
246gb|M36114.1|DROHSC4A2 D.melanogaster heat shock cognate 4 (hsc4)... 48 0.032
247gb|AY651253.1| Rhynchobodo ATCC50359 heat shock protein 70 cytos... 46 0.13
248gb|DQ025691.1| Oncorhynchus nerka clone One.hsc71.19.34 genomic ... 46 0.13
249gb|DQ025620.1| Oncorhynchus keta clone Oke.hsc71.19.23 genomic s... 46 0.13
250gb|DQ025546.1| Oncorhynchus tshawytscha clone Ots.hsc71.19.32 ge... 46 0.13
251ref|XM_508938.1| PREDICTED: Pan troglodytes similar to heat shoc... 46 0.13
252ref|XM_508830.1| PREDICTED: Pan troglodytes heat shock 70kDa pro... 46 0.13
253ref|XM_518899.1| PREDICTED: Pan troglodytes similar to Heat shoc... 46 0.13
254ref|NM_001003067.1| Canis familiaris heat shock protein 70 (HSP7... 46 0.13
255ref|NM_174550.1| Bos taurus heat shock 70 kD protein 1 (HSPA1A),... 46 0.13
256gb|AY662497.1| Bos taurus heat shock protein 70 kDa mRNA, comple... 46 0.13
257gb|AF134726.1| Homo sapiens BAC clone 215O12 NG35, NG36, G9A, NG... 46 0.13
258gb|BC063507.1| Homo sapiens heat shock 70kDa protein 1B, mRNA (c... 46 0.13
259gb|BC016660.1| Homo sapiens heat shock 70kDa protein 8, transcri... 46 0.13
260gb|BC016179.1| Homo sapiens heat shock 70kDa protein 8, transcri... 46 0.13
261gb|BC019816.2| Homo sapiens heat shock 70kDa protein 8, transcri... 46 0.13
262gb|BC007276.1| Homo sapiens heat shock 70kDa protein 8, mRNA (cD... 46 0.13
263ref|NM_006597.3| Homo sapiens heat shock 70kDa protein 8 (HSPA8)... 46 0.13
264gb|DQ440299.1| Aedes aegypti clone AET-381 heat shock cognate 70... 46 0.13
265gb|AY559741.1| Homo sapiens sequence in region of NEU1 and HSPA1... 46 0.13
266ref|XM_535493.2| PREDICTED: Canis familiaris similar to GRINL1A ... 46 0.13
267gb|AY466608.1| Sus scrofa heat shock protein 70.2 (hsp70.2) mRNA... 46 0.13
268gb|BC008907.2| Homo sapiens heat shock 70kDa protein 8, mRNA (cD... 46 0.13
269gb|BC009322.2| Homo sapiens heat shock 70kDa protein 1A, mRNA (c... 46 0.13
270gb|BC002423.1| Homo sapiens ribosomal protein L8, mRNA (cDNA clo... 46 0.13
271ref|XM_812644.1| Trypanosoma cruzi strain CL Brener heat shock p... 46 0.13
272ref|XM_812645.1| Trypanosoma cruzi strain CL Brener heat shock p... 46 0.13
273gb|BC018740.1| Homo sapiens heat shock 70kDa protein 1A, mRNA (c... 46 0.13
274gb|BC112920.1| Homo sapiens cDNA clone IMAGE:7484542, **** WARNI... 46 0.13
275emb|AL929592.8| Human DNA sequence from clone DAQB-147D11 on chr... 46 0.13
276emb|AL671762.10| Human DNA sequence from clone XXbac-254B15 on c... 46 0.13
277emb|AL662834.8| Human DNA sequence from clone XXbac-40G17 on chr... 46 0.13
278gb|AY149619.1| Bos taurus heat-shock 70-kilodalton protein 1A (H... 46 0.13
279gb|AY149618.1| Bos taurus heat-shock 70-kilodalton protein 1A (H... 46 0.13
280emb|Y00371.1|HSHSC70 Human hsc70 gene for 71 kd heat shock cogna... 46 0.13
281emb|X67716.1|TCHSPR70 T.cruzi mRNA for HSP70 46 0.13
282emb|X58715.1|TCHSP70PA T.cruzi hsp70 mRNA for 70 kDa heat shock ... 46 0.13
283emb|CR925990.1| Pongo pygmaeus mRNA; cDNA DKFZp459M2220 (from cl... 46 0.13
284ref|NM_005345.4| Homo sapiens heat shock 70kDa protein 1A (HSPA1... 46 0.13
285gb|DQ451402.1| Homo sapiens heat shock 70kDa protein 1A (HSPA1A)... 46 0.13
286emb|AJ812563.1| Bubalus bubalis partial mRNA for putative heat s... 46 0.13
287emb|CR937348.1| Single read from an extremity of a cDNA clone ma... 46 0.13
288emb|CR937294.1| Single read from an extremity of a cDNA clone ma... 46 0.13
289emb|CR759915.6| Human DNA sequence from clone DAAP-21F2 on chrom... 46 0.13
290gb|BC057397.1| Homo sapiens heat shock 70kDa protein 1B, mRNA (c... 46 0.13
291emb|CR861166.1| Pongo pygmaeus mRNA; cDNA DKFZp459P2416 (from cl... 46 0.13
292emb|CR859344.1| Pongo pygmaeus mRNA; cDNA DKFZp469O0514 (from cl... 46 0.13
293emb|CR860584.1| Pongo pygmaeus mRNA; cDNA DKFZp459L1519 (from cl... 46 0.13
294emb|CR860185.1| Pongo pygmaeus mRNA; cDNA DKFZp469I011 (from clo... 46 0.13
295emb|CR859135.1| Pongo pygmaeus mRNA; cDNA DKFZp459D1928 (from cl... 46 0.13
296emb|CR388202.9| Human DNA sequence from clone DADB-333F21 on chr... 46 0.13
297dbj|D87511.1| Trypanosoma cruzi mRNA for heat shock protein 70, ... 46 0.13
298emb|CR626292.1| full-length cDNA clone CS0DF038YK05 of Fetal bra... 46 0.13
299emb|CR625958.1| full-length cDNA clone CS0DF029YC09 of Fetal bra... 46 0.13
300emb|CR624878.1| full-length cDNA clone CS0DF012YA23 of Fetal bra... 46 0.13
301emb|CR623327.1| full-length cDNA clone CL0BB012ZA08 of Neuroblas... 46 0.13
302emb|CR621778.1| full-length cDNA clone CS0DE003YF16 of Placenta ... 46 0.13
303emb|CR620700.1| full-length cDNA clone CS0DM001YK04 of Fetal liv... 46 0.13
304emb|CR618855.1| full-length cDNA clone CS0DA004YH14 of Neuroblas... 46 0.13
305dbj|AK096100.1| Homo sapiens cDNA FLJ38781 fis, clone LIVER20002... 46 0.13
306emb|CR619085.1| full-length cDNA clone CS0DF008YL15 of Fetal bra... 46 0.13
307emb|CR618761.1| full-length cDNA clone CS0DN003YF07 of Adult bra... 46 0.13
308dbj|AK096017.1| Homo sapiens cDNA FLJ38698 fis, clone KIDNE20020... 46 0.13
309emb|CR618452.1| full-length cDNA clone CS0DA004YF21 of Neuroblas... 46 0.13
310emb|CR617847.1| full-length cDNA clone CS0DN003YP05 of Adult bra... 46 0.13
311emb|CR614382.1| full-length cDNA clone CS0CAP006YL11 of Thymus o... 46 0.13
312emb|CR612907.1| full-length cDNA clone CS0DF036YM23 of Fetal bra... 46 0.13
313dbj|AK097113.1| Homo sapiens cDNA FLJ39794 fis, clone SPLEN20039... 46 0.13
314emb|CR609237.1| full-length cDNA clone CL0BA012ZA08 of Placenta ... 46 0.13
315emb|CR609187.1| full-length cDNA clone CS0DF023YF04 of Fetal bra... 46 0.13
316emb|CR609094.1| full-length cDNA clone CS0DF023YO18 of Fetal bra... 46 0.13
317emb|CR608110.1| full-length cDNA clone CS0DJ004YG01 of T cells (... 46 0.13
318emb|CR606872.1| full-length cDNA clone CS0DF021YI09 of Fetal bra... 46 0.13
319emb|CR606370.1| full-length cDNA clone CS0DI037YG01 of Placenta ... 46 0.13
320emb|CR605894.1| full-length cDNA clone CS0DA003YN07 of Neuroblas... 46 0.13
321emb|CR605852.1| full-length cDNA clone CS0DA010YP23 of Neuroblas... 46 0.13
322emb|CR605652.1| full-length cDNA clone CS0DF033YK03 of Fetal bra... 46 0.13
323emb|CR603812.1| full-length cDNA clone CS0DF020YJ02 of Fetal bra... 46 0.13
324emb|CR602771.1| full-length cDNA clone CS0DF004YF23 of Fetal bra... 46 0.13
325emb|CR600856.1| full-length cDNA clone CS0DJ009YJ18 of T cells (... 46 0.13
326emb|CR599778.1| full-length cDNA clone CS0DE006YC12 of Placenta ... 46 0.13
327emb|CR599258.1| full-length cDNA clone CS0DF007YE19 of Fetal bra... 46 0.13
328emb|CR598680.1| full-length cDNA clone CS0DC028YM15 of Neuroblas... 46 0.13
329emb|CR598455.1| full-length cDNA clone CS0DA003YC01 of Neuroblas... 46 0.13
330emb|CR598352.1| full-length cDNA clone CS0DF006YL22 of Fetal bra... 46 0.13
331emb|CR597390.1| full-length cDNA clone CS0DF009YO17 of Fetal bra... 46 0.13
332emb|CR595673.1| full-length cDNA clone CS0DE002YK13 of Placenta ... 46 0.13
333emb|CR593858.1| full-length cDNA clone CS0DF022YI19 of Fetal bra... 46 0.13
334gb|AE012421.1| Xanthomonas campestris pv. campestris str. ATCC 3... 46 0.13
335emb|CR591386.1| full-length cDNA clone CS0DI003YO22 of Placenta ... 46 0.13
336dbj|AB073886.1| Homo sapiens primary neuroblastoma cDNA, clone:N... 46 0.13
337ref|XM_694630.1| PREDICTED: Danio rerio similar to heat shock pr... 46 0.13
338gb|DQ388429.1| Homo sapiens heat shock 70kDa protein 1B (HSPA1B)... 46 0.13
339ref|NM_005346.3| Homo sapiens heat shock 70kDa protein 1B (HSPA1... 46 0.13
340gb|BC015699.1|BC015699 Homo sapiens, clone IMAGE:3906958, mRNA, ... 46 0.13
341gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 46 0.13
342gb|BC103083.1| Bos taurus heat shock 70 kD protein 2, mRNA (cDNA... 46 0.13
343gb|AF217511.1|AF217511 Homo sapiens uncharacterized bone marrow ... 46 0.13
344gb|AC148662.1| Macaca mulatta Major Histocompatibility Complex B... 46 0.13
345gb|DQ022675.1| Bos grunniens heat shock protein 70.2 (hsp70.2) m... 46 0.13
346gb|AF352832.1|AF352832 Homo sapiens constitutive heat shock prot... 46 0.13
347dbj|AK222785.1| Homo sapiens mRNA for heat shock 70kDa protein 8... 46 0.13
348dbj|AB072749.1| Macaca fascicularis testis cDNA clone:QtsA-16150... 46 0.13
349gb|AY974355.1| Culex pipiens heat shock protein 70 mRNA, complet... 46 0.13
350ref|NM_213766.1| Sus scrofa heat shock protein 70.2 (HSP70.2), mRNA 46 0.13
351gb|AC007207.22| Homo sapiens 12 BAC RP11-320N7 (Roswell Park Can... 46 0.13
352gb|AF291716.1|AF291716 Leishmania braziliensis heat shock protei... 46 0.13
353gb|AY161271.1| Spodoptera frugiperda heat shock cognate 70 prote... 46 0.13
354dbj|BA000025.2| Homo sapiens genomic DNA, chromosome 6p21.3, HLA... 46 0.13
355gb|AF142571.1|AF142571 Saguinus oedipus intracellular vitamin D ... 46 0.13
356gb|AY891855.1| Synthetic construct Homo sapiens clone FLH116883.... 46 0.13
357gb|AY889368.1| Synthetic construct Homo sapiens clone FLH116887.... 46 0.13
358dbj|AK000571.1| Homo sapiens cDNA FLJ20564 fis, clone KAT12033 46 0.13
359dbj|AK129885.1| Homo sapiens cDNA FLJ26375 fis, clone HRT06292, ... 46 0.13
360dbj|AB114672.1| Canis familiaris hsp70 mRNA for heat shock prote... 46 0.13
361dbj|AK110255.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.13
362gb|AY423555.2| Dicentrarchus labrax HSP70 (HSP70) mRNA, complete... 46 0.13
363gb|BC002453.2| Homo sapiens heat shock 70kDa protein 1A, mRNA (c... 46 0.13
364dbj|AB114675.1| Canis familiaris hsp70 mRNA for heat shock prote... 46 0.13
365dbj|AB114674.1| Canis familiaris hsp70 mRNA for heat shock prote... 46 0.13
366dbj|AB114673.1| Canis familiaris hsp70 mRNA for heat shock prote... 46 0.13
367dbj|AP000926.6| Homo sapiens genomic DNA, chromosome 11 clone:RP... 46 0.13
368dbj|AB209818.1| Homo sapiens mRNA for heat shock 70kDa protein 1... 46 0.13
369ref|NM_203322.2| Bos taurus heat shock 70 kD protein 2 (HSPA1B),... 46 0.13
370emb|AL773559.16| Pig DNA sequence from clone XX-711D2, complete ... 46 0.13
371gb|U09861.1|BTU09861 Bos taurus 70 kDA heat-shock protein (hsp70... 46 0.13
372gb|M59830.1|HUMMHHSP2 Human MHC class III HSP70-2 gene (HLA), co... 46 0.13
373gb|M59828.1|HUMMHHSP Human MHC class III HSP70-1 gene (HLA), com... 46 0.13
374gb|L14604.1|LEIHSP70C Leishmania amazonensis heat shock protein ... 46 0.13
375emb|X73685.1|CAHSP C.aethiops hsp70 mRNA 46 0.13
376gb|M11717.1|HUMHSP70D Human heat shock protein (hsp 70) gene, co... 46 0.13
377emb|AL360193.1|HST000239 Homo sapiens mRNA full length insert cD... 46 0.13
378gb|M69100.1|PIGHSP70G Pig hsp70 gene, complete cds 46 0.13
379gb|M26595.1|TRBHSP70AB T.cruzi heat shock protein (HSP70) gene, ... 46 0.13
380gb|U02892.1|BTU02892 Bos taurus Angus 70 kda heat shock protein-... 46 0.13
381gb|U02891.1|BTU02891 Bos taurus Angus 70 kda heat shock protein-... 46 0.13
382dbj|AB075027.1| Canis familiaris hsp70 mRNA for heat shock prote... 46 0.13
383emb|AL773527.8| Pig DNA sequence from clone XX-707F1, complete s... 46 0.13
384gb|AY422994.1| Danio rerio heat shock 70kDa protein 8 (HSPA8) mR... 44 0.50
385gb|AC124141.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.50
386gb|AY748350.1| Fenneropenaeus chinensis heat shock protein 70 co... 44 0.50
387gb|AY538777.1| Pimephales promelas heat shock cognate 70 kDa pro... 44 0.50
388emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 44 0.50
389gb|AY288515.1| Trypanoplasma borreli heat shock protein 70 gene,... 44 0.50
390emb|CR635883.2|CNS0EPM9 Tetraodon nigroviridis full-length cDNA 44 0.50
391ref|XM_797014.1| PREDICTED: Strongylocentrotus purpuratus simila... 44 0.50
392ref|XM_775743.1| PREDICTED: Strongylocentrotus purpuratus simila... 44 0.50
393ref|XM_797002.1| PREDICTED: Strongylocentrotus purpuratus simila... 44 0.50
394ref|XM_796989.1| PREDICTED: Strongylocentrotus purpuratus simila... 44 0.50
395ref|XM_796976.1| PREDICTED: Strongylocentrotus purpuratus simila... 44 0.50
396ref|XM_796964.1| PREDICTED: Strongylocentrotus purpuratus simila... 44 0.50
397ref|XM_796945.1| PREDICTED: Strongylocentrotus purpuratus simila... 44 0.50
398emb|Y11413.1|DRHSC70 D.rerio hsc70 mRNA 44 0.50
399emb|X62485.1|LB70HSP L.brasiliensis mRNA for 70 Kd heat shock pr... 44 0.50
400gb|M87878.1| Leishmania braziliensis heat shock protein 70 (HSP7... 44 0.50
401gb|L01500.1|DROHSC4A Drosophila melanogaster heat shock protein ... 44 0.50
402gb|AY072815.1| Chlorella zofingiensis heat shock protein 70 mRNA... 44 0.50
403ref|XM_687844.1| PREDICTED: Danio rerio similar to Heat shock pr... 44 0.50
404gb|AF227986.1|AF227986 Rivulus marmoratus HSC71 gene, complete cds 44 0.50
405gb|AY233001.1| Kryptolebias marmoratus heat shock cognate 71 (Hs... 44 0.50
406emb|BX276087.14| Zebrafish DNA sequence from clone CH211-270M20 ... 44 0.50
407dbj|AB013075.1| Canis familiaris gene for heat shock protein 70,... 44 0.50
408gb|BC063228.1| Danio rerio heat shock protein 8, mRNA (cDNA clon... 44 0.50
409gb|BC045841.1| Danio rerio heat shock protein 8, mRNA (cDNA clon... 44 0.50
410ref|NM_131401.1| Danio rerio heat shock protein 8 (hspa8), mRNA 44 0.50
411dbj|AB006814.1| Paralichthys olivaceus mRNA for hsc71, complete cds 44 0.50
412gb|L77146.1|ZEFHSC7R Danio rerio heat shock cognate (hsc70) mRNA... 44 0.50
413dbj|AK099474.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.50
414emb|BX120005.6| Zebrafish DNA sequence from clone RP71-56I13 in ... 44 0.50
415gb|AF053059.1|AF053059 Paralichthys olivaceus heat shock protein... 44 0.50
416gb|U58209.1|ZMU58209 Zea mays lumenal binding protein cBiPe3 mRN... 44 0.50
417gb|U58208.1|ZMU58208 Zea mays lumenal binding protein cBiPe2 mRN... 44 0.50
418gb|BC066491.1| Danio rerio heat shock protein 8, mRNA (cDNA clon... 44 0.50
419gb|M59449.1|MZEB70A Zea mays polypeptide chain-binding protein m... 44 0.50
420gb|AY651255.1| Cryptobia helicis heat shock protein 70 cytosolic... 42 2.0
421gb|AC150414.2| Branchiostoma floridae clone CH302-62C22, complet... 42 2.0
422ref|XM_463631.1| Oryza sativa (japonica cultivar-group), predic... 42 2.0
423gb|AY617976.1| Sterkiella histriomuscorum clone UGC1O0006_M14_R ... 42 2.0
424gb|AY618164.1| Sterkiella histriomuscorum clone UGC1O0006_M22_R ... 42 2.0
425ref|XM_872816.1| PREDICTED: Bos taurus similar to Septin-11, tra... 42 2.0
426ref|XM_864283.1| PREDICTED: Bos taurus similar to Septin-11, tra... 42 2.0
427ref|XM_615857.2| PREDICTED: Bos taurus similar to Septin-11, tra... 42 2.0
428emb|AJ249329.1|CSA249329 Cucumis sativus mRNA for heat shock pro... 42 2.0
429gb|DQ173923.1| Homarus americanus heat shock protein 70 mRNA, co... 42 2.0
430gb|AF474375.1| Penaeus monodon heat shock protein 70 mRNA, compl... 42 2.0
431emb|X85798.1|LIHSP70 L.infantum hsp70 gene 42 2.0
432gb|AC008646.7| Homo sapiens chromosome 5 clone CTB-182O9, comple... 42 2.0
433dbj|AB252419.1| Uncultured bacterium hmbp gene for heavy metal-b... 42 2.0
434gb|AE011965.1| Xanthomonas axonopodis pv. citri str. 306, secti... 42 2.0
435dbj|AP007169.1| Aspergillus oryzae RIB40 genomic DNA, SC038 42 2.0
436dbj|AB240143.1| Chlorella pyrenoidosa hsp70 mRNA for heat shock ... 42 2.0
437gb|AC006836.7| Arabidopsis thaliana chromosome 2 clone F19B11 ma... 42 2.0
438gb|AF421541.1| Crypthecodinium cohnii Hsp90 mRNA, complete cds 42 2.0
439emb|AL116551.1|CNS01D9R Botrytis cinerea strain T4 cDNA library 42 2.0
440emb|AL116529.1|CNS01D95 Botrytis cinerea strain T4 cDNA library 42 2.0
441emb|AL116524.1|CNS01D90 Botrytis cinerea strain T4 cDNA library 42 2.0
442emb|AL116406.1|CNS01D5Q Botrytis cinerea strain T4 cDNA library 42 2.0
443emb|AL115343.1|CNS01CC7 Botrytis cinerea strain T4 cDNA library 42 2.0
444emb|AL115335.1|CNS01CBZ Botrytis cinerea strain T4 cDNA library 42 2.0
445emb|AL115184.1|CNS01C7S Botrytis cinerea strain T4 cDNA library 42 2.0
446emb|AL113611.1|CNS01B03 Botrytis cinerea strain T4 cDNA library 42 2.0
447emb|AL112912.1|CNS01AGO Botrytis cinerea strain T4 cDNA library 42 2.0
448emb|AL112762.1|CNS01ACI Botrytis cinerea strain T4 cDNA library 42 2.0
449emb|AL112751.1|CNS01AC7 Botrytis cinerea strain T4 cDNA library 42 2.0
450emb|AL112598.1|CNS01A7Y Botrytis cinerea strain T4 cDNA library 42 2.0
451emb|AL112279.1|CNS019Z3 Botrytis cinerea strain T4 cDNA library 42 2.0
452emb|AL110798.1|CNS018TZ Botrytis cinerea strain T4 cDNA library 42 2.0
453gb|AF232230.1|AF232230 Acanthamoeba castellanii 20S proteasome a... 42 2.0
454dbj|AP003437.3| Oryza sativa (japonica cultivar-group) genomic D... 42 2.0
455dbj|AP006843.2| Oryza sativa (japonica cultivar-group) genomic D... 42 2.0
456gb|AY729863.1| Guillardia theta heat shock protein 90 gene, part... 42 2.0
457gb|L14605.1|LEIHSP70G Leishmania amazonensis heat shock protein ... 42 2.0
458gb|CP000148.1| Geobacter metallireducens GS-15, complete genome 40 7.9
459gb|AC159266.3| Mus musculus BAC clone RP24-64D24 from chromosome... 40 7.9
460gb|AC009388.5| Drosophila melanogaster clone BACR11P22, complete... 40 7.9
461ref|NM_018672.2| Homo sapiens ATP-binding cassette, sub-family A... 40 7.9
462gb|AC108761.2| Oryza sativa (japonica cultivar-group) chromosome... 40 7.9
463gb|AC152826.2| Mus musculus BAC clone RP23-111C21 from chromosom... 40 7.9
464ref|XM_870731.1| PREDICTED: Bos taurus similar to Heat shock cog... 40 7.9
465ref|XM_590005.2| PREDICTED: Bos taurus similar to MEGF11 protein... 40 7.9
466gb|AY645906.1| Litopenaeus vannamei heat shock protein 70 gene, ... 40 7.9
467ref|NM_020804.2| Homo sapiens protein kinase C and casein kinase... 40 7.9
468ref|NM_019400.1| Mus musculus rabaptin, RAB GTPase binding effec... 40 7.9
469gb|AY702003.1| Leishmania donovani strain MHOM/IN/1983/AG83 heat... 40 7.9
470ref|NM_172232.1| Homo sapiens ATP-binding cassette, sub-family A... 40 7.9
471gb|AC116569.6| Mus musculus BAC clone RP23-59O19 from chromosome... 40 7.9
472gb|AC138173.2| Mus musculus strain C57BL/6J clone rp23-364j24 ma... 40 7.9
473ref|XM_751924.1| Ustilago maydis 521 hypothetical protein (UM008... 40 7.9
474ref|XM_389647.1| Gibberella zeae PH-1 chromosome 4 GR78_NEUCR 78... 40 7.9
475gb|AC125075.4| Mus musculus BAC clone RP23-468P13 from chromosom... 40 7.9
476ref|XM_531893.2| PREDICTED: Canis familiaris similar to MEGF10 p... 40 7.9
477gb|BC009814.1| Mus musculus rabaptin, RAB GTPase binding effecto... 40 7.9
478emb|Z80223.1|CEF26D10 Caenorhabditis elegans Cosmid F26D10, comp... 40 7.9
479gb|AY236713.1| Goniomonas sp. ATCC 50108 heat shock protein 90 (... 40 7.9
480ref|XM_857754.1| PREDICTED: Canis familiaris similar to ATP-bind... 40 7.9
481ref|XM_857680.1| PREDICTED: Canis familiaris similar to ATP-bind... 40 7.9
482ref|XM_857657.1| PREDICTED: Canis familiaris similar to ATP-bind... 40 7.9
483ref|XM_537573.2| PREDICTED: Canis familiaris similar to ATP-bind... 40 7.9
484gb|AC122207.2| Mus musculus BAC clone RP23-88I22 from 16, comple... 40 7.9
485gb|BC060166.1| Mus musculus rabaptin, RAB GTPase binding effecto... 40 7.9
486emb|CR730635.1|CNS0GQPC Tetraodon nigroviridis full-length cDNA 40 7.9
487emb|CR728398.2|CNS0GOZ8 Tetraodon nigroviridis full-length cDNA 40 7.9
488emb|CR727568.2|CNS0GOC6 Tetraodon nigroviridis full-length cDNA 40 7.9
489emb|CR724923.2|CNS0GMAP Tetraodon nigroviridis full-length cDNA 40 7.9
490emb|CR697314.2|CNS0G0ZY Tetraodon nigroviridis full-length cDNA 40 7.9
491emb|CR688052.2|CNS0FTUO Tetraodon nigroviridis full-length cDNA 40 7.9
492emb|CR680851.1|CNS0FOAN Tetraodon nigroviridis full-length cDNA 40 7.9
493emb|CR679231.2|CNS0FN1N Tetraodon nigroviridis full-length cDNA 40 7.9
494emb|CR678387.2|CNS0FMEC Tetraodon nigroviridis full-length cDNA 40 7.9
495emb|CR678206.2|CNS0FM9E Tetraodon nigroviridis full-length cDNA 40 7.9
496emb|CR677879.2|CNS0FM0F Tetraodon nigroviridis full-length cDNA 40 7.9
497emb|CR676221.1|CNS0FKQH Tetraodon nigroviridis full-length cDNA 40 7.9
498gb|BC040228.1| Homo sapiens protein kinase C and casein kinase s... 40 7.9
499emb|CR675491.2|CNS0FK6H Tetraodon nigroviridis full-length cDNA 40 7.9
500emb|CR673489.2|CNS0FIMV Tetraodon nigroviridis full-length cDNA 40 7.9

>gb|BT016462.1| Zea mays clone Contig295 mRNA sequence
          Length = 1014

 Score =  276 bits (139), Expect = 8e-71
 Identities = 255/294 (86%), Gaps = 6/294 (2%)
 Strand = Plus / Minus

                                                                       
Query: 289 ttagtcgacctcctcgatcttggggccagggccgccggatgcagcaggggtgtcatcgtc 348
           |||||| |||||||||||||||||||||||||| |||  | |||| || | ||| |||||
Sbjct: 848 ttagtccacctcctcgatcttggggccagggccaccgcttccagccggagcgtcctcgtc 789

                                                                       
Query: 349 catgccaccctc------catgtcggcaccagcaccctggtacatcttggcgatgatggg 402
           |||||| ||  |      |||||||||||| || ||||||||||||||||||||||||||
Sbjct: 788 catgccgccggcgccacccatgtcggcacccgcgccctggtacatcttggcgatgatggg 729

                                                                       
Query: 403 gttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctg 462
           |||||| |||  ||||||||||||||||||||| || |||||||||||||| || |||||
Sbjct: 728 gttgcaaaggctctccagctccttcatcttgtcatcgaactcgtccgcctcggcgagctg 669

                                                                       
Query: 463 gttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtc 522
           ||| | |||||||||   |||||| || |||||||| |||||||||||||||||||||||
Sbjct: 668 gttggcgtccagccagctgatggccgcgtcgatggcgtcctcgatcttcttcttgtcgtc 609

                                                                 
Query: 523 ggccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
           ||| | ||||||||| |||||||||||||||||||| |||||||||||||||||
Sbjct: 608 ggcagccagcttggacgcgatcttctcgtccttgatcgtgttgcgcatgttgta 555



to top

>gb|AY914601.1| Zea mays heat shock protein 70 mRNA, partial cds
          Length = 1284

 Score =  276 bits (139), Expect = 8e-71
 Identities = 255/294 (86%), Gaps = 6/294 (2%)
 Strand = Plus / Minus

                                                                        
Query: 289  ttagtcgacctcctcgatcttggggccagggccgccggatgcagcaggggtgtcatcgtc 348
            |||||| |||||||||||||||||||||||||| |||  | |||| || | ||| |||||
Sbjct: 1123 ttagtccacctcctcgatcttggggccagggccaccgcttccagccggagcgtcctcgtc 1064

                                                                        
Query: 349  catgccaccctc------catgtcggcaccagcaccctggtacatcttggcgatgatggg 402
            |||||| ||  |      |||||||||||| || ||||||||||||||||||||||||||
Sbjct: 1063 catgccgccggcgccacccatgtcggcacccgcgccctggtacatcttggcgatgatggg 1004

                                                                        
Query: 403  gttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctg 462
            |||||| |||  ||||||||||||||||||||| || |||||||||||||| || |||||
Sbjct: 1003 gttgcaaaggctctccagctccttcatcttgtcatcgaactcgtccgcctcggcgagctg 944

                                                                        
Query: 463  gttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtc 522
            ||| | |||||||||   |||||| || |||||||| |||||||||||||||||||||||
Sbjct: 943  gttggcgtccagccagctgatggccgcgtcgatggcgtcctcgatcttcttcttgtcgtc 884

                                                                  
Query: 523  ggccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
            ||| | ||||||||| |||||||||||||||||||| |||||||||||||||||
Sbjct: 883  ggcagccagcttggacgcgatcttctcgtccttgatcgtgttgcgcatgttgta 830



to top

>gb|AY109330.1| Zea mays CL45_1 mRNA sequence
          Length = 3772

 Score =  276 bits (139), Expect = 8e-71
 Identities = 255/294 (86%), Gaps = 6/294 (2%)
 Strand = Plus / Minus

                                                                        
Query: 289  ttagtcgacctcctcgatcttggggccagggccgccggatgcagcaggggtgtcatcgtc 348
            |||||| |||||||||||||||||||||||||| |||  | |||| || | ||| |||||
Sbjct: 3222 ttagtccacctcctcgatcttggggccagggccaccgcttccagccggagcgtcctcgtc 3163

                                                                        
Query: 349  catgccaccctc------catgtcggcaccagcaccctggtacatcttggcgatgatggg 402
            |||||| ||  |      |||||||||||| || ||||||||||||||||||||||||||
Sbjct: 3162 catgccgccggcgccacccatgtcggcacccgcgccctggtacatcttggcgatgatggg 3103

                                                                        
Query: 403  gttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctg 462
            |||||| |||  ||||||||||||||||||||| || |||||||||||||| || |||||
Sbjct: 3102 gttgcaaaggctctccagctccttcatcttgtcatcgaactcgtccgcctcggcgagctg 3043

                                                                        
Query: 463  gttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtc 522
            ||| | |||||||||   |||||| || |||||||| |||||||||||||||||||||||
Sbjct: 3042 gttggcgtccagccagctgatggccgcgtcgatggcgtcctcgatcttcttcttgtcgtc 2983

                                                                  
Query: 523  ggccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
            ||| | ||||||||| |||||||||||||||||||| |||||||||||||||||
Sbjct: 2982 ggcagccagcttggacgcgatcttctcgtccttgatcgtgttgcgcatgttgta 2929



to top

>gb|BT016812.1| Zea mays clone Contig645 mRNA sequence
          Length = 2327

 Score =  268 bits (135), Expect = 2e-68
 Identities = 254/294 (86%), Gaps = 6/294 (2%)
 Strand = Plus / Minus

                                                                        
Query: 289  ttagtcgacctcctcgatcttggggccagggccgccggatgcagcaggggtgtcatcgtc 348
            |||||| ||||||||||||||||||||||||||||||    | ||||||| ||| |||||
Sbjct: 1834 ttagtccacctcctcgatcttggggccagggccgccgctgccggcaggggcgtcctcgtc 1775

                                                                        
Query: 349  catgccaccctc------catgtcggcaccagcaccctggtacatcttggcgatgatggg 402
            |||||| ||  |      ||||||  |||| || ||||||||||||||||||||||||||
Sbjct: 1774 catgccgccagcgccgcccatgtcttcacccgcgccctggtacatcttggcgatgatggg 1715

                                                                        
Query: 403  gttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctg 462
            |||||| |||  ||||||||||||||||||||| || |||||||||||||| || |||||
Sbjct: 1714 gttgcagaggctctccagctccttcatcttgtcctcgaactcgtccgcctcggcgagctg 1655

                                                                        
Query: 463  gttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtc 522
            ||| | |||||||||   |||||| || |||||||| |||||||||||||||||||| ||
Sbjct: 1654 gttggcgtccagccagctgatggccgcgtcgatggcgtcctcgatcttcttcttgtcatc 1595

                                                                  
Query: 523  ggccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
            ||||||||||||||| || ||||||||||||||||| |||||||||||||||||
Sbjct: 1594 ggccggcagcttggacgcaatcttctcgtccttgatcgtgttgcgcatgttgta 1541



to top

>emb|X78415.1|ZMHSP705 Z.mays (cv DH5xDH7) hsp70-5 mRNA for heat shock protein 70
          Length = 842

 Score =  260 bits (131), Expect = 5e-66
 Identities = 253/294 (86%), Gaps = 6/294 (2%)
 Strand = Plus / Minus

                                                                       
Query: 289 ttagtcgacctcctcgatcttggggccagggccgccggatgcagcaggggtgtcatcgtc 348
           |||||| |||||||||||||||||||||||| | |||  | |||| || | ||| |||||
Sbjct: 662 ttagtccacctcctcgatcttggggccaggggcaccgcttccagccggagcgtcctcgtc 603

                                                                       
Query: 349 catgccaccctc------catgtcggcaccagcaccctggtacatcttggcgatgatggg 402
           |||||| ||| |      |||||||||||| || ||||||||||||||||||||||||||
Sbjct: 602 catgccgcccgcgccacccatgtcggcacccgcgccctggtacatcttggcgatgatggg 543

                                                                       
Query: 403 gttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctg 462
           |||  | |||  ||||||||||||||||||||| || |||||||||||||| || |||||
Sbjct: 542 gttcgaaaggctctccagctccttcatcttgtcatcgaactcgtccgcctcggcgagctg 483

                                                                       
Query: 463 gttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtc 522
           ||| | |||||||||   |||||| || |||||||| |||||||||||||||||||||||
Sbjct: 482 gttggcgtccagccagctgatggccgcgtcgatggcgtcctcgatcttcttcttgtcgtc 423

                                                                 
Query: 523 ggccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
           ||| | ||||||||| |||||||||||||||||||| |||||||||||||||||
Sbjct: 422 ggcagccagcttggacgcgatcttctcgtccttgatcgtgttgcgcatgttgta 369



to top

>gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1281_H05,
             complete sequence
          Length = 163130

 Score =  258 bits (130), Expect = 2e-65
 Identities = 250/290 (86%)
 Strand = Plus / Plus

                                                                         
Query: 287   gtttagtcgacctcctcgatcttggggccagggccgccggatgcagcaggggtgtcatcg 346
             ||||||||||||||||||||||||||||| | ||||| |    | || || | ||| |||
Sbjct: 43944 gtttagtcgacctcctcgatcttggggcctgcgccgctgccgcccgccggcgcgtcctcg 44003

                                                                         
Query: 347   tccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatggggttg 406
             |||||||| ||  |||||||||| || |  ||||||||||||||||||||||| ||||||
Sbjct: 44004 tccatgcctccggccatgtcggcgccggggccctggtacatcttggcgatgatcgggttg 44063

                                                                         
Query: 407   cacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttc 466
             || | | |||||||||||||||||||||| || |||||||| ||||| || |||||||| 
Sbjct: 44064 cagatgccctccagctccttcatcttgtcctcgaactcgtcggcctcggcgagctggttg 44123

                                                                         
Query: 467   gtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcggcc 526
             ||||| |||||   ||||||  |||||||||| ||||||||| |||||||||||||||| 
Sbjct: 44124 gtgtcgagccagctgatggcgccatcgatggcgtcctcgatcctcttcttgtcgtcggcg 44183

                                                               
Query: 527   ggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
             |  |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 44184 gcgagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 44233



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  258 bits (130), Expect = 2e-65
 Identities = 250/290 (86%)
 Strand = Plus / Plus

                                                                            
Query: 287      gtttagtcgacctcctcgatcttggggccagggccgccggatgcagcaggggtgtcatcg 346
                ||||||||||||||||||||||||||||| | ||||| |    | || || | ||| |||
Sbjct: 22454537 gtttagtcgacctcctcgatcttggggcctgcgccgctgccgcccgccggcgcgtcctcg 22454596

                                                                            
Query: 347      tccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatggggttg 406
                |||||||| ||  |||||||||| || |  ||||||||||||||||||||||| ||||||
Sbjct: 22454597 tccatgcctccggccatgtcggcgccggggccctggtacatcttggcgatgatcgggttg 22454656

                                                                            
Query: 407      cacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttc 466
                || | | |||||||||||||||||||||| || |||||||| ||||| || |||||||| 
Sbjct: 22454657 cagatgccctccagctccttcatcttgtcctcgaactcgtcggcctcggcgagctggttg 22454716

                                                                            
Query: 467      gtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcggcc 526
                ||||| |||||   ||||||  |||||||||| ||||||||| |||||||||||||||| 
Sbjct: 22454717 gtgtcgagccagctgatggcgccatcgatggcgtcctcgatcctcttcttgtcgtcggcg 22454776

                                                                  
Query: 527      ggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
                |  |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22454777 gcgagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 22454826



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 24       accaaaagaaaagcaaaacaca 45
                ||||||||||||||||||||||
Sbjct: 14472412 accaaaagaaaagcaaaacaca 14472433



to top

>ref|XM_475365.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1941

 Score =  254 bits (128), Expect = 3e-64
 Identities = 248/288 (86%)
 Strand = Plus / Minus

                                                                        
Query: 289  ttagtcgacctcctcgatcttggggccagggccgccggatgcagcaggggtgtcatcgtc 348
            ||||||||||||||||||||||||||| | ||||| |    | || || | ||| |||||
Sbjct: 1941 ttagtcgacctcctcgatcttggggcctgcgccgctgccgcccgccggcgcgtcctcgtc 1882

                                                                        
Query: 349  catgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgca 408
            |||||| ||  |||||||||| || |  ||||||||||||||||||||||| ||||||||
Sbjct: 1881 catgcctccggccatgtcggcgccggggccctggtacatcttggcgatgatcgggttgca 1822

                                                                        
Query: 409  cagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgt 468
             | | |||||||||||||||||||||| || |||||||| ||||| || |||||||| ||
Sbjct: 1821 gatgccctccagctccttcatcttgtcctcgaactcgtcggcctcggcgagctggttggt 1762

                                                                        
Query: 469  gtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcggccgg 528
            ||| |||||   ||||||  |||||||||| ||||||||| |||||||||||||||| | 
Sbjct: 1761 gtcgagccagctgatggcgccatcgatggcgtcctcgatcctcttcttgtcgtcggcggc 1702

                                                            
Query: 529  cagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
             |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1701 gagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 1654



to top

>gb|AC134045.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0022E16
              map C481S, complete sequence
          Length = 179668

 Score =  240 bits (121), Expect = 4e-60
 Identities = 205/233 (87%)
 Strand = Plus / Minus

                                                                          
Query: 344    tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 403
              ||||||||||| ||  ||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 135577 tcgtccatgccgccggccatgtccgcgccagcgccctggtacatcttggcgatgatgggg 135518

                                                                          
Query: 404    ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 463
              ||||| | | |||||||||||||||||||||| || ||||| || |||||||| ||||||
Sbjct: 135517 ttgcagatgccctccagctccttcatcttgtcatcgaactcatcagcctcagcgagctgg 135458

                                                                          
Query: 464    ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcg 523
              ||   ||||||||||||||||||    |||||||| ||||||||||||||||||||  | 
Sbjct: 135457 ttgccgtccagccactggatggcctggtcgatggcatcctcgatcttcttcttgtccgct 135398

                                                                   
Query: 524    gccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
              ||||| ||||| |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 135397 gccgggagcttcgaggcgatcttctcatccttgatggtgttgcgcatgttgta 135345



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                           
Query: 289    ttagtcgacctcctcgatcttggggccag 317
              |||||||||||||||||||||||||||||
Sbjct: 135638 ttagtcgacctcctcgatcttggggccag 135610



to top

>emb|X67711.2|OSHSC70A O.sativa hsp70 gene for heat shock protein 70
          Length = 4791

 Score =  240 bits (121), Expect = 4e-60
 Identities = 205/233 (87%)
 Strand = Plus / Minus

                                                                        
Query: 344  tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 403
            ||||||||||| ||  ||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 4513 tcgtccatgccgccggccatgtccgcgccagcgccctggtacatcttggcgatgatgggg 4454

                                                                        
Query: 404  ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 463
            ||||| | | |||||||||||||||||||||| || ||||| || |||||||| ||||||
Sbjct: 4453 ttgcagatgccctccagctccttcatcttgtcatcgaactcatcagcctcagcgagctgg 4394

                                                                        
Query: 464  ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcg 523
            ||   ||||||||||||||||||    |||||||| ||||||||||||||||||||  | 
Sbjct: 4393 ttgccgtccagccactggatggcctggtcgatggcatcctcgatcttcttcttgtccgct 4334

                                                                 
Query: 524  gccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
            ||||| ||||| |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 4333 gccgggagcttcgaggcgatcttctcatccttgatggtgttgcgcatgttgta 4281



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                         
Query: 289  ttagtcgacctcctcgatcttggggccag 317
            |||||||||||||||||||||||||||||
Sbjct: 4574 ttagtcgacctcctcgatcttggggccag 4546



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score =  240 bits (121), Expect = 4e-60
 Identities = 205/233 (87%)
 Strand = Plus / Minus

                                                                            
Query: 344      tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 403
                ||||||||||| ||  ||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 28177022 tcgtccatgccgccggccatgtccgcgccagcgccctggtacatcttggcgatgatgggg 28176963

                                                                            
Query: 404      ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 463
                ||||| | | |||||||||||||||||||||| || ||||| || |||||||| ||||||
Sbjct: 28176962 ttgcagatgccctccagctccttcatcttgtcatcgaactcatcagcctcagcgagctgg 28176903

                                                                            
Query: 464      ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcg 523
                ||   ||||||||||||||||||    |||||||| ||||||||||||||||||||  | 
Sbjct: 28176902 ttgccgtccagccactggatggcctggtcgatggcatcctcgatcttcttcttgtccgct 28176843

                                                                     
Query: 524      gccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
                ||||| ||||| |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 28176842 gccgggagcttcgaggcgatcttctcatccttgatggtgttgcgcatgttgta 28176790



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                             
Query: 289      ttagtcgacctcctcgatcttggggccag 317
                |||||||||||||||||||||||||||||
Sbjct: 28177083 ttagtcgacctcctcgatcttggggccag 28177055



to top

>dbj|AK119710.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-E11, full
           insert sequence
          Length = 529

 Score =  240 bits (121), Expect = 4e-60
 Identities = 205/233 (87%)
 Strand = Plus / Minus

                                                                       
Query: 344 tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 403
           ||||||||||| ||  ||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 253 tcgtccatgccgccggccatgtccgcgccagcgccctggtacatcttggcgatgatgggg 194

                                                                       
Query: 404 ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 463
           ||||| | | |||||||||||||||||||||| || ||||| || |||||||| ||||||
Sbjct: 193 ttgcagatgccctccagctccttcatcttgtcatcgaactcatcagcctcagcgagctgg 134

                                                                       
Query: 464 ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcg 523
           ||   ||||||||||||||||||    |||||||| ||||||||||||||||||||  | 
Sbjct: 133 ttgccgtccagccactggatggcctggtcgatggcatcctcgatcttcttcttgtccgct 74

                                                                
Query: 524 gccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
           ||||| ||||| |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 73  gccgggagcttcgaggcgatcttctcatccttgatggtgttgcgcatgttgta 21



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                        
Query: 289 ttagtcgacctcctcgatcttggggccag 317
           |||||||||||||||||||||||||||||
Sbjct: 314 ttagtcgacctcctcgatcttggggccag 286



to top

>dbj|AK119255.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-123-H02, full
            insert sequence
          Length = 2311

 Score =  240 bits (121), Expect = 4e-60
 Identities = 205/233 (87%)
 Strand = Plus / Minus

                                                                        
Query: 344  tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 403
            ||||||||||| ||  ||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 2063 tcgtccatgccgccggccatgtccgcgccagcgccctggtacatcttggcgatgatgggg 2004

                                                                        
Query: 404  ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 463
            ||||| | | |||||||||||||||||||||| || ||||| || |||||||| ||||||
Sbjct: 2003 ttgcagatgccctccagctccttcatcttgtcatcgaactcatcagcctcagcgagctgg 1944

                                                                        
Query: 464  ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcg 523
            ||   ||||||||||||||||||    |||||||| ||||||||||||||||||||  | 
Sbjct: 1943 ttgccgtccagccactggatggcctggtcgatggcatcctcgatcttcttcttgtccgct 1884

                                                                 
Query: 524  gccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
            ||||| ||||| |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 1883 gccgggagcttcgaggcgatcttctcatccttgatggtgttgcgcatgttgta 1831



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                         
Query: 289  ttagtcgacctcctcgatcttggggccag 317
            |||||||||||||||||||||||||||||
Sbjct: 2124 ttagtcgacctcctcgatcttggggccag 2096



to top

>dbj|AK065431.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013021C17, full
            insert sequence
          Length = 2380

 Score =  240 bits (121), Expect = 4e-60
 Identities = 205/233 (87%)
 Strand = Plus / Minus

                                                                        
Query: 344  tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 403
            ||||||||||| ||  ||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 1961 tcgtccatgccgccggccatgtccgcgccagcgccctggtacatcttggcgatgatgggg 1902

                                                                        
Query: 404  ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 463
            ||||| | | |||||||||||||||||||||| || ||||| || |||||||| ||||||
Sbjct: 1901 ttgcagatgccctccagctccttcatcttgtcatcgaactcatcagcctcagcgagctgg 1842

                                                                        
Query: 464  ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcg 523
            ||   ||||||||||||||||||    |||||||| ||||||||||||||||||||  | 
Sbjct: 1841 ttgccgtccagccactggatggcctggtcgatggcatcctcgatcttcttcttgtccgct 1782

                                                                 
Query: 524  gccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
            ||||| ||||| |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 1781 gccgggagcttcgaggcgatcttctcatccttgatggtgttgcgcatgttgta 1729



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                         
Query: 289  ttagtcgacctcctcgatcttggggccag 317
            |||||||||||||||||||||||||||||
Sbjct: 2022 ttagtcgacctcctcgatcttggggccag 1994



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  240 bits (121), Expect = 4e-60
 Identities = 205/233 (87%)
 Strand = Plus / Minus

                                                                            
Query: 344      tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 403
                ||||||||||| ||  ||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 28161900 tcgtccatgccgccggccatgtccgcgccagcgccctggtacatcttggcgatgatgggg 28161841

                                                                            
Query: 404      ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 463
                ||||| | | |||||||||||||||||||||| || ||||| || |||||||| ||||||
Sbjct: 28161840 ttgcagatgccctccagctccttcatcttgtcatcgaactcatcagcctcagcgagctgg 28161781

                                                                            
Query: 464      ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcg 523
                ||   ||||||||||||||||||    |||||||| ||||||||||||||||||||  | 
Sbjct: 28161780 ttgccgtccagccactggatggcctggtcgatggcatcctcgatcttcttcttgtccgct 28161721

                                                                     
Query: 524      gccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
                ||||| ||||| |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 28161720 gccgggagcttcgaggcgatcttctcatccttgatggtgttgcgcatgttgta 28161668



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                             
Query: 289      ttagtcgacctcctcgatcttggggccag 317
                |||||||||||||||||||||||||||||
Sbjct: 28161961 ttagtcgacctcctcgatcttggggccag 28161933



to top

>emb|X78414.1|ZMHSP704 Z.mays (cv DH5xDH7) hsp70-4 mRNA for heat shock protein 70
          Length = 913

 Score =  226 bits (114), Expect = 6e-56
 Identities = 253/296 (85%), Gaps = 10/296 (3%)
 Strand = Plus / Minus

                                                                       
Query: 289 ttagtcgacctcctcgatcttggggccagggccgccg-gatgcag-caggggtgtcatcg 346
           |||||| |||||||||||||||||||||||  ||||| | ||| | |||||| ||| |||
Sbjct: 662 ttagtccacctcctcgatcttggggccagg--cgccgcgctgccggcaggggcgtcctcg 605

                                                                       
Query: 347 tccatgccacc------ctccatgtcggcaccagcaccctggtacatcttggcgatgatg 400
           |||||||| ||      | |||||||  |||| || |||| |||||||||||||||||||
Sbjct: 604 tccatgccgccaggccgccccatgtcttcacccgcgcccttgtacatcttggcgatgatg 545

                                                                       
Query: 401 gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 460
           |||||||| |||  ||||||||||||||||||||  || |||||||||||||| ||| ||
Sbjct: 544 gggttgcagaggctctccagctccttcatcttgtactcgaactcgtccgcctcggcaggc 485

                                                                       
Query: 461 tggttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcg 520
           ||||  | |||||||||   |||||| || |||||||| |||||||||||||||||||| 
Sbjct: 484 tggtcggcgtccagccagctgatggccgcgtcgatggcgtcctcgatcttcttcttgtca 425

                                                                   
Query: 521 tcggccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
           ||||||||||||||||| || ||||||||||||||||| |||||||||||||||||
Sbjct: 424 tcggccggcagcttggacgcaatcttctcgtccttgatcgtgttgcgcatgttgta 369



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  216 bits (109), Expect = 6e-53
 Identities = 202/233 (86%)
 Strand = Plus / Minus

                                                                           
Query: 344     tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 403
               ||||||||||| ||  ||||||| || || || |||||||||||||||||||||||||||
Sbjct: 9344803 tcgtccatgcctccggccatgtcagctccggcgccctggtacatcttggcgatgatgggg 9344744

                                                                           
Query: 404     ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 463
               ||||| | | |||||||||||||||||||||| || ||||| || ||||| || ||||||
Sbjct: 9344743 ttgcagacgccctccagctccttcatcttgtcctcgaactcctcggcctcggcgagctgg 9344684

                                                                           
Query: 464     ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcg 523
               ||  |||| |||||   ||||||| | |||||||| ||||||||||||||||||||| | 
Sbjct: 9344683 ttgctgtcgagccagctgatggcaccgtcgatggcgtcctcgatcttcttcttgtcggcc 9344624

                                                                    
Query: 524     gccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
                ||||||||||||| |||||||| ||||||||||||||||| |||||||||||
Sbjct: 9344623 tccggcagcttggacgcgatcttgtcgtccttgatggtgttccgcatgttgta 9344571



 Score =  210 bits (106), Expect = 4e-51
 Identities = 205/238 (86%)
 Strand = Plus / Minus

                                                                            
Query: 341      tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 400
                ||||||||||| |||||  |||||||||||||||||||||||||||||||||| || || 
Sbjct: 34146522 tcatcgtccattccaccacccatgtcggcaccagcaccctggtacatcttggcaataatt 34146463

                                                                            
Query: 401      gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 460
                |||||||||||| ||||||||||||||||||||||||| ||||| ||  ||||||| |||
Sbjct: 34146462 gggttgcacaggccctccagctccttcatcttgtcttcgaactcttcaacctcagcgagc 34146403

                                                                            
Query: 461      tggttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcg 520
                |||||  |||||||||||||||| ||    ||||  || ||||| ||||| |||||||||
Sbjct: 34146402 tggttgttgtccagccactggatcgcctgctcgaccgcgtcctcaatctttttcttgtcg 34146343

                                                                          
Query: 521      tcggccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaag 578
                || || ||||||||||| || ||||||||||| | ||| ||||| | |||||||||||
Sbjct: 34146342 tcagctggcagcttggaagcaatcttctcgtcttggatagtgttcctcatgttgtaag 34146285



 Score =  167 bits (84), Expect = 5e-38
 Identities = 153/176 (86%)
 Strand = Plus / Plus

                                                                           
Query: 377     ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 436
               |||||||||||||| | |||||| || ||||| |||  ||| ||||||||||||||||| 
Sbjct: 9383971 ccctggtacatctttgagatgatcggattgcagaggctctcgagctccttcatcttgtcc 9384030

                                                                           
Query: 437     tcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatg 496
               || |||||||| ||||| || ||||||||   ||| ||||||| ||||||| | ||||||
Sbjct: 9384031 tcgaactcgtcggcctcggcgagctggttgccgtcgagccacttgatggcatcctcgatg 9384090

                                                                       
Query: 497     gcctcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtc 552
               || |||||||||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 9384091 gcgtcctcgatcttcttcttgtcgtcggcggggagcttggaggcgatcttctcgtc 9384146



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                  
Query: 289     ttagtcgacctcctcgatcttggggccagggccgc 323
               |||||| || ||||||||||||||||||| |||||
Sbjct: 9383868 ttagtccacttcctcgatcttggggccagcgccgc 9383902



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                              
Query: 288      tttagtcgacctcctcgatcttggggccag 317
                |||||||||||||||| ||||| |||||||
Sbjct: 34146578 tttagtcgacctcctcaatcttagggccag 34146549



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 288     tttagtcgacctcctcgatcttggg 312
               |||||||||| ||||||||||||||
Sbjct: 9344868 tttagtcgacttcctcgatcttggg 9344844



to top

>gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0002D01, from chromosome 3, complete sequence
          Length = 187589

 Score =  216 bits (109), Expect = 6e-53
 Identities = 202/233 (86%)
 Strand = Plus / Minus

                                                                         
Query: 344   tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 403
             ||||||||||| ||  ||||||| || || || |||||||||||||||||||||||||||
Sbjct: 42203 tcgtccatgcctccggccatgtcagctccggcgccctggtacatcttggcgatgatgggg 42144

                                                                         
Query: 404   ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 463
             ||||| | | |||||||||||||||||||||| || ||||| || ||||| || ||||||
Sbjct: 42143 ttgcagacgccctccagctccttcatcttgtcctcgaactcctcggcctcggcgagctgg 42084

                                                                         
Query: 464   ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcg 523
             ||  |||| |||||   ||||||| | |||||||| ||||||||||||||||||||| | 
Sbjct: 42083 ttgctgtcgagccagctgatggcaccgtcgatggcgtcctcgatcttcttcttgtcggcc 42024

                                                                  
Query: 524   gccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
              ||||||||||||| |||||||| ||||||||||||||||| |||||||||||
Sbjct: 42023 tccggcagcttggacgcgatcttgtcgtccttgatggtgttccgcatgttgta 41971



 Score =  167 bits (84), Expect = 5e-38
 Identities = 153/176 (86%)
 Strand = Plus / Plus

                                                                         
Query: 377   ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 436
             |||||||||||||| | |||||| || ||||| |||  ||| ||||||||||||||||| 
Sbjct: 81371 ccctggtacatctttgagatgatcggattgcagaggctctcgagctccttcatcttgtcc 81430

                                                                         
Query: 437   tcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatg 496
             || |||||||| ||||| || ||||||||   ||| ||||||| ||||||| | ||||||
Sbjct: 81431 tcgaactcgtcggcctcggcgagctggttgccgtcgagccacttgatggcatcctcgatg 81490

                                                                     
Query: 497   gcctcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtc 552
             || |||||||||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 81491 gcgtcctcgatcttcttcttgtcgtcggcggggagcttggaggcgatcttctcgtc 81546



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 289   ttagtcgacctcctcgatcttggggccagggccgc 323
             |||||| || ||||||||||||||||||| |||||
Sbjct: 81268 ttagtccacttcctcgatcttggggccagcgccgc 81302



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 288   tttagtcgacctcctcgatcttggg 312
             |||||||||| ||||||||||||||
Sbjct: 42268 tttagtcgacttcctcgatcttggg 42244



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  216 bits (109), Expect = 6e-53
 Identities = 202/233 (86%)
 Strand = Plus / Minus

                                                                           
Query: 344     tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 403
               ||||||||||| ||  ||||||| || || || |||||||||||||||||||||||||||
Sbjct: 9342924 tcgtccatgcctccggccatgtcagctccggcgccctggtacatcttggcgatgatgggg 9342865

                                                                           
Query: 404     ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 463
               ||||| | | |||||||||||||||||||||| || ||||| || ||||| || ||||||
Sbjct: 9342864 ttgcagacgccctccagctccttcatcttgtcctcgaactcctcggcctcggcgagctgg 9342805

                                                                           
Query: 464     ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcg 523
               ||  |||| |||||   ||||||| | |||||||| ||||||||||||||||||||| | 
Sbjct: 9342804 ttgctgtcgagccagctgatggcaccgtcgatggcgtcctcgatcttcttcttgtcggcc 9342745

                                                                    
Query: 524     gccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
                ||||||||||||| |||||||| ||||||||||||||||| |||||||||||
Sbjct: 9342744 tccggcagcttggacgcgatcttgtcgtccttgatggtgttccgcatgttgta 9342692



 Score =  210 bits (106), Expect = 4e-51
 Identities = 205/238 (86%)
 Strand = Plus / Minus

                                                                            
Query: 341      tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 400
                ||||||||||| |||||  |||||||||||||||||||||||||||||||||| || || 
Sbjct: 34236994 tcatcgtccattccaccacccatgtcggcaccagcaccctggtacatcttggcaataatt 34236935

                                                                            
Query: 401      gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 460
                |||||||||||| ||||||||||||||||||||||||| ||||| ||  ||||||| |||
Sbjct: 34236934 gggttgcacaggccctccagctccttcatcttgtcttcgaactcttcaacctcagcgagc 34236875

                                                                            
Query: 461      tggttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcg 520
                |||||  |||||||||||||||| ||    ||||  || ||||| ||||| |||||||||
Sbjct: 34236874 tggttgttgtccagccactggatcgcctgctcgaccgcgtcctcaatctttttcttgtcg 34236815

                                                                          
Query: 521      tcggccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaag 578
                || || ||||||||||| || ||||||||||| | ||| ||||| | |||||||||||
Sbjct: 34236814 tcagctggcagcttggaagcaatcttctcgtcttggatagtgttcctcatgttgtaag 34236757



 Score =  167 bits (84), Expect = 5e-38
 Identities = 153/176 (86%)
 Strand = Plus / Plus

                                                                           
Query: 377     ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 436
               |||||||||||||| | |||||| || ||||| |||  ||| ||||||||||||||||| 
Sbjct: 9382092 ccctggtacatctttgagatgatcggattgcagaggctctcgagctccttcatcttgtcc 9382151

                                                                           
Query: 437     tcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatg 496
               || |||||||| ||||| || ||||||||   ||| ||||||| ||||||| | ||||||
Sbjct: 9382152 tcgaactcgtcggcctcggcgagctggttgccgtcgagccacttgatggcatcctcgatg 9382211

                                                                       
Query: 497     gcctcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtc 552
               || |||||||||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 9382212 gcgtcctcgatcttcttcttgtcgtcggcggggagcttggaggcgatcttctcgtc 9382267



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                  
Query: 289     ttagtcgacctcctcgatcttggggccagggccgc 323
               |||||| || ||||||||||||||||||| |||||
Sbjct: 9381989 ttagtccacttcctcgatcttggggccagcgccgc 9382023



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                              
Query: 288      tttagtcgacctcctcgatcttggggccag 317
                |||||||||||||||| ||||| |||||||
Sbjct: 34237050 tttagtcgacctcctcaatcttagggccag 34237021



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 288     tttagtcgacctcctcgatcttggg 312
               |||||||||| ||||||||||||||
Sbjct: 9342989 tttagtcgacttcctcgatcttggg 9342965



to top

>gb|AC137698.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBb0014A21, from chromosome 3, complete sequence
          Length = 134014

 Score =  216 bits (109), Expect = 6e-53
 Identities = 202/233 (86%)
 Strand = Plus / Plus

                                                                         
Query: 344   tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 403
             ||||||||||| ||  ||||||| || || || |||||||||||||||||||||||||||
Sbjct: 11162 tcgtccatgcctccggccatgtcagctccggcgccctggtacatcttggcgatgatgggg 11221

                                                                         
Query: 404   ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 463
             ||||| | | |||||||||||||||||||||| || ||||| || ||||| || ||||||
Sbjct: 11222 ttgcagacgccctccagctccttcatcttgtcctcgaactcctcggcctcggcgagctgg 11281

                                                                         
Query: 464   ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcg 523
             ||  |||| |||||   ||||||| | |||||||| ||||||||||||||||||||| | 
Sbjct: 11282 ttgctgtcgagccagctgatggcaccgtcgatggcgtcctcgatcttcttcttgtcggcc 11341

                                                                  
Query: 524   gccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
              ||||||||||||| |||||||| ||||||||||||||||| |||||||||||
Sbjct: 11342 tccggcagcttggacgcgatcttgtcgtccttgatggtgttccgcatgttgta 11394



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 288   tttagtcgacctcctcgatcttggg 312
             |||||||||| ||||||||||||||
Sbjct: 11097 tttagtcgacttcctcgatcttggg 11121



to top

>dbj|AK109474.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-129-B01, full
            insert sequence
          Length = 2253

 Score =  216 bits (109), Expect = 6e-53
 Identities = 202/233 (86%)
 Strand = Plus / Minus

                                                                        
Query: 344  tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 403
            ||||||||||| ||  ||||||| || || || |||||||||||||||||||||||||||
Sbjct: 1996 tcgtccatgcctccggccatgtcagctccggcgccctggtacatcttggcgatgatgggg 1937

                                                                        
Query: 404  ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 463
            ||||| | | |||||||||||||||||||||| || ||||| || ||||| || ||||||
Sbjct: 1936 ttgcagacgccctccagctccttcatcttgtcctcgaactcctcggcctcggcgagctgg 1877

                                                                        
Query: 464  ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcg 523
            ||  |||| |||||   ||||||| | |||||||| ||||||||||||||||||||| | 
Sbjct: 1876 ttgctgtcgagccagctgatggcaccgtcgatggcgtcctcgatcttcttcttgtcggcc 1817

                                                                 
Query: 524  gccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
             ||||||||||||| |||||||| ||||||||||||||||| |||||||||||
Sbjct: 1816 tccggcagcttggacgcgatcttgtcgtccttgatggtgttccgcatgttgta 1764



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 288  tttagtcgacctcctcgatcttggg 312
            |||||||||| ||||||||||||||
Sbjct: 2061 tttagtcgacttcctcgatcttggg 2037



to top

>dbj|AK099275.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023078D02, full
            insert sequence
          Length = 2243

 Score =  216 bits (109), Expect = 6e-53
 Identities = 202/233 (86%)
 Strand = Plus / Minus

                                                                        
Query: 344  tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 403
            ||||||||||| ||  ||||||| || || || |||||||||||||||||||||||||||
Sbjct: 1999 tcgtccatgcctccggccatgtcagctccggcgccctggtacatcttggcgatgatgggg 1940

                                                                        
Query: 404  ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 463
            ||||| | | |||||||||||||||||||||| || ||||| || ||||| || ||||||
Sbjct: 1939 ttgcagacgccctccagctccttcatcttgtcctcgaactcctcggcctcggcgagctgg 1880

                                                                        
Query: 464  ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcg 523
            ||  |||| |||||   ||||||| | |||||||| ||||||||||||||||||||| | 
Sbjct: 1879 ttgctgtcgagccagctgatggcaccgtcgatggcgtcctcgatcttcttcttgtcggcc 1820

                                                                 
Query: 524  gccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
             ||||||||||||| |||||||| ||||||||||||||||| |||||||||||
Sbjct: 1819 tccggcagcttggacgcgatcttgtcgtccttgatggtgttccgcatgttgta 1767



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 288  tttagtcgacctcctcgatcttggg 312
            |||||||||| ||||||||||||||
Sbjct: 2064 tttagtcgacttcctcgatcttggg 2040



to top

>dbj|AK072830.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023139H01, full
            insert sequence
          Length = 2252

 Score =  216 bits (109), Expect = 6e-53
 Identities = 202/233 (86%)
 Strand = Plus / Minus

                                                                        
Query: 344  tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 403
            ||||||||||| ||  ||||||| || || || |||||||||||||||||||||||||||
Sbjct: 2003 tcgtccatgcctccggccatgtcagctccggcgccctggtacatcttggcgatgatgggg 1944

                                                                        
Query: 404  ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 463
            ||||| | | |||||||||||||||||||||| || ||||| || ||||| || ||||||
Sbjct: 1943 ttgcagacgccctccagctccttcatcttgtcctcgaactcctcggcctcggcgagctgg 1884

                                                                        
Query: 464  ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcg 523
            ||  |||| |||||   ||||||| | |||||||| ||||||||||||||||||||| | 
Sbjct: 1883 ttgctgtcgagccagctgatggcaccgtcgatggcgtcctcgatcttcttcttgtcggcc 1824

                                                                 
Query: 524  gccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
             ||||||||||||| |||||||| ||||||||||||||||| |||||||||||
Sbjct: 1823 tccggcagcttggacgcgatcttgtcgtccttgatggtgttccgcatgttgta 1771



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 288  tttagtcgacctcctcgatcttggg 312
            |||||||||| ||||||||||||||
Sbjct: 2068 tttagtcgacttcctcgatcttggg 2044



to top

>ref|XM_470141.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2522

 Score =  210 bits (106), Expect = 4e-51
 Identities = 205/238 (86%)
 Strand = Plus / Minus

                                                                        
Query: 341  tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 400
            ||||||||||| |||||  |||||||||||||||||||||||||||||||||| || || 
Sbjct: 1990 tcatcgtccattccaccacccatgtcggcaccagcaccctggtacatcttggcaataatt 1931

                                                                        
Query: 401  gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 460
            |||||||||||| ||||||||||||||||||||||||| ||||| ||  ||||||| |||
Sbjct: 1930 gggttgcacaggccctccagctccttcatcttgtcttcgaactcttcaacctcagcgagc 1871

                                                                        
Query: 461  tggttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcg 520
            |||||  |||||||||||||||| ||    ||||  || ||||| ||||| |||||||||
Sbjct: 1870 tggttgttgtccagccactggatcgcctgctcgaccgcgtcctcaatctttttcttgtcg 1811

                                                                      
Query: 521  tcggccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaag 578
            || || ||||||||||| || ||||||||||| | ||| ||||| | |||||||||||
Sbjct: 1810 tcagctggcagcttggaagcaatcttctcgtcttggatagtgttcctcatgttgtaag 1753



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 288  tttagtcgacctcctcgatcttggggccag 317
            |||||||||||||||| ||||| |||||||
Sbjct: 2046 tttagtcgacctcctcaatcttagggccag 2017



to top

>gb|AC104433.8| Oryza sativa chromosome 3 BAC OJ1754_E06 genomic sequence, complete
              sequence
          Length = 163828

 Score =  210 bits (106), Expect = 4e-51
 Identities = 205/238 (86%)
 Strand = Plus / Minus

                                                                          
Query: 341    tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 400
              ||||||||||| |||||  |||||||||||||||||||||||||||||||||| || || 
Sbjct: 110334 tcatcgtccattccaccacccatgtcggcaccagcaccctggtacatcttggcaataatt 110275

                                                                          
Query: 401    gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 460
              |||||||||||| ||||||||||||||||||||||||| ||||| ||  ||||||| |||
Sbjct: 110274 gggttgcacaggccctccagctccttcatcttgtcttcgaactcttcaacctcagcgagc 110215

                                                                          
Query: 461    tggttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcg 520
              |||||  |||||||||||||||| ||    ||||  || ||||| ||||| |||||||||
Sbjct: 110214 tggttgttgtccagccactggatcgcctgctcgaccgcgtcctcaatctttttcttgtcg 110155

                                                                        
Query: 521    tcggccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaag 578
              || || ||||||||||| || ||||||||||| | ||| ||||| | |||||||||||
Sbjct: 110154 tcagctggcagcttggaagcaatcttctcgtcttggatagtgttcctcatgttgtaag 110097



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 288    tttagtcgacctcctcgatcttggggccag 317
              |||||||||||||||| ||||| |||||||
Sbjct: 110390 tttagtcgacctcctcaatcttagggccag 110361



to top

>dbj|AK102784.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033107K19, full
            insert sequence
          Length = 2370

 Score =  210 bits (106), Expect = 4e-51
 Identities = 205/238 (86%)
 Strand = Plus / Minus

                                                                        
Query: 341  tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 400
            ||||||||||| |||||  |||||||||||||||||||||||||||||||||| || || 
Sbjct: 2023 tcatcgtccattccaccacccatgtcggcaccagcaccctggtacatcttggcaataatt 1964

                                                                        
Query: 401  gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 460
            |||||||||||| ||||||||||||||||||||||||| ||||| ||  ||||||| |||
Sbjct: 1963 gggttgcacaggccctccagctccttcatcttgtcttcgaactcttcaacctcagcgagc 1904

                                                                        
Query: 461  tggttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcg 520
            |||||  |||||||||||||||| ||    ||||  || ||||| ||||| |||||||||
Sbjct: 1903 tggttgttgtccagccactggatcgcctgctcgaccgcgtcctcaatctttttcttgtcg 1844

                                                                      
Query: 521  tcggccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaag 578
            || || ||||||||||| || ||||||||||| | ||| ||||| | |||||||||||
Sbjct: 1843 tcagctggcagcttggaagcaatcttctcgtcttggatagtgttcctcatgttgtaag 1786



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 288  tttagtcgacctcctcgatcttggggccag 317
            |||||||||||||||| ||||| |||||||
Sbjct: 2079 tttagtcgacctcctcaatcttagggccag 2050



to top

>dbj|AK069740.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023030D03, full
            insert sequence
          Length = 2282

 Score =  210 bits (106), Expect = 4e-51
 Identities = 205/238 (86%)
 Strand = Plus / Minus

                                                                        
Query: 341  tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 400
            ||||||||||| |||||  |||||||||||||||||||||||||||||||||| || || 
Sbjct: 2025 tcatcgtccattccaccacccatgtcggcaccagcaccctggtacatcttggcaataatt 1966

                                                                        
Query: 401  gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 460
            |||||||||||| ||||||||||||||||||||||||| ||||| ||  ||||||| |||
Sbjct: 1965 gggttgcacaggccctccagctccttcatcttgtcttcgaactcttcaacctcagcgagc 1906

                                                                        
Query: 461  tggttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcg 520
            |||||  |||||||||||||||| ||    ||||  || ||||| ||||| |||||||||
Sbjct: 1905 tggttgttgtccagccactggatcgcctgctcgaccgcgtcctcaatctttttcttgtcg 1846

                                                                      
Query: 521  tcggccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaag 578
            || || ||||||||||| || ||||||||||| | ||| ||||| | |||||||||||
Sbjct: 1845 tcagctggcagcttggaagcaatcttctcgtcttggatagtgttcctcatgttgtaag 1788



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 288  tttagtcgacctcctcgatcttggggccag 317
            |||||||||||||||| ||||| |||||||
Sbjct: 2081 tttagtcgacctcctcaatcttagggccag 2052



to top

>ref|NM_190528.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1947

 Score =  208 bits (105), Expect = 1e-50
 Identities = 189/217 (87%)
 Strand = Plus / Minus

                                                                        
Query: 360  ccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctcca 419
            ||||||| || || || |||||||||||||| ||||||||||||||||| | |  |||||
Sbjct: 1870 ccatgtccgcgccggcgccctggtacatcttcgcgatgatggggttgcagatgctctcca 1811

                                                                        
Query: 420  gctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccact 479
            |||||||||||||||| || |||||||||||||| || ||||||||  |||| ||||| |
Sbjct: 1810 gctccttcatcttgtcctcgaactcgtccgcctccgcgagctggttgctgtcgagccagt 1751

                                                                        
Query: 480  ggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcggccggcagcttggagg 539
             ||||||  | |||||||| ||||||||||||||||||||||| ||||  ||||||||||
Sbjct: 1750 tgatggcgccgtcgatggcgtcctcgatcttcttcttgtcgtccgccgagagcttggagg 1691

                                                 
Query: 540  cgatcttctcgtccttgatggtgttgcgcatgttgta 576
            ||||||| ||||||||||||||||| | |||||||||
Sbjct: 1690 cgatcttgtcgtccttgatggtgttcctcatgttgta 1654



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 293  tcgacctcctcgatcttggggcc 315
            |||||||||||||||||||||||
Sbjct: 1943 tcgacctcctcgatcttggggcc 1921



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  208 bits (105), Expect = 1e-50
 Identities = 189/217 (87%)
 Strand = Plus / Minus

                                                                            
Query: 360      ccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctcca 419
                ||||||| || || || |||||||||||||| ||||||||||||||||| | |  |||||
Sbjct: 36036152 ccatgtccgcgccggcgccctggtacatcttcgcgatgatggggttgcagatgctctcca 36036093

                                                                            
Query: 420      gctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccact 479
                |||||||||||||||| || |||||||||||||| || ||||||||  |||| ||||| |
Sbjct: 36036092 gctccttcatcttgtcctcgaactcgtccgcctccgcgagctggttgctgtcgagccagt 36036033

                                                                            
Query: 480      ggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcggccggcagcttggagg 539
                 ||||||  | |||||||| ||||||||||||||||||||||| ||||  ||||||||||
Sbjct: 36036032 tgatggcgccgtcgatggcgtcctcgatcttcttcttgtcgtccgccgagagcttggagg 36035973

                                                     
Query: 540      cgatcttctcgtccttgatggtgttgcgcatgttgta 576
                ||||||| ||||||||||||||||| | |||||||||
Sbjct: 36035972 cgatcttgtcgtccttgatggtgttcctcatgttgta 36035936



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 293      tcgacctcctcgatcttggggcc 315
                |||||||||||||||||||||||
Sbjct: 36036225 tcgacctcctcgatcttggggcc 36036203



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 505      gatcttcttcttgtcgtcggccggc 529
                |||||||||||| ||||||||||||
Sbjct: 40186339 gatcttcttcttctcgtcggccggc 40186363



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 77       acatcatcgaactaatatat 96
                ||||||||||||||||||||
Sbjct: 15119654 acatcatcgaactaatatat 15119673



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 163     cacggaataactacgaccac 182
               ||||||||||||||||||||
Sbjct: 5589872 cacggaataactacgaccac 5589853



to top

>dbj|AP003241.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0408C03
          Length = 141273

 Score =  208 bits (105), Expect = 1e-50
 Identities = 189/217 (87%)
 Strand = Plus / Minus

                                                                         
Query: 360   ccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctcca 419
             ||||||| || || || |||||||||||||| ||||||||||||||||| | |  |||||
Sbjct: 48877 ccatgtccgcgccggcgccctggtacatcttcgcgatgatggggttgcagatgctctcca 48818

                                                                         
Query: 420   gctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccact 479
             |||||||||||||||| || |||||||||||||| || ||||||||  |||| ||||| |
Sbjct: 48817 gctccttcatcttgtcctcgaactcgtccgcctccgcgagctggttgctgtcgagccagt 48758

                                                                         
Query: 480   ggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcggccggcagcttggagg 539
              ||||||  | |||||||| ||||||||||||||||||||||| ||||  ||||||||||
Sbjct: 48757 tgatggcgccgtcgatggcgtcctcgatcttcttcttgtcgtccgccgagagcttggagg 48698

                                                  
Query: 540   cgatcttctcgtccttgatggtgttgcgcatgttgta 576
             ||||||| ||||||||||||||||| | |||||||||
Sbjct: 48697 cgatcttgtcgtccttgatggtgttcctcatgttgta 48661



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 293   tcgacctcctcgatcttggggcc 315
             |||||||||||||||||||||||
Sbjct: 48950 tcgacctcctcgatcttggggcc 48928



to top

>dbj|AP003231.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0031D11
          Length = 138108

 Score =  208 bits (105), Expect = 1e-50
 Identities = 189/217 (87%)
 Strand = Plus / Minus

                                                                          
Query: 360    ccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctcca 419
              ||||||| || || || |||||||||||||| ||||||||||||||||| | |  |||||
Sbjct: 134830 ccatgtccgcgccggcgccctggtacatcttcgcgatgatggggttgcagatgctctcca 134771

                                                                          
Query: 420    gctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccact 479
              |||||||||||||||| || |||||||||||||| || ||||||||  |||| ||||| |
Sbjct: 134770 gctccttcatcttgtcctcgaactcgtccgcctccgcgagctggttgctgtcgagccagt 134711

                                                                          
Query: 480    ggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcggccggcagcttggagg 539
               ||||||  | |||||||| ||||||||||||||||||||||| ||||  ||||||||||
Sbjct: 134710 tgatggcgccgtcgatggcgtcctcgatcttcttcttgtcgtccgccgagagcttggagg 134651

                                                   
Query: 540    cgatcttctcgtccttgatggtgttgcgcatgttgta 576
              ||||||| ||||||||||||||||| | |||||||||
Sbjct: 134650 cgatcttgtcgtccttgatggtgttcctcatgttgta 134614



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 293    tcgacctcctcgatcttggggcc 315
              |||||||||||||||||||||||
Sbjct: 134903 tcgacctcctcgatcttggggcc 134881



to top

>gb|U41653.1|SBU41653 Sorghum bicolor heat shock protein 70 (hsp70) pseudogene
          Length = 3305

 Score =  186 bits (94), Expect = 5e-44
 Identities = 178/206 (86%)
 Strand = Plus / Minus

                                                                        
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatc 430
            ||||| |||||||||||||| || |||||||||||||| | | |||||||||||||||||
Sbjct: 3052 ccagctccctggtacatcttcgcaatgatggggttgcagatgccctccagctccttcatc 2993

                                                                        
Query: 431  ttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagca 490
            |||||||| |||||||| |||||||| ||||||||  ||||||||||   ||||||  ||
Sbjct: 2992 ttgtcttcgaactcgtcggcctcagcgagctggttgctgtccagccagctgatggctcca 2933

                                                                        
Query: 491  tcgatggcctcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcg 550
            ||||  || |||||||||||||||||||| || || || |||| |||||||||||| |||
Sbjct: 2932 tcgacagcgtcctcgatcttcttcttgtcctccgcagggagctcggaggcgatcttgtcg 2873

                                      
Query: 551  tccttgatggtgttgcgcatgttgta 576
            ||||||||||| || | |||||||||
Sbjct: 2872 tccttgatggtattcctcatgttgta 2847



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 289  ttagtcgacctcctcgatcttggg 312
            ||||||||||||||| ||||||||
Sbjct: 3122 ttagtcgacctcctcaatcttggg 3099



to top

>gb|AF005993.1|AF005993 Triticum aestivum 70 kDa heat shock protein (TaHSP70d) mRNA, complete
            cds
          Length = 2311

 Score =  174 bits (88), Expect = 2e-40
 Identities = 172/200 (86%)
 Strand = Plus / Minus

                                                                        
Query: 377  ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 436
            |||||||||||||||||||||||||||||||| | | |||||||||||||||||||||| 
Sbjct: 1967 ccctggtacatcttggcgatgatggggttgcagatgccctccagctccttcatcttgtcc 1908

                                                                        
Query: 437  tcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatg 496
            || |||||||| ||||| || |||||||| | |||||||||   |||||   | ||||| 
Sbjct: 1907 tcgaactcgtcggcctcggcgagctggttggcgtccagccagctgatggtgccctcgatc 1848

                                                                        
Query: 497  gcctcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttg 556
            |||||||| | ||||||||||||||| ||    ||||||||||||||||| |||||||||
Sbjct: 1847 gcctcctccaccttcttcttgtcgtccgcgccgagcttggaggcgatcttgtcgtccttg 1788

                                
Query: 557  atggtgttgcgcatgttgta 576
            |  |||||||||||||||||
Sbjct: 1787 accgtgttgcgcatgttgta 1768



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                 
Query: 289  ttagtcgacctcctcgatcttggggccagggccgccg 325
            |||||| |||||||||||||||||||||| |||||||
Sbjct: 2061 ttagtccacctcctcgatcttggggccagcgccgccg 2025



to top

>gb|BT016692.1| Zea mays clone Contig525 mRNA sequence
          Length = 1806

 Score =  167 bits (84), Expect = 5e-38
 Identities = 171/200 (85%)
 Strand = Plus / Minus

                                                                        
Query: 377  ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 436
            |||||||||||||| ||||||||||||||||| |   |||| ||||||||||||||||||
Sbjct: 1560 ccctggtacatcttcgcgatgatggggttgcagatcccctcaagctccttcatcttgtct 1501

                                                                        
Query: 437  tcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatg 496
            |||||||| ||| ||||||| ||||||||  ||||||||||   ||||||    || | |
Sbjct: 1500 tcaaactcctccacctcagccagctggttgctgtccagccagctgatggcgctgtcaacg 1441

                                                                        
Query: 497  gcctcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttg 556
            || || ||||||||||||||||| || || || ||||||||||||||||| |||||||||
Sbjct: 1440 gcatcttcgatcttcttcttgtcctcagcggggagcttggaggcgatcttgtcgtccttg 1381

                                
Query: 557  atggtgttgcgcatgttgta 576
            |||||||| | |||||||||
Sbjct: 1380 atggtgttcctcatgttgta 1361



to top

>gb|BT018649.1| Zea mays clone EL01N0505F04.d mRNA sequence
          Length = 1788

 Score =  167 bits (84), Expect = 5e-38
 Identities = 176/204 (86%), Gaps = 2/204 (0%)
 Strand = Plus / Minus

                                                                        
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatc 430
            ||||| || ||||||||||||||||||||||||||||| | | |||| ||||||||||||
Sbjct: 1539 ccagcgccttggtacatcttggcgatgatggggttgcagatgccctcgagctccttcatc 1480

                                                                        
Query: 431  ttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagcca-ctggatggcagc 489
            |||||||| ||||||||| ||||||| ||||||||  |||||||||| |||| ||||   
Sbjct: 1479 ttgtcttcgaactcgtccacctcagctagctggttgctgtccagccagctgg-tggcgct 1421

                                                                        
Query: 490  atcgatggcctcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctc 549
            |||||  || ||||||||||| |||||||| || ||||  ||||||||||||||||| ||
Sbjct: 1420 atcgacagcgtcctcgatctttttcttgtcatctgccgagagcttggaggcgatcttgtc 1361

                                    
Query: 550  gtccttgatggtgttgcgcatgtt 573
             |||||||||||||| | ||||||
Sbjct: 1360 atccttgatggtgttcctcatgtt 1337



to top

>emb|X03697.1|ZMHSP702 Maize gene for heat shock protein 70 exon 2 and 3'-UT (hsp70; clone
            pMON 9502)
          Length = 1934

 Score =  161 bits (81), Expect = 3e-36
 Identities = 168/197 (85%)
 Strand = Plus / Minus

                                                                        
Query: 380  tggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttca 439
            ||||||||||| ||||||||||||||||| |   |||| |||||||||||||||||||| 
Sbjct: 1772 tggtacatcttcgcgatgatggggttgcagatcccctcaagctccttcatcttgtcttcg 1713

                                                                        
Query: 440  aactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatggcc 499
            ||||| ||| ||||||| ||||||||  ||||||||||   ||||||  | || | ||| 
Sbjct: 1712 aactcctccacctcagccagctggttgctgtccagccagctgatggcgccgtcaacggca 1653

                                                                        
Query: 500  tcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttgatg 559
            || ||||||||||||||||| || || || ||||||||||||||||| ||||||||||||
Sbjct: 1652 tcttcgatcttcttcttgtcctcagcggggagcttggaggcgatcttgtcgtccttgatg 1593

                             
Query: 560  gtgttgcgcatgttgta 576
            ||||| | |||||||||
Sbjct: 1592 gtgttcctcatgttgta 1576



to top

>gb|AF479058.1| Sandersonia aurantiaca 70 kDa heat shock protein mRNA, complete cds
          Length = 1241

 Score =  161 bits (81), Expect = 3e-36
 Identities = 177/209 (84%)
 Strand = Plus / Minus

                                                                       
Query: 368 gcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
           ||||||||||| ||||||||||||||||||||||||||||| | |  |||||| ||||||
Sbjct: 994 gcaccagcaccttggtacatcttggcgatgatggggttgcagatgctctccagttccttc 935

                                                                       
Query: 428 atcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggca 487
           |||||||| |||||||| || || ||||||||||||||  |||| ||||||||||| || 
Sbjct: 934 atcttgtcatcaaactcatcagcttcagcaagctggttgttgtcgagccactggattgcc 875

                                                                       
Query: 488 gcatcgatggcctcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttc 547
              || || || ||||| ||||||||||||||  | || ||||||||||| || ||||| 
Sbjct: 874 tggtcaattgcatcctcaatcttcttcttgtcagcagcaggcagcttggaagcaatcttg 815

                                        
Query: 548 tcgtccttgatggtgttgcgcatgttgta 576
           || |||||||||||||| | |||||||||
Sbjct: 814 tcatccttgatggtgttcctcatgttgta 786



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 289  ttagtcgacctcctcgatcttggggccag 317
            ||||||||||||||| |||||||| ||||
Sbjct: 1076 ttagtcgacctcctcaatcttgggaccag 1048



to top

>gb|AY104350.1| Zea mays PCO083553 mRNA sequence
          Length = 1167

 Score =  159 bits (80), Expect = 1e-35
 Identities = 170/200 (85%)
 Strand = Plus / Minus

                                                                       
Query: 377 ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 436
           ||||| |||||||| ||||||||||||||||| | | |||||||||||||||||||||| 
Sbjct: 844 ccctgatacatcttcgcgatgatggggttgcagatgccctccagctccttcatcttgtcc 785

                                                                       
Query: 437 tcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatg 496
           |||||||| ||  |||| || ||||||||  |||| ||||| | ||||||  | |||| |
Sbjct: 784 tcaaactcatcaacctcggcgagctggttgttgtcgagccaattgatggccccctcgacg 725

                                                                       
Query: 497 gcctcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttg 556
           || || |||||||| |||||||||||  |||| ||||||||||||||||| |||||  ||
Sbjct: 724 gcgtcatcgatctttttcttgtcgtcctccggtagcttggaggcgatcttgtcgtctctg 665

                               
Query: 557 atggtgttgcgcatgttgta 576
           |||||||||||||| |||||
Sbjct: 664 atggtgttgcgcatattgta 645



to top

>emb|X61491.1|SOSCE70 S.oleracea sce70 mRNA for 70 kDa heat shock protein of the
            chloroplast envelope membrane
          Length = 2535

 Score =  141 bits (71), Expect = 3e-30
 Identities = 152/179 (84%)
 Strand = Plus / Minus

                                                                        
Query: 341  tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 400
            ||||| |||||||| ||  |||||||  |||||||||| |||||||||||||| ||||| 
Sbjct: 2269 tcatcttccatgcctccacccatgtcaccaccagcaccttggtacatcttggcaatgatt 2210

                                                                        
Query: 401  gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 460
            |||||||| | |  ||||| ||||||||||||||| || ||||| || ||||||||||||
Sbjct: 2209 gggttgcagatgctctccaactccttcatcttgtcatcgaactcatcagcctcagcaagc 2150

                                                                       
Query: 461  tggttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtc 519
            |||||   ||| ||||| || |||| |||||||||||| || |||||||||||||||||
Sbjct: 2149 tggttaccgtcaagccattgaatggaagcatcgatggcttcttcgatcttcttcttgtc 2091



to top

>gb|AF034618.1|AF034618 Spinacia oleracea cytosolic heat shock 70 protein (HSC70-1) gene,
            complete cds
          Length = 4349

 Score =  141 bits (71), Expect = 3e-30
 Identities = 152/179 (84%)
 Strand = Plus / Minus

                                                                        
Query: 341  tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 400
            ||||| |||||||| ||  |||||||  |||||||||| |||||||||||||| ||||| 
Sbjct: 4091 tcatcttccatgcctccacccatgtcaccaccagcaccttggtacatcttggcaatgatt 4032

                                                                        
Query: 401  gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 460
            |||||||| | |  ||||| ||||||||||||||| || ||||| || ||||||||||||
Sbjct: 4031 gggttgcagatgctctccaactccttcatcttgtcatcgaactcatcagcctcagcaagc 3972

                                                                       
Query: 461  tggttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtc 519
            |||||   ||| ||||| || |||| |||||||||||| || |||||||||||||||||
Sbjct: 3971 tggttaccgtcaagccattgaatggaagcatcgatggcttcttcgatcttcttcttgtc 3913



to top

>gb|L26243.1|SPIC70A Spinacia oleracea heat shock C70 protein mRNA, complete cds
          Length = 2194

 Score =  141 bits (71), Expect = 3e-30
 Identities = 152/179 (84%)
 Strand = Plus / Minus

                                                                        
Query: 341  tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 400
            ||||| |||||||| ||  |||||||  |||||||||| |||||||||||||| ||||| 
Sbjct: 1936 tcatcttccatgcctccacccatgtcaccaccagcaccttggtacatcttggcaatgatt 1877

                                                                        
Query: 401  gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 460
            |||||||| | |  ||||| ||||||||||||||| || ||||| || ||||||||||||
Sbjct: 1876 gggttgcagatgctctccaactccttcatcttgtcatcgaactcatcagcctcagcaagc 1817

                                                                       
Query: 461  tggttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtc 519
            |||||   ||| ||||| || |||| |||||||||||| || |||||||||||||||||
Sbjct: 1816 tggttaccgtcaagccattgaatggaagcatcgatggcttcttcgatcttcttcttgtc 1758



to top

>gb|AY106152.1| Zea mays PCO094428 mRNA sequence
          Length = 1011

 Score =  129 bits (65), Expect = 1e-26
 Identities = 164/197 (83%)
 Strand = Plus / Minus

                                                                       
Query: 377 ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 436
           |||||||||||||  | ||||||||||||||| | |  ||||||||||||||||||||| 
Sbjct: 678 ccctggtacatctgtgagatgatggggttgcagatgctctccagctccttcatcttgtcc 619

                                                                       
Query: 437 tcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatg 496
           || ||||| || ||||| || ||||||||   ||| ||||||| ||||||  | ||||| 
Sbjct: 618 tcgaactcctcggcctccgcgagctggttgccgtcgagccacttgatggcgtcctcgatc 559

                                                                       
Query: 497 gcctcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttg 556
           |  |||||||||||||||||||| ||||| |||||||| || |||||||||||||||   
Sbjct: 558 gtgtcctcgatcttcttcttgtcatcggcgggcagcttcgacgcgatcttctcgtcccgc 499

                            
Query: 557 atggtgttgcgcatgtt 573
           |  ||||||||||||||
Sbjct: 498 accgtgttgcgcatgtt 482



to top

>emb|AJ249331.1|CSA249331 Cucumis sativus mRNA for heat shock protein 70 isoform-2
          Length = 2617

 Score =  127 bits (64), Expect = 4e-26
 Identities = 129/148 (87%), Gaps = 2/148 (1%)
 Strand = Plus / Minus

                                                                        
Query: 374  gcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttg 433
            ||||| |||||||||||||| ||||| |||||||| | |  ||||| |||||||||||||
Sbjct: 2223 gcaccttggtacatcttggcaatgattgggttgcaaatgctctccaactccttcatcttg 2164

                                                                        
Query: 434  tcttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatgg-cagcatc 492
            ||||| |||||||| |||||||| |||||||| | ||||||||| ||||||| | || ||
Sbjct: 2163 tcttcgaactcgtcagcctcagctagctggttggcgtccagccattggatggactgc-tc 2105

                                        
Query: 493  gatggcctcctcgatcttcttcttgtcg 520
            |||||| || ||||||||||||||||||
Sbjct: 2104 gatggcatcgtcgatcttcttcttgtcg 2077



to top

>gb|AY257488.1| Lycopersicon esculentum HSC2-like mRNA, partial sequence
          Length = 804

 Score =  123 bits (62), Expect = 7e-25
 Identities = 170/206 (82%)
 Strand = Plus / Minus

                                                                       
Query: 371 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatc 430
           |||||||| |||||||||||||| || || |||||||| | |  ||||| ||||||||||
Sbjct: 523 ccagcaccttggtacatcttggcaataattgggttgcaaatgctctccaactccttcatc 464

                                                                       
Query: 431 ttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagca 490
           ||||||||||| || || | ||||||||||||||| |  || ||||||||||||||    
Sbjct: 463 ttgtcttcaaattcatcagactcagcaagctggttggcatcgagccactggatggcctgc 404

                                                                       
Query: 491 tcgatggcctcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcg 550
           || ||||| ||||| ||||||||| |||   |  | ||||||||||| || |||||||| 
Sbjct: 403 tcaatggcttcctcaatcttcttcctgtttgcctcaggcagcttggatgcaatcttctca 344

                                     
Query: 551 tccttgatggtgttgcgcatgttgta 576
           |||||||||||||| | |||||||||
Sbjct: 343 tccttgatggtgttcctcatgttgta 318



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 289 ttagtcgacctcctcgatcttggggccag 317
           |||||||||||||||||||||||| ||||
Sbjct: 611 ttagtcgacctcctcgatcttgggaccag 583



to top

>gb|AF161180.1|AF161180 Malus domestica high molecular weight heat shock protein (Hsp2) mRNA,
            complete cds
          Length = 2212

 Score =  123 bits (62), Expect = 7e-25
 Identities = 158/190 (83%)
 Strand = Plus / Minus

                                                                        
Query: 375  caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 434
            ||||||||||||||||||| ||||| || ||||| | |  ||||||||||||||||||||
Sbjct: 1891 caccctggtacatcttggcaatgatcggattgcagatgctctccagctccttcatcttgt 1832

                                                                        
Query: 435  cttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcga 494
            | ||||||||||| |||||||||||||||||   ||| ||||| ||||||||    || |
Sbjct: 1831 cctcaaactcgtcggcctcagcaagctggtttccgtcaagccattggatggcctggtcaa 1772

                                                                        
Query: 495  tggcctcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtcct 554
            | || ||||| ||||||||||||||  | ||    ||||||||||| ||||| |||||||
Sbjct: 1771 ttgcatcctcaatcttcttcttgtcagctgcgtctagcttggaggcaatcttatcgtcct 1712

                      
Query: 555  tgatggtgtt 564
            |||| |||||
Sbjct: 1711 tgatcgtgtt 1702



to top

>dbj|AB012716.1| Salix gilgiana Hsc70 mRNA for heat shock protein 70 cognate, partial
            cds
          Length = 1475

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                        
Query: 341  tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 400
            ||||| |||||||||||  |||| || || |||||||| || |||||||| || ||||||
Sbjct: 1172 tcatcctccatgccaccacccatatcagctccagcaccttgatacatcttagcaatgatg 1113

                                                                        
Query: 401  gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 460
            || ||||| | |  ||| ||||||||||||||||| |||||||| || |||||||| |||
Sbjct: 1112 ggattgcagatgctctcaagctccttcatcttgtcctcaaactcatctgcctcagcgagc 1053

                                                                        
Query: 461  tggttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcg 520
            |||||  |||| ||||||||||| ||    || || || |||||||| ||||||||||||
Sbjct: 1052 tggttgctgtcgagccactggatagcctggtcaatcgcatcctcgattttcttcttgtcg 993

                                                                    
Query: 521  tcggccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
            || ||   |||||| |||  ||||||||| |||||||  ||||| | |||||||||
Sbjct: 992  tctgcacccagcttagagctgatcttctcatccttgacagtgttcctcatgttgta 937



to top

>gb|AF527796.1| Cucurbita maxima cell-autonomous heat shock cognate protein 70
            (Hsc70-3) mRNA, complete cds
          Length = 1953

 Score =  115 bits (58), Expect = 2e-22
 Identities = 129/150 (86%), Gaps = 2/150 (1%)
 Strand = Plus / Minus

                                                                        
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatc 430
            ||||| || |||||||||||||||||||| |||||||| | |  ||||| ||||||||||
Sbjct: 1862 ccagcgccttggtacatcttggcgatgattgggttgcagatgctctccaactccttcatc 1803

                                                                        
Query: 431  ttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatgg-cagc 489
            |||||||| ||||| || || ||||| |||||||| | ||| ||||||||||||| | ||
Sbjct: 1802 ttgtcttcgaactcatcggcttcagccagctggttggcgtcaagccactggatggactgc 1743

                                          
Query: 490  atcgatggcctcctcgatcttcttcttgtc 519
             |||||||| || |||||||||||||||||
Sbjct: 1742 -tcgatggcatcttcgatcttcttcttgtc 1714



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 289  ttagtcgacctcctcgatcttggggccag 317
            ||||||||| |||||||||||||| ||||
Sbjct: 1953 ttagtcgacttcctcgatcttgggaccag 1925



to top

>gb|AF033852.1|AF033852 Spinacia oleracea cytosolic heat shock 70 protein (HSC70) mRNA,
            complete cds
          Length = 2184

 Score =  105 bits (53), Expect = 2e-19
 Identities = 86/97 (88%)
 Strand = Plus / Minus

                                                                        
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 428
            |||||||||| ||||||||||| || |||||||||||||| |    ||||||||||||||
Sbjct: 1911 caccagcaccttggtacatcttagcaatgatggggttgcaaatactctccagctccttca 1852

                                                 
Query: 429  tcttgtcttcaaactcgtccgcctcagcaagctggtt 465
            |||| ||||||||||| || |||||||||||||||||
Sbjct: 1851 tcttatcttcaaactcatcagcctcagcaagctggtt 1815



to top

>gb|AF034617.1|AF034617 Spinacia oleracea cytosolic heat shock 70 protein (HSC70-3alpha)
            gene, complete cds
          Length = 5903

 Score =  105 bits (53), Expect = 2e-19
 Identities = 86/97 (88%)
 Strand = Plus / Minus

                                                                        
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 428
            |||||||||| ||||||||||| || |||||||||||||| |    ||||||||||||||
Sbjct: 4486 caccagcaccttggtacatcttagcaatgatggggttgcaaatactctccagctccttca 4427

                                                 
Query: 429  tcttgtcttcaaactcgtccgcctcagcaagctggtt 465
            |||| ||||||||||| || |||||||||||||||||
Sbjct: 4426 tcttatcttcaaactcatcagcctcagcaagctggtt 4390



to top

>gb|AF034616.1|AF034616 Spinacia oleracea cytosolic heat shock 70 protein (HSC70-3beta) gene,
            complete cds
          Length = 6425

 Score =  105 bits (53), Expect = 2e-19
 Identities = 86/97 (88%)
 Strand = Plus / Minus

                                                                        
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 428
            |||||||||| ||||||||||| || |||||||||||||| |    ||||||||||||||
Sbjct: 5013 caccagcaccttggtacatcttagcaatgatggggttgcaaatactctccagctccttca 4954

                                                 
Query: 429  tcttgtcttcaaactcgtccgcctcagcaagctggtt 465
            |||| ||||||||||| || |||||||||||||||||
Sbjct: 4953 tcttatcttcaaactcatcagcctcagcaagctggtt 4917



to top

>gb|AF527795.1| Cucurbita maxima non-cell-autonomous heat shock cognate protein 70
            (Hsc70-1) mRNA, complete cds
          Length = 1959

 Score =  101 bits (51), Expect = 2e-18
 Identities = 126/151 (83%)
 Strand = Plus / Minus

                                                                        
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 428
            |||||||||||||||||||||| || |  || |||||||| | |  ||| || |||||||
Sbjct: 1864 caccagcaccctggtacatcttagcaacaattgggttgcaaatgctctcaagttccttca 1805

                                                                        
Query: 429  tcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcag 488
            | ||||||||||||||||| ||||| ||||| |||||  |||||||||||||||  ||  
Sbjct: 1804 ttttgtcttcaaactcgtcggcctctgcaagttggttattgtccagccactggactgctc 1745

                                           
Query: 489  catcgatggcctcctcgatcttcttcttgtc 519
            | |||||||| || ||||||||||| |||||
Sbjct: 1744 cctcgatggcatcttcgatcttctttttgtc 1714



to top

>dbj|AB112816.1| Nicotiana benthamiana Hsp70 mRNA for heat shock protein 70, partial
           cds, sub_clone:NbHsp70c-C
          Length = 351

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 380 tggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttca 439
           |||||||||||||| |||||||||||||| | |  ||| |||||||||||||| ||||||
Sbjct: 233 tggtacatcttggcaatgatggggttgcagatgctctcgagctccttcatcttatcttca 174

                                     
Query: 440 aactcgtccgcctcagcaagctggtt 465
           |||||||| || ||||||||||||||
Sbjct: 173 aactcgtcagcttcagcaagctggtt 148



to top

>gb|AF509339.1| Saussurea medusa heat shock protein 70 (HSP70) mRNA, partial cds
          Length = 1484

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 121/145 (83%)
 Strand = Plus / Minus

                                                                        
Query: 375  caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 434
            |||| ||||||||||| || ||||| ||||||||||    ||| ||||||||||||||||
Sbjct: 1198 caccttggtacatcttagcaatgatcgggttgcacacattctcaagctccttcatcttgt 1139

                                                                        
Query: 435  cttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcga 494
            | |||||||| || |||||||||||||||||  |||||| ||||   || ||  |||| |
Sbjct: 1138 cctcaaactcatcagcctcagcaagctggttgctgtccaaccacgaaatagcctcatcaa 1079

                                     
Query: 495  tggcctcctcgatcttcttcttgtc 519
            |||| ||||| ||||||||||||||
Sbjct: 1078 tggcatcctcaatcttcttcttgtc 1054



to top

>gb|AC150776.2| Medicago truncatula chromosome 7 BAC clone mte1-45n16, complete
             sequence
          Length = 107886

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 121/145 (83%)
 Strand = Plus / Plus

                                                                         
Query: 375   caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 434
             |||| |||||||||||||| ||||| |||||||| |   | || || |||||||||||||
Sbjct: 27323 caccttggtacatcttggcaatgatagggttgcagacaccttcaagttccttcatcttgt 27382

                                                                         
Query: 435   cttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcga 494
             | |||||||| || ||||| ||||||||||| |  || ||||||||||| ||||| || |
Sbjct: 27383 cctcaaactcatcagcctctgcaagctggttggcatctagccactggatagcagcctcaa 27442

                                      
Query: 495   tggcctcctcgatcttcttcttgtc 519
             |||  |||||||||||||| |||||
Sbjct: 27443 tggtgtcctcgatcttctttttgtc 27467



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 288   tttagtcgacctcctcgatcttggggccag 317
             |||||||||||||||| ||||| |||||||
Sbjct: 27230 tttagtcgacctcctcaatcttagggccag 27259



to top

>gb|AF527794.1| Cucurbita maxima non-cell-autonomous heat shock cognate protein 70
            (Hsc70-2) mRNA, complete cds
          Length = 1944

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                        
Query: 360  ccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctcca 419
            ||||||| || || ||||| |||||||||||||||||||| |||||||| | |  |||||
Sbjct: 1873 ccatgtcagctccggcaccttggtacatcttggcgatgattgggttgcagatgctctcca 1814

                                                                        
Query: 420  gctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccact 479
             ||||||||||||||| || || || || ||||| || |||||||| |  || |||||||
Sbjct: 1813 actccttcatcttgtcctcgaattcatcggcctccgccagctggttggcatcgagccact 1754

                                                     
Query: 480  ggatggcagcatcgatggcctcctcgatcttcttcttgtcg 520
            |||||||    |||||||| || || |||||||||||||||
Sbjct: 1753 ggatggcttgctcgatggcgtcttcaatcttcttcttgtcg 1713



to top

>dbj|AB105430.2| Nicotiana benthamiana Hsp70 mRNA for heat shock protein 70, partial
            cds
          Length = 1203

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                        
Query: 377  ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 436
            ||||||||||| || || |||| ||||||||| ||| |||| || |||||||| ||||||
Sbjct: 1054 ccctggtacatttttgcaatgaaggggttgcagaggccctctagttccttcattttgtct 995

                                                                        
Query: 437  tcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatg 496
            |||||||| || ||||| |||||||||||    || ||||| ||||||||  | || |||
Sbjct: 994  tcaaactcatcagcctcggcaagctggtttccatcaagccattggatggcttcctcaatg 935

                                                                 
Query: 497  gcctcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctc 549
            || ||||| |||||||||||||| || || | ||| ||||| || ||||||||
Sbjct: 934  gcatcctcaatcttcttcttgtcttcagcagacagtttggatgcaatcttctc 882



to top

>dbj|AB112814.1| Nicotiana benthamiana Hsp70 mRNA for heat shock protein 70, partial
           cds, sub_clone:NbHsp70c-A
          Length = 422

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 85/97 (87%)
 Strand = Plus / Minus

                                                                       
Query: 369 caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 428
           ||||||||||||||||||||||||| |||||||| || || | | |||| ||||||||||
Sbjct: 328 caccagcaccctggtacatcttggcaatgatgggattacaaatgccctcaagctccttca 269

                                                
Query: 429 tcttgtcttcaaactcgtccgcctcagcaagctggtt 465
           ||||||| |||||||| || || || |||||||||||
Sbjct: 268 tcttgtcctcaaactcatcagcttctgcaagctggtt 232



to top

>gb|AF002667.1|SCAF002667 Solanum commersonii heat shock cognate protein (SCHSP70) mRNA,
           complete cds
          Length = 1149

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 85/97 (87%)
 Strand = Plus / Minus

                                                                       
Query: 369 caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 428
           |||||||||||||||||||||| || || ||||| ||||| |||  |||||| |||||||
Sbjct: 949 caccagcaccctggtacatcttagcaattatgggattgcataggctctccagttccttca 890

                                                
Query: 429 tcttgtcttcaaactcgtccgcctcagcaagctggtt 465
           |||| ||||||||||| || || ||||||||||||||
Sbjct: 889 tcttatcttcaaactcatcagcttcagcaagctggtt 853



to top

>gb|AY694190.1| Camellia sinensis HSP70 (hsp70) mRNA, partial cds
          Length = 491

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 84/96 (87%)
 Strand = Plus / Minus

                                                                       
Query: 370 accagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcat 429
           |||||||||||| |||||||| || || ||||| ||||| | |  |||||||||||||||
Sbjct: 192 accagcaccctgatacatctttgcaattatgggattgcagatgctctccagctccttcat 133

                                               
Query: 430 cttgtcttcaaactcgtccgcctcagcaagctggtt 465
           |||||| |||||||| |||||||| |||||||||||
Sbjct: 132 cttgtcctcaaactcatccgcctcggcaagctggtt 97



to top

>gb|AY836799.1| Saussurea medusa heat shock protein hsp70 gene, complete cds
          Length = 3290

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 120/145 (82%)
 Strand = Plus / Minus

                                                                        
Query: 375  caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 434
            |||| ||||||||||| || ||||| ||||||||||    ||| ||||||||||||||||
Sbjct: 3048 caccttggtacatcttagcaatgatcgggttgcacacattctcaagctccttcatcttgt 2989

                                                                        
Query: 435  cttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcga 494
            | |||||||| || |||||||||||||||||  |||||| ||||   || ||  |||| |
Sbjct: 2988 cctcaaactcatcagcctcagcaagctggttgctgtccaaccacgaaatagcctcatcaa 2929

                                     
Query: 495  tggcctcctcgatcttcttcttgtc 519
            | || ||||| ||||||||||||||
Sbjct: 2928 tcgcatcctcaatcttcttcttgtc 2904



to top

>gb|AY372071.1| Nicotiana tabacum heat shock protein 70-3 (HSP70-3) gene, complete
            cds
          Length = 3208

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 84/97 (86%)
 Strand = Plus / Minus

                                                                        
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 428
            |||||||||| ||||||||||| || |||||||| ||||| | |  ||| ||||||||||
Sbjct: 2928 caccagcaccttggtacatcttagcaatgatgggattgcagatgctctcgagctccttca 2869

                                                 
Query: 429  tcttgtcttcaaactcgtccgcctcagcaagctggtt 465
            |||| ||||||||||| || || ||||||||||||||
Sbjct: 2868 tcttatcttcaaactcatcagcttcagcaagctggtt 2832



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 542  atcttctcgtccttgatggtgttgcgcatgttgta 576
            |||||||||||||| |||||||| | |||||||||
Sbjct: 2755 atcttctcgtcctttatggtgttcctcatgttgta 2721



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 289  ttagtcgacctcctcgatcttggg 312
            ||||||||||||||| ||||||||
Sbjct: 3011 ttagtcgacctcctcaatcttggg 2988



to top

>gb|AY253326.1| Nicotiana tabacum heat shock protein 70 (Hsp70) mRNA, complete cds
          Length = 2259

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 84/97 (86%)
 Strand = Plus / Minus

                                                                        
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 428
            |||||||||| ||||||||||| || |||||||| ||||| | |  ||| ||||||||||
Sbjct: 1966 caccagcaccttggtacatcttagcaatgatgggattgcagatgctctcgagctccttca 1907

                                                 
Query: 429  tcttgtcttcaaactcgtccgcctcagcaagctggtt 465
            |||| ||||||||||| || || ||||||||||||||
Sbjct: 1906 tcttatcttcaaactcatcagcttcagcaagctggtt 1870



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 542  atcttctcgtccttgatggtgttgcgcatgttgta 576
            |||||||||||||| |||||||| | |||||||||
Sbjct: 1793 atcttctcgtcctttatggtgttcctcatgttgta 1759



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 289  ttagtcgacctcctcgatcttggg 312
            ||||||||||||||| ||||||||
Sbjct: 2049 ttagtcgacctcctcaatcttggg 2026



to top

>gb|AF509336.1| Saussurea medusa heat shock protein 70 (HSP70) mRNA, complete cds
          Length = 2224

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 120/145 (82%)
 Strand = Plus / Minus

                                                                        
Query: 375  caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 434
            |||| ||||||||||| || ||||| ||||||||||    ||| ||||||||||||||||
Sbjct: 1914 caccttggtacatcttagcaatgatcgggttgcacacattctcaagctccttcatcttgt 1855

                                                                        
Query: 435  cttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcga 494
            | |||||||| || |||||||||||||||||  |||||| ||||   || ||  |||| |
Sbjct: 1854 cctcaaactcatcagcctcagcaagctggttgctgtccaaccacgaaatagcctcatcaa 1795

                                     
Query: 495  tggcctcctcgatcttcttcttgtc 519
            | || ||||| ||||||||||||||
Sbjct: 1794 tcgcatcctcaatcttcttcttgtc 1770



to top

>gb|AY485986.1| Vigna radiata 70 kDa heat shock cognate protein 1 mRNA, complete cds
          Length = 2218

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 84/98 (85%)
 Strand = Plus / Minus

                                                                        
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 428
            |||||||||| ||||||||||| ||||||||||| ||||| | |  ||||| ||||||||
Sbjct: 1948 caccagcaccttggtacatcttagcgatgatgggattgcatatgctctccaactccttca 1889

                                                  
Query: 429  tcttgtcttcaaactcgtccgcctcagcaagctggttc 466
            ||||||| ||||| || || |||||| |||| ||||||
Sbjct: 1888 tcttgtcctcaaattcatcagcctcaccaagttggttc 1851



to top

>gb|AY261674.1| Citrus x paradisi HSP70 mRNA, partial cds
          Length = 276

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 114/138 (82%)
 Strand = Plus / Minus

                                                                       
Query: 382 gtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttcaaa 441
           |||||||||||| || || |||||||| | | |||||||||| |||||||| ||||||||
Sbjct: 276 gtacatcttggcaataattgggttgcagatgccctccagctctttcatcttatcttcaaa 217

                                                                       
Query: 442 ctcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatggcctc 501
           ||| || ||||| || |||||||||  ||| ||||| ||||||||  | || ||||| ||
Sbjct: 216 ctcatctgcctctgcgagctggttcccgtcaagccattggatggcctcctcaatggcatc 157

                             
Query: 502 ctcgatcttcttcttgtc 519
            || || |||||||||||
Sbjct: 156 ttcaattttcttcttgtc 139



to top

>gb|AF035414.1|AF035414 Brassica napus heat shock cognate protein (Hsc70) mRNA, complete cds
          Length = 2184

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 168/210 (80%)
 Strand = Plus / Minus

                                                                        
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 428
            ||||||| || |||||||||||||| ||||| |||||||| | |  ||||| ||||||||
Sbjct: 1930 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaactccttca 1871

                                                                        
Query: 429  tcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcag 488
            ||||||| || ||||| || |||||| | | ||| ||  | ||||||||||| || ||  
Sbjct: 1870 tcttgtcctcgaactcatcagcctcacccaactgattgttctccagccactgaatcgcct 1811

                                                                        
Query: 489  catcgatggcctcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttct 548
              || || || ||||||||||||||||||||  | ||||| |||||     | |||||||
Sbjct: 1810 gctcaatagcgtcctcgatcttcttcttgtctgcagccggtagcttctcaccaatcttct 1751

                                          
Query: 549  cgtccttgatggtgttgcgcatgttgtaag 578
            |||||| ||||||||| | |||||||||||
Sbjct: 1750 cgtcctggatggtgttcctcatgttgtaag 1721



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                        
Query: 289  ttagtcgacctcctcgatcttggggccagggccgccggatgcagcaggggtgtcatcgtc 348
            |||||||||||| |||||||| |||||||  ||||| || |||| ||| |  ||||||||
Sbjct: 2007 ttagtcgacctcttcgatcttagggccagcaccgcctgaggcaggaggagcatcatcgtc 1948

               
Query: 349  cat 351
            |||
Sbjct: 1947 cat 1945



to top

>gb|BT013586.1| Lycopersicon esculentum clone 132340F, mRNA sequence
          Length = 2190

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                        
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 428
            |||||||||||||||||||||| || |||||||| || || | | |||| ||||||||||
Sbjct: 1959 caccagcaccctggtacatctttgcaatgatgggattacagatgccctcgagctccttca 1900

                                                 
Query: 429  tcttgtcttcaaactcgtccgcctcagcaagctggtt 465
            ||||||| |||||||| ||  | || |||||||||||
Sbjct: 1899 tcttgtcctcaaactcatcaacttctgcaagctggtt 1863



to top

>emb|X54029.1|LEHSC170 Lycopersicon esculentum hsc-1 mRNA for heat shock protein 70 kD
          Length = 2120

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                        
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 428
            |||||||||||||||||||||| || |||||||| || || | | |||| ||||||||||
Sbjct: 1907 caccagcaccctggtacatctttgcaatgatgggattacagatgccctcgagctccttca 1848

                                                 
Query: 429  tcttgtcttcaaactcgtccgcctcagcaagctggtt 465
            ||||||| |||||||| ||  | || |||||||||||
Sbjct: 1847 tcttgtcctcaaactcatcaacttctgcaagctggtt 1811



to top

>gb|DQ124007.1| Coffea arabica x Coffea canephora clone HT-SSH4-F01 mRNA sequence
          Length = 262

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 89/105 (84%)
 Strand = Plus / Minus

                                                                       
Query: 382 gtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttcaaa 441
           |||||||||||| |||||||| ||||| |||  ||||||||||||||||||||| || ||
Sbjct: 262 gtacatcttggctatgatgggattgcaaaggctctccagctccttcatcttgtcctcgaa 203

                                                        
Query: 442 ctcgtccgcctcagcaagctggttcgtgtccagccactggatggc 486
            || || |||||||| ||||| ||  |||| ||||||| ||||||
Sbjct: 202 ttcatctgcctcagctagctgattactgtcaagccacttgatggc 158



to top

>gb|AY830127.1| Medicago sativa heat shock protein 70 (HSP70-1) mRNA, complete cds
          Length = 2302

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                        
Query: 375  caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 434
            |||| ||||||||||| || ||||| |||||||| | ||  || ||||||||||||||||
Sbjct: 1962 caccttggtacatctttgcaatgattgggttgcagatggtttcaagctccttcatcttgt 1903

                                           
Query: 435  cttcaaactcgtccgcctcagcaagctggtt 465
            |||| ||||| || || ||||||||||||||
Sbjct: 1902 cttcgaactcatcggcttcagcaagctggtt 1872



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 289  ttagtcgacctcctcgatcttggggccag 317
            ||||||||||||||| |||||||| ||||
Sbjct: 2054 ttagtcgacctcctcaatcttgggaccag 2026



to top

>gb|AC146757.19| Medicago truncatula clone mth2-16n21, complete sequence
          Length = 135915

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 78/91 (85%)
 Strand = Plus / Plus

                                                                          
Query: 375    caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 434
              |||| ||||||||||| || ||||| ||||| || |  | ||| ||||||||||||||||
Sbjct: 118421 caccttggtacatctttgcaatgattgggttacagattgtctcaagctccttcatcttgt 118480

                                             
Query: 435    cttcaaactcgtccgcctcagcaagctggtt 465
              |||||||||| || || ||||||||||||||
Sbjct: 118481 cttcaaactcatcggcttcagcaagctggtt 118511



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 112/137 (81%)
 Strand = Plus / Minus

                                                                         
Query: 383   tacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttcaaac 442
             ||||||||||| ||||| |||||||| |||  ||| || ||||||||||| |||||||||
Sbjct: 35431 tacatcttggcaatgattgggttgcaaaggctctcaagttccttcatcttatcttcaaac 35372

                                                                         
Query: 443   tcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatggcctcc 502
             || || ||||| || | ||||||  |||||| |||||| || ||||| || || || || 
Sbjct: 35371 tcatcagcctctgccaactggttactgtccaaccactgaattgcagcgtcaattgcatca 35312

                              
Query: 503   tcgatcttcttcttgtc 519
             || |||||||| |||||
Sbjct: 35311 tcaatcttctttttgtc 35295



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 289    ttagtcgacctcctcgatcttggggccag 317
              ||||||||||||||| |||||||| ||||
Sbjct: 118329 ttagtcgacctcctcaatcttgggaccag 118357



to top

>gb|AC147536.12| Medicago truncatula clone mth2-9l3, complete sequence
          Length = 111486

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 78/91 (85%)
 Strand = Plus / Plus

                                                                         
Query: 375   caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 434
             |||| ||||||||||| || ||||| ||||| || |  | ||| ||||||||||||||||
Sbjct: 93989 caccttggtacatctttgcaatgattgggttacagattgtctcaagctccttcatcttgt 94048

                                            
Query: 435   cttcaaactcgtccgcctcagcaagctggtt 465
             |||||||||| || || ||||||||||||||
Sbjct: 94049 cttcaaactcatcggcttcagcaagctggtt 94079



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 112/137 (81%)
 Strand = Plus / Minus

                                                                         
Query: 383   tacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttcaaac 442
             ||||||||||| ||||| |||||||| |||  ||| || ||||||||||| |||||||||
Sbjct: 10998 tacatcttggcaatgattgggttgcaaaggctctcaagttccttcatcttatcttcaaac 10939

                                                                         
Query: 443   tcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatggcctcc 502
             || || ||||| || | ||||||  |||||| |||||| || ||||| || || || || 
Sbjct: 10938 tcatcagcctctgccaactggttactgtccaaccactgaattgcagcgtcaattgcatca 10879

                              
Query: 503   tcgatcttcttcttgtc 519
             || |||||||| |||||
Sbjct: 10878 tcaatcttctttttgtc 10862



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 289   ttagtcgacctcctcgatcttggggccag 317
             ||||||||||||||| |||||||| ||||
Sbjct: 93897 ttagtcgacctcctcaatcttgggaccag 93925



to top

>ref|NM_120328.2| Arabidopsis thaliana HSC70-1; ATP binding AT5G02500 (HSC70-1) mRNA,
            complete cds
          Length = 2371

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                        
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 428
            ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 1969 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 1910

                                                 
Query: 429  tcttgtcttcaaactcgtccgcctcagcaagctggtt 465
            |||||||||| ||||| || |||||||| | ||||||
Sbjct: 1909 tcttgtcttcgaactcatcagcctcagccaactggtt 1873



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 65/79 (82%)
 Strand = Plus / Minus

                                                                        
Query: 500  tcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttgatg 559
            ||||||||||||||||||||  | ||||| |||||     | ||||||||||| | ||||
Sbjct: 1838 tcctcgatcttcttcttgtctgcagccgggagcttctcaccaatcttctcgtcttggatg 1779

                               
Query: 560  gtgttgcgcatgttgtaag 578
            ||||| | |||||||||||
Sbjct: 1778 gtgttcctcatgttgtaag 1760



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 289  ttagtcgacctcctcgatctt 309
            |||||||||||||||||||||
Sbjct: 2061 ttagtcgacctcctcgatctt 2041



to top

>emb|X99197.1|MS70KDHSP M.sativa mRNA for 70 kD heat shock protein
          Length = 830

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                       
Query: 369 caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 428
           |||||||||| || ||||||||| | ||||| |||||||| | | |||||||||||||||
Sbjct: 560 caccagcaccttgatacatcttgccaatgatagggttgcaaatgccctccagctccttca 501

                        
Query: 429 tcttgtcttcaaa 441
           ||||||| |||||
Sbjct: 500 tcttgtcctcaaa 488



to top

>emb|X77199.1|ATHSC701 A.thaliana hsc70-1 gene
          Length = 4297

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                        
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 428
            ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 2146 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 2087

                                                 
Query: 429  tcttgtcttcaaactcgtccgcctcagcaagctggtt 465
            |||||||||| ||||| || |||||||| | ||||||
Sbjct: 2086 tcttgtcttcgaactcatcagcctcagccaactggtt 2050



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 65/79 (82%)
 Strand = Plus / Minus

                                                                        
Query: 500  tcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttgatg 559
            ||||||||||||||||||||  | ||||| |||||     | ||||||||||| | ||||
Sbjct: 2015 tcctcgatcttcttcttgtctgcagccgggagcttctcaccaatcttctcgtcttggatg 1956

                               
Query: 560  gtgttgcgcatgttgtaag 578
            ||||| | |||||||||||
Sbjct: 1955 gtgttcctcatgttgtaag 1937



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 289  ttagtcgacctcctcgatctt 309
            |||||||||||||||||||||
Sbjct: 2238 ttagtcgacctcctcgatctt 2218



to top

>emb|X74604.1|ATHSC70 A.thaliana hsc70 mRNA for heat shock cognate protein
          Length = 2209

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                        
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 428
            ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 1938 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 1879

                                                 
Query: 429  tcttgtcttcaaactcgtccgcctcagcaagctggtt 465
            |||||||||| ||||| || |||||||| | ||||||
Sbjct: 1878 tcttgtcttcgaactcatcagcctcagccaactggtt 1842



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 65/79 (82%)
 Strand = Plus / Minus

                                                                        
Query: 500  tcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttgatg 559
            ||||||||||||||||||||  | ||||| |||||     | ||||||||||| | ||||
Sbjct: 1807 tcctcgatcttcttcttgtctgcagccgggagcttctcaccaatcttctcgtcttggatg 1748

                               
Query: 560  gtgttgcgcatgttgtaag 578
            ||||| | |||||||||||
Sbjct: 1747 gtgttcctcatgttgtaag 1729



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 289  ttagtcgacctcctcgatctt 309
            |||||||||||||||||||||
Sbjct: 2030 ttagtcgacctcctcgatctt 2010



to top

>gb|AY035123.1| Arabidopsis thaliana putative dnaK-type molecular chaperone hsc70.1
           protein (At5g02500) mRNA, partial cds
          Length = 860

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                       
Query: 369 caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 428
           ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 556 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 497

                                                
Query: 429 tcttgtcttcaaactcgtccgcctcagcaagctggtt 465
           |||||||||| ||||| || |||||||| | ||||||
Sbjct: 496 tcttgtcttcgaactcatcagcctcagccaactggtt 460



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 65/79 (82%)
 Strand = Plus / Minus

                                                                       
Query: 500 tcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttgatg 559
           ||||||||||||||||||||  | ||||| |||||     | ||||||||||| | ||||
Sbjct: 425 tcctcgatcttcttcttgtctgcagccgggagcttctcaccaatcttctcgtcttggatg 366

                              
Query: 560 gtgttgcgcatgttgtaag 578
           ||||| | |||||||||||
Sbjct: 365 gtgttcctcatgttgtaag 347



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 289 ttagtcgacctcctcgatctt 309
           |||||||||||||||||||||
Sbjct: 648 ttagtcgacctcctcgatctt 628



to top

>emb|AL162971.1|ATT22P11 Arabidopsis thaliana DNA chromosome 5, BAC clone T22P11 (ESSA project)
          Length = 96424

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 82/97 (84%)
 Strand = Plus / Plus

                                                                         
Query: 369   caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 428
             ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 35077 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 35136

                                                  
Query: 429   tcttgtcttcaaactcgtccgcctcagcaagctggtt 465
             |||||||||| ||||| || |||||||| | ||||||
Sbjct: 35137 tcttgtcttcgaactcatcagcctcagccaactggtt 35173



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                         
Query: 380   tggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttca 439
             ||||||||||| |||||||| || ||||| |    ||||| |||||||||||||||||||
Sbjct: 31335 tggtacatcttagcgatgatcggattgcaaacactctccaactccttcatcttgtcttca 31394

                     
Query: 440   aactcgtc 447
             ||||||||
Sbjct: 31395 aactcgtc 31402



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 65/79 (82%)
 Strand = Plus / Plus

                                                                         
Query: 500   tcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttgatg 559
             ||||||||||||||||||||  | ||||| |||||     | ||||||||||| | ||||
Sbjct: 35208 tcctcgatcttcttcttgtctgcagccgggagcttctcaccaatcttctcgtcttggatg 35267

                                
Query: 560   gtgttgcgcatgttgtaag 578
             ||||| | |||||||||||
Sbjct: 35268 gtgttcctcatgttgtaag 35286



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 289   ttagtcgacctcctcgatctt 309
             |||||||||||||||||||||
Sbjct: 34985 ttagtcgacctcctcgatctt 35005



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 289   ttagtcgacctcctcgatcttggggccag 317
             ||||||||| |||||||||||||| ||||
Sbjct: 31226 ttagtcgacttcctcgatcttgggaccag 31254



to top

>gb|AY120747.1| Arabidopsis thaliana DnaK-type molecular chaperone hsc70.1
            (At5g02500) mRNA, complete cds
          Length = 2254

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                        
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 428
            ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 1968 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 1909

                                                 
Query: 429  tcttgtcttcaaactcgtccgcctcagcaagctggtt 465
            |||||||||| ||||| || |||||||| | ||||||
Sbjct: 1908 tcttgtcttcgaactcatcagcctcagccaactggtt 1872



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 65/79 (82%)
 Strand = Plus / Minus

                                                                        
Query: 500  tcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttgatg 559
            ||||||||||||||||||||  | ||||| |||||     | ||||||||||| | ||||
Sbjct: 1837 tcctcgatcttcttcttgtctgcagccgggagcttctcaccaatcttctcgtcttggatg 1778

                               
Query: 560  gtgttgcgcatgttgtaag 578
            ||||| | |||||||||||
Sbjct: 1777 gtgttcctcatgttgtaag 1759



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 289  ttagtcgacctcctcgatctt 309
            |||||||||||||||||||||
Sbjct: 2060 ttagtcgacctcctcgatctt 2040



to top

>gb|AY057481.1| Arabidopsis thaliana AT5g02500/T22P11_90 mRNA, complete cds
          Length = 2228

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                        
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 428
            ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 1968 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 1909

                                                 
Query: 429  tcttgtcttcaaactcgtccgcctcagcaagctggtt 465
            |||||||||| ||||| || |||||||| | ||||||
Sbjct: 1908 tcttgtcttcgaactcatcagcctcagccaactggtt 1872



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 65/79 (82%)
 Strand = Plus / Minus

                                                                        
Query: 500  tcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttgatg 559
            ||||||||||||||||||||  | ||||| |||||     | ||||||||||| | ||||
Sbjct: 1837 tcctcgatcttcttcttgtctgcagccgggagcttctcaccaatcttctcgtcttggatg 1778

                               
Query: 560  gtgttgcgcatgttgtaag 578
            ||||| | |||||||||||
Sbjct: 1777 gtgttcctcatgttgtaag 1759



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 289  ttagtcgacctcctcgatctt 309
            |||||||||||||||||||||
Sbjct: 2060 ttagtcgacctcctcgatctt 2040



to top

>emb|BX832460.1|CNS0A1Q8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH75ZA02 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 2188

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                        
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 428
            ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 1949 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 1890

                                                 
Query: 429  tcttgtcttcaaactcgtccgcctcagcaagctggtt 465
            |||||||||| ||||| || |||||||| | ||||||
Sbjct: 1889 tcttgtcttcgaactcatcagcctcagccaactggtt 1853



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 65/79 (82%)
 Strand = Plus / Minus

                                                                        
Query: 500  tcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttgatg 559
            ||||||||||||||||||||  | ||||| |||||     | ||||||||||| | ||||
Sbjct: 1818 tcctcgatcttcttcttgtctgcagccgggagcttctcaccaatcttctcgtcttggatg 1759

                               
Query: 560  gtgttgcgcatgttgtaag 578
            ||||| | |||||||||||
Sbjct: 1758 gtgttcctcatgttgtaag 1740



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 289  ttagtcgacctcctcgatctt 309
            |||||||||||||||||||||
Sbjct: 2041 ttagtcgacctcctcgatctt 2021



to top

>gb|BT002754.1| Arabidopsis thaliana clone C104920 putative dnaK-type molecular
            chaperone hsc70.1 protein (At5g02500) mRNA, complete cds
          Length = 1987

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                        
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 428
            ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 1864 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 1805

                                                 
Query: 429  tcttgtcttcaaactcgtccgcctcagcaagctggtt 465
            |||||||||| ||||| || |||||||| | ||||||
Sbjct: 1804 tcttgtcttcgaactcatcagcctcagccaactggtt 1768



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 65/79 (82%)
 Strand = Plus / Minus

                                                                        
Query: 500  tcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttgatg 559
            ||||||||||||||||||||  | ||||| |||||     | ||||||||||| | ||||
Sbjct: 1733 tcctcgatcttcttcttgtctgcagccgggagcttctcaccaatcttctcgtcttggatg 1674

                               
Query: 560  gtgttgcgcatgttgtaag 578
            ||||| | |||||||||||
Sbjct: 1673 gtgttcctcatgttgtaag 1655



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 289  ttagtcgacctcctcgatctt 309
            |||||||||||||||||||||
Sbjct: 1956 ttagtcgacctcctcgatctt 1936



to top

>gb|AY929184.1| Latimeria chalumnae heat shock protein 70 (Hsp70) gene, partial cds
          Length = 1839

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 85/101 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 436
            |||||||||| ||||||||||||||| |||||||    |||||| |||||| ||||||  
Sbjct: 1757 ccctggtacagcttggcgatgatgggtttgcacacttgctccagttccttcttcttgtgc 1698

                                                     
Query: 437  tcaaactcgtccgcctcagcaagctggttcgtgtccagcca 477
            ||| ||||||||  |||||| ||||||||  ||||||||||
Sbjct: 1697 tcatactcgtccttctcagccagctggttgctgtccagcca 1657



to top

>emb|X54030.1|LEHSC270 Lycopersicon esculentum hsc-2 mRNA for heat shock protein cognate 70
          Length = 2117

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Minus

                                                                        
Query: 359  tccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctcc 418
            ||||||||  |||| || || |||||||| || || ||||| |||||||| ||   ||| 
Sbjct: 1946 tccatgtcaccacctgctccttggtacatttttgcaatgatagggttgcaaagactctct 1887

                                                                        
Query: 419  agctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccac 478
            ||||||||||||||||| |||||||| || |||||||| ||||||||    || ||||||
Sbjct: 1886 agctccttcatcttgtcctcaaactcttcagcctcagcgagctggttaccatcaagccac 1827

                    
Query: 479  tggatggc 486
            ||||||||
Sbjct: 1826 tggatggc 1819



to top

>gb|DQ324856.1| Haliotis discus hannai heat shock protein 70 mRNA, complete cds
          Length = 2631

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 84/100 (84%)
 Strand = Plus / Minus

                                                                        
Query: 378  cctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtctt 437
            ||||||||| ||||| |||||||||||| ||||   ||||||||||||||  ||||| ||
Sbjct: 1924 cctggtacaacttggtgatgatggggttacacactccctccagctccttctgcttgtgtt 1865

                                                    
Query: 438  caaactcgtccgcctcagcaagctggttcgtgtccagcca 477
            | ||||| |||  ||| ||||||||||| | |||||||||
Sbjct: 1864 cgaactcatccttctcggcaagctggttagagtccagcca 1825



to top

>gb|S85730.1| hsc71=major heat-shock-protein-like gene [rainbow trout, testes,
            Genomic, 6825 nt]
          Length = 6825

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                      
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgcaca 410
            |||||||||||||||||| ||||| |||||||||||||||||
Sbjct: 6055 caccagcaccctggtacagcttggtgatgatggggttgcaca 6014



to top

>dbj|AB196460.1| Oncorhynchus mykiss HSC70A mRNA for heat shock 70kDa protein 8
            isoform a, complete cds
          Length = 2359

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                      
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgcaca 410
            |||||||||||||||||| ||||| |||||||||||||||||
Sbjct: 1958 caccagcaccctggtacagcttggtgatgatggggttgcaca 1917



to top

>gb|AY485987.1| Vigna radiata 70 kDa heat shock cognate protein 2 mRNA, complete cds
          Length = 2264

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 116/143 (81%), Gaps = 3/143 (2%)
 Strand = Plus / Minus

                                                                        
Query: 341  tcatcgtccatgccaccctccatgtcggcaccagcacc---ctggtacatcttggcgatg 397
            ||||||||||| |||||  ||||||| | |||||||||   ||||||||||||||| |||
Sbjct: 1905 tcatcgtccattccacctcccatgtctggaccagcacctccctggtacatcttggcaatg 1846

                                                                        
Query: 398  atggggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagca 457
            || || ||||| | |   ||||  |||||||| ||||| |||||||| || |||||  ||
Sbjct: 1845 ataggattgcagatgctttccaattccttcattttgtcctcaaactcatctgcctctcca 1786

                                   
Query: 458  agctggttcgtgtccagccactg 480
            || |||||  |||||||||||||
Sbjct: 1785 agttggttgctgtccagccactg 1763



to top

>emb|X62799.1|GMHSP70 Glycine max hsp 70 gene
          Length = 3272

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                        
Query: 372  cagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatct 431
            ||||||||||||||||||| || |||||||||||||| |   | |||| |||||||  ||
Sbjct: 2628 cagcaccctggtacatcttagcaatgatggggttgcagatcccttccaactccttctgct 2569

                             
Query: 432  tgtcttcaaactcgtcc 448
            |||| ||||||||||||
Sbjct: 2568 tgtcctcaaactcgtcc 2552



to top

>gb|DQ295224.1| Malawimonas jakobiformis cytosolic heat shock protein 70 (HSP70)
            gene, partial cds
          Length = 1937

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                     
Query: 536  gaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
            ||||||| |||||||||||||| ||||||||||||||||||
Sbjct: 1723 gaggcgaacttctcgtccttgacggtgttgcgcatgttgta 1683



to top

>gb|L41253.1|TOMHSC70A Lycopersicon esculentum Hsc70 gene, complete cds
          Length = 3573

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                        
Query: 377  ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 436
            |||||||||||||| ||||| ||||||||||| | |  ||| ||||||||||||||||| 
Sbjct: 3206 ccctggtacatcttcgcgataatggggttgcatatgctctcaagctccttcatcttgtcc 3147

                 
Query: 437  tcaaa 441
            |||||
Sbjct: 3146 tcaaa 3142



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 530  agcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
            ||||| ||||||||||| || |||||||||||||| | |||||||||
Sbjct: 3053 agctttgaggcgatcttgtcatccttgatggtgttcctcatgttgta 3007



to top

>dbj|AB112815.1| Nicotiana benthamiana Hsp70 mRNA for heat shock protein 70, partial
           cds, sub_clone:NbHsp70c-B
          Length = 313

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 165/209 (78%)
 Strand = Plus / Minus

                                                                       
Query: 341 tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 400
           ||||| |||||| ||||  |||||||  |||| ||||| |||||||| ||||| ||||| 
Sbjct: 215 tcatcatccatggcaccgcccatgtcaccacctgcaccttggtacattttggcaatgatt 156

                                                                       
Query: 401 gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 460
           || ||||| | |  |||||   ||||||| ||||| ||||| || || | ||||||||||
Sbjct: 155 ggattgcagatgctctccaatcccttcattttgtcctcaaattcatcagactcagcaagc 96

                                                                       
Query: 461 tggttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcg 520
           ||||| |  || |||||||| ||||| |  || ||||| || ||||||||||| ||||| 
Sbjct: 95  tggttggcatcaagccactgtatggctgactcaatggcatcttcgatcttctttttgtca 36

                                        
Query: 521 tcggccggcagcttggaggcgatcttctc 549
            |  | ||||||||||| || ||||||||
Sbjct: 35  gcctcaggcagcttggatgcaatcttctc 7



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 289 ttagtcgacctcctcgatctt 309
           |||||||||||||||||||||
Sbjct: 273 ttagtcgacctcctcgatctt 253



to top

>ref|NM_120327.3| Arabidopsis thaliana ATP binding AT5G02490 mRNA, complete cds
          Length = 2303

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                        
Query: 380  tggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttca 439
            ||||||||||| |||||||| || ||||| |    ||||| |||||||||||||||||||
Sbjct: 1933 tggtacatcttagcgatgatcggattgcaaacactctccaactccttcatcttgtcttca 1874

                    
Query: 440  aactcgtc 447
            ||||||||
Sbjct: 1873 aactcgtc 1866



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 289  ttagtcgacctcctcgatcttggggccag 317
            ||||||||| |||||||||||||| ||||
Sbjct: 2042 ttagtcgacttcctcgatcttgggaccag 2014



to top

>gb|BC077998.1| Xenopus laevis cDNA clone MGC:82390 IMAGE:4406669, complete cds
          Length = 2723

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                        
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgcacagg 412
            |||||||||||||||| | ||||| |||||||||||||||||||
Sbjct: 1874 caccagcaccctggtatagcttggtgatgatggggttgcacagg 1831



to top

>gb|BT008411.1| Arabidopsis thaliana At5g02490 gene, complete cds
          Length = 1962

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                        
Query: 380  tggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttca 439
            ||||||||||| |||||||| || ||||| |    ||||| |||||||||||||||||||
Sbjct: 1853 tggtacatcttagcgatgatcggattgcaaacactctccaactccttcatcttgtcttca 1794

                    
Query: 440  aactcgtc 447
            ||||||||
Sbjct: 1793 aactcgtc 1786



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 289  ttagtcgacctcctcgatcttggggccag 317
            ||||||||| |||||||||||||| ||||
Sbjct: 1962 ttagtcgacttcctcgatcttgggaccag 1934



to top

>gb|AY093152.1| Arabidopsis thaliana DnaK-type molecular chaperone hsc70.1-like
            (At5g02490) mRNA, complete cds
          Length = 2124

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                        
Query: 380  tggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttca 439
            ||||||||||| |||||||| || ||||| |    ||||| |||||||||||||||||||
Sbjct: 1933 tggtacatcttagcgatgatcggattgcaaacactctccaactccttcatcttgtcttca 1874

                    
Query: 440  aactcgtc 447
            ||||||||
Sbjct: 1873 aactcgtc 1866



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 289  ttagtcgacctcctcgatcttggggccag 317
            ||||||||| |||||||||||||| ||||
Sbjct: 2042 ttagtcgacttcctcgatcttgggaccag 2014



to top

>emb|Y08892.1|ATHSC70G8 A.thaliana mRNA for Hsc70-G8 protein, partial
          Length = 315

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 380 tggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttca 439
           ||||||||||| |||||||| || ||||| |    ||||| |||||||||||||||||||
Sbjct: 206 tggtacatcttagcgatgatcggattgcaaacactctccaactccttcatcttgtcttca 147

                   
Query: 440 aactcgtc 447
           ||||||||
Sbjct: 146 aactcgtc 139



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 289 ttagtcgacctcctcgatcttggggccag 317
           |||||||||||||||||||||||| ||||
Sbjct: 315 ttagtcgacctcctcgatcttgggaccag 287



to top

>gb|DQ059998.1| Volvox carteri f. nagariensis heat-shock inducible Hsp70 (hsp70A)
            gene, complete cds
          Length = 6449

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 289  ttagtcgacctcctcgatcttggggccagggccgc 323
            ||||||||||||||||||||||||||||| |||||
Sbjct: 5694 ttagtcgacctcctcgatcttggggccagcgccgc 5660



to top

>gb|DQ059999.1| Volvox carteri f. nagariensis heat-shock inducible Hsp70 (hsp70A)
            mRNA, complete cds
          Length = 1950

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 289  ttagtcgacctcctcgatcttggggccagggccgc 323
            ||||||||||||||||||||||||||||| |||||
Sbjct: 1950 ttagtcgacctcctcgatcttggggccagcgccgc 1916



to top

>ref|NM_104519.1| Arabidopsis thaliana HSP70T-1; ATP binding AT1G56410 (HSP70T-1) mRNA,
            complete cds
          Length = 1854

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                      
Query: 415  ctccagctccttcatcttgtcttcaaactcgtccgcctcagc 456
            ||||| |||||||||||||| |||||||||||| ||||||||
Sbjct: 1812 ctccaactccttcatcttgtgttcaaactcgtcagcctcagc 1771



to top

>gb|DQ446367.1| Arabidopsis thaliana clone pENTR221-At1g56410 heat shock cognate 70
            kDa protein/HSC70/HSP70 (At1g56410) mRNA, complete cds
          Length = 1854

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                      
Query: 415  ctccagctccttcatcttgtcttcaaactcgtccgcctcagc 456
            ||||| |||||||||||||| |||||||||||| ||||||||
Sbjct: 1812 ctccaactccttcatcttgtgttcaaactcgtcagcctcagc 1771



to top

>emb|X51765.1|LPHSP70 L.polyphyllus mRNA for heat schock protein 70
          Length = 1005

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 60/70 (85%)
 Strand = Plus / Minus

                                                                       
Query: 375 caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 434
           ||||||||||||||||||| ||||| |||||||| |||   || || |||||||| ||||
Sbjct: 684 caccctggtacatcttggcaatgattgggttgcagaggctttcaagttccttcattttgt 625

                     
Query: 435 cttcaaactc 444
           | ||||||||
Sbjct: 624 cctcaaactc 615



to top

>gb|AC058785.8|AC058785 Arabidopsis thaliana chromosome 1 BAC F13N6 genomic sequence, complete
             sequence
          Length = 90698

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                       
Query: 415   ctccagctccttcatcttgtcttcaaactcgtccgcctcagc 456
             ||||| |||||||||||||| |||||||||||| ||||||||
Sbjct: 29212 ctccaactccttcatcttgtgttcaaactcgtcagcctcagc 29171



to top

>emb|CR735051.2|CNS0GTY2 Tetraodon nigroviridis full-length cDNA
          Length = 1868

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1577 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1521



to top

>emb|CR734665.2|CNS0GTNC Tetraodon nigroviridis full-length cDNA
          Length = 2238

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1940 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1884



to top

>emb|CR732389.2|CNS0GS22 Tetraodon nigroviridis full-length cDNA
          Length = 1982

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1687 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1631



to top

>emb|CR731254.2|CNS0GR6J Tetraodon nigroviridis full-length cDNA
          Length = 1156

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 371 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 854 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 798



to top

>emb|CR730967.2|CNS0GQYK Tetraodon nigroviridis full-length cDNA
          Length = 2232

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1933 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1877



to top

>emb|CR730283.2|CNS0GQFK Tetraodon nigroviridis full-length cDNA
          Length = 2238

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1942 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1886



to top

>emb|CR729311.2|CNS0GPOL Tetraodon nigroviridis full-length cDNA
          Length = 2216

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1927 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1871



to top

>emb|CR725754.2|CNS0GMXS Tetraodon nigroviridis full-length cDNA
          Length = 1557

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 371 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 801 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 745



to top

>emb|CR724374.2|CNS0GLVG Tetraodon nigroviridis full-length cDNA
          Length = 1874

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1575 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1519



to top

>emb|CR722706.2|CNS0GKL4 Tetraodon nigroviridis full-length cDNA
          Length = 1374

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1078 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1022



to top

>emb|CR719367.2|CNS0GI0D Tetraodon nigroviridis full-length cDNA
          Length = 646

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 371 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 347 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 291



to top

>emb|CR716753.2|CNS0GFZU Tetraodon nigroviridis full-length cDNA
          Length = 956

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 371 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 657 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 601



to top

>emb|CR711358.2|CNS0GBU2 Tetraodon nigroviridis full-length cDNA
          Length = 623

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 371 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 324 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 268



to top

>emb|CR703631.2|CNS0G5VF Tetraodon nigroviridis full-length cDNA
          Length = 1151

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 371 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 870 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 814



to top

>emb|CR699773.2|CNS0G2W9 Tetraodon nigroviridis full-length cDNA
          Length = 1414

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1114 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1058



to top

>emb|CR700210.2|CNS0G38E Tetraodon nigroviridis full-length cDNA
          Length = 1664

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1377 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1321



to top

>emb|CR699628.2|CNS0G2S8 Tetraodon nigroviridis full-length cDNA
          Length = 1096

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 371 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 800 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 744



to top

>emb|CR699327.2|CNS0G2JV Tetraodon nigroviridis full-length cDNA
          Length = 1645

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1349 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1293



to top

>emb|CR698441.2|CNS0G1V9 Tetraodon nigroviridis full-length cDNA
          Length = 433

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 371 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 134 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 78



to top

>emb|CR696974.2|CNS0G0QI Tetraodon nigroviridis full-length cDNA
          Length = 1832

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1543 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1487



to top

>emb|CR696115.2|CNS0G02N Tetraodon nigroviridis full-length cDNA
          Length = 2230

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1931 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1875



to top

>emb|CR694651.2|CNS0FYXZ Tetraodon nigroviridis full-length cDNA
          Length = 1683

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1393 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1337



to top

>emb|CR693639.2|CNS0FY5V Tetraodon nigroviridis full-length cDNA
          Length = 2235

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1939 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1883



to top

>emb|CR691059.2|CNS0FW67 Tetraodon nigroviridis full-length cDNA
          Length = 1779

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1485 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1429



to top

>emb|CR688768.2|CNS0FUEK Tetraodon nigroviridis full-length cDNA
          Length = 1419

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1123 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1067



to top

>emb|CR688743.2|CNS0FUDV Tetraodon nigroviridis full-length cDNA
          Length = 1013

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 371 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 725 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 669



to top

>emb|CR688098.2|CNS0FTVY Tetraodon nigroviridis full-length cDNA
          Length = 2216

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1929 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1873



to top

>emb|CR685229.2|CNS0FRO9 Tetraodon nigroviridis full-length cDNA
          Length = 2234

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1937 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1881



to top

>emb|CR684600.2|CNS0FR6S Tetraodon nigroviridis full-length cDNA
          Length = 2217

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1932 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1876



to top

>emb|CR682045.2|CNS0FP7T Tetraodon nigroviridis full-length cDNA
          Length = 1538

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1253 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1197



to top

>emb|CR682007.2|CNS0FP6R Tetraodon nigroviridis full-length cDNA
          Length = 978

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 371 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 679 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 623



to top

>emb|CR681947.2|CNS0FP53 Tetraodon nigroviridis full-length cDNA
          Length = 1673

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1377 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1321



to top

>emb|CR681557.2|CNS0FOU9 Tetraodon nigroviridis full-length cDNA
          Length = 1581

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1281 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1225



to top

>emb|CR680840.2|CNS0FOAC Tetraodon nigroviridis full-length cDNA
          Length = 1046

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 371 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 746 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 690



to top

>emb|CR680599.1|CNS0FO3N Tetraodon nigroviridis full-length cDNA
          Length = 1226

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 371 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 948 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 892



to top

>emb|CR674390.2|CNS0FJBW Tetraodon nigroviridis full-length cDNA
          Length = 1296

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1005 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 949



to top

>emb|CR673444.2|CNS0FILM Tetraodon nigroviridis full-length cDNA
          Length = 1467

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1170 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1114



to top

>emb|CR668849.2|CNS0FF1Z Tetraodon nigroviridis full-length cDNA
          Length = 1580

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1282 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1226



to top

>emb|CR668292.2|CNS0FEMI Tetraodon nigroviridis full-length cDNA
          Length = 1459

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1167 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1111



to top

>emb|CR666588.2|CNS0FDB6 Tetraodon nigroviridis full-length cDNA
          Length = 1261

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 371 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 963 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 907



to top

>emb|CR664947.2|CNS0FC1L Tetraodon nigroviridis full-length cDNA
          Length = 1560

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1262 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1206



to top

>emb|CR664739.2|CNS0FBVT Tetraodon nigroviridis full-length cDNA
          Length = 917

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 371 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 617 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 561



to top

>emb|CR664071.2|CNS0FBD9 Tetraodon nigroviridis full-length cDNA
          Length = 2047

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1762 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1706



to top

>emb|CR663097.2|CNS0FAM7 Tetraodon nigroviridis full-length cDNA
          Length = 1285

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1002 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 946



to top

>emb|CR662148.2|CNS0F9VU Tetraodon nigroviridis full-length cDNA
          Length = 1562

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1263 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1207



to top

>emb|CR657309.2|CNS0F65F Tetraodon nigroviridis full-length cDNA
          Length = 1218

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 371 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 930 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 874



to top

>emb|CR656869.2|CNS0F5T7 Tetraodon nigroviridis full-length cDNA
          Length = 1801

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1505 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1449



to top

>emb|CR655448.1|CNS0F4PQ Tetraodon nigroviridis full-length cDNA
          Length = 1372

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1088 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1032



to top

>emb|CR656433.1|CNS0F5H3 Tetraodon nigroviridis full-length cDNA
          Length = 1511

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1212 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1156



to top

>emb|CR656379.1|CNS0F5FL Tetraodon nigroviridis full-length cDNA
          Length = 2215

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1930 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1874



to top

>emb|CR656173.1|CNS0F59V Tetraodon nigroviridis full-length cDNA
          Length = 1228

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 371 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 938 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 882



to top

>emb|CR655567.2|CNS0F4T1 Tetraodon nigroviridis full-length cDNA
          Length = 1251

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 371 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 954 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 898



to top

>emb|CR654938.1|CNS0F4BK Tetraodon nigroviridis full-length cDNA
          Length = 1232

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 371 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 939 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 883



to top

>emb|CR654405.2|CNS0F3WR Tetraodon nigroviridis full-length cDNA
          Length = 1263

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 371 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 968 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 912



to top

>emb|CR654109.2|CNS0F3OJ Tetraodon nigroviridis full-length cDNA
          Length = 1642

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1377 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1321



to top

>emb|CR654231.1|CNS0F3RX Tetraodon nigroviridis full-length cDNA
          Length = 2038

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1753 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1697



to top

>emb|CR651953.2|CNS0F20N Tetraodon nigroviridis full-length cDNA
          Length = 1144

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 371 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 847 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 791



to top

>emb|CR651660.2|CNS0F1SI Tetraodon nigroviridis full-length cDNA
          Length = 431

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 371 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 134 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 78



to top

>emb|CR651251.2|CNS0F1H5 Tetraodon nigroviridis full-length cDNA
          Length = 1937

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1640 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1584



to top

>emb|CR650378.1|CNS0F0SW Tetraodon nigroviridis full-length cDNA
          Length = 1483

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1199 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1143



to top

>emb|CR649698.2|CNS0F0A0 Tetraodon nigroviridis full-length cDNA
          Length = 1245

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 371 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 946 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 890



to top

>emb|CR648821.2|CNS0EZLN Tetraodon nigroviridis full-length cDNA
          Length = 1887

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1586 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1530



to top

>emb|CR643803.1|CNS0EVQ9 Tetraodon nigroviridis full-length cDNA
          Length = 1221

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 371 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 942 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 886



to top

>emb|CR641941.2|CNS0EUAJ Tetraodon nigroviridis full-length cDNA
          Length = 445

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 371 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 146 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 90



to top

>emb|CR638956.2|CNS0ERZM Tetraodon nigroviridis full-length cDNA
          Length = 2037

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1756 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1700



to top

>emb|CR633864.2|CNS0EO26 Tetraodon nigroviridis full-length cDNA
          Length = 1618

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1323 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1267



to top

>emb|Z32537.1|PSHSC71R P.sativum (little marvel) HSC71.0 mRNA
          Length = 2122

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 89/109 (81%)
 Strand = Plus / Minus

                                                                        
Query: 375  caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 434
            ||||||||||||||||||| ||||| |||||||| |     ||||  |||||||| ||||
Sbjct: 1890 caccctggtacatcttggcaatgatagggttgcagacactttccaattccttcattttgt 1831

                                                             
Query: 435  cttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggat 483
            | |||||||| || ||||| ||||| |||||  |||| | |||||||||
Sbjct: 1830 cctcaaactcatctgcctctgcaagttggttgctgtctaaccactggat 1782



to top

>emb|X13301.1|PHHSP70R Petunia mRNA for heat shock protein hsp70
          Length = 2079

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 83/101 (82%)
 Strand = Plus / Minus

                                                                        
Query: 416  tccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagc 475
            |||| ||||||||||||||||||||| || || ||||| ||||| |||||  |||| |||
Sbjct: 1802 tccaactccttcatcttgtcttcaaattcatcagcctctgcaagttggttattgtctagc 1743

                                                     
Query: 476  cactggatggcagcatcgatggcctcctcgatcttcttctt 516
            |||| ||| ||  |||| || || ||||| ||| |||||||
Sbjct: 1742 cacttgatagcttcatcaattgcatcctcaatcctcttctt 1702



to top

>emb|X06932.1|PHHSP70G Petunia hsp70 gene
          Length = 2958

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 83/101 (82%)
 Strand = Plus / Minus

                                                                        
Query: 416  tccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagc 475
            |||| ||||||||||||||||||||| || || ||||| ||||| |||||  |||| |||
Sbjct: 2678 tccaactccttcatcttgtcttcaaattcatcagcctctgcaagttggttattgtctagc 2619

                                                     
Query: 476  cactggatggcagcatcgatggcctcctcgatcttcttctt 516
            |||| ||| ||  |||| || || ||||| ||| |||||||
Sbjct: 2618 cacttgatagcttcatcaattgcatcctcaatcctcttctt 2578



to top

>ref|XM_686300.1| PREDICTED: Danio rerio similar to heat shock cognate 70 kDa protein
            (LOC562935), mRNA
          Length = 2448

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 83/101 (82%)
 Strand = Plus / Minus

                                                                        
Query: 377  ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 436
            |||||||||| ||||| ||||||||||||||| ||   |||||||||||||  || ||  
Sbjct: 2057 ccctggtacagcttggtgatgatggggttgcagagcttctccagctccttctgctggtgc 1998

                                                     
Query: 437  tcaaactcgtccgcctcagcaagctggttcgtgtccagcca 477
            |||||||| |||  ||| |||  ||||||| ||||||||||
Sbjct: 1997 tcaaactcctccttctctgcagtctggttcttgtccagcca 1957



to top

>dbj|AK222068.1| Arabidopsis thaliana mRNA for dnaK-type molecular chaperone hsc70.1 -
            like, partial cds, clone: RAFL22-80-J10
          Length = 1371

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                             
Query: 415  ctccagctccttcatcttgtcttcaaactcgtc 447
            ||||| |||||||||||||||||||||||||||
Sbjct: 1071 ctccaactccttcatcttgtcttcaaactcgtc 1039



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 289  ttagtcgacctcctcgatcttggggccag 317
            ||||||||| |||||||||||||| ||||
Sbjct: 1215 ttagtcgacttcctcgatcttgggaccag 1187



to top

>gb|BC091445.1| Danio rerio cDNA clone IMAGE:7286763, containing frame-shift errors
          Length = 1375

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 83/101 (82%)
 Strand = Plus / Minus

                                                                       
Query: 377 ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 436
           |||||||||| ||||| ||||||||||||||| ||   |||||||||||||  || ||  
Sbjct: 970 ccctggtacagcttggtgatgatggggttgcagagcttctccagctccttctgctggtgc 911

                                                    
Query: 437 tcaaactcgtccgcctcagcaagctggttcgtgtccagcca 477
           |||||||| |||  ||| |||  ||||||| ||||||||||
Sbjct: 910 tcaaactcctccttctctgcagtctggttcttgtccagcca 870



to top

>emb|AJ249330.1|CSA249330 Cucumis sativus mRNA for heat shock protein 70 isoform-1
          Length = 2370

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 91/112 (81%)
 Strand = Plus / Minus

                                                                        
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatc 430
            |||||||| || |||||||| || | |||||||||||| |    ||| ||||||||||| 
Sbjct: 2055 ccagcaccttgatacatcttagcaacgatggggttgcaaatactctcaagctccttcatt 1996

                                                                
Query: 431  ttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccactgga 482
            || ||||| ||||| || || |||||||| |||||  |||| ||||||||||
Sbjct: 1995 ttatcttcgaactcatcagcttcagcaagttggttgttgtcaagccactgga 1944



to top

>emb|CR734111.2|CNS0GT7Y Tetraodon nigroviridis full-length cDNA
          Length = 1839

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 372  cagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            |||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1541 cagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1486



to top

>emb|CR728102.2|CNS0GOR0 Tetraodon nigroviridis full-length cDNA
          Length = 2238

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcaca 410
            ||||||| |||||||||||| | |||||||||||||||||
Sbjct: 1940 ccagcactctggtacatctttgtgatgatggggttgcaca 1901



to top

>emb|CR703946.1|CNS0G646 Tetraodon nigroviridis full-length cDNA
          Length = 2204

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcaca 410
            ||||||| |||||||||||| | |||||||||||||||||
Sbjct: 1922 ccagcactctggtacatctttgtgatgatggggttgcaca 1883



to top

>emb|CR683400.2|CNS0FQ9G Tetraodon nigroviridis full-length cDNA
          Length = 1560

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcaca 410
            ||||||| |||||||||||| | |||||||||||||||||
Sbjct: 1274 ccagcactctggtacatctttgtgatgatggggttgcaca 1235



to top

>emb|CR656537.1|CNS0F5JZ Tetraodon nigroviridis full-length cDNA
          Length = 1198

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 371 ccagcaccctggtacatcttggcgatgatggggttgcaca 410
           ||||||| |||||||||||| | |||||||||||||||||
Sbjct: 902 ccagcactctggtacatctttgtgatgatggggttgcaca 863



to top

>gb|U23504.1|TNU23504 Trichoplusia ni HSC70 mRNA, complete cds
          Length = 2161

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 377  ccctggtacatcttggcgatgatggggttgca 408
            |||||||||||||||| |||||||||||||||
Sbjct: 1953 ccctggtacatcttggtgatgatggggttgca 1922



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 286  tgtttagtcgacctcctcgat 306
            |||||||||||||||||||||
Sbjct: 2074 tgtttagtcgacctcctcgat 2054



to top

>ref|NM_112093.1| Arabidopsis thaliana HSP70; ATP binding AT3G12580 (HSP70) mRNA,
            complete cds
          Length = 2281

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 530  agcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
            ||||| || |||||||||||||||||||| ||||| | |||||||||
Sbjct: 1805 agcttagatgcgatcttctcgtccttgatcgtgttcctcatgttgta 1759



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 401  gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagc 456
            |||||||| || | ||| |||||||||||||| || || ||||| || ||||||||
Sbjct: 1934 gggttgcaaagagactcgagctccttcatcttatcctcgaactcatctgcctcagc 1879



to top

>emb|CR626889.13| Zebrafish DNA sequence from clone DKEY-4P15 in linkage group 15, complete
              sequence
          Length = 205513

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                                 
Query: 377    ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
              |||||||||| ||||| ||||||||||||||| ||   |||||||||||||
Sbjct: 138774 ccctggtacagcttggtgatgatggggttgcagagcttctccagctccttc 138824



to top

>gb|AY762969.1| Acanthopagrus schlegelii HSC70 (HSC70) mRNA, complete cds
          Length = 1953

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                       
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            |||| |||| |||||||| ||||| |||||||||||||||||    |||||||||||||
Sbjct: 1846 caccggcactctggtacaacttggtgatgatggggttgcacaccttctccagctccttc 1788



to top

>emb|AJ002551.1|ATAJ2551 Arabidopsis thaliana mRNA for heat shock protein 70
          Length = 2171

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 530  agcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
            ||||| || |||||||||||||||||||| ||||| | |||||||||
Sbjct: 1787 agcttagatgcgatcttctcgtccttgatcgtgttcctcatgttgta 1741



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 401  gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagc 456
            |||||||| || | ||| |||||||||||||| || || ||||| || ||||||||
Sbjct: 1916 gggttgcaaagagactcgagctccttcatcttatcctcgaactcatctgcctcagc 1861



to top

>gb|M76725.2| Chlamydomonas reinhardtii 70 kDa heat shock protein (hsp70) gene,
            complete cds
          Length = 4808

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                       
Query: 289  ttagtcgacctcctcgatcttggggcc 315
            |||||||||||||||||||||||||||
Sbjct: 3799 ttagtcgacctcctcgatcttggggcc 3773



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 394  gatgatggggttgcacagggcctccagctcctt 426
            ||||||||||||||||||  |||||||||||||
Sbjct: 3682 gatgatggggttgcacagcccctccagctcctt 3650



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 556  gatggtgttgcgcatgttgta 576
            |||||||||||||||||||||
Sbjct: 3520 gatggtgttgcgcatgttgta 3500



to top

>gb|AY029210.1| Ambystoma mexicanum heat shock protein 70 (HSP70) mRNA, complete cds
          Length = 2250

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                       
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            |||||||||||||||||| |||||  ||||| ||||||||||    |||||||||||||
Sbjct: 1901 caccagcaccctggtacagcttggtaatgatcgggttgcacactttctccagctccttc 1843



to top

>gb|AY059885.1| Arabidopsis thaliana 70 kDa heat shock protein (T16H11.7) mRNA,
            complete cds
          Length = 2185

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 530  agcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
            ||||| || |||||||||||||||||||| ||||| | |||||||||
Sbjct: 1804 agcttagatgcgatcttctcgtccttgatcgtgttcctcatgttgta 1758



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 401  gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagc 456
            |||||||| || | ||| |||||||||||||| || || ||||| || ||||||||
Sbjct: 1933 gggttgcaaagagactcgagctccttcatcttatcctcgaactcatctgcctcagc 1878



to top

>gb|AY054190.1| Arabidopsis thaliana AT3g12580/T2E22_110 mRNA, complete cds
          Length = 2185

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 530  agcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
            ||||| || |||||||||||||||||||| ||||| | |||||||||
Sbjct: 1804 agcttagatgcgatcttctcgtccttgatcgtgttcctcatgttgta 1758



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 401  gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagc 456
            |||||||| || | ||| |||||||||||||| || || ||||| || ||||||||
Sbjct: 1933 gggttgcaaagagactcgagctccttcatcttatcctcgaactcatctgcctcagc 1878



to top

>gb|AY054183.1| Arabidopsis thaliana AT3g12580/T2E22_110 mRNA, complete cds
          Length = 2284

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 530  agcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
            ||||| || |||||||||||||||||||| ||||| | |||||||||
Sbjct: 1805 agcttagatgcgatcttctcgtccttgatcgtgttcctcatgttgta 1759



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 401  gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagc 456
            |||||||| || | ||| |||||||||||||| || || ||||| || ||||||||
Sbjct: 1934 gggttgcaaagagactcgagctccttcatcttatcctcgaactcatctgcctcagc 1879



to top

>gb|AC069474.4|AC069474 Arabidopsis thaliana chromosome 3 BAC T2E22 genomic sequence, complete
             sequence
          Length = 105768

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                            
Query: 530   agcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
             ||||| || |||||||||||||||||||| ||||| | |||||||||
Sbjct: 36057 agcttagatgcgatcttctcgtccttgatcgtgttcctcatgttgta 36011



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                     
Query: 401   gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagc 456
             |||||||| || | ||| |||||||||||||| || || ||||| || ||||||||
Sbjct: 36186 gggttgcaaagagactcgagctccttcatcttatcctcgaactcatctgcctcagc 36131



to top

>gb|AY436786.1| Rhabdosargus sarba heat shock cognate 70 (hsc70) mRNA, complete cds
          Length = 1950

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                       
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||||| |||||| | ||||| |||||||||||||||||    |||||||||||||
Sbjct: 1846 caccagcactctggtatagcttggtgatgatggggttgcacactttctccagctccttc 1788



to top

>dbj|AP002055.2| Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone: T16H11
          Length = 21024

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                            
Query: 530   agcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 576
             ||||| || |||||||||||||||||||| ||||| | |||||||||
Sbjct: 18872 agcttagatgcgatcttctcgtccttgatcgtgttcctcatgttgta 18918



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                     
Query: 401   gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagc 456
             |||||||| || | ||| |||||||||||||| || || ||||| || ||||||||
Sbjct: 18743 gggttgcaaagagactcgagctccttcatcttatcctcgaactcatctgcctcagc 18798



to top

>gb|AY456093.1| Phytophthora nicotianae heat shock protein 70 (Hsp70a) gene,
           complete cds
          Length = 4220

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 282 cgactgtttagtcgacctcctcgatcttggggcc 315
           |||||| ||||||||||||||| |||||||||||
Sbjct: 407 cgactgcttagtcgacctcctcaatcttggggcc 440



to top

>gb|AY219845.1| Cyprinus carpio constitutive heat shock protein HSC70-2 (hsc70-2)
            mRNA, partial cds
          Length = 1935

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgca 408
            ||||||| |||||||| ||||| |||||||||||||||
Sbjct: 1829 ccagcactctggtacagcttggtgatgatggggttgca 1792



to top

>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome
          Length = 4940217

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                             
Query: 491     tcgatggcctcctcgatcttcttcttgtcg 520
               ||||||||| ||||||||||||||||||||
Sbjct: 1338539 tcgatggccgcctcgatcttcttcttgtcg 1338510



to top

>dbj|AB196461.1| Oncorhynchus mykiss HSC70B mRNA for heat shock 70kDa protein 8
            isoform b, partial cds
          Length = 1864

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                      
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgcaca 410
            |||| |||| |||||||| ||||| |||||||||||||||||
Sbjct: 1507 caccggcactctggtacagcttggtgatgatggggttgcaca 1466



to top

>gb|AF194819.1|AF194819 Manduca sexta heat shock cognate 70 protein mRNA, complete cds
          Length = 2116

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                        
Query: 374  gcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttg 433
            ||||||||||||| ||||| |||||| |||||||| | | | || |||||||||  ||||
Sbjct: 1926 gcaccctggtacagcttggtgatgatcgggttgcagatgccttcgagctccttctgcttg 1867

                                                          
Query: 434  tcttcaaactcgtccgcctcagcaagctggttcgtgtccagccact 479
            | |||| |||| |||   || || |||||||||| ||| |||||||
Sbjct: 1866 tgttcatactcctccttgtcggcgagctggttcgagtctagccact 1821



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 286  tgtttagtcgacctcctcgat 306
            |||||||||||||||||||||
Sbjct: 2047 tgtttagtcgacctcctcgat 2027



to top

>dbj|AB092840.1| Carassius auratus HSC70 mRNA for heat shock cognate 70 kDa, partial
            cds
          Length = 2208

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgca 408
            ||||||| |||||||| ||||| |||||||||||||||
Sbjct: 1792 ccagcactctggtacagcttggtgatgatggggttgca 1755



to top

>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome
          Length = 4941439

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                             
Query: 491     tcgatggcctcctcgatcttcttcttgtcg 520
               ||||||||| ||||||||||||||||||||
Sbjct: 1362119 tcgatggccgcctcgatcttcttcttgtcg 1362090



to top

>gb|AY485988.1| Vigna radiata 70 kDa heat shock cognate protein 3 mRNA, complete cds
          Length = 2314

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 88/109 (80%)
 Strand = Plus / Minus

                                                                        
Query: 375  caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 434
            ||||||||||||| ||||| ||||| || ||||| | |   ||||  |||||||| || |
Sbjct: 1935 caccctggtacattttggcaatgataggattgcagacgctttccaattccttcattttat 1876

                                                             
Query: 435  cttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggat 483
            | |||||||| || ||||| |||||||||||  |||||| ||| |||||
Sbjct: 1875 cctcaaactcatctgcctctgcaagctggttgctgtccaaccattggat 1827



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 288  tttagtcgacctcctcgatcttggggccag 317
            |||||||||| ||||| |||||||||||||
Sbjct: 2034 tttagtcgacttcctcaatcttggggccag 2005



to top

>gb|AY423868.1| Leishmania tarentolae 70 kDa heat shock protein (hsp70) gene,
            complete cds
          Length = 1974

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                             
Query: 379  ctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||||||||||  ||||| |||||||| | | ||||||||||||||
Sbjct: 1845 ctggtacatcttggtcatgatcgggttgcatatgtcctccagctccttc 1797



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 289  ttagtcgacctcctcgatcttggg 312
            ||||||||||||||||| ||||||
Sbjct: 1974 ttagtcgacctcctcgaccttggg 1951



to top

>gb|AY078499.4| Dunaliella salina heat shock protein 70a (HSP70) mRNA, complete cds
          Length = 2652

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 288  tttagtcgacctcctcgatcttggg 312
            |||||||||||||||||||||||||
Sbjct: 2014 tttagtcgacctcctcgatcttggg 1990



to top

>emb|X52314.1|LDHSP70 Leishmania hsp70 gene for heat shock protein 70
          Length = 2126

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 289  ttagtcgacctcctcgatcttggggccag 317
            ||||||||||||||||| |||||||||||
Sbjct: 2126 ttagtcgacctcctcgaccttggggccag 2098



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                             
Query: 379  ctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||||||||||  ||||| |||||||| | |  |||||||||||||
Sbjct: 2006 ctggtacatcttggtcatgatcgggttgcatacgctctccagctccttc 1958



to top

>emb|BX833094.1|CNS0A0GB Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL33ZH03 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 767

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 415 ctccagctccttcatcttgtcttcaaactcgtc 447
           ||||| ||||||||||||||||| |||||||||
Sbjct: 543 ctccaactccttcatcttgtctttaaactcgtc 511



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 288 tttagtcgacctcctcgatcttggggccagg 318
           |||||||||| |||||||||||||| |||||
Sbjct: 689 tttagtcgacttcctcgatcttgggaccagg 659



to top

>emb|Z30176.1|TRMHSP70 T.repens (Huia) mRNA for heat shock protein 70
          Length = 554

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 289 ttagtcgacctcctcgatcttggggccag 317
           ||||||||||||||| |||||||||||||
Sbjct: 397 ttagtcgacctcctcaatcttggggccag 369



to top

>gb|U26448.1|EGU26448 Echinococcus granulosus heat shock 70 kDa protein mRNA, complete cds
          Length = 2136

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 378  cctggtacatcttggcgatgatggggttgcaca 410
            ||||||||||||| ||||| |||||||||||||
Sbjct: 1843 cctggtacatcttcgcgattatggggttgcaca 1811



to top

>gb|U08820.1|PSU08820 Pisum sativum HSP70b mRNA, partial cds
          Length = 487

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 82/101 (81%)
 Strand = Plus / Minus

                                                                       
Query: 419 agctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccac 478
           |||||||||||||| ||||||||||| || || ||||| |  |||||  | |||| ||||
Sbjct: 409 agctccttcatcttatcttcaaactcatctgcttcagccaattggttactatccaaccac 350

                                                    
Query: 479 tggatggcagcatcgatggcctcctcgatcttcttcttgtc 519
           || || ||||| || || || || || ||||||||||||||
Sbjct: 349 tgaattgcagcctcaattgcatcatctatcttcttcttgtc 309



to top

>gb|BT023894.1| Drosophila melanogaster LP19893 full insert cDNA
          Length = 2773

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 287  gtttagtcgacctcctcgatcttggggccagggccgccgg 326
            ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 2458 gtttagtcgacctcctcgatggtggggccagcaccgccgg 2419



to top

>ref|XM_882866.1| PREDICTED: Bos taurus similar to Rab GTPase binding effector
           protein 1 (Rabaptin-5) (Rabaptin-5alpha), transcript
           variant 6 (LOC504785), mRNA
          Length = 3746

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 412 ggcctccagctccttcatcttgtcttca 439
           ||||||||||||||| ||||||||||||
Sbjct: 858 ggcctccagctccttaatcttgtcttca 831



to top

>ref|XM_882853.1| PREDICTED: Bos taurus similar to Rab GTPase binding effector
           protein 1 (Rabaptin-5) (Rabaptin-5alpha), transcript
           variant 5 (LOC504785), mRNA
          Length = 3824

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 412 ggcctccagctccttcatcttgtcttca 439
           ||||||||||||||| ||||||||||||
Sbjct: 858 ggcctccagctccttaatcttgtcttca 831



to top

>ref|XM_882846.1| PREDICTED: Bos taurus similar to Rab GTPase binding effector
           protein 1 (Rabaptin-5) (Rabaptin-5alpha), transcript
           variant 4 (LOC504785), mRNA
          Length = 1229

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 412 ggcctccagctccttcatcttgtcttca 439
           ||||||||||||||| ||||||||||||
Sbjct: 858 ggcctccagctccttaatcttgtcttca 831



to top

>ref|XM_869715.1| PREDICTED: Bos taurus similar to Rab GTPase binding effector
           protein 1 (Rabaptin-5) (Rabaptin-5alpha), transcript
           variant 2 (LOC504785), mRNA
          Length = 3845

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 412 ggcctccagctccttcatcttgtcttca 439
           ||||||||||||||| ||||||||||||
Sbjct: 858 ggcctccagctccttaatcttgtcttca 831



to top

>gb|AY913842.2| Leishmania donovani strain DD8 heat shock protein 70 (hsp70) mRNA,
           partial cds
          Length = 821

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 288 tttagtcgacctcctcgatcttggggcc 315
           |||||||||||||||||| |||||||||
Sbjct: 814 tttagtcgacctcctcgaccttggggcc 787



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 379 ctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
           ||||||||||||||  ||||| |||||||| | |  |||||||||||||
Sbjct: 693 ctggtacatcttggtcatgatcgggttgcatacgttctccagctccttc 645



to top

>gb|AY524794.1| Thellungiella halophila heat shock cognate protein 70 (hsc70) mRNA,
            complete cds
          Length = 2208

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                        
Query: 386  atcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttcaaactcg 445
            |||||||| ||||| |||||||| | |  |||||  |||||||||||| |||| ||||| 
Sbjct: 1886 atcttggcaatgattgggttgcaaatgctctccaattccttcatcttggcttcgaactca 1827

                                
Query: 446  tccgcctcagcaagctggtt 465
            || |||||||| | ||||||
Sbjct: 1826 tcagcctcagccaactggtt 1807



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 542  atcttctcgtccttgatggtgttgcgcatgttgta 576
            ||||||||||||| ||||||||| | |||||||||
Sbjct: 1730 atcttctcgtcctggatggtgttcctcatgttgta 1696



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 280  atcgactgtttagtcgacctcctcgatcttggggccag 317
            |||||| | ||||||||||||||| |||||||| ||||
Sbjct: 2004 atcgacagattagtcgacctcctcaatcttgggaccag 1967



to top

>emb|CR723474.2|CNS0GL6G Tetraodon nigroviridis full-length cDNA
          Length = 1722

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 371  ccagcaccctggtacatcttggcgatgatggggttgcaca 410
            ||||||| |||||||||||| |  ||||||||||||||||
Sbjct: 1415 ccagcactctggtacatctttgtcatgatggggttgcaca 1376



to top

>ref|XM_797036.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock
            protein 8, transcript variant 7 (LOC576276), mRNA
          Length = 2475

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgca 408
            |||||||| | ||||||||||||| |||||||||| ||||
Sbjct: 1977 caccagcagcttggtacatcttggtgatgatgggggtgca 1938



to top

>ref|XM_797035.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock
            protein 8, transcript variant 6 (LOC576276), mRNA
          Length = 2069

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgca 408
            |||||||| | ||||||||||||| |||||||||| ||||
Sbjct: 1977 caccagcagcttggtacatcttggtgatgatgggggtgca 1938



to top

>ref|XM_797034.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock
            protein 8, transcript variant 5 (LOC576276), mRNA
          Length = 2045

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgca 408
            |||||||| | ||||||||||||| |||||||||| ||||
Sbjct: 1977 caccagcagcttggtacatcttggtgatgatgggggtgca 1938



to top

>ref|XM_776060.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock
            protein 8, transcript variant 1 (LOC576276), mRNA
          Length = 2075

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgca 408
            |||||||| | ||||||||||||| |||||||||| ||||
Sbjct: 1977 caccagcagcttggtacatcttggtgatgatgggggtgca 1938



to top

>ref|XM_797027.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock
            protein 8, transcript variant 4 (LOC576276), mRNA
          Length = 1449

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgca 408
            |||||||| | ||||||||||||| |||||||||| ||||
Sbjct: 1357 caccagcagcttggtacatcttggtgatgatgggggtgca 1318



to top

>ref|XM_797023.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock
            protein 8, transcript variant 3 (LOC576276), mRNA
          Length = 1976

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgca 408
            |||||||| | ||||||||||||| |||||||||| ||||
Sbjct: 1887 caccagcagcttggtacatcttggtgatgatgggggtgca 1848



to top

>emb|Y08020.1|LIHSP706 L.infantum hsp70 gene, clone B2g6
          Length = 3758

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 288  tttagtcgacctcctcgatcttggggcc 315
            |||||||||||||||||| |||||||||
Sbjct: 2265 tttagtcgacctcctcgaccttggggcc 2238



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                             
Query: 379  ctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 427
            ||||||||||||||  ||||| |||||||| | |  |||||||||||||
Sbjct: 2144 ctggtacatcttggtcatgatcgggttgcatacgctctccagctccttc 2096



to top

>emb|AJ004940.1|GGAJ4940 Gallus gallus mRNA for heat shock cognate 70
          Length = 2120

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 379  ctggtacatcttggcgatgatggggttgcaca 410
            |||||||| ||||| |||||||||||||||||
Sbjct: 1882 ctggtacagcttggtgatgatggggttgcaca 1851



to top

>emb|Y08019.1|LIHSP701 L.infantum hsp70 gene, clone B2g1
          Length = 1119

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 288 tttagtcgacctcctcgatcttggggcc 315
           |||||||||||||||||| |||||||||
Sbjct: 64  tttagtcgacctcctcgaccttggggcc 37



to top

>ref|NM_176503.1| Drosophila melanogaster Heat shock protein cognate 4 CG4264-RF,
            transcript variant F (Hsc70-4), mRNA
          Length = 2362

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 287  gtttagtcgacctcctcgatcttggggccagggccgccgg 326
            ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 2062 gtttagtcgacctcctcgatggtggggccagcaccgccgg 2023



to top

>ref|NM_176502.1| Drosophila melanogaster Heat shock protein cognate 4 CG4264-RE,
            transcript variant E (Hsc70-4), mRNA
          Length = 2287

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 287  gtttagtcgacctcctcgatcttggggccagggccgccgg 326
            ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 1987 gtttagtcgacctcctcgatggtggggccagcaccgccgg 1948



to top

>ref|NM_169627.1| Drosophila melanogaster Heat shock protein cognate 4 CG4264-RD,
            transcript variant D (Hsc70-4), mRNA
          Length = 2355

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 287  gtttagtcgacctcctcgatcttggggccagggccgccgg 326
            ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 2055 gtttagtcgacctcctcgatggtggggccagcaccgccgg 2016



to top

>ref|NM_169626.1| Drosophila melanogaster Heat shock protein cognate 4 CG4264-RC,
            transcript variant C (Hsc70-4), mRNA
          Length = 2283

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 287  gtttagtcgacctcctcgatcttggggccagggccgccgg 326
            ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 1983 gtttagtcgacctcctcgatggtggggccagcaccgccgg 1944



to top

>ref|NM_169625.1| Drosophila melanogaster Heat shock protein cognate 4 CG4264-RB,
            transcript variant B (Hsc70-4), mRNA
          Length = 2342

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 287  gtttagtcgacctcctcgatcttggggccagggccgccgg 326
            ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 2042 gtttagtcgacctcctcgatggtggggccagcaccgccgg 2003



to top

>dbj|AB167744.1| Numida meleagris hspa8 mRNA for heat shock protein, complete cds
          Length = 2269

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 379  ctggtacatcttggcgatgatggggttgcaca 410
            |||||||| ||||| |||||||||||||||||
Sbjct: 1962 ctggtacagcttggtgatgatggggttgcaca 1931



to top

>ref|NM_079632.4| Drosophila melanogaster Heat shock protein cognate 4 CG4264-RA,
            transcript variant A (Hsc70-4), mRNA
          Length = 2413

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 287  gtttagtcgacctcctcgatcttggggccagggccgccgg 326
            ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 2113 gtttagtcgacctcctcgatggtggggccagcaccgccgg 2074



to top

>gb|AY084193.1| Drosophila melanogaster RH04426 full insert cDNA
          Length = 2425

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 287  gtttagtcgacctcctcgatcttggggccagggccgccgg 326
            ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 2112 gtttagtcgacctcctcgatggtggggccagcaccgccgg 2073



to top

>ref|XM_694544.1| PREDICTED: Danio rerio similar to Splicing factor 3B subunit 2
           (Spliceosome associated protein 145) (SAP 145) (SF3b150)
           (Pre-mRNA splicing factor SF3b 145 kDa subunit)
           (LOC570994), partial mRNA
          Length = 858

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 489 catcgatggcctcctcgatcttcttctt 516
           |||| |||||||||||||||||||||||
Sbjct: 562 catccatggcctcctcgatcttcttctt 535



to top

>ref|XM_691025.1| PREDICTED: Danio rerio similar to Splicing factor 3B subunit 2
           (Spliceosome associated protein 145) (SAP 145) (SF3b150)
           (Pre-mRNA splicing factor SF3b 145 kDa subunit)
           (LOC567725), mRNA
          Length = 462

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 489 catcgatggcctcctcgatcttcttctt 516
           |||| |||||||||||||||||||||||
Sbjct: 133 catccatggcctcctcgatcttcttctt 106



to top

>gb|L19533.1|CRUU14HS Cricetulus griseus heat resistant protein gene
          Length = 4730

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgca 408
            ||||||||| |||||||| |||||  ||||||||||||||
Sbjct: 4195 caccagcactctggtacagcttggtaatgatggggttgca 4156



to top

>gb|AC009904.7| Drosophila melanogaster, chromosome 3R, region 88E-88E, BAC clone
              BACR32A03, complete sequence
          Length = 182601

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                      
Query: 287    gtttagtcgacctcctcgatcttggggccagggccgccgg 326
              ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 156340 gtttagtcgacctcctcgatggtggggccagcaccgccgg 156301



to top

>emb|CR386963.1| Gallus gallus finished cDNA, clone ChEST104m7
          Length = 747

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 379 ctggtacatcttggcgatgatggggttgcaca 410
           |||||||| ||||| |||||||||||||||||
Sbjct: 351 ctggtacagcttggtgatgatggggttgcaca 320



to top

>gb|AC007648.6|AC007648 Drosophila melanogaster, chromosome 3R, region 88E-88F, BAC clone
            BACR13A02, complete sequence
          Length = 166141

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 287  gtttagtcgacctcctcgatcttggggccagggccgccgg 326
            ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 5374 gtttagtcgacctcctcgatggtggggccagcaccgccgg 5335



to top

>ref|NM_205003.1| Gallus gallus heat shock cognate 70 (HSC70), mRNA
          Length = 2120

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 379  ctggtacatcttggcgatgatggggttgcaca 410
            |||||||| ||||| |||||||||||||||||
Sbjct: 1882 ctggtacagcttggtgatgatggggttgcaca 1851



to top

>emb|X95688.1|ACHSP70HM A.cepa mRNA for heat shock protein 70-like protein
          Length = 396

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 77/95 (81%)
 Strand = Plus / Minus

                                                                       
Query: 422 tccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccactgg 481
           ||||||| |||||| ||||||||  | |||||||| | ||||||  | |||| |||||| 
Sbjct: 291 tccttcancttgtcatcaaactcagcagcctcagccaactggttgttatccaaccactga 232

                                              
Query: 482 atggcagcatcgatggcctcctcgatcttcttctt 516
           || ||  |||| || |||||||| |||||||||||
Sbjct: 231 atcgcctcatctatagcctcctctatcttcttctt 197



to top

>gb|AE003708.3| Drosophila melanogaster chromosome 3R, section 46 of 118 of the
             complete sequence
          Length = 236375

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                     
Query: 287   gtttagtcgacctcctcgatcttggggccagggccgccgg 326
             ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 49806 gtttagtcgacctcctcgatggtggggccagcaccgccgg 49767



to top

>gb|U64207.1|PCU64207 Penicillium citrinum heat shock protein 70 mRNA, partial cds
          Length = 1739

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 500  tcctcgatcttcttcttgtcgtcg 523
            ||||||||||||||||||||||||
Sbjct: 1315 tcctcgatcttcttcttgtcgtcg 1292



to top

>gb|M34561.1|CRUHSP70A Chinese hamster heat shock protein (cognate form of hsp70) mRNA,
            complete cds
          Length = 2243

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 369  caccagcaccctggtacatcttggcgatgatggggttgca 408
            ||||||||| |||||||| |||||  ||||||||||||||
Sbjct: 1895 caccagcactctggtacagcttggtaatgatggggttgca 1856



to top

>gb|M36114.1|DROHSC4A2 D.melanogaster heat shock cognate 4 (hsc4) gene, exon 2
          Length = 2082

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 287  gtttagtcgacctcctcgatcttggggccagggccgccgg 326
            ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 1983 gtttagtcgacctcctcgatggtggggccagcaccgccgg 1944



to top

>gb|AY651253.1| Rhynchobodo ATCC50359 heat shock protein 70 cytosolic isoform gene,
            partial cds
          Length = 1828

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 374  gcaccctggtacatcttggcgat 396
            |||||||||||||||||||||||
Sbjct: 1791 gcaccctggtacatcttggcgat 1769



to top

>gb|DQ025691.1| Oncorhynchus nerka clone One.hsc71.19.34 genomic sequence
          Length = 340

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 369 caccagcaccctggtacatcttggcgatgatgggg 403
           |||||||||||||||| | ||||| ||||||||||
Sbjct: 35  caccagcaccctggtatagcttggtgatgatgggg 1



to top

>gb|DQ025620.1| Oncorhynchus keta clone Oke.hsc71.19.23 genomic sequence
          Length = 343

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 369 caccagcaccctggtacatcttggcgatgatgggg 403
           |||||||||||||||| | ||||| ||||||||||
Sbjct: 35  caccagcaccctggtatagcttggtgatgatgggg 1



to top

>gb|DQ025546.1| Oncorhynchus tshawytscha clone Ots.hsc71.19.32 genomic sequence
          Length = 360

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 369 caccagcaccctggtacatcttggcgatgatgggg 403
           |||||||||||||||| | ||||| ||||||||||
Sbjct: 326 caccagcaccctggtatagcttggtgatgatgggg 360


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,389,752
Number of Sequences: 3902068
Number of extensions: 5389752
Number of successful extensions: 119000
Number of sequences better than 10.0: 613
Number of HSP's better than 10.0 without gapping: 620
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 116800
Number of HSP's gapped (non-prelim): 2158
length of query: 579
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 556
effective length of database: 17,143,297,704
effective search space: 9531673523424
effective search space used: 9531673523424
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top