ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags23g16 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|D13472.2|BLYINOPP Hordeum vulgare mRNA for vacuolar membrane proton-translocating inorganic pyrophosphatase, complete cds Length = 2649 Score = 1078 bits (544), Expect = 0.0 Identities = 617/635 (97%), Gaps = 15/635 (2%) Strand = Plus / Minus Query: 6 aagggtgggttnaa-cattatcgtcgtcatcatgggacgaggaaaatttgccaggcacat 64 ||||||||||| || ||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 2626 aagggtgggttcaaacattatcgtcgtcatcatgggacgaggaaaatttgccagacacat 2567 Query: 65 accaacgagggaggacatctggtctctctcttctactacatggagctacaagccggtaat 124 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 2566 accaacgagggaggacatctggtctctctcttctactacatggagctacaagccg-taat 2508 Query: 125 gtaatggtgagactaacataacgccttcaagaggccaggggaaaggggggtaggtaaccg 184 |||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| | Sbjct: 2507 gtaatg-tgagactaacataacgc-ttcaagaggccaggggaaaggggggtaggtaactg 2450 Query: 185 cggcaatcctggaatgacattgacaaccaaaaataacagcagcgcacaacgtacgaa--- 241 ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2449 cggcaatcctgga-tgacattgacaaccaaaaataacagcagcgcacaacgtacgaacgg 2391 Query: 242 --ggcgggcgggcaggcaggcgggggagttattcgtgacagtgtctgtagatcatcgctc 299 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2390 cgggcgggcgggcaggcaggcgggggagttattcgtgacagtgtctgtagatcatcgctc 2331 Query: 300 gactc-----gagtcctctagatgtacttgaacagcagacctccgtacgtggcgaagaag 354 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2330 gactcatcacgagtcctctagatgtacttgaacagcagacctccgtacgtggcgaagaag 2271 Query: 355 ggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgacgggcct 414 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2270 ggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgacgggcct 2211 Query: 415 gaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtggcagtct 474 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2210 gaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtggcagtct 2151 Query: 475 gaacccttgggaccaagggacctcgcatgctcgctgttgccggcctcgatgtacttcttt 534 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2150 gaacccttgggaccaagggacctcgcatgctcgctgttgccggcctcgatgtacttcttt 2091 Query: 535 gcgttgtcccatgcaccaccggtgttggaagcagagatggcgatctgcactccagaaacg 594 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2090 gcgttgtcccatgcaccaccggtgttggaagcagagatggcgatctgcactccagaaacg 2031 Query: 595 agggcaccagccagaacaccagacagggtttccac 629 ||||||||||||||||||||||||||||||||||| Sbjct: 2030 agggcaccagccagaacaccagacagggtttccac 1996
>gb|AY296911.1| Triticum aestivum vacuolar proton-inorganic pyrophosphatase mRNA, complete cds Length = 2671 Score = 543 bits (274), Expect = e-151 Identities = 313/326 (96%) Strand = Plus / Minus Query: 304 cgagtcctctagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaac 363 |||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| Sbjct: 2327 cgagtcttctagatgtacttgaacagcacacctccgtacgtggcgaagaagggcgcgaac 2268 Query: 364 acgagggactcaacggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtcc 423 ||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 2267 acgagggactcgacggccatcagcttgatgaggatgttgagcgacgggcctgaggtgtcc 2208 Query: 424 ttgagggggtctccgatggtgtcaccgatcacggcggccttgtggcagtctgaacccttg 483 ||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| Sbjct: 2207 ttgagggggtctccgatggtgtcgccgatcacggccgccttgtggcagtctgaacccttg 2148 Query: 484 ggaccaagggacctcgcatgctcgctgttgccggcctcgatgtacttctttgcgttgtcc 543 || |||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| Sbjct: 2147 gggccaagggacctcgcgtgctcgctgttgccggcctcaatgtacttctttgcgttgtcc 2088 Query: 544 catgcaccaccggtgttggaagcagagatggcgatctgcactccagaaacgagggcacca 603 |||||||| ||||||||||||||||||||||||||||| ||||||||||| ||||||||| Sbjct: 2087 catgcaccgccggtgttggaagcagagatggcgatctgtactccagaaacaagggcacca 2028 Query: 604 gccagaacaccagacagggtttccac 629 || ||||||||||||||||||||||| Sbjct: 2027 gcaagaacaccagacagggtttccac 2002 Score = 170 bits (86), Expect = 4e-39 Identities = 210/244 (86%), Gaps = 18/244 (7%) Strand = Plus / Minus Query: 18 aacattatcgtcgtcatcatgggacgaggaaaatttgccaggcacataccaacgagg--- 74 ||||||||||||||||||| ||||||||||||||||||||| |||||||||| | | Sbjct: 2610 aacattatcgtcgtcatcacgggacgaggaaaatttgccagacacataccaataatgacc 2551 Query: 75 gaggacatctggtctctctcttctactacatggagctacaagccggtaatgtaatggtga 134 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 2550 gaggacatctggtctctctcttctactacatggagctacaagccg-----gtaatggtga 2496 Query: 135 gactaacataacgccttcaagaggcc-aggggaaag-gggggtaggtaaccgcggcaatc 192 ||||||| |||| | ||||||||| | ||||||| ||||||| ||| ||||||||| Sbjct: 2495 gactaacgtaacacacccaagaggccaaagggaaagtgggggta---aactgcggcaatc 2439 Query: 193 ctgg---aatgacattgacaaccaaaaataacagcagcgcacaacgtacgaa-ggcgggc 248 |||| ||||||| | |||||||||||||||||||||||||| |||||| ||||||| Sbjct: 2438 ctggaataatgaca-caagaaccaaaaataacagcagcgcacaacatacgaacggcgggc 2380 Query: 249 gggc 252 |||| Sbjct: 2379 gggc 2376
>ref|XM_476313.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2304 Score = 385 bits (194), Expect = e-103 Identities = 281/310 (90%) Strand = Plus / Minus Query: 320 acttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacgg 379 |||||||||||||||| |||| ||||||||||| ||||| ||||| |||||||| |||| Sbjct: 2296 acttgaacagcagaccaccgtgtgtggcgaagaaaggcgcaaacacaagggactcgacgg 2237 Query: 380 ccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctccga 439 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | Sbjct: 2236 ccatgagcttgatgaggatgttgagcgacgggcctgatgtgtccttgagggggtctccaa 2177 Query: 440 tggtgtcaccgatcacggcggccttgtggcagtctgaacccttgggaccaagggacctcg 499 ||||||||||||||||||||||||||||||||||||| |||||||||||||||| || | Sbjct: 2176 tggtgtcaccgatcacggcggccttgtggcagtctgatcccttgggaccaagggtccgag 2117 Query: 500 catgctcgctgttgccggcctcgatgtacttctttgcgttgtcccatgcaccaccggtgt 559 ||||||| ||| || ||||| ||||||||||||||||| |||||||| ||||| |||| Sbjct: 2116 catgctcactggcaccagcctcaatgtacttctttgcgttatcccatgcgccaccagtgt 2057 Query: 560 tggaagcagagatggcgatctgcactccagaaacgagggcaccagccagaacaccagaca 619 |||| || |||||||||||||| ||||| ||||| || |||||||||||||||||||||| Sbjct: 2056 tggaggccgagatggcgatctgaactccggaaacaagagcaccagccagaacaccagaca 1997 Query: 620 gggtttccac 629 |||| ||||| Sbjct: 1996 gggtctccac 1987
>dbj|AK066933.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013091F19, full insert sequence Length = 2738 Score = 385 bits (194), Expect = e-103 Identities = 281/310 (90%) Strand = Plus / Minus Query: 320 acttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacgg 379 |||||||||||||||| |||| ||||||||||| ||||| ||||| |||||||| |||| Sbjct: 2405 acttgaacagcagaccaccgtgtgtggcgaagaaaggcgcaaacacaagggactcgacgg 2346 Query: 380 ccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctccga 439 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | Sbjct: 2345 ccatgagcttgatgaggatgttgagcgacgggcctgatgtgtccttgagggggtctccaa 2286 Query: 440 tggtgtcaccgatcacggcggccttgtggcagtctgaacccttgggaccaagggacctcg 499 ||||||||||||||||||||||||||||||||||||| |||||||||||||||| || | Sbjct: 2285 tggtgtcaccgatcacggcggccttgtggcagtctgatcccttgggaccaagggtccgag 2226 Query: 500 catgctcgctgttgccggcctcgatgtacttctttgcgttgtcccatgcaccaccggtgt 559 ||||||| ||| || ||||| ||||||||||||||||| |||||||| ||||| |||| Sbjct: 2225 catgctcactggcaccagcctcaatgtacttctttgcgttatcccatgcgccaccagtgt 2166 Query: 560 tggaagcagagatggcgatctgcactccagaaacgagggcaccagccagaacaccagaca 619 |||| || |||||||||||||| ||||| ||||| || |||||||||||||||||||||| Sbjct: 2165 tggaggccgagatggcgatctgaactccggaaacaagagcaccagccagaacaccagaca 2106 Query: 620 gggtttccac 629 |||| ||||| Sbjct: 2105 gggtctccac 2096 Score = 81.8 bits (41), Expect = 3e-12 Identities = 41/41 (100%) Strand = Plus / Minus Query: 18 aacattatcgtcgtcatcatgggacgaggaaaatttgccag 58 ||||||||||||||||||||||||||||||||||||||||| Sbjct: 2687 aacattatcgtcgtcatcatgggacgaggaaaatttgccag 2647
>dbj|D45384.1| Oryza sativa mRNA for vacuolar H+-pyrophosphatase, complete cds Length = 2710 Score = 385 bits (194), Expect = e-103 Identities = 281/310 (90%) Strand = Plus / Minus Query: 320 acttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacgg 379 |||||||||||||||| |||| ||||||||||| ||||| ||||| |||||||| |||| Sbjct: 2390 acttgaacagcagaccaccgtgtgtggcgaagaaaggcgcaaacacaagggactcgacgg 2331 Query: 380 ccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctccga 439 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | Sbjct: 2330 ccatgagcttgatgaggatgttgagcgacgggcctgatgtgtccttgagggggtctccaa 2271 Query: 440 tggtgtcaccgatcacggcggccttgtggcagtctgaacccttgggaccaagggacctcg 499 ||||||||||||||||||||||||||||||||||||| |||||||||||||||| || | Sbjct: 2270 tggtgtcaccgatcacggcggccttgtggcagtctgatcccttgggaccaagggtccgag 2211 Query: 500 catgctcgctgttgccggcctcgatgtacttctttgcgttgtcccatgcaccaccggtgt 559 ||||||| ||| || ||||| ||||||||||||||||| |||||||| ||||| |||| Sbjct: 2210 catgctcactggcaccagcctcaatgtacttctttgcgttatcccatgcgccaccagtgt 2151 Query: 560 tggaagcagagatggcgatctgcactccagaaacgagggcaccagccagaacaccagaca 619 |||| || |||||||||||||| ||||| ||||| || |||||||||||||||||||||| Sbjct: 2150 tggaggccgagatggcgatctgaactccggaaacaagagcaccagccagaacaccagaca 2091 Query: 620 gggtttccac 629 |||| ||||| Sbjct: 2090 gggtctccac 2081 Score = 81.8 bits (41), Expect = 3e-12 Identities = 41/41 (100%) Strand = Plus / Minus Query: 18 aacattatcgtcgtcatcatgggacgaggaaaatttgccag 58 ||||||||||||||||||||||||||||||||||||||||| Sbjct: 2672 aacattatcgtcgtcatcatgggacgaggaaaatttgccag 2632
>gb|AY103622.1| Zea mays PCO084888 mRNA sequence Length = 2801 Score = 329 bits (166), Expect = 6e-87 Identities = 262/294 (89%) Strand = Plus / Minus Query: 318 gtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaac 377 ||||||||| ||||| || || | ||||| |||||||| || |||||||||||||| || Sbjct: 2373 gtacttgaagagcaggccaccctgggtggcaaagaagggggcaaacacgagggactccac 2314 Query: 378 ggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctcc 437 ||||||||||||||||||||||||||| |||||||| ||||||||||| |||||||| || Sbjct: 2313 ggccatgagcttgatgaggatgttgagggacgggccggaggtgtccttcagggggtcacc 2254 Query: 438 gatggtgtcaccgatcacggcggccttgtggcagtctgaacccttgggaccaagggacct 497 ||||||||||| ||||| ||||||||||||||||| || ||||||||||| |||| ||| Sbjct: 2253 aatggtgtcacctatcacagcggccttgtggcagtcggatcccttgggaccgagggtcct 2194 Query: 498 cgcatgctcgctgttgccggcctcgatgtacttctttgcgttgtcccatgcaccaccggt 557 ||| ||||||||| || ||||| ||||||||||| || |||||||||||||| ||||| Sbjct: 2193 cgcgtgctcgctggcaccagcctcaatgtacttcttagcattgtcccatgcaccgccggt 2134 Query: 558 gttggaagcagagatggcgatctgcactccagaaacgagggcaccagccagaac 611 |||||||||||||||||||||||||||||||||||| ||||||||||| ||||| Sbjct: 2133 gttggaagcagagatggcgatctgcactccagaaaccagggcaccagcaagaac 2080
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 268 bits (135), Expect = 2e-68 Identities = 174/187 (93%) Strand = Plus / Minus Query: 320 acttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacgg 379 |||||||||||||||| |||| ||||||||||| ||||| ||||| |||||||| |||| Sbjct: 3934784 acttgaacagcagaccaccgtgtgtggcgaagaaaggcgcaaacacaagggactcgacgg 3934725 Query: 380 ccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctccga 439 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | Sbjct: 3934724 ccatgagcttgatgaggatgttgagcgacgggcctgatgtgtccttgagggggtctccaa 3934665 Query: 440 tggtgtcaccgatcacggcggccttgtggcagtctgaacccttgggaccaagggacctcg 499 ||||||||||||||||||||||||||||||||||||| |||||||||||||||| || | Sbjct: 3934664 tggtgtcaccgatcacggcggccttgtggcagtctgatcccttgggaccaagggtccgag 3934605 Query: 500 catgctc 506 ||||||| Sbjct: 3934604 catgctc 3934598 Score = 151 bits (76), Expect = 3e-33 Identities = 142/164 (86%) Strand = Plus / Minus Query: 343 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 402 ||||||||||| || || |||||||| ||||| || ||||| |||||||||||||||||| Sbjct: 25894188 gtggcgaagaacggggcaaacacgagcgactcgacagccatcagcttgatgaggatgttg 25894129 Query: 403 agcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcc 462 ||||| |||||||||||||||||||| || || || |||||||| |||||||| || ||| Sbjct: 25894128 agcgaggggcctgaggtgtccttgagaggatccccaatggtgtcgccgatcacagcagcc 25894069 Query: 463 ttgtggcagtctgaacccttgggaccaagggacctcgcatgctc 506 |||||||||||||| || || || || |||| ||| |||||||| Sbjct: 25894068 ttgtggcagtctgagcctttcgggcccagggtccttgcatgctc 25894025 Score = 81.8 bits (41), Expect = 3e-12 Identities = 41/41 (100%) Strand = Plus / Minus Query: 18 aacattatcgtcgtcatcatgggacgaggaaaatttgccag 58 ||||||||||||||||||||||||||||||||||||||||| Sbjct: 3935066 aacattatcgtcgtcatcatgggacgaggaaaatttgccag 3935026 Score = 79.8 bits (40), Expect = 1e-11 Identities = 58/64 (90%) Strand = Plus / Minus Query: 518 cctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcga 577 |||| ||||||||||||||||||||||| |||||||| ||||| || ||||||||||| | Sbjct: 25893905 cctcaatgtacttctttgcgttgtcccaggcaccaccagtgtttgatgcagagatggcaa 25893846 Query: 578 tctg 581 |||| Sbjct: 25893845 tctg 25893842 Score = 79.8 bits (40), Expect = 1e-11 Identities = 58/64 (90%) Strand = Plus / Minus Query: 518 cctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcga 577 |||| ||||||||||||||||| |||||||| ||||| |||||||| || |||||||||| Sbjct: 3934490 cctcaatgtacttctttgcgttatcccatgcgccaccagtgttggaggccgagatggcga 3934431 Query: 578 tctg 581 |||| Sbjct: 3934430 tctg 3934427 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 583 actccagaaacgagggcaccagccagaacaccagacagggtttccac 629 ||||| ||||| || |||||||||||||||||||||||||| ||||| Sbjct: 3934342 actccggaaacaagagcaccagccagaacaccagacagggtctccac 3934296
>dbj|AP003019.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0035I03 Length = 153749 Score = 268 bits (135), Expect = 2e-68 Identities = 174/187 (93%) Strand = Plus / Minus Query: 320 acttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacgg 379 |||||||||||||||| |||| ||||||||||| ||||| ||||| |||||||| |||| Sbjct: 40660 acttgaacagcagaccaccgtgtgtggcgaagaaaggcgcaaacacaagggactcgacgg 40601 Query: 380 ccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctccga 439 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | Sbjct: 40600 ccatgagcttgatgaggatgttgagcgacgggcctgatgtgtccttgagggggtctccaa 40541 Query: 440 tggtgtcaccgatcacggcggccttgtggcagtctgaacccttgggaccaagggacctcg 499 ||||||||||||||||||||||||||||||||||||| |||||||||||||||| || | Sbjct: 40540 tggtgtcaccgatcacggcggccttgtggcagtctgatcccttgggaccaagggtccgag 40481 Query: 500 catgctc 506 ||||||| Sbjct: 40480 catgctc 40474 Score = 81.8 bits (41), Expect = 3e-12 Identities = 41/41 (100%) Strand = Plus / Minus Query: 18 aacattatcgtcgtcatcatgggacgaggaaaatttgccag 58 ||||||||||||||||||||||||||||||||||||||||| Sbjct: 40942 aacattatcgtcgtcatcatgggacgaggaaaatttgccag 40902 Score = 79.8 bits (40), Expect = 1e-11 Identities = 58/64 (90%) Strand = Plus / Minus Query: 518 cctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcga 577 |||| ||||||||||||||||| |||||||| ||||| |||||||| || |||||||||| Sbjct: 40366 cctcaatgtacttctttgcgttatcccatgcgccaccagtgttggaggccgagatggcga 40307 Query: 578 tctg 581 |||| Sbjct: 40306 tctg 40303 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 583 actccagaaacgagggcaccagccagaacaccagacagggtttccac 629 ||||| ||||| || |||||||||||||||||||||||||| ||||| Sbjct: 40218 actccggaaacaagagcaccagccagaacaccagacagggtctccac 40172
>dbj|AB012766.1| Oryza sativa gene for ovp2, complete cds Length = 5985 Score = 268 bits (135), Expect = 2e-68 Identities = 174/187 (93%) Strand = Plus / Minus Query: 320 acttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacgg 379 |||||||||||||||| |||| ||||||||||| ||||| ||||| |||||||| |||| Sbjct: 5664 acttgaacagcagaccaccgtgtgtggcgaagaaaggcgcaaacacaagggactcgacgg 5605 Query: 380 ccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctccga 439 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | Sbjct: 5604 ccatgagcttgatgaggatgttgagcgacgggcctgatgtgtccttgagggggtctccaa 5545 Query: 440 tggtgtcaccgatcacggcggccttgtggcagtctgaacccttgggaccaagggacctcg 499 ||||||||||||||||||||||||||||||||||||| |||||||||||||||| || | Sbjct: 5544 tggtgtcaccgatcacggcggccttgtggcagtctgatcccttgggaccaagggtccgag 5485 Query: 500 catgctc 506 ||||||| Sbjct: 5484 catgctc 5478 Score = 81.8 bits (41), Expect = 3e-12 Identities = 41/41 (100%) Strand = Plus / Minus Query: 18 aacattatcgtcgtcatcatgggacgaggaaaatttgccag 58 ||||||||||||||||||||||||||||||||||||||||| Sbjct: 5946 aacattatcgtcgtcatcatgggacgaggaaaatttgccag 5906 Score = 79.8 bits (40), Expect = 1e-11 Identities = 58/64 (90%) Strand = Plus / Minus Query: 518 cctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcga 577 |||| ||||||||||||||||| |||||||| ||||| |||||||| || |||||||||| Sbjct: 5370 cctcaatgtacttctttgcgttatcccatgcgccaccagtgttggaggccgagatggcga 5311 Query: 578 tctg 581 |||| Sbjct: 5310 tctg 5307 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 583 actccagaaacgagggcaccagccagaacaccagacagggtttccac 629 ||||| ||||| || |||||||||||||||||||||||||| ||||| Sbjct: 5222 actccggaaacaagagcaccagccagaacaccagacagggtctccac 5176
>dbj|AB032839.1| Hordeum vulgare HVP1 mRNA for vacuolar proton-inorganic pyrophosphatase, complete cds Length = 2757 Score = 260 bits (131), Expect = 5e-66 Identities = 253/291 (86%), Gaps = 2/291 (0%) Strand = Plus / Minus Query: 334 cctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatg 393 ||||| || |||||||||||||| |||||||||||||||||||| ||||||||||||||| Sbjct: 2376 cctccataggtggcgaagaagggggcgaacacgagggactcaaccgccatgagcttgatg 2317 Query: 394 aggatgttgagcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatc 453 |||||||||||||| ||||| |||||||||||||| ||||| |||||||||||||||||| Sbjct: 2316 aggatgttgagcgaggggcccgaggtgtccttgagagggtccccgatggtgtcaccgatc 2257 Query: 454 acggcggccttgtggcagtctgaacccttgggaccaagggacctcgcatgctc-gctgtt 512 |||||||||||||||||||| || || || || || ||| | | |||||||| | || Sbjct: 2256 acggcggccttgtggcagtcagagcctttcgggcccaggctctttgcatgctcagatg-c 2198 Query: 513 gccggcctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagat 572 ||| ||||| ||||||||||| |||||||||||||||||||||||||| || || || || Sbjct: 2197 gccagcctcaatgtacttcttggcgttgtcccatgcaccaccggtgttcgatgccgaaat 2138 Query: 573 ggcgatctgcactccagaaacgagggcaccagccagaacaccagacagggt 623 ||| ||||| || |||||||| || ||||| || || |||||||| ||||| Sbjct: 2137 ggcaatctgaacaccagaaaccagagcaccggcaaggacaccagagagggt 2087
>emb|AJ621242.1| Oryza sativa mRNA for proton translocating pyrophosphatase (VP4 gene) Length = 2289 Score = 258 bits (130), Expect = 2e-65 Identities = 232/266 (87%) Strand = Plus / Minus Query: 334 cctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatg 393 ||||||| |||||||||||| ||||||||||| || ||||| |||||||||||||||||| Sbjct: 2267 cctccgtgcgtggcgaagaatggcgcgaacaccagcgactcgacggccatgagcttgatg 2208 Query: 394 aggatgttgagcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatc 453 |||||||| ||||||||||| || ||||||||||| ||||| ||||||||||| |||||| Sbjct: 2207 aggatgttcagcgacgggcccgacgtgtccttgagcgggtcgccgatggtgtcgccgatc 2148 Query: 454 acggcggccttgtggcagtctgaacccttgggaccaagggacctcgcatgctcgctgttg 513 || || |||||||||||||| || |||||||| || || |||||||| ||||| || Sbjct: 2147 accgccgccttgtggcagtccgatcccttgggccccagcgacctcgcgtgctcactcgcc 2088 Query: 514 ccggcctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatg 573 || ||||||||||| |||||||||||||||||||| ||||||||||| || ||||||||| Sbjct: 2087 ccagcctcgatgtatttctttgcgttgtcccatgcgccaccggtgttcgacgcagagatg 2028 Query: 574 gcgatctgcactccagaaacgagggc 599 |||| ||| || || || |||||||| Sbjct: 2027 gcgacctgtacgccggagacgagggc 2002
>dbj|AK102146.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086B11, full insert sequence Length = 2699 Score = 250 bits (126), Expect = 5e-63 Identities = 231/266 (86%) Strand = Plus / Minus Query: 334 cctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatg 393 ||||||| |||||||||||| ||||||||||| || ||||| |||||||||||||||||| Sbjct: 2376 cctccgtgcgtggcgaagaatggcgcgaacaccagcgactcgacggccatgagcttgatg 2317 Query: 394 aggatgttgagcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatc 453 |||||||| ||||||||||| || ||||||||||| ||||| || |||||||| |||||| Sbjct: 2316 aggatgttcagcgacgggcccgacgtgtccttgagcgggtcgccaatggtgtcgccgatc 2257 Query: 454 acggcggccttgtggcagtctgaacccttgggaccaagggacctcgcatgctcgctgttg 513 || || |||||||||||||| || |||||||| || || |||||||| ||||| || Sbjct: 2256 accgccgccttgtggcagtccgatcccttgggccccagcgacctcgcgtgctcactcgcc 2197 Query: 514 ccggcctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatg 573 || ||||||||||| |||||||||||||||||||| ||||||||||| || ||||||||| Sbjct: 2196 ccagcctcgatgtatttctttgcgttgtcccatgcgccaccggtgttcgacgcagagatg 2137 Query: 574 gcgatctgcactccagaaacgagggc 599 |||| ||| || || || |||||||| Sbjct: 2136 gcgacctgtacgccggagacgagggc 2111
>dbj|AB097115.1| Pyrus communis PVP3 mRNA for vacuolar proton-inorganic pyrophosphatase, complete cds Length = 2625 Score = 244 bits (123), Expect = 3e-61 Identities = 246/287 (85%) Strand = Plus / Minus Query: 343 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 402 |||||||||||||| || |||||||||||||| |||||||||||||| || ||||||||| Sbjct: 2337 gtggcgaagaagggagcaaacacgagggactccacggccatgagcttaataaggatgttg 2278 Query: 403 agcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcc 462 || || || ||||||||||||||||| |||||||| ||||||||||| ||||| || ||| Sbjct: 2277 agtgatggccctgaggtgtccttgagcgggtctccaatggtgtcaccaatcactgctgcc 2218 Query: 463 ttgtggcagtctgaacccttgggaccaagggacctcgcatgctcgctgttgccggcctcg 522 ||||| |||||||||||| || || |||| ||| |||||||| |||||||| Sbjct: 2217 ttgtgtgggtctgaacccttcgggccgagggtccttgcatgctctgaagcaccggcctca 2158 Query: 523 atgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcgatctgc 582 ||||||||||| || ||||||||||||||||| ||||| |||||||| || || |||||| Sbjct: 2157 atgtacttcttagcattgtcccatgcaccaccagtgttagaagcagatatcgctatctgc 2098 Query: 583 actccagaaacgagggcaccagccagaacaccagacagggtttccac 629 || |||||||| |||| |||||||||||||||||| ||||| ||||| Sbjct: 2097 acaccagaaacaagggaaccagccagaacaccagatagggtctccac 2051
>dbj|AK064361.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-108-B10, full insert sequence Length = 2009 Score = 242 bits (122), Expect = 1e-60 Identities = 230/266 (86%) Strand = Plus / Minus Query: 334 cctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatg 393 ||||||| |||||||||||| ||||||||||| || ||||| |||||| ||||||||||| Sbjct: 1670 cctccgtgcgtggcgaagaatggcgcgaacaccagcgactcgacggccgtgagcttgatg 1611 Query: 394 aggatgttgagcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatc 453 |||||||| ||||||||||| || ||||||||||| ||||| || |||||||| |||||| Sbjct: 1610 aggatgttcagcgacgggcccgacgtgtccttgagcgggtcgccaatggtgtcgccgatc 1551 Query: 454 acggcggccttgtggcagtctgaacccttgggaccaagggacctcgcatgctcgctgttg 513 || || |||||||||||||| || |||||||| || || |||||||| ||||| || Sbjct: 1550 accgccgccttgtggcagtccgatcccttgggccccagcgacctcgcgtgctcactcgcc 1491 Query: 514 ccggcctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatg 573 || ||||||||||| |||||||||||||||||||| ||||||||||| || ||||||||| Sbjct: 1490 ccagcctcgatgtatttctttgcgttgtcccatgcgccaccggtgttcgacgcagagatg 1431 Query: 574 gcgatctgcactccagaaacgagggc 599 |||| ||| || || || |||||||| Sbjct: 1430 gcgacctgtacgccggagacgagggc 1405
>dbj|AK119631.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-E10, full insert sequence Length = 1674 Score = 214 bits (108), Expect = 3e-52 Identities = 227/264 (85%), Gaps = 2/264 (0%) Strand = Plus / Minus Query: 343 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 402 ||||||||||| || || |||||||| ||||| || ||||| |||||||||||||||||| Sbjct: 1300 gtggcgaagaacggggcaaacacgagcgactcgacagccatcagcttgatgaggatgttg 1241 Query: 403 agcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcc 462 ||||| |||||||||||||||||||| || || || |||||||| |||||||| || ||| Sbjct: 1240 agcgaggggcctgaggtgtccttgagaggatccccaatggtgtcgccgatcacagcagcc 1181 Query: 463 ttgtggcagtctgaacccttgggaccaagggacctcgcatgctc-gctgttgccggcctc 521 |||||||||||||| || || || || |||| ||| |||||||| | || || ||||| Sbjct: 1180 ttgtggcagtctgagcctttcgggcccagggtccttgcatgctcagatg-caccagcctc 1122 Query: 522 gatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcgatctg 581 ||||||||||||||||||||||| |||||||| ||||| || ||||||||||| ||||| Sbjct: 1121 aatgtacttctttgcgttgtcccaggcaccaccagtgtttgatgcagagatggcaatctg 1062 Query: 582 cactccagaaacgagggcaccagc 605 || ||||||||||| |||||||| Sbjct: 1061 aacaccagaaacgagagcaccagc 1038
>dbj|AK099807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013098H04, full insert sequence Length = 3197 Score = 214 bits (108), Expect = 3e-52 Identities = 227/264 (85%), Gaps = 2/264 (0%) Strand = Plus / Minus Query: 343 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 402 ||||||||||| || || |||||||| ||||| || ||||| |||||||||||||||||| Sbjct: 2373 gtggcgaagaacggggcaaacacgagcgactcgacagccatcagcttgatgaggatgttg 2314 Query: 403 agcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcc 462 ||||| |||||||||||||||||||| || || || |||||||| |||||||| || ||| Sbjct: 2313 agcgaggggcctgaggtgtccttgagaggatccccaatggtgtcgccgatcacagcagcc 2254 Query: 463 ttgtggcagtctgaacccttgggaccaagggacctcgcatgctc-gctgttgccggcctc 521 |||||||||||||| || || || || |||| ||| |||||||| | || || ||||| Sbjct: 2253 ttgtggcagtctgagcctttcgggcccagggtccttgcatgctcagatg-caccagcctc 2195 Query: 522 gatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcgatctg 581 ||||||||||||||||||||||| |||||||| ||||| || ||||||||||| ||||| Sbjct: 2194 aatgtacttctttgcgttgtcccaggcaccaccagtgtttgatgcagagatggcaatctg 2135 Query: 582 cactccagaaacgagggcaccagc 605 || ||||||||||| |||||||| Sbjct: 2134 aacaccagaaacgagagcaccagc 2111
>dbj|D45383.1| Oryza sativa mRNA for vacuolar H+-pyrophosphatase, complete cds Length = 2742 Score = 214 bits (108), Expect = 3e-52 Identities = 227/264 (85%), Gaps = 2/264 (0%) Strand = Plus / Minus Query: 343 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 402 ||||||||||| || || |||||||| ||||| || ||||| |||||||||||||||||| Sbjct: 2349 gtggcgaagaacggggcaaacacgagcgactcgacagccatcagcttgatgaggatgttg 2290 Query: 403 agcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcc 462 ||||| |||||||||||||||||||| || || || |||||||| |||||||| || ||| Sbjct: 2289 agcgaggggcctgaggtgtccttgagaggatccccaatggtgtcgccgatcacagcagcc 2230 Query: 463 ttgtggcagtctgaacccttgggaccaagggacctcgcatgctc-gctgttgccggcctc 521 |||||||||||||| || || || || |||| ||| |||||||| | || || ||||| Sbjct: 2229 ttgtggcagtctgagcctttcgggcccagggtccttgcatgctcagatg-caccagcctc 2171 Query: 522 gatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcgatctg 581 ||||||||||||||||||||||| |||||||| ||||| || ||||||||||| ||||| Sbjct: 2170 aatgtacttctttgcgttgtcccaggcaccaccagtgtttgatgcagagatggcaatctg 2111 Query: 582 cactccagaaacgagggcaccagc 605 || ||||||||||| |||||||| Sbjct: 2110 aacaccagaaacgagagcaccagc 2087
>gb|AY255181.1| Hordeum brevisubulatum vacuolar proton-inorganic pyrophosphatase (AVP1) mRNA, complete cds Length = 2777 Score = 204 bits (103), Expect = 3e-49 Identities = 133/143 (93%) Strand = Plus / Minus Query: 334 cctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatg 393 |||||||| |||||||||||||| ||||||||||||||||| || ||||||||||||||| Sbjct: 2338 cctccgtaggtggcgaagaagggggcgaacacgagggactcgaccgccatgagcttgatg 2279 Query: 394 aggatgttgagcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatc 453 |||||||||||||| ||||| |||||||||||||| ||||| ||||||||||| |||||| Sbjct: 2278 aggatgttgagcgaggggcccgaggtgtccttgagagggtccccgatggtgtcgccgatc 2219 Query: 454 acggcggccttgtggcagtctga 476 || |||||||||||||||||||| Sbjct: 2218 actgcggccttgtggcagtctga 2196 Score = 85.7 bits (43), Expect = 2e-13 Identities = 91/107 (85%) Strand = Plus / Minus Query: 517 gcctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcg 576 ||||| ||||||||||| ||||||||||| |||||||||||||| || || || ||||| Sbjct: 2155 gcctcaatgtacttcttggcgttgtcccaggcaccaccggtgttcgatgctgaaatggca 2096 Query: 577 atctgcactccagaaacgagggcaccagccagaacaccagacagggt 623 ||||| || |||||||| || ||||| || || |||||||| ||||| Sbjct: 2095 atctgaacaccagaaaccagagcaccggcaaggacaccagagagggt 2049
>ref|XM_464356.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2313 Score = 202 bits (102), Expect = 1e-48 Identities = 239/282 (84%), Gaps = 2/282 (0%) Strand = Plus / Minus Query: 343 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 402 |||||||||||||| ||||| |||||||| || || |||||||||||||||||||||||| Sbjct: 2282 gtggcgaagaagggggcgaaaacgagggattcgaccgccatgagcttgatgaggatgttg 2223 Query: 403 agcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcc 462 || || || ||||| ||||||||||| ||||||||||||||||||||||| ||||| ||| Sbjct: 2222 agagagggtcctgaagtgtccttgagagggtctccgatggtgtcaccgatgacggccgcc 2163 Query: 463 ttgtggcagtctgaacccttgggaccaagggacctcgcatgctc-gctgttgccggcctc 521 |||||| || ||||| ||||||||||||| ||| |||||||| | | | || ||||| Sbjct: 2162 ttgtggggatcggaacctttgggaccaagggtcctggcatgctctgaagct-ccagcctc 2104 Query: 522 gatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcgatctg 581 ||||| |||||||| |||||||| ||||| || ||||| || || |||||||| ||||| Sbjct: 2103 aatgtatttctttgcattgtcccaagcaccgccagtgtttgatgcggagatggcaatctg 2044 Query: 582 cactccagaaacgagggcaccagccagaacaccagacagggt 623 || ||||| ||||| |||||||| || || ||||| ||||| Sbjct: 2043 aacaccagagacgagagcaccagcaaggactccagagagggt 2002
>gb|AF367446.1| Prunus persica clone Vp1 vacuolar H+-pyrophosphatase (vp1) mRNA, complete cds Length = 2619 Score = 196 bits (99), Expect = 6e-47 Identities = 240/287 (83%) Strand = Plus / Minus Query: 343 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 402 ||||| |||||||| || ||||| |||||||| || |||||||||||||||||||||||| Sbjct: 2346 gtggcaaagaagggagcaaacacaagggactccactgccatgagcttgatgaggatgttg 2287 Query: 403 agcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcc 462 || || ||||||||||||||||| || ||||| || ||||||||||| ||||| || ||| Sbjct: 2286 agtgatgggcctgaggtgtccttcagtgggtccccaatggtgtcaccaatcactgctgcc 2227 Query: 463 ttgtggcagtctgaacccttgggaccaagggacctcgcatgctcgctgttgccggcctcg 522 ||||| ||| || ||||| || ||||||| ||| |||||||| || ||||| Sbjct: 2226 ttgtgtgggtcagatccctttggcccaagggtccttgcatgctctgaagcaccagcctca 2167 Query: 523 atgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcgatctgc 582 ||||||||||| || ||||||||||||||||| |||||||||||||| || || | |||| Sbjct: 2166 atgtacttcttagcattgtcccatgcaccacctgtgttggaagcagatattgctacctgc 2107 Query: 583 actccagaaacgagggcaccagccagaacaccagacagggtttccac 629 || || |||||||| | |||||| ||||||||||| ||||| ||||| Sbjct: 2106 acaccggaaacgagtgaaccagcaagaacaccagatagggtctccac 2060
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 184 bits (93), Expect = 2e-43 Identities = 153/173 (88%) Strand = Plus / Plus Query: 334 cctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatg 393 ||||||| |||||||||||| ||||||||||| || ||||| |||||||||||||||||| Sbjct: 34229256 cctccgtgcgtggcgaagaatggcgcgaacaccagcgactcgacggccatgagcttgatg 34229315 Query: 394 aggatgttgagcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatc 453 |||||||| ||||||||||| || ||||||||||| ||||| || |||||||| |||||| Sbjct: 34229316 aggatgttcagcgacgggcccgacgtgtccttgagcgggtcgccaatggtgtcgccgatc 34229375 Query: 454 acggcggccttgtggcagtctgaacccttgggaccaagggacctcgcatgctc 506 || || |||||||||||||| || |||||||| || || |||||||| ||||| Sbjct: 34229376 accgccgccttgtggcagtccgatcccttgggccccagcgacctcgcgtgctc 34229428 Score = 174 bits (88), Expect = 2e-40 Identities = 145/164 (88%) Strand = Plus / Plus Query: 343 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 402 |||||||||||||| ||||| |||||||| || || |||||||||||||||||||||||| Sbjct: 4694181 gtggcgaagaagggggcgaaaacgagggattcgaccgccatgagcttgatgaggatgttg 4694240 Query: 403 agcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcc 462 || || || ||||| ||||||||||| ||||||||||||||||||||||| ||||| ||| Sbjct: 4694241 agagagggtcctgaagtgtccttgagagggtctccgatggtgtcaccgatgacggccgcc 4694300 Query: 463 ttgtggcagtctgaacccttgggaccaagggacctcgcatgctc 506 |||||| || ||||| ||||||||||||| ||| |||||||| Sbjct: 4694301 ttgtggggatcggaacctttgggaccaagggtcctggcatgctc 4694344 Score = 87.7 bits (44), Expect = 4e-14 Identities = 56/60 (93%) Strand = Plus / Plus Query: 518 cctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcga 577 |||||||||| |||||||||||||||||||| ||||||||||| || ||||||||||||| Sbjct: 34229533 cctcgatgtatttctttgcgttgtcccatgcgccaccggtgttcgacgcagagatggcga 34229592 Score = 40.1 bits (20), Expect = 8.6 Identities = 32/36 (88%) Strand = Plus / Plus Query: 519 ctcgatgtacttctttgcgttgtcccatgcaccacc 554 ||||||||||||||| || || ||||| |||||||| Sbjct: 19932621 ctcgatgtacttcttagcattatcccaggcaccacc 19932656
>dbj|AP007227.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0032L17 Length = 165808 Score = 184 bits (93), Expect = 2e-43 Identities = 153/173 (88%) Strand = Plus / Plus Query: 334 cctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatg 393 ||||||| |||||||||||| ||||||||||| || ||||| |||||||||||||||||| Sbjct: 156770 cctccgtgcgtggcgaagaatggcgcgaacaccagcgactcgacggccatgagcttgatg 156829 Query: 394 aggatgttgagcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatc 453 |||||||| ||||||||||| || ||||||||||| ||||| || |||||||| |||||| Sbjct: 156830 aggatgttcagcgacgggcccgacgtgtccttgagcgggtcgccaatggtgtcgccgatc 156889 Query: 454 acggcggccttgtggcagtctgaacccttgggaccaagggacctcgcatgctc 506 || || |||||||||||||| || |||||||| || || |||||||| ||||| Sbjct: 156890 accgccgccttgtggcagtccgatcccttgggccccagcgacctcgcgtgctc 156942 Score = 87.7 bits (44), Expect = 4e-14 Identities = 56/60 (93%) Strand = Plus / Plus Query: 518 cctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcga 577 |||||||||| |||||||||||||||||||| ||||||||||| || ||||||||||||| Sbjct: 157047 cctcgatgtatttctttgcgttgtcccatgcgccaccggtgttcgacgcagagatggcga 157106
>dbj|AP005056.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0689B12 Length = 154745 Score = 184 bits (93), Expect = 2e-43 Identities = 153/173 (88%) Strand = Plus / Plus Query: 334 cctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatg 393 ||||||| |||||||||||| ||||||||||| || ||||| |||||||||||||||||| Sbjct: 64529 cctccgtgcgtggcgaagaatggcgcgaacaccagcgactcgacggccatgagcttgatg 64588 Query: 394 aggatgttgagcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatc 453 |||||||| ||||||||||| || ||||||||||| ||||| || |||||||| |||||| Sbjct: 64589 aggatgttcagcgacgggcccgacgtgtccttgagcgggtcgccaatggtgtcgccgatc 64648 Query: 454 acggcggccttgtggcagtctgaacccttgggaccaagggacctcgcatgctc 506 || || |||||||||||||| || |||||||| || || |||||||| ||||| Sbjct: 64649 accgccgccttgtggcagtccgatcccttgggccccagcgacctcgcgtgctc 64701 Score = 87.7 bits (44), Expect = 4e-14 Identities = 56/60 (93%) Strand = Plus / Plus Query: 518 cctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcga 577 |||||||||| |||||||||||||||||||| ||||||||||| || ||||||||||||| Sbjct: 64806 cctcgatgtatttctttgcgttgtcccatgcgccaccggtgttcgacgcagagatggcga 64865
>dbj|AB126350.1| Oryza sativa (japonica cultivar-group) OVP3 gene for vacuolar proton pyrophosphatase, complete cds Length = 5548 Score = 184 bits (93), Expect = 2e-43 Identities = 153/173 (88%) Strand = Plus / Minus Query: 334 cctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatg 393 ||||||| |||||||||||| ||||||||||| || ||||| |||||||||||||||||| Sbjct: 5235 cctccgtgcgtggcgaagaatggcgcgaacaccagcgactcgacggccatgagcttgatg 5176 Query: 394 aggatgttgagcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatc 453 |||||||| ||||||||||| || ||||||||||| ||||| || |||||||| |||||| Sbjct: 5175 aggatgttcagcgacgggcccgacgtgtccttgagcgggtcgccaatggtgtcgccgatc 5116 Query: 454 acggcggccttgtggcagtctgaacccttgggaccaagggacctcgcatgctc 506 || || |||||||||||||| || |||||||| || || |||||||| ||||| Sbjct: 5115 accgccgccttgtggcagtccgatcccttgggccccagcgacctcgcgtgctc 5063 Score = 87.7 bits (44), Expect = 4e-14 Identities = 56/60 (93%) Strand = Plus / Minus Query: 518 cctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcga 577 |||||||||| |||||||||||||||||||| ||||||||||| || ||||||||||||| Sbjct: 4958 cctcgatgtatttctttgcgttgtcccatgcgccaccggtgttcgacgcagagatggcga 4899
>dbj|AP004066.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1572_F02 Length = 93626 Score = 174 bits (88), Expect = 2e-40 Identities = 145/164 (88%) Strand = Plus / Plus Query: 343 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 402 |||||||||||||| ||||| |||||||| || || |||||||||||||||||||||||| Sbjct: 66253 gtggcgaagaagggggcgaaaacgagggattcgaccgccatgagcttgatgaggatgttg 66312 Query: 403 agcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcc 462 || || || ||||| ||||||||||| ||||||||||||||||||||||| ||||| ||| Sbjct: 66313 agagagggtcctgaagtgtccttgagagggtctccgatggtgtcaccgatgacggccgcc 66372 Query: 463 ttgtggcagtctgaacccttgggaccaagggacctcgcatgctc 506 |||||| || ||||| ||||||||||||| ||| |||||||| Sbjct: 66373 ttgtggggatcggaacctttgggaccaagggtcctggcatgctc 66416
>dbj|AB126351.1| Oryza sativa (japonica cultivar-group) OVP5 gene for vacuolar proton pyrophosphatase, complete cds Length = 5595 Score = 170 bits (86), Expect = 4e-39 Identities = 143/162 (88%) Strand = Plus / Minus Query: 343 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 402 |||||||||||||| ||||| |||||||| || || |||||||||||||||||||||||| Sbjct: 5248 gtggcgaagaagggggcgaaaacgagggattcgaccgccatgagcttgatgaggatgttg 5189 Query: 403 agcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcc 462 || || || ||||| ||||||||||| ||||||||||||||||||||||| ||||| ||| Sbjct: 5188 agagagggtcctgaagtgtccttgagagggtctccgatggtgtcaccgatgacggccgcc 5129 Query: 463 ttgtggcagtctgaacccttgggaccaagggacctcgcatgc 504 |||||| || ||||| ||||||||||||| ||| |||||| Sbjct: 5128 ttgtggggatcggaacctttgggaccaagggtcctggcatgc 5087
>emb|AJ715528.1| Zea mays mRNA for vacuolar H+-translocating inorganic pyrophosphatase (vpp1 gene) Length = 2631 Score = 165 bits (83), Expect = 2e-37 Identities = 230/279 (82%) Strand = Plus / Minus Query: 345 ggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgag 404 |||||||||||| ||||| || ||||| ||||| ||||| |||||||||||||||||||| Sbjct: 2268 ggcgaagaagggggcgaagacaagggattcaaccgccataagcttgatgaggatgttgag 2209 Query: 405 cgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcctt 464 || ||||| || ||||||||||| || ||||| ||||||||||| || || || ||||| Sbjct: 2208 ggaagggccagacgtgtccttgagaggatctccaatggtgtcaccaatgacagccgcctt 2149 Query: 465 gtggcagtctgaacccttgggaccaagggacctcgcatgctcgctgttgccggcctcgat 524 ||| ||| ||||| || || ||||||| ||| |||||||| || ||||| || Sbjct: 2148 gtgagggtcagaaccttttgggccaagggtcctggcatgctctgaaactccagcctcaat 2089 Query: 525 gtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcgatctgcac 584 ||||||||| ||||||||||| |||||||| |||||||| ||||| ||||| ||||| || Sbjct: 2088 gtacttcttggcgttgtcccaggcaccaccagtgttggatgcagaaatggcaatctgaac 2029 Query: 585 tccagaaacgagggcaccagccagaacaccagacagggt 623 ||||| || ||||||||||| || || ||||| ||||| Sbjct: 2028 accagagacaagggcaccagcaaggactccagagagggt 1990
>gb|L32792.1|BEUPYROA Beta vulgaris clone P1 pyrophosphatase mRNA, complete cds Length = 2801 Score = 165 bits (83), Expect = 2e-37 Identities = 259/315 (82%), Gaps = 2/315 (0%) Strand = Plus / Minus Query: 313 tagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggac 372 |||| ||||||||| |||| || |||| |||||||||||||| |||||||| || ||| Sbjct: 2354 tagaggtacttgaagagcaagccaccgtgggtggcgaagaagggggcgaacactagtgac 2295 Query: 373 tcaacggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgaggggg 432 || || ||||| |||||||| || |||||||| || || ||||| |||||||| || ||| Sbjct: 2294 tcgacagccataagcttgattagaatgttgagtgatggtcctgatgtgtccttaagtggg 2235 Query: 433 tctccgatggtgtcaccgatcacggcggccttgtg-gcagtctgaacccttgggaccaag 491 || |||||||||||||||||||| || |||||||| ||| ||||| |||||||||||||| Sbjct: 2234 tcaccgatggtgtcaccgatcacagctgccttgtgtgca-tctgatcccttgggaccaag 2176 Query: 492 ggacctcgcatgctcgctgttgccggcctcgatgtacttctttgcgttgtcccatgcacc 551 | ||| |||||||| || ||||| ||||||||||| || |||||||| ||||| Sbjct: 2175 tgtccttgcatgctctgaagcaccagcctcaatgtacttcttggcattgtcccaagcacc 2116 Query: 552 accggtgttggaagcagagatggcgatctgcactccagaaacgagggcaccagccagaac 611 ||| |||||||| ||||| || || ||||| || ||||| || || | |||||| ||||| Sbjct: 2115 accagtgttggatgcagaaatagcaatctgtacaccagacacaagagaaccagcaagaac 2056 Query: 612 accagacagggtttc 626 |||||||| ||||| Sbjct: 2055 gccagacagagtttc 2041
>dbj|AB018529.1| Chara corallina CPP1 mRNA for vacuolar H+-pyrophosphatase, complete cds Length = 2839 Score = 161 bits (81), Expect = 3e-36 Identities = 207/249 (83%) Strand = Plus / Minus Query: 348 gaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcga 407 |||||| ||||| ||||| ||||| || ||||||||||||||||| || |||||||| || Sbjct: 2558 gaagaaaggcgcaaacacaagggattcgacggccatgagcttgataagaatgttgagtga 2499 Query: 408 cgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtg 467 ||| || || ||||||||||| || || || | ||||| || || || ||||| ||||| Sbjct: 2498 cggtccagatgtgtccttgagaggatcacccacagtgtccccaatgacagcggctttgtg 2439 Query: 468 gcagtctgaacccttgggaccaagggacctcgcatgctcgctgttgccggcctcgatgta 527 |||||| || ||||||||||| || | |||||| || ||| || |||||||||||||| Sbjct: 2438 gcagtccgaccccttgggaccgagcgtcctcgcgtgatcgttgccaccggcctcgatgta 2379 Query: 528 cttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcgatctgcactcc 587 ||||||||| |||||||| || |||||||||||||| ||||| ||||| || || || || Sbjct: 2378 cttctttgcattgtcccaggctccaccggtgttggacgcagaaatggcaatttgtacacc 2319 Query: 588 agaaacgag 596 ||||||||| Sbjct: 2318 agaaacgag 2310
>gb|BT018996.1| Zea mays clone Contig484.F mRNA sequence Length = 1100 Score = 151 bits (76), Expect = 3e-33 Identities = 231/280 (82%), Gaps = 2/280 (0%) Strand = Plus / Minus Query: 345 ggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgag 404 |||||||||||| ||||| || ||||| ||||| ||||| ||||||||||| |||||||| Sbjct: 580 ggcgaagaagggggcgaagacaagggattcaaccgccataagcttgatgagaatgttgag 521 Query: 405 cgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcctt 464 || ||||| || ||||||||||| || ||||| || |||||||| || || || ||||| Sbjct: 520 ggaggggccagacgtgtccttgagaggatctccaatagtgtcaccaatgacagccgcctt 461 Query: 465 gtggcagtctgaacccttgggaccaagggacctcgcatgctc-gctgttgccggcctcga 523 ||| ||| ||||| || || ||||||| ||| |||||||| | | | || ||||| | Sbjct: 460 gtgagggtcagaaccttttgggccaagggtcctggcatgctctgaagct-ccagcctcaa 402 Query: 524 tgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcgatctgca 583 |||||||||| ||||||||||| |||||||| |||||||| ||||| ||||| ||||| | Sbjct: 401 tgtacttcttggcgttgtcccaggcaccaccagtgttggatgcagaaatggcaatctgaa 342 Query: 584 ctccagaaacgagggcaccagccagaacaccagacagggt 623 | ||||| || ||||||||||| || || ||||| ||||| Sbjct: 341 caccagagacaagggcaccagcaaggaccccagagagggt 302
>dbj|AP003568.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0017B12 Length = 157424 Score = 151 bits (76), Expect = 3e-33 Identities = 142/164 (86%) Strand = Plus / Minus Query: 343 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 402 ||||||||||| || || |||||||| ||||| || ||||| |||||||||||||||||| Sbjct: 49286 gtggcgaagaacggggcaaacacgagcgactcgacagccatcagcttgatgaggatgttg 49227 Query: 403 agcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcc 462 ||||| |||||||||||||||||||| || || || |||||||| |||||||| || ||| Sbjct: 49226 agcgaggggcctgaggtgtccttgagaggatccccaatggtgtcgccgatcacagcagcc 49167 Query: 463 ttgtggcagtctgaacccttgggaccaagggacctcgcatgctc 506 |||||||||||||| || || || || |||| ||| |||||||| Sbjct: 49166 ttgtggcagtctgagcctttcgggcccagggtccttgcatgctc 49123 Score = 79.8 bits (40), Expect = 1e-11 Identities = 58/64 (90%) Strand = Plus / Minus Query: 518 cctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcga 577 |||| ||||||||||||||||||||||| |||||||| ||||| || ||||||||||| | Sbjct: 49003 cctcaatgtacttctttgcgttgtcccaggcaccaccagtgtttgatgcagagatggcaa 48944 Query: 578 tctg 581 |||| Sbjct: 48943 tctg 48940
>dbj|AB012765.1| Oryza sativa gene for ovp1, complete cds Length = 6410 Score = 151 bits (76), Expect = 3e-33 Identities = 142/164 (86%) Strand = Plus / Minus Query: 343 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 402 ||||||||||| || || |||||||| ||||| || ||||| |||||||||||||||||| Sbjct: 6016 gtggcgaagaacggggcaaacacgagcgactcgacagccatcagcttgatgaggatgttg 5957 Query: 403 agcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcc 462 ||||| |||||||||||||||||||| || || || |||||||| |||||||| || ||| Sbjct: 5956 agcgaggggcctgaggtgtccttgagaggatccccaatggtgtcgccgatcacagcagcc 5897 Query: 463 ttgtggcagtctgaacccttgggaccaagggacctcgcatgctc 506 |||||||||||||| || || || || |||| ||| |||||||| Sbjct: 5896 ttgtggcagtctgagcctttcgggcccagggtccttgcatgctc 5853 Score = 79.8 bits (40), Expect = 1e-11 Identities = 58/64 (90%) Strand = Plus / Minus Query: 518 cctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcga 577 |||| ||||||||||||||||||||||| |||||||| ||||| || ||||||||||| | Sbjct: 5733 cctcaatgtacttctttgcgttgtcccaggcaccaccagtgtttgatgcagagatggcaa 5674 Query: 578 tctg 581 |||| Sbjct: 5673 tctg 5670
>emb|AJ304836.1|CRE304836 Chlamydomonas reinhardtii mRNA for proton-translocating inorganic pyrophosphatase (vppa gene) Length = 2381 Score = 147 bits (74), Expect = 5e-32 Identities = 113/126 (89%) Strand = Plus / Minus Query: 348 gaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcga 407 |||||||||||||||||| || ||||| ||||||||||||||||| |||||||||||||| Sbjct: 2277 gaagaagggcgcgaacaccagcgactccacggccatgagcttgatcaggatgttgagcga 2218 Query: 408 cgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtg 467 ||||| |||||||||||| ||||| || | |||||| |||||||||||||||||||| Sbjct: 2217 ggggccgttggtgtccttgagcgggtcgcccacggtgtcgccgatcacggcggccttgtg 2158 Query: 468 gcagtc 473 |||||| Sbjct: 2157 gcagtc 2152 Score = 69.9 bits (35), Expect = 1e-08 Identities = 47/51 (92%) Strand = Plus / Minus Query: 513 gccggcctcgatgtacttctttgcgttgtcccatgcaccaccggtgttgga 563 |||||||||||||||||| |||||||||||||| || || ||||||||||| Sbjct: 2112 gccggcctcgatgtacttttttgcgttgtcccaggcgccgccggtgttgga 2062
>ref|XM_475605.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2313 Score = 145 bits (73), Expect = 2e-31 Identities = 169/201 (84%) Strand = Plus / Minus Query: 345 ggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgag 404 |||||||||||| ||||| ||||| | ||| |||||||||||||||| |||||||||||| Sbjct: 2280 ggcgaagaagggggcgaagacgagcgcctcgacggccatgagcttgacgaggatgttgag 2221 Query: 405 cgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcctt 464 ||| || || |||||||||||||| ||||| ||||||||||| |||||||| || ||||| Sbjct: 2220 cgatggccccgaggtgtccttgagcgggtcgccgatggtgtccccgatcaccgccgcctt 2161 Query: 465 gtggcagtctgaacccttgggaccaagggacctcgcatgctcgctgttgccggcctcgat 524 ||| || || |||||||| || || |||||||| | ||| | ||||||||||| Sbjct: 2160 gtgcgcctcggagcccttgggccccagcgacctcgcctcctccgtcgccccggcctcgat 2101 Query: 525 gtacttctttgcgttgtccca 545 ||||||||| ||||||||||| Sbjct: 2100 gtacttcttggcgttgtccca 2080
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 145 bits (73), Expect = 2e-31 Identities = 169/201 (84%) Strand = Plus / Plus Query: 345 ggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgag 404 |||||||||||| ||||| ||||| | ||| |||||||||||||||| |||||||||||| Sbjct: 3275269 ggcgaagaagggggcgaagacgagcgcctcgacggccatgagcttgacgaggatgttgag 3275328 Query: 405 cgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcctt 464 ||| || || |||||||||||||| ||||| ||||||||||| |||||||| || ||||| Sbjct: 3275329 cgatggccccgaggtgtccttgagcgggtcgccgatggtgtccccgatcaccgccgcctt 3275388 Query: 465 gtggcagtctgaacccttgggaccaagggacctcgcatgctcgctgttgccggcctcgat 524 ||| || || |||||||| || || |||||||| | ||| | ||||||||||| Sbjct: 3275389 gtgcgcctcggagcccttgggccccagcgacctcgcctcctccgtcgccccggcctcgat 3275448 Query: 525 gtacttctttgcgttgtccca 545 ||||||||| ||||||||||| Sbjct: 3275449 gtacttcttggcgttgtccca 3275469
>dbj|AK109809.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-147-G08, full insert sequence Length = 1486 Score = 145 bits (73), Expect = 2e-31 Identities = 169/201 (84%) Strand = Plus / Plus Query: 345 ggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgag 404 |||||||||||| ||||| ||||| | ||| |||||||||||||||| |||||||||||| Sbjct: 23 ggcgaagaagggggcgaagacgagcgcctcgacggccatgagcttgacgaggatgttgag 82 Query: 405 cgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcctt 464 ||| || || |||||||||||||| ||||| ||||||||||| |||||||| || ||||| Sbjct: 83 cgatggccccgaggtgtccttgagcgggtcgccgatggtgtccccgatcaccgccgcctt 142 Query: 465 gtggcagtctgaacccttgggaccaagggacctcgcatgctcgctgttgccggcctcgat 524 ||| || || |||||||| || || |||||||| | ||| | ||||||||||| Sbjct: 143 gtgcgcctcggagcccttgggccccagcgacctcgcctcctccgtcgccccggcctcgat 202 Query: 525 gtacttctttgcgttgtccca 545 ||||||||| ||||||||||| Sbjct: 203 gtacttcttggcgttgtccca 223
>dbj|AK107275.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-126-A04, full insert sequence Length = 2661 Score = 145 bits (73), Expect = 2e-31 Identities = 169/201 (84%) Strand = Plus / Minus Query: 345 ggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgag 404 |||||||||||| ||||| ||||| | ||| |||||||||||||||| |||||||||||| Sbjct: 2375 ggcgaagaagggggcgaagacgagcgcctcgacggccatgagcttgacgaggatgttgag 2316 Query: 405 cgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcctt 464 ||| || || |||||||||||||| ||||| ||||||||||| |||||||| || ||||| Sbjct: 2315 cgatggccccgaggtgtccttgagcgggtcgccgatggtgtccccgatcaccgccgcctt 2256 Query: 465 gtggcagtctgaacccttgggaccaagggacctcgcatgctcgctgttgccggcctcgat 524 ||| || || |||||||| || || |||||||| | ||| | ||||||||||| Sbjct: 2255 gtgcgcctcggagcccttgggccccagcgacctcgcctcctccgtcgccccggcctcgat 2196 Query: 525 gtacttctttgcgttgtccca 545 ||||||||| ||||||||||| Sbjct: 2195 gtacttcttggcgttgtccca 2175
>gb|AC087425.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0676G05, complete sequence Length = 167317 Score = 145 bits (73), Expect = 2e-31 Identities = 169/201 (84%) Strand = Plus / Plus Query: 345 ggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgag 404 |||||||||||| ||||| ||||| | ||| |||||||||||||||| |||||||||||| Sbjct: 69093 ggcgaagaagggggcgaagacgagcgcctcgacggccatgagcttgacgaggatgttgag 69152 Query: 405 cgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcctt 464 ||| || || |||||||||||||| ||||| ||||||||||| |||||||| || ||||| Sbjct: 69153 cgatggccccgaggtgtccttgagcgggtcgccgatggtgtccccgatcaccgccgcctt 69212 Query: 465 gtggcagtctgaacccttgggaccaagggacctcgcatgctcgctgttgccggcctcgat 524 ||| || || |||||||| || || |||||||| | ||| | ||||||||||| Sbjct: 69213 gtgcgcctcggagcccttgggccccagcgacctcgcctcctccgtcgccccggcctcgat 69272 Query: 525 gtacttctttgcgttgtccca 545 ||||||||| ||||||||||| Sbjct: 69273 gtacttcttggcgttgtccca 69293
>gb|BT018410.1| Zea mays clone EL01N0326G05.d mRNA sequence Length = 1446 Score = 139 bits (70), Expect = 1e-29 Identities = 231/281 (82%), Gaps = 3/281 (1%) Strand = Plus / Minus Query: 345 ggcgaagaagggcgcgaacac-gagggactcaacggccatgagcttgatgaggatgttga 403 |||||||||||| ||||| || |||||| ||||| ||||| ||||||||||| ||||||| Sbjct: 936 ggcgaagaagggggcgaagacagagggattcaaccgccataagcttgatgagaatgttga 877 Query: 404 gcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcct 463 | || ||||| || ||||||||||| || ||||| || |||||||| || || || |||| Sbjct: 876 gggaggggccagacgtgtccttgagaggatctccaatagtgtcaccaatgacagccgcct 817 Query: 464 tgtggcagtctgaacccttgggaccaagggacctcgcatgctc-gctgttgccggcctcg 522 |||| ||| ||||| || || ||||||| ||| |||||||| | | | || ||||| Sbjct: 816 tgtgagggtcagaaccttttgggccaagggtcctggcatgctctgaagct-ccagcctca 758 Query: 523 atgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcgatctgc 582 ||||||||||| |||||||| || |||||||| |||||||| ||||| ||||| ||||| Sbjct: 757 atgtacttcttggcgttgtcncaggcaccaccagtgttggatgcagaaatggcaatctga 698 Query: 583 actccagaaacgagggcaccagccagaacaccagacagggt 623 || ||||| || ||||||||||| || || ||||| ||||| Sbjct: 697 acaccagagacaagggcaccagcaaggaccccagagagggt 657
>dbj|AB009077.1| Vigna radiata mRNA for proton pyrophosphatase, complete cds Length = 2531 Score = 123 bits (62), Expect = 7e-25 Identities = 197/242 (81%) Strand = Plus / Minus Query: 349 aagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgac 408 |||||||| || || || || |||||||| ||||| |||||||| |||||||| || || Sbjct: 2277 aagaagggggcaaaaacaagagactcaactgccatcagcttgataaggatgttaagtgag 2218 Query: 409 gggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtgg 468 || || || || |||||||| |||||||| ||||||||||| || || || ||||||||| Sbjct: 2217 ggaccagatgtatccttgagagggtctccaatggtgtcaccaataactgctgccttgtgg 2158 Query: 469 cagtctgaacccttgggaccaagggacctcgcatgctcgctgttgccggcctcgatgtac 528 || ||||| || || ||||||||| || |||||||| || ||||| |||||| Sbjct: 2157 caatctgacccttttggaccaaggcttctggcatgctcagaagcaccagcctcaatgtac 2098 Query: 529 ttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcgatctgcactcca 588 |||||||| || ||||||||||| ||||||||||| ||||||||||| ||||| || ||| Sbjct: 2097 ttctttgcattatcccatgcaccgccggtgttggatgcagagatggcaatctgtacacca 2038 Query: 589 ga 590 || Sbjct: 2037 ga 2036
>emb|X83730.1|NTIPTVP9 N.tabacum mRNA for inorganic pyrophosphatase (TVP9 clone) Length = 2551 Score = 121 bits (61), Expect = 3e-24 Identities = 238/297 (80%) Strand = Plus / Minus Query: 321 cttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggc 380 |||||| |||||||| || | ||||| ||||| || || || ||||| || || || || Sbjct: 2307 cttgaaaagcagaccaccatgagtggcaaagaatggagcaaatacgagtgattcgactgc 2248 Query: 381 catgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctccgat 440 ||| |||||||| || |||||||| || |||||||| |||||||| || ||||| || || Sbjct: 2247 catcagcttgatcagaatgttgagtgatgggcctgaagtgtccttcagagggtcgccaat 2188 Query: 441 ggtgtcaccgatcacggcggccttgtggcagtctgaacccttgggaccaagggacctcgc 500 ||||||||| || || || |||||||| |||||||||||| |||||||||| ||| || Sbjct: 2187 ggtgtcaccaataacagctgccttgtgtgggtctgaaccctttggaccaagggtccttgc 2128 Query: 501 atgctcgctgttgccggcctcgatgtacttctttgcgttgtcccatgcaccaccggtgtt 560 |||||| || ||||| || |||||||| || ||||||||||||||||| ||||| Sbjct: 2127 atgctccgaagcaccagcctcaatatacttcttggcattgtcccatgcaccaccagtgtt 2068 Query: 561 ggaagcagagatggcgatctgcactccagaaacgagggcaccagccagaacaccaga 617 ||| ||||| || || ||||| || || ||||| | ||||| || ||||||||||| Sbjct: 2067 ggatgcagatattgctatctgtacaccggaaaccaaagcaccggcaagaacaccaga 2011
>ref|NM_183912.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2322 Score = 119 bits (60), Expect = 1e-23 Identities = 201/248 (81%) Strand = Plus / Minus Query: 349 aagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgac 408 ||||| |||||||| ||||| || || ||||||||||||||||| | ||||||||||||| Sbjct: 2291 aagaatggcgcgaagacgagagattcgacggccatgagcttgatcaagatgttgagcgac 2232 Query: 409 gggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtgg 468 || || || ||||||||||| ||||| || ||||| || |||||||| || |||||||| Sbjct: 2231 ggcccggatgtgtccttgagcgggtcgccaatggtatcgccgatcaccgccgccttgtga 2172 Query: 469 cagtctgaacccttgggaccaagggacctcgcatgctcgctgttgccggcctcgatgtac 528 ||| ||||||||||||||||| | | | ||||| ||| || |||||||| || Sbjct: 2171 gcgtccgaacccttgggaccaagtgcctttgcatggtcggatgcacctgcctcgatatat 2112 Query: 529 ttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcgatctgcactcca 588 ||||| || |||||||| || || || ||||||||||||| ||||| | |||||| || Sbjct: 2111 ttcttggcattgtcccaggctcccccactgttggaagcagatatggcaacctgcacgccg 2052 Query: 589 gaaacgag 596 |||||||| Sbjct: 2051 gaaacgag 2044
>gb|AY333187.1| Oryza sativa (japonica cultivar-group) H+-pyrophosphatase mRNA, complete cds Length = 2610 Score = 119 bits (60), Expect = 1e-23 Identities = 201/248 (81%) Strand = Plus / Minus Query: 349 aagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgac 408 ||||| |||||||| ||||| || || ||||||||||||||||| | ||||||||||||| Sbjct: 2388 aagaatggcgcgaagacgagagattcgacggccatgagcttgatcaagatgttgagcgac 2329 Query: 409 gggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtgg 468 || || || ||||||||||| ||||| || ||||| || |||||||| || |||||||| Sbjct: 2328 ggcccggatgtgtccttgagcgggtcgccaatggtatcgccgatcaccgccgccttgtga 2269 Query: 469 cagtctgaacccttgggaccaagggacctcgcatgctcgctgttgccggcctcgatgtac 528 ||| ||||||||||||||||| | | | ||||| ||| || |||||||| || Sbjct: 2268 gcgtccgaacccttgggaccaagtgcctttgcatggtcggatgcacctgcctcgatatat 2209 Query: 529 ttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcgatctgcactcca 588 ||||| || |||||||| || || || ||||||||||||| ||||| | |||||| || Sbjct: 2208 ttcttggcattgtcccaggctcccccactgttggaagcagatatggcaacctgcacgccg 2149 Query: 589 gaaacgag 596 |||||||| Sbjct: 2148 gaaacgag 2141
>gb|AF257777.1|AF257777 Vitis vinifera H+-pyrophosphatase mRNA, complete cds Length = 2745 Score = 119 bits (60), Expect = 1e-23 Identities = 120/140 (85%) Strand = Plus / Minus Query: 346 gcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagc 405 |||||||| || ||||| || | |||||| || |||||||||||||| ||||||||||| Sbjct: 2495 gcgaagaacggagcgaagaccaaggactcgaccgccatgagcttgatcaggatgttgagt 2436 Query: 406 gacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttg 465 || ||||| ||||||||||||||||| || ||||| |||||||| ||||| || |||||| Sbjct: 2435 gaagggccagaggtgtccttgaggggatcgccgattgtgtcacctatcacagctgccttg 2376 Query: 466 tggcagtctgaacccttggg 485 ||| |||||| |||||||| Sbjct: 2375 tgggggtctgaccccttggg 2356 Score = 61.9 bits (31), Expect = 2e-06 Identities = 85/103 (82%) Strand = Plus / Minus Query: 514 ccggcctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatg 573 |||||||| || || |||||||| || |||||||| ||||| ||||||||||| || ||| Sbjct: 2327 ccggcctctatatatttctttgcattatcccatgccccacctgtgttggaagctgatatg 2268 Query: 574 gcgatctgcactccagaaacgagggcaccagccagaacaccag 616 || | ||| || |||||||| || | |||||| ||||| |||| Sbjct: 2267 gcaacctggacaccagaaaccagtgaaccagcaagaactccag 2225
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 117 bits (59), Expect = 5e-23 Identities = 122/143 (85%) Strand = Plus / Minus Query: 349 aagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgac 408 ||||| |||||||| ||||| || || ||||||||||||||||| | ||||||||||||| Sbjct: 13228730 aagaatggcgcgaagacgagagattcgacggccatgagcttgatcaagatgttgagcgac 13228671 Query: 409 gggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtgg 468 || || || ||||||||||| ||||| || ||||| || |||||||| || |||||||| Sbjct: 13228670 ggcccggatgtgtccttgagcgggtcgccaatggtatcgccgatcaccgccgccttgtga 13228611 Query: 469 cagtctgaacccttgggaccaag 491 ||| ||||||||||||||||| Sbjct: 13228610 gcgtccgaacccttgggaccaag 13228588
>dbj|AP003793.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0487E11 Length = 151303 Score = 117 bits (59), Expect = 5e-23 Identities = 122/143 (85%) Strand = Plus / Minus Query: 349 aagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgac 408 ||||| |||||||| ||||| || || ||||||||||||||||| | ||||||||||||| Sbjct: 101031 aagaatggcgcgaagacgagagattcgacggccatgagcttgatcaagatgttgagcgac 100972 Query: 409 gggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtgg 468 || || || ||||||||||| ||||| || ||||| || |||||||| || |||||||| Sbjct: 100971 ggcccggatgtgtccttgagcgggtcgccaatggtatcgccgatcaccgccgccttgtga 100912 Query: 469 cagtctgaacccttgggaccaag 491 ||| ||||||||||||||||| Sbjct: 100911 gcgtccgaacccttgggaccaag 100889
>emb|AJ715529.1| Zea mays vpp1 gene for vacuolar H+-translocating inorganic pyrophosphatase, exons 1-8 Length = 9177 Score = 115 bits (58), Expect = 2e-22 Identities = 136/162 (83%) Strand = Plus / Minus Query: 345 ggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgag 404 |||||||||||| ||||| || ||||| ||||| ||||| |||||||||||||||||||| Sbjct: 8742 ggcgaagaagggggcgaagacaagggattcaaccgccataagcttgatgaggatgttgag 8683 Query: 405 cgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcctt 464 || ||||| || ||||||||||| || ||||| ||||||||||| || || || ||||| Sbjct: 8682 ggaagggccagacgtgtccttgagaggatctccaatggtgtcaccaatgacagccgcctt 8623 Query: 465 gtggcagtctgaacccttgggaccaagggacctcgcatgctc 506 ||| ||| ||||| || || ||||||| ||| |||||||| Sbjct: 8622 gtgagggtcagaaccttttgggccaagggtcctggcatgctc 8581 Score = 71.9 bits (36), Expect = 2e-09 Identities = 57/64 (89%) Strand = Plus / Minus Query: 518 cctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcga 577 |||| ||||||||||| ||||||||||| |||||||| |||||||| ||||| ||||| | Sbjct: 8443 cctcaatgtacttcttggcgttgtcccaggcaccaccagtgttggatgcagaaatggcaa 8384 Query: 578 tctg 581 |||| Sbjct: 8383 tctg 8380
>emb|AJ278019.1|LES278019 Lycopersicon esculentum partial mRNA for vacuolar-type H+-pyrophosphatase (vp1.1 gene) Length = 1335 Score = 111 bits (56), Expect = 3e-21 Identities = 247/308 (80%), Gaps = 2/308 (0%) Strand = Plus / Minus Query: 320 acttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacgg 379 ||||||| || ||||| |||| |||||| |||||||| || |||||||||||||| || | Sbjct: 1063 acttgaagagaagaccaccgtgcgtggcaaagaagggagcaaacacgagggactcgacag 1004 Query: 380 ccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctccga 439 |||| |||||||| || ||||| | || || || || ||||||||||| ||||| || | Sbjct: 1003 ccatcagcttgataagaatgttcaatgatggtccagatgtgtccttgagagggtcaccaa 944 Query: 440 tggtgtcaccgatcacggcggccttgtg-gcagtctgaacccttgggaccaagggacctc 498 |||||||| || || || || ||||| ||| || || |||||||| ||||| | ||| Sbjct: 943 cagtgtcaccaattacagcagctttgtgtgca-tcagatcccttggggccaagagtccta 885 Query: 499 gcatgctcgctgttgccggcctcgatgtacttctttgcgttgtcccatgcaccaccggtg 558 ||||| || | || ||||||||||||||||| ||||||||||| |||||||| ||| Sbjct: 884 gcatgttctgaggctccagcctcgatgtacttcttagcgttgtcccaggcaccaccagtg 825 Query: 559 ttggaagcagagatggcgatctgcactccagaaacgagggcaccagccagaacaccagac 618 ||||| ||||| ||||| ||||| || ||||| ||||| | || || ||||||||||| Sbjct: 824 ttggatgcagaaatggcaatctgtacaccagagacgagagatcctgcaagaacaccagaa 765 Query: 619 agggtttc 626 || ||||| Sbjct: 764 agtgtttc 757
>gb|AF367447.1| Prunus persica clone Vp2 vacuolar H+-pyrophosphatase (vp2) mRNA, complete cds Length = 2646 Score = 101 bits (51), Expect = 3e-18 Identities = 87/99 (87%) Strand = Plus / Minus Query: 369 ggactcaacggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgag 428 ||||||||| |||||||||||||| || |||||||| || || || || ||||||||||| Sbjct: 2340 ggactcaactgccatgagcttgataagaatgttgagtgaaggaccagaagtgtccttgag 2281 Query: 429 ggggtctccgatggtgtcaccgatcacggcggccttgtg 467 |||||||||||| ||||| || |||||||| |||||||| Sbjct: 2280 ggggtctccgattgtgtcgcctatcacggccgccttgtg 2242 Score = 81.8 bits (41), Expect = 3e-12 Identities = 68/77 (88%) Strand = Plus / Minus Query: 517 gcctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcg 576 ||||| ||||| |||||||| || |||||||||||||||||||| ||||| || ||||| Sbjct: 2192 gcctctatgtatttctttgcattatcccatgcaccaccggtgttcgaagctgaaatggca 2133 Query: 577 atctgcactccagaaac 593 |||||||| |||||||| Sbjct: 2132 atctgcacgccagaaac 2116
>gb|L32791.1|BEUPYRO Beta vulgaris clone P2 pyrophosphatase mRNA, complete cds Length = 2868 Score = 101 bits (51), Expect = 3e-18 Identities = 93/107 (86%) Strand = Plus / Minus Query: 517 gcctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcg 576 ||||||||||||||||| || ||||||||||||||||| |||||||| ||||| || || Sbjct: 2281 gcctcgatgtacttcttggcattgtcccatgcaccaccagtgttggaggcagatattgct 2222 Query: 577 atctgcactccagaaacgagggcaccagccagaacaccagacagggt 623 ||||| ||||| ||||| |||| ||||| ||||||||||| ||||| Sbjct: 2221 atctggactccggaaacaagggatccagctagaacaccagatagggt 2175 Score = 69.9 bits (35), Expect = 1e-08 Identities = 98/119 (82%) Strand = Plus / Minus Query: 349 aagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgac 408 ||||| || ||||| ||||| |||||||||||||| || ||||| | ||||| | || Sbjct: 2449 aagaatggagcgaaaacgagagactcaacggccataagtttgatcaaaatgttcaatgaa 2390 Query: 409 gggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtg 467 |||||||||||||||||||| ||||| || ||||| ||||| || || || |||||||| Sbjct: 2389 gggcctgaggtgtccttgagtgggtcaccaatggtatcaccaatgactgctgccttgtg 2331
>dbj|AP006375.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT32M04, TM0219, complete sequence Length = 72880 Score = 101 bits (51), Expect = 3e-18 Identities = 123/147 (83%) Strand = Plus / Minus Query: 346 gcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagc 405 ||||||||||| ||||||||||| |||||||| ||||| ||||||||||||||||| || Sbjct: 42907 gcgaagaagggtgcgaacacgagagactcaacagccattagcttgatgaggatgttaagt 42848 Query: 406 gacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttg 465 || || || || || ||||| || |||||||| ||||||||||| || || || || ||| Sbjct: 42847 gagggaccagatgtatccttaagagggtctccaatggtgtcaccaataacagcagctttg 42788 Query: 466 tggcagtctgaacccttgggaccaagg 492 || || ||||| || || ||||||||| Sbjct: 42787 tgacaatctgagcctttaggaccaagg 42761 Score = 56.0 bits (28), Expect = 1e-04 Identities = 55/64 (85%) Strand = Plus / Minus Query: 518 cctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcga 577 |||| ||||||||||| || || ||||| |||||||| |||||||| |||||||| || | Sbjct: 42503 cctcaatgtacttcttggcattatcccaagcaccaccagtgttggatgcagagatagcaa 42444 Query: 578 tctg 581 |||| Sbjct: 42443 tctg 42440
>gb|U36437.1|ZMU36437 Zea mays H+-pyrophosphatase mRNA, partial cds Length = 1529 Score = 101 bits (51), Expect = 3e-18 Identities = 93/107 (86%) Strand = Plus / Minus Query: 517 gcctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcg 576 ||||| ||||||||||| |||||||||||||||||||| |||||||| ||||| ||||| Sbjct: 1438 gcctcaatgtacttcttggcgttgtcccatgcaccaccagtgttggatgcagaaatggca 1379 Query: 577 atctgcactccagaaacgagggcaccagccagaacaccagacagggt 623 ||||| || ||||| || ||||||||||| || || ||||| ||||| Sbjct: 1378 atctgaacaccagagacaagggcaccagcaaggactccagagagggt 1332
>gb|U31467.1|VRU31467 Vigna radiata pyrophosphatase mRNA, complete cds Length = 2522 Score = 95.6 bits (48), Expect = 2e-16 Identities = 194/242 (80%), Gaps = 3/242 (1%) Strand = Plus / Minus Query: 349 aagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgac 408 |||||||| || || || || |||||||| ||||| |||||||| |||||||| || || Sbjct: 2284 aagaagggggcaaaaacaagagactcaactgccatcagcttgataaggatgttaagtgag 2225 Query: 409 gggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtgg 468 || || || || |||||||| |||||||| ||||||||||| || || || ||||||||| Sbjct: 2224 ggaccagatgtatccttgagagggtctccaatggtgtcaccaataactgctgccttgtgg 2165 Query: 469 cagtctgaacccttgggaccaagggacctcgcatgctcgctgttgccggcctcgatgtac 528 || ||||| || || ||||||||| || |||||||| || ||||| |||||| Sbjct: 2164 caatctgacccttttggaccaaggcttctggcatgctcagaagcaccagcctcaatgtac 2105 Query: 529 ttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcgatctgcactcca 588 |||||||| || ||||||| | ||||||||||| ||||||||||| ||||| || ||| Sbjct: 2104 ttctttgcattatcccatg---cgccggtgttggatgcagagatggcaatctgtacacca 2048 Query: 589 ga 590 || Sbjct: 2047 ga 2046
>emb|AJ557256.2|VVI557256 Vitis vinifera mRNA for vacuolar pyrophosphatase (vpp2 gene) Length = 2664 Score = 93.7 bits (47), Expect = 7e-16 Identities = 83/95 (87%) Strand = Plus / Minus Query: 373 tcaacggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgaggggg 432 ||||| ||||| |||||||||||||||||||| |||||||| || ||||||||||| ||| Sbjct: 2231 tcaactgccattagcttgatgaggatgttgagagacgggccagaagtgtccttgagaggg 2172 Query: 433 tctccgatggtgtcaccgatcacggcggccttgtg 467 || || || |||||||| ||||| || |||||||| Sbjct: 2171 tccccaattgtgtcaccaatcacagctgccttgtg 2137 Score = 67.9 bits (34), Expect = 4e-08 Identities = 64/74 (86%) Strand = Plus / Minus Query: 517 gcctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcg 576 ||||| || |||||||| || || ||||| |||||||| |||||||||||||||||||| Sbjct: 2087 gcctcaatatacttcttggcattatcccaagcaccaccagtgttggaagcagagatggca 2028 Query: 577 atctgcactccaga 590 ||||| || ||||| Sbjct: 2027 atctggacaccaga 2014
>dbj|D86306.1| Cucurbita moschata mRNA for proton-translocating inorganic pyrophosphatase, complete cds Length = 2704 Score = 91.7 bits (46), Expect = 3e-15 Identities = 94/110 (85%) Strand = Plus / Minus Query: 517 gcctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcg 576 ||||||||||||||||| ||||| ||||| ||||| |||||||| || ||||| ||||| Sbjct: 2206 gcctcgatgtacttcttagcgttatcccaggcacctccggtgttagatgcagaaatggca 2147 Query: 577 atctgcactccagaaacgagggcaccagccagaacaccagacagggtttc 626 |||||||| |||||||| |||| ||||| || |||||||| || ||||| Sbjct: 2146 atctgcacaccagaaacaagggacccagcaaggacaccagaaagagtttc 2097
>gb|AY514019.1| Hevea brasiliensis PPase mRNA, complete cds Length = 2807 Score = 89.7 bits (45), Expect = 1e-14 Identities = 96/113 (84%) Strand = Plus / Minus Query: 343 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 402 ||||| |||||||| || || ||||| || || || ||||| ||||||||||| |||||| Sbjct: 2386 gtggcaaagaagggagcaaagacgagagattccacagccataagcttgatgagaatgttg 2327 Query: 403 agcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcac 455 || || |||||||| |||||||| || ||||| |||||||||||||| ||||| Sbjct: 2326 agtgatgggcctgaagtgtccttaagtgggtcaccgatggtgtcaccaatcac 2274 Score = 89.7 bits (45), Expect = 1e-14 Identities = 87/101 (86%) Strand = Plus / Minus Query: 517 gcctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcg 576 ||||| || |||||||| || || |||||||||||||| ||||| || ||||| || || Sbjct: 2212 gcctcaatatacttcttggcattatcccatgcaccaccagtgttagatgcagaaattgct 2153 Query: 577 atctgcactccagaaacgagggcaccagccagaacaccaga 617 ||||| || |||||||| ||||||||||||||||||||||| Sbjct: 2152 atctgaacaccagaaacaagggcaccagccagaacaccaga 2112
>emb|X83729.1|NTIPTVP31 N.tabacum mRNA for inorganic pyrophosphatase (TVP31 clone) Length = 2867 Score = 87.7 bits (44), Expect = 4e-14 Identities = 218/276 (78%) Strand = Plus / Minus Query: 321 cttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggc 380 |||||| || ||||| |||| ||||| |||||||| |||||||| ||||| || || || Sbjct: 2646 cttgaagagaagaccaccgtgagtggcaaagaagggagcgaacaccagggattcgacagc 2587 Query: 381 catgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctccgat 440 ||| ||||||||||| ||||| || || || || || || |||||||| ||||| || | Sbjct: 2586 catcagcttgatgagaatgttcagtgatggtccagatgtatccttgagagggtcaccaac 2527 Query: 441 ggtgtcaccgatcacggcggccttgtggcagtctgaacccttgggaccaagggacctcgc 500 |||||||| ||||| || |||||||| ||| || |||||||| ||||||| || || Sbjct: 2526 agtgtcaccaatcacagcagccttgtgtgcgtcagatcccttggggccaagggttcttgc 2467 Query: 501 atgctcgctgttgccggcctcgatgtacttctttgcgttgtcccatgcaccaccggtgtt 560 ||| || | || ||||| ||||||||||| || || ||||| |||||||| || || Sbjct: 2466 atgttctgagactccagcctcaatgtacttcttagcattatcccaggcaccacctgtatt 2407 Query: 561 ggaagcagagatggcgatctgcactccagaaacgag 596 || ||||||||||| ||||| || ||||| ||||| Sbjct: 2406 agatgcagagatggcaatctgtacgccagagacgag 2371
>gb|AF533337.1| Chenopodium rubrum vacuolar proton-pumping PPase (CVP1) precursor RNA, intron and complete cds Length = 2898 Score = 85.7 bits (43), Expect = 2e-13 Identities = 100/119 (84%) Strand = Plus / Minus Query: 349 aagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgac 408 |||||||| || ||||| || ||||| || ||||| |||||||| || |||||||| ||| Sbjct: 2540 aagaagggggcaaacactagtgactcgacagccataagcttgatcagaatgttgagtgac 2481 Query: 409 gggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtg 467 || || || |||||||| || ||||| || ||||||||||||||||| || |||||||| Sbjct: 2480 ggtccagatgtgtccttaagagggtcaccaatggtgtcaccgatcacagcagccttgtg 2422
>gb|AF533336.1| Chenopodium rubrum vacuolar proton-pumping PPase (CVP1) mRNA, complete cds Length = 2695 Score = 85.7 bits (43), Expect = 2e-13 Identities = 100/119 (84%) Strand = Plus / Minus Query: 349 aagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgac 408 |||||||| || ||||| || ||||| || ||||| |||||||| || |||||||| ||| Sbjct: 2337 aagaagggggcaaacactagtgactcgacagccataagcttgatcagaatgttgagtgac 2278 Query: 409 gggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtg 467 || || || |||||||| || ||||| || ||||||||||||||||| || |||||||| Sbjct: 2277 ggtccagatgtgtccttaagagggtcaccaatggtgtcaccgatcacagcagccttgtg 2219
>gb|DQ443731.1| Chenopodium glaucum vacuolar H+-pyrophosphatase (CVP1) mRNA, complete cds Length = 2718 Score = 83.8 bits (42), Expect = 6e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 517 gcctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcg 576 ||||| ||||| ||||| || |||||||| |||||||| |||||||| |||||||| ||| Sbjct: 2087 gcctcaatgtatttcttggcattgtcccaagcaccaccagtgttggatgcagagatagcg 2028 Query: 577 atctgcactccagaaacgagggcaccagccagaacaccagacagggtttc 626 ||||| || ||||| || || | |||||| ||||||||||| || ||||| Sbjct: 2027 atctgtacaccagacactagagaaccagcaagaacaccagaaagagtttc 1978 Score = 77.8 bits (39), Expect = 4e-11 Identities = 99/119 (83%) Strand = Plus / Minus Query: 349 aagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgac 408 |||||||| || ||||| || |||||||| ||||| |||||||| ||||||||||| || Sbjct: 2255 aagaagggggcaaacactagtgactcaacagccatcagcttgatcaggatgttgagtgat 2196 Query: 409 gggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtg 467 || || || || ||||| || ||||| || ||||||||||| ||||| || |||||||| Sbjct: 2195 ggtccagatgtatccttaagagggtcaccaatggtgtcaccaatcacagctgccttgtg 2137
>ref|NM_101437.2| Arabidopsis thaliana AVP1; ATPase AT1G15690 (AVP1) mRNA, complete cds Length = 3207 Score = 79.8 bits (40), Expect = 1e-11 Identities = 145/180 (80%) Strand = Plus / Minus Query: 313 tagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggac 372 |||| ||||||||| || | ||| |||| |||||||||||||| || || || || ||| Sbjct: 2437 tagaagtacttgaaaaggataccaccgtgagtggcgaagaagggagcaaagacaagagac 2378 Query: 373 tcaacggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgaggggg 432 ||||| ||||||||||||||||||||||| | || || ||||| || ||||| | ||| Sbjct: 2377 tcaacagccatgagcttgatgaggatgttcaatgaaggtcctgaagtatccttcaatggg 2318 Query: 433 tctccgatggtgtcaccgatcacggcggccttgtggcagtctgaacccttgggaccaagg 492 ||||| || ||||| || ||||| || |||||||| ||||||||||| || |||||| Sbjct: 2317 tctccaattgtgtctccaatcacagctgccttgtgtggctctgaaccctttggtccaagg 2258 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 517 gcctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcg 576 ||||||||||| ||||| ||||||||||| |||||||| ||||| || || || |||||| Sbjct: 2233 gcctcgatgtatttcttggcgttgtcccaggcaccaccagtgttagatgctgatatggcg 2174 Query: 577 atctg 581 ||||| Sbjct: 2173 atctg 2169
>gb|AY078953.1| Arabidopsis thaliana At1g15690/F7H2_3 mRNA, complete cds Length = 2669 Score = 79.8 bits (40), Expect = 1e-11 Identities = 145/180 (80%) Strand = Plus / Minus Query: 313 tagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggac 372 |||| ||||||||| || | ||| |||| |||||||||||||| || || || || ||| Sbjct: 2430 tagaagtacttgaaaaggataccaccgtgagtggcgaagaagggagcaaagacaagagac 2371 Query: 373 tcaacggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgaggggg 432 ||||| ||||||||||||||||||||||| | || || ||||| || ||||| | ||| Sbjct: 2370 tcaacagccatgagcttgatgaggatgttcaatgaaggtcctgaagtatccttcaatggg 2311 Query: 433 tctccgatggtgtcaccgatcacggcggccttgtggcagtctgaacccttgggaccaagg 492 ||||| || ||||| || ||||| || |||||||| ||||||||||| || |||||| Sbjct: 2310 tctccaattgtgtctccaatcacagctgccttgtgtggctctgaaccctttggtccaagg 2251 Score = 58.0 bits (29), Expect = 4e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 517 gcctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcg 576 ||||||||||| ||||| ||||||||||| |||||||| ||||| || || || ||||| Sbjct: 2226 gcctcgatgtatttcttggcgttgtcccaggcaccaccagtgttagatgctgatgtggcg 2167 Query: 577 atctg 581 ||||| Sbjct: 2166 atctg 2162
>gb|AY065016.1| Arabidopsis thaliana At1g15690/F7H2_3 mRNA, complete cds Length = 2760 Score = 79.8 bits (40), Expect = 1e-11 Identities = 145/180 (80%) Strand = Plus / Minus Query: 313 tagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggac 372 |||| ||||||||| || | ||| |||| |||||||||||||| || || || || ||| Sbjct: 2430 tagaagtacttgaaaaggataccaccgtgagtggcgaagaagggagcaaagacaagagac 2371 Query: 373 tcaacggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgaggggg 432 ||||| ||||||||||||||||||||||| | || || ||||| || ||||| | ||| Sbjct: 2370 tcaacagccatgagcttgatgaggatgttcaatgaaggtcctgaagtatccttcaatggg 2311 Query: 433 tctccgatggtgtcaccgatcacggcggccttgtggcagtctgaacccttgggaccaagg 492 ||||| || ||||| || ||||| || |||||||| ||||||||||| || |||||| Sbjct: 2310 tctccaattgtgtctccaatcacagctgccttgtgtggctctgaaccctttggtccaagg 2251 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 517 gcctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcg 576 ||||||||||| ||||| ||||||||||| |||||||| ||||| || || || |||||| Sbjct: 2226 gcctcgatgtatttcttggcgttgtcccaggcaccaccagtgttagatgctgatatggcg 2167 Query: 577 atctg 581 ||||| Sbjct: 2166 atctg 2162
>dbj|AK221989.1| Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL22-60-N09 Length = 717 Score = 79.8 bits (40), Expect = 1e-11 Identities = 145/180 (80%) Strand = Plus / Minus Query: 313 tagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggac 372 |||| ||||||||| || | ||| |||| |||||||||||||| || || || || ||| Sbjct: 532 tagaagtacttgaaaaggataccaccgtgagtggcgaagaagggagcaaagacaagagac 473 Query: 373 tcaacggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgaggggg 432 ||||| ||||||||||||||||||||||| | || || ||||| || ||||| | ||| Sbjct: 472 tcaacagccatgagcttgatgaggatgttcaatgaaggtcctgaagtatccttcaatggg 413 Query: 433 tctccgatggtgtcaccgatcacggcggccttgtggcagtctgaacccttgggaccaagg 492 ||||| || ||||| || ||||| || |||||||| ||||||||||| || |||||| Sbjct: 412 tctccaattgtgtctccaatcacagctgccttgtgtggctctgaaccctttggtccaagg 353 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 517 gcctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcg 576 ||||||||||| ||||| ||||||||||| |||||||| ||||| || || || |||||| Sbjct: 328 gcctcgatgtatttcttggcgttgtcccaggcaccaccagtgttagatgctgatatggcg 269 Query: 577 atctg 581 ||||| Sbjct: 268 atctg 264
>gb|BT002481.1| Arabidopsis thaliana Unknown protein mRNA, complete cds Length = 2680 Score = 79.8 bits (40), Expect = 1e-11 Identities = 145/180 (80%) Strand = Plus / Minus Query: 313 tagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggac 372 |||| ||||||||| || | ||| |||| |||||||||||||| || || || || ||| Sbjct: 2437 tagaagtacttgaaaaggataccaccgtgagtggcgaagaagggagcaaagacaagagac 2378 Query: 373 tcaacggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgaggggg 432 ||||| ||||||||||||||||||||||| | || || ||||| || ||||| | ||| Sbjct: 2377 tcaacagccatgagcttgatgaggatgttcaatgaaggtcctgaagtatccttcaatggg 2318 Query: 433 tctccgatggtgtcaccgatcacggcggccttgtggcagtctgaacccttgggaccaagg 492 ||||| || ||||| || ||||| || |||||||| ||||||||||| || |||||| Sbjct: 2317 tctccaattgtgtctccaatcacagctgccttgtgtggctctgaaccctttggtccaagg 2258 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 517 gcctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcg 576 ||||||||||| ||||| ||||||||||| |||||||| ||||| || || || |||||| Sbjct: 2233 gcctcgatgtatttcttggcgttgtcccaggcaccaccagtgttagatgctgatatggcg 2174 Query: 577 atctg 581 ||||| Sbjct: 2173 atctg 2169
>gb|AC034256.3|F7H2 Sequence of BAC F7H2 from Arabidopsis thaliana chromosome 1, complete sequence Length = 77521 Score = 79.8 bits (40), Expect = 1e-11 Identities = 145/180 (80%) Strand = Plus / Minus Query: 313 tagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggac 372 |||| ||||||||| || | ||| |||| |||||||||||||| || || || || ||| Sbjct: 14757 tagaagtacttgaaaaggataccaccgtgagtggcgaagaagggagcaaagacaagagac 14698 Query: 373 tcaacggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgaggggg 432 ||||| ||||||||||||||||||||||| | || || ||||| || ||||| | ||| Sbjct: 14697 tcaacagccatgagcttgatgaggatgttcaatgaaggtcctgaagtatccttcaatggg 14638 Query: 433 tctccgatggtgtcaccgatcacggcggccttgtggcagtctgaacccttgggaccaagg 492 ||||| || ||||| || ||||| || |||||||| ||||||||||| || |||||| Sbjct: 14637 tctccaattgtgtctccaatcacagctgccttgtgtggctctgaaccctttggtccaagg 14578 Score = 63.9 bits (32), Expect = 6e-07 Identities = 56/64 (87%) Strand = Plus / Minus Query: 518 cctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcga 577 |||||||||| ||||| ||||||||||| |||||||| ||||| || || || ||||||| Sbjct: 14471 cctcgatgtatttcttggcgttgtcccaggcaccaccagtgttagatgctgatatggcga 14412 Query: 578 tctg 581 |||| Sbjct: 14411 tctg 14408
>dbj|AB015138.1| Arabidopsis thaliana AVP3 gene for Vacuolar proton pyrophosphatase, complete cds Length = 4648 Score = 79.8 bits (40), Expect = 1e-11 Identities = 145/180 (80%) Strand = Plus / Minus Query: 313 tagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggac 372 |||| ||||||||| || | ||| |||| |||||||||||||| || || || || ||| Sbjct: 4484 tagaagtacttgaaaaggataccaccgtgagtggcgaagaagggagcaaagacaagagac 4425 Query: 373 tcaacggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgaggggg 432 ||||| ||||||||||||||||||||||| | || || ||||| || ||||| | ||| Sbjct: 4424 tcaacagccatgagcttgatgaggatgttcaatgaaggtcctgaagtatccttcaatggg 4365 Query: 433 tctccgatggtgtcaccgatcacggcggccttgtggcagtctgaacccttgggaccaagg 492 ||||| || ||||| || ||||| || |||||||| ||||||||||| || |||||| Sbjct: 4364 tctccaattgtgtctccaatcacagctgccttgtgtggctctgaaccctttggtccaagg 4305 Score = 48.1 bits (24), Expect = 0.035 Identities = 54/64 (84%) Strand = Plus / Minus Query: 518 cctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcga 577 |||||||||| ||||| ||||||||||| || || || ||||| || || || ||||||| Sbjct: 4198 cctcgatgtatttcttggcgttgtcccaggctcctccagtgttagatgctgatatggcga 4139 Query: 578 tctg 581 |||| Sbjct: 4138 tctg 4135
>gb|M61742.1|ATHPATPC A.thaliana chloroplast ATP synthase gamma subunit (atpC2) gene, complete cds Length = 4418 Score = 79.8 bits (40), Expect = 1e-11 Identities = 145/180 (80%) Strand = Plus / Plus Query: 313 tagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggac 372 |||| ||||||||| || | ||| |||| |||||||||||||| || || || || ||| Sbjct: 3647 tagaagtacttgaaaaggataccaccgtgagtggcgaagaagggagcaaagacaagagac 3706 Query: 373 tcaacggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgaggggg 432 ||||| ||||||||||||||||||||||| | || || ||||| || ||||| | ||| Sbjct: 3707 tcaacagccatgagcttgatgaggatgttcaatgaaggtcctgaagtatccttcaatggg 3766 Query: 433 tctccgatggtgtcaccgatcacggcggccttgtggcagtctgaacccttgggaccaagg 492 ||||| || ||||| || ||||| || |||||||| ||||||||||| || |||||| Sbjct: 3767 tctccaattgtgtctccaatcacagctgccttgtgtggctctgaaccctttggtccaagg 3826 Score = 48.1 bits (24), Expect = 0.035 Identities = 54/64 (84%) Strand = Plus / Plus Query: 518 cctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcga 577 |||||||||| ||||| ||||||||||| || || || ||||| || || || ||||||| Sbjct: 3933 cctcgatgtatttcttggcgttgtcccaggctcctccagtgttagatgctgatatggcga 3992 Query: 578 tctg 581 |||| Sbjct: 3993 tctg 3996
>gb|M81892.1|ATHAVP3 Arabidopsis thaliana vacuolar H+ - pyrophosphatase (AVP-3) mRNA, complete cds Length = 2813 Score = 79.8 bits (40), Expect = 1e-11 Identities = 145/180 (80%) Strand = Plus / Minus Query: 313 tagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggac 372 |||| ||||||||| || | ||| |||| |||||||||||||| || || || || ||| Sbjct: 2467 tagaagtacttgaaaaggataccaccgtgagtggcgaagaagggagcaaagacaagagac 2408 Query: 373 tcaacggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgaggggg 432 ||||| ||||||||||||||||||||||| | || || ||||| || ||||| | ||| Sbjct: 2407 tcaacagccatgagcttgatgaggatgttcaatgaaggtcctgaagtatccttcaatggg 2348 Query: 433 tctccgatggtgtcaccgatcacggcggccttgtggcagtctgaacccttgggaccaagg 492 ||||| || ||||| || ||||| || |||||||| ||||||||||| || |||||| Sbjct: 2347 tctccaattgtgtctccaatcacagctgccttgtgtggctctgaaccctttggtccaagg 2288 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 517 gcctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcg 576 ||||||||||| ||||| ||||||||||| |||||||| ||||| || || || |||||| Sbjct: 2263 gcctcgatgtatttcttggcgttgtcccaggcaccaccagtgttagatgctgatatggcg 2204 Query: 577 atctg 581 ||||| Sbjct: 2203 atctg 2199
>emb|X83728.1|NTIPTVP17 N.tabacum mRNA for inorganic pyrophosphatase (TVP17 clone) Length = 1838 Score = 77.8 bits (39), Expect = 4e-11 Identities = 120/147 (81%) Strand = Plus / Minus Query: 321 cttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggc 380 |||||| || ||||| |||| |||||||||||||| |||||||||||||| || || || Sbjct: 1618 cttgaagagaagaccaccgtgagtggcgaagaagggagcgaacacgagggattcgacagc 1559 Query: 381 catgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctccgat 440 ||| ||||||||||| ||||| | || || || || ||||||||||| ||||| || | Sbjct: 1558 catcagcttgatgagaatgttcaatgatggtccagatgtgtccttgagagggtcaccaac 1499 Query: 441 ggtgtcaccgatcacggcggccttgtg 467 |||||||| || || || |||||||| Sbjct: 1498 agtgtcaccaataacagcagccttgtg 1472 Score = 56.0 bits (28), Expect = 1e-04 Identities = 58/68 (85%) Strand = Plus / Minus Query: 514 ccggcctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatg 573 |||||||| ||||||||||| || || ||||| |||||||| || || || ||||||||| Sbjct: 1425 ccggcctcaatgtacttcttagcattatcccaggcaccacctgtattagatgcagagatg 1366 Query: 574 gcgatctg 581 || ||||| Sbjct: 1365 gcaatctg 1358
>dbj|AK110424.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-166-A10, full insert sequence Length = 2654 Score = 75.8 bits (38), Expect = 2e-10 Identities = 65/74 (87%) Strand = Plus / Minus Query: 378 ggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctcc 437 ||||||||| |||||||| ||||||||||||||||| || |||||||| || ||||| || Sbjct: 2229 ggccatgagtttgatgagaatgttgagcgacgggccagacgtgtccttcagcgggtcacc 2170 Query: 438 gatggtgtcaccga 451 || |||||||||| Sbjct: 2169 gaccgtgtcaccga 2156
>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome Length = 3566135 Score = 71.9 bits (36), Expect = 2e-09 Identities = 72/84 (85%) Strand = Plus / Plus Query: 385 agcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctccgatggtg 444 |||||||| |||||||| | ||||||||| ||||||||||||| |||||| |||| ||| Sbjct: 2750041 agcttgatcaggatgttcatcgacgggccggaggtgtccttgaaggggtcgccgaccgtg 2750100 Query: 445 tcaccgatcacggcggccttgtgg 468 || |||| ||||| ||||||||| Sbjct: 2750101 tcgccgacgacggccgccttgtgg 2750124 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Plus Query: 513 gccggcctcgatgtacttctttgcgttgtcccatgcaccaccggtgttgg 562 ||||||||||||||||||||| ||||| ||||| || || |||| ||||| Sbjct: 2750151 gccggcctcgatgtacttcttcgcgttatcccacgcgccgccggcgttgg 2750200
>emb|X77915.1|NTSAMIPP N.tabacum mRNA for inorganic pyrophosphatase (TVP5clone) Length = 2713 Score = 69.9 bits (35), Expect = 1e-08 Identities = 215/275 (78%) Strand = Plus / Minus Query: 343 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 402 ||||| ||||| || || || ||||| |||||||| ||||| |||||||| | |||||| Sbjct: 2352 gtggcaaagaatggagcaaatacgagcgactcaactgccataagcttgatcaaaatgttg 2293 Query: 403 agcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcc 462 || || |||||||| |||||||| |||||||| || || |||||||| || || || ||| Sbjct: 2292 agtgatgggcctgaagtgtcctttagggggtcaccaattgtgtcaccaataacagcagcc 2233 Query: 463 ttgtggcagtctgaacccttgggaccaagggacctcgcatgctcgctgttgccggcctcg 522 ||||| || |||||||| || ||||| | ||| |||||||| || ||||| Sbjct: 2232 ttgtgaggttcggaaccctttgggccaagagtccttgcatgctctgaagcaccagcctca 2173 Query: 523 atgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcgatctgc 582 || |||||||| || |||||||||||||| || || || || ||||| || || ||||| Sbjct: 2172 atatacttcttggcattgtcccatgcacctccagtatttgatgcagatattgctatctgt 2113 Query: 583 actccagaaacgagggcaccagccagaacaccaga 617 || || ||||| | |||||||| || |||||||| Sbjct: 2112 acacctgaaaccaaagcaccagcaaggacaccaga 2078
>gb|AY436553.2| Thellungiella salsuginea pyrophosphate-energized vacuolar membrane proton pump (vp1) mRNA, complete cds Length = 2759 Score = 67.9 bits (34), Expect = 4e-08 Identities = 121/150 (80%) Strand = Plus / Minus Query: 318 gtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaac 377 ||||||||| || | ||| |||| ||||| |||||||| || || || || |||||||| Sbjct: 2409 gtacttgaaaaggataccaccgtgggtggcaaagaagggagcaaagacaagagactcaac 2350 Query: 378 ggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctcc 437 |||||||||||||| |||||||| | ||| || ||||| || ||||| | |||||||| Sbjct: 2349 agccatgagcttgatcaggatgttcaacgaaggtcctgaagtatccttcaatgggtctcc 2290 Query: 438 gatggtgtcaccgatcacggcggccttgtg 467 |||||||| || || || || |||||||| Sbjct: 2289 aatggtgtctccaataacagctgccttgtg 2260 Score = 61.9 bits (31), Expect = 2e-06 Identities = 88/107 (82%) Strand = Plus / Minus Query: 517 gcctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcg 576 ||||| ||||| ||||| || |||||||| |||||||| ||||| || ||||| ||||| Sbjct: 2210 gcctcaatgtatttcttggcattgtcccaggcaccaccagtgttagatgcagaaatggca 2151 Query: 577 atctgcactccagaaacgagggcaccagccagaacaccagacagggt 623 ||||| || |||||||| || | || || ||||||||||| ||||| Sbjct: 2150 atctgaacaccagaaacaagagagccggcgagaacaccagagagggt 2104
>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome Length = 4940217 Score = 63.9 bits (32), Expect = 6e-07 Identities = 32/32 (100%) Strand = Plus / Plus Query: 520 tcgatgtacttctttgcgttgtcccatgcacc 551 |||||||||||||||||||||||||||||||| Sbjct: 957765 tcgatgtacttctttgcgttgtcccatgcacc 957796
>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome Length = 4941439 Score = 63.9 bits (32), Expect = 6e-07 Identities = 32/32 (100%) Strand = Plus / Plus Query: 520 tcgatgtacttctttgcgttgtcccatgcacc 551 |||||||||||||||||||||||||||||||| Sbjct: 989026 tcgatgtacttctttgcgttgtcccatgcacc 989057
>ref|XM_808367.1| Trypanosoma cruzi strain CL Brener vacuolar-type proton translocating pyrophosphatase 1 (Tc00.1047053510773.20) partial mRNA Length = 2445 Score = 60.0 bits (30), Expect = 9e-06 Identities = 54/62 (87%) Strand = Plus / Minus Query: 523 atgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcgatctgc 582 ||||||||||| ||||||||||| || || ||||||||||| || |||||||| | |||| Sbjct: 2234 atgtacttcttcgcgttgtcccacgccccgccggtgttggaggcggagatggccacctgc 2175 Query: 583 ac 584 || Sbjct: 2174 ac 2173
>ref|XM_809775.1| Trypanosoma cruzi strain CL Brener vacuolar-type proton translocating pyrophosphatase 1 (Tc00.1047053511385.30) partial mRNA Length = 2445 Score = 60.0 bits (30), Expect = 9e-06 Identities = 54/62 (87%) Strand = Plus / Minus Query: 523 atgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcgatctgc 582 ||||||||||| ||||||||||| || || ||||||||||| || |||||||| | |||| Sbjct: 2234 atgtacttcttcgcgttgtcccacgccccgccggtgttggaggcggagatggccacctgc 2175 Query: 583 ac 584 || Sbjct: 2174 ac 2173
>gb|AF159881.1|AF159881 Trypanosoma cruzi vacuolar-type proton translocating pyrophosphatase 1 (PPase1) gene, complete cds Length = 3669 Score = 60.0 bits (30), Expect = 9e-06 Identities = 54/62 (87%) Strand = Plus / Minus Query: 523 atgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcgatctgc 582 ||||||||||| ||||||||||| || || ||||||||||| || |||||||| | |||| Sbjct: 2805 atgtacttcttcgcgttgtcccacgccccgccggtgttggaggcggagatggccacctgc 2746 Query: 583 ac 584 || Sbjct: 2745 ac 2744
>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome Length = 4406967 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 513 gccggcctcgatgtacttctttgcgttgtcccatgc 548 |||| |||||||||||||||| |||||||||||||| Sbjct: 2429045 gccgtcctcgatgtacttcttggcgttgtcccatgc 2429080
>gb|CP000088.1| Thermobifida fusca YX, complete genome Length = 3642249 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Minus Query: 408 cgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcct 463 |||||| | ||||||||||| |||||| ||||||||||| ||||| |||| ||||| Sbjct: 158988 cgggcccgcggtgtccttgaaggggtcgccgatggtgtcgccgatgacggtggcct 158933
>gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome Length = 3551823 Score = 56.0 bits (28), Expect = 1e-04 Identities = 73/88 (82%) Strand = Plus / Minus Query: 380 ccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctccga 439 |||| ||||||||||||| ||||||||| || |||| |||||||| || ||||| || | Sbjct: 1035895 ccatcagcttgatgaggacgttgagcgagggccctgccgtgtccttcagcgggtcgccca 1035836 Query: 440 tggtgtcaccgatcacggcggccttgtg 467 |||||| || | ||||| ||||||||| Sbjct: 1035835 cggtgtcgcccaccacggaggccttgtg 1035808 Score = 54.0 bits (27), Expect = 6e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 513 gccggcctcgatgtacttctttgcgttgtcccatgcaccaccggtgttgga 563 ||||| ||||||||||||||| ||||||||||| || || |||| |||||| Sbjct: 1035780 gccggactcgatgtacttcttggcgttgtcccaggcgcccccggcgttgga 1035730
>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome Length = 4501104 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 518 cctcgatgtacttctttgcgttgtcccatgcaccaccg 555 |||||||||||||||| ||||| ||||| ||||||||| Sbjct: 3454275 cctcgatgtacttcttggcgttatcccacgcaccaccg 3454312 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 343 gtggcgaagaagggcgcgaa 362 |||||||||||||||||||| Sbjct: 447622 gtggcgaagaagggcgcgaa 447603
>gb|CP000252.1| Syntrophus aciditrophicus SB, complete genome Length = 3179300 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 519 ctcgatgtacttctttgcgttgtcccatgcaccaccgg 556 ||||||||| ||||| ||||||||||| |||||||||| Sbjct: 1966493 ctcgatgtatttcttcgcgttgtcccacgcaccaccgg 1966456 Score = 44.1 bits (22), Expect = 0.55 Identities = 34/38 (89%) Strand = Plus / Minus Query: 415 gaggtgtccttgagggggtctccgatggtgtcaccgat 452 ||||| ||||||| |||||| |||| |||||||||||| Sbjct: 1966579 gaggtatccttgaaggggtcgccgacggtgtcaccgat 1966542
>emb|AJ245400.1|LMA245400 Leishmania major partial ppa gene for proton-translocating inorganic pyrophosphatase Length = 551 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 535 gcgttgtcccatgcaccaccggtgttggaagcagagatggcgatctgcac 584 |||||||||||||| || ||||||||||| || ||||| || |||||||| Sbjct: 551 gcgttgtcccatgcgccgccggtgttggaggccgagatagccatctgcac 502
>gb|BT014617.1| Lycopersicon esculentum clone 134104R, mRNA sequence Length = 2633 Score = 50.1 bits (25), Expect = 0.009 Identities = 46/53 (86%) Strand = Plus / Minus Query: 517 gcctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcaga 569 ||||| || |||||||| ||||||||||||||||| || ||||| || ||||| Sbjct: 2194 gcctcaatatacttcttggcgttgtcccatgcacctccagtgtttgatgcaga 2142
>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome Length = 4892717 Score = 50.1 bits (25), Expect = 0.009 Identities = 31/33 (93%) Strand = Plus / Minus Query: 513 gccggcctcgatgtacttctttgcgttgtccca 545 |||| |||||||||||||||| ||||||||||| Sbjct: 2992674 gccgtcctcgatgtacttcttggcgttgtccca 2992642
>emb|BX572601.1| Rhodopseudomonas palustris CGA009 complete genome; segment 9/16 Length = 348580 Score = 50.1 bits (25), Expect = 0.009 Identities = 31/33 (93%) Strand = Plus / Minus Query: 513 gccggcctcgatgtacttctttgcgttgtccca 545 |||| |||||||||||||||| ||||||||||| Sbjct: 310645 gccgtcctcgatgtacttcttggcgttgtccca 310613 Score = 40.1 bits (20), Expect = 8.6 Identities = 44/52 (84%) Strand = Plus / Minus Query: 417 ggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtgg 468 |||||||||| ||| || |||| |||||| ||| |||| |||||||||||| Sbjct: 310723 ggtgtccttgtagggatcgccgacggtgtcgccggtcaccgcggccttgtgg 310672
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 50.1 bits (25), Expect = 0.009 Identities = 31/33 (93%) Strand = Plus / Minus Query: 513 gccggcctcgatgtacttctttgcgttgtccca 545 |||| |||||||||||||||| ||||||||||| Sbjct: 3022803 gccgtcctcgatgtacttcttggcgttgtccca 3022771 Score = 46.1 bits (23), Expect = 0.14 Identities = 44/51 (86%) Strand = Plus / Minus Query: 418 gtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtgg 468 ||||||||| |||||| |||| |||||| ||| |||| |||||||||||| Sbjct: 3022880 gtgtccttgtaggggtcgccgacggtgtcgccggtcaccgcggccttgtgg 3022830
>emb|AJ278020.1|LPI278020 Lycopersicon pimpinellifolium partial mRNA for putative vacuolar-type H+-pyrophosphatase (vp1 gene) Length = 420 Score = 50.1 bits (25), Expect = 0.009 Identities = 76/93 (81%) Strand = Plus / Minus Query: 534 tgcgttgtcccatgcaccaccggtgttggaagcagagatggcgatctgcactccagaaac 593 |||||||||||| || || || |||||||| ||||| ||||| ||||| || ||||| || Sbjct: 420 tgcgttgtcccaggcgccgccagtgttggatgcagaaatggcaatctgtacaccagagac 361 Query: 594 gagggcaccagccagaacaccagacagggtttc 626 ||| | || || ||||||||||| || ||||| Sbjct: 360 gagagatcctgcaagaacaccagaaagtgtttc 328
>dbj|AK110444.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-166-D10, full insert sequence Length = 2786 Score = 50.1 bits (25), Expect = 0.009 Identities = 52/61 (85%) Strand = Plus / Minus Query: 379 gccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctccg 438 ||||| |||||||| |||||||| |||| ||||| || ||||||||||| ||||| ||| Sbjct: 2504 gccatcagcttgatcaggatgttcagcgcggggccggacgtgtccttgagcgggtcgccg 2445 Query: 439 a 439 | Sbjct: 2444 a 2444 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Minus Query: 519 ctcgatgtacttctttgcgttgtccca 545 ||||||||||||||| ||||||||||| Sbjct: 2373 ctcgatgtacttcttcgcgttgtccca 2347
>gb|U74631.1|RCU74631 Ricinus communis calreticulin gene, complete cds Length = 4975 Score = 50.1 bits (25), Expect = 0.009 Identities = 100/125 (80%) Strand = Plus / Minus Query: 322 ttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggcc 381 ||||||||||||||||||| | || ||||| || || ||||| | ||||| || ||| Sbjct: 183 ttgaacagcagacctccgtgagcagcaaagaatggagcaaacaccaatgactcgactgcc 124 Query: 382 atgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctccgatg 441 ||||||||||| ||||| || || || || || || |||||||| || ||||| ||||| Sbjct: 123 atgagcttgatcaggatattaagtgatggacccgaagtgtccttaagagggtcgccgatt 64 Query: 442 gtgtc 446 ||||| Sbjct: 63 gtgtc 59
>emb|AJ249333.1|ESC249333 Endotrypanum schaudinni partial ppa gene for putative proton-translocating inorganic pyrophosphatase Length = 552 Score = 50.1 bits (25), Expect = 0.009 Identities = 49/57 (85%) Strand = Plus / Minus Query: 534 tgcgttgtcccatgcaccaccggtgttggaagcagagatggcgatctgcactccaga 590 |||||||||||| || || || |||||||| ||||| ||||| |||||||| ||||| Sbjct: 552 tgcgttgtcccaggcgccgccagtgttggaggcagaaatggccatctgcacgccaga 496
>gb|AC151744.23| Medicago truncatula clone mth2-32k10, complete sequence Length = 110897 Score = 48.1 bits (24), Expect = 0.035 Identities = 54/64 (84%) Strand = Plus / Minus Query: 518 cctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggcga 577 |||| ||||||||||| || || ||||| ||||| || |||||||| |||||||| || | Sbjct: 43179 cctcaatgtacttcttggcattatcccaagcaccgccagtgttggatgcagagatagcaa 43120 Query: 578 tctg 581 |||| Sbjct: 43119 tctg 43116 Score = 40.1 bits (20), Expect = 8.6 Identities = 104/132 (78%) Strand = Plus / Minus Query: 361 aacacgagggactcaacggccatgagcttgatgaggatgttgagcgacgggcctgaggtg 420 ||||| || ||||| || ||||| |||||||| || ||||| || || || || || ||| Sbjct: 43486 aacaccagagactccactgccatcagcttgataagaatgttaagggatggaccagatgtg 43427 Query: 421 tccttgagggggtctccgatggtgtcaccgatcacggcggccttgtggcagtctgaaccc 480 ||||| | ||||| || ||||||||||| || || || |||||||| |||||| || Sbjct: 43426 tccttcaatgggtccccaatggtgtcaccaataactgctgccttgtgtgggtctgaccct 43367 Query: 481 ttgggaccaagg 492 || ||||||||| Sbjct: 43366 tttggaccaagg 43355
>gb|AE012448.1| Xanthomonas campestris pv. campestris str. ATCC 33913, section 356 of 460 of the complete genome Length = 13170 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Minus Query: 520 tcgatgtacttctttgcgttgtcccatgcacc 551 |||||||||||||| ||||||||||| ||||| Sbjct: 5589 tcgatgtacttcttggcgttgtcccaggcacc 5558
>gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, complete genome Length = 3561584 Score = 48.1 bits (24), Expect = 0.035 Identities = 33/36 (91%) Strand = Plus / Plus Query: 510 gttgccggcctcgatgtacttctttgcgttgtccca 545 ||||||| |||||||||||||||| || |||||||| Sbjct: 1110420 gttgccgtcctcgatgtacttcttggcattgtccca 1110455
>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome Length = 5148708 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Plus Query: 520 tcgatgtacttctttgcgttgtcccatgcacc 551 |||||||||||||| ||||||||||| ||||| Sbjct: 1032264 tcgatgtacttcttggcgttgtcccaggcacc 1032295
>gb|AE010299.1| Methanosarcina acetivorans str. C2A, complete genome Length = 5751492 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Plus Query: 520 tcgatgtacttctttgcgttgtcccatgcacc 551 |||||||| ||||||||||||||||| ||||| Sbjct: 4765995 tcgatgtatttctttgcgttgtcccacgcacc 4766026
>gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete genome Length = 2909809 Score = 48.1 bits (24), Expect = 0.035 Identities = 27/28 (96%) Strand = Plus / Plus Query: 518 cctcgatgtacttctttgcgttgtccca 545 |||||||||||||||| ||||||||||| Sbjct: 1589969 cctcgatgtacttcttggcgttgtccca 1589996
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome Length = 9105828 Score = 48.1 bits (24), Expect = 0.035 Identities = 27/28 (96%) Strand = Plus / Plus Query: 518 cctcgatgtacttctttgcgttgtccca 545 |||||||||||||||| ||||||||||| Sbjct: 5571967 cctcgatgtacttcttggcgttgtccca 5571994
>gb|AC004695.1|AC004695 Homo sapiens BAC clone CTA-317H1 from 3p13-3p14.2, complete sequence Length = 149572 Score = 48.1 bits (24), Expect = 0.035 Identities = 24/24 (100%) Strand = Plus / Plus Query: 239 gaaggcgggcgggcaggcaggcgg 262 |||||||||||||||||||||||| Sbjct: 102371 gaaggcgggcgggcaggcaggcgg 102394
>gb|AC163640.5| Mus musculus BAC clone RP24-182L3 from chromosome 16, complete sequence Length = 168350 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 241 aggcgggcgggcaggcaggcggg 263 ||||||||||||||||||||||| Sbjct: 151434 aggcgggcgggcaggcaggcggg 151412
>gb|AC160961.3| Mus musculus BAC clone RP24-288N19 from chromosome 16, complete sequence Length = 157144 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 241 aggcgggcgggcaggcaggcggg 263 ||||||||||||||||||||||| Sbjct: 4912 aggcgggcgggcaggcaggcggg 4890
>gb|AC122873.5| Mus musculus BAC clone RP23-110K10 from 8, complete sequence Length = 199474 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Plus Query: 241 aggcgggcgggcaggcaggcggg 263 ||||||||||||||||||||||| Sbjct: 91354 aggcgggcgggcaggcaggcggg 91376
>gb|CP000316.1| Polaromonas sp. JS666, complete genome Length = 5200264 Score = 46.1 bits (23), Expect = 0.14 Identities = 44/51 (86%) Strand = Plus / Plus Query: 417 ggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtg 467 |||||||||| |||||| || | |||||| ||| |||||||||||||||| Sbjct: 2393256 ggtgtccttgtaggggtcgcccacggtgtcgccggtcacggcggccttgtg 2393306
>emb|BX842650.1| Bdellovibrio bacteriovorus complete genome, strain HD100; segment 5/11 Length = 349723 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 520 tcgatgtacttctttgcgttgtcccatgcaccacc 554 |||||||| ||||| ||||| |||||||||||||| Sbjct: 261252 tcgatgtatttcttagcgttatcccatgcaccacc 261218
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome Length = 4751080 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Plus Query: 345 ggcgaagaagggcgcgaacacga 367 ||||||||||||||||||||||| Sbjct: 972774 ggcgaagaagggcgcgaacacga 972796
>emb|CR956397.19| Pig DNA sequence from clone CH242-259E5 on chromosome 17, complete sequence Length = 177531 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Plus Query: 241 aggcgggcgggcaggcaggcggg 263 ||||||||||||||||||||||| Sbjct: 41128 aggcgggcgggcaggcaggcggg 41150
>gb|AC127258.4| Mus musculus BAC clone RP24-302G16 from 8, complete sequence Length = 163028 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 241 aggcgggcgggcaggcaggcggg 263 ||||||||||||||||||||||| Sbjct: 1135 aggcgggcgggcaggcaggcggg 1113
>emb|AJ249299.1|HMU249299 Herpetomonas muscarum partial ppa gene for proton-translocating inorganic pyrophosphatase Length = 552 Score = 46.1 bits (23), Expect = 0.14 Identities = 44/51 (86%) Strand = Plus / Minus Query: 534 tgcgttgtcccatgcaccaccggtgttggaagcagagatggcgatctgcac 584 |||||||||||| || || |||||||| || || |||||||| |||||||| Sbjct: 552 tgcgttgtcccaggcgccgccggtgttcgaggccgagatggccatctgcac 502
>emb|AJ251218.1|LCT251218 Leptomonas ctenocephali partial vppa gene for putative proton-translocating inorganic pyrophosphatase Length = 552 Score = 46.1 bits (23), Expect = 0.14 Identities = 44/51 (86%) Strand = Plus / Minus Query: 534 tgcgttgtcccatgcaccaccggtgttggaagcagagatggcgatctgcac 584 |||||||||||| || || || ||||||||||| || ||||| |||||||| Sbjct: 552 tgcgttgtcccaggcgccgcctgtgttggaagcggaaatggccatctgcac 502
>ref|NM_001033812.1| Mus musculus RIKEN cDNA F830208F22 gene (F830208F22Rik), mRNA Length = 2892 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 243 gcgggcgggcaggcaggcgggg 264 |||||||||||||||||||||| Sbjct: 1663 gcgggcgggcaggcaggcgggg 1642
>gb|AF109905.1|MMHC213L3 Mus musculus major histocompatibility locus class III regions Hsc70t gene, partial cds; smRNP, G7A, NG23, MutS homolog, CLCP, NG24, NG25, and NG26 genes, complete cds; and unknown genes Length = 135545 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 242 ggcgggcgggcaggcaggcggg 263 |||||||||||||||||||||| Sbjct: 122842 ggcgggcgggcaggcaggcggg 122821
>gb|AC162291.13| Mus musculus chromosome 18, clone RP23-264B14, complete sequence Length = 198736 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 243 gcgggcgggcaggcaggcgggg 264 |||||||||||||||||||||| Sbjct: 77888 gcgggcgggcaggcaggcgggg 77867
>gb|BC056354.1| Mus musculus LUC7-like 2 (S. cerevisiae), mRNA (cDNA clone MGC:73491 IMAGE:6811460), complete cds Length = 2691 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 244 cgggcgggcaggcaggcggggg 265 |||||||||||||||||||||| Sbjct: 377 cgggcgggcaggcaggcggggg 356
>gb|BC056383.1| Mus musculus LUC7-like 2 (S. cerevisiae), mRNA (cDNA clone MGC:73932 IMAGE:6853955), complete cds Length = 4252 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 244 cgggcgggcaggcaggcggggg 265 |||||||||||||||||||||| Sbjct: 358 cgggcgggcaggcaggcggggg 337
>gb|AC132099.3| Mus musculus BAC clone RP24-292F6 from chromosome 16, complete sequence Length = 160650 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 242 ggcgggcgggcaggcaggcggg 263 |||||||||||||||||||||| Sbjct: 7840 ggcgggcgggcaggcaggcggg 7819
>gb|AC083805.17| Homo sapiens 12 BAC RP11-620J15 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 104816 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Minus Query: 242 ggcgggcgggcaggcaggcgggggag 267 ||||||||||||||| |||||||||| Sbjct: 85751 ggcgggcgggcaggctggcgggggag 85726
>gb|BC056970.1| Mus musculus LUC7-like 2 (S. cerevisiae), mRNA (cDNA clone MGC:66790 IMAGE:6811460), complete cds Length = 2691 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 244 cgggcgggcaggcaggcggggg 265 |||||||||||||||||||||| Sbjct: 377 cgggcgggcaggcaggcggggg 356
>gb|AC087117.9| Mus Musculus Strain C57BL6/J chromosome 17 BAC, RP23-349B4, Complete Sequence, complete sequence Length = 221899 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 242 ggcgggcgggcaggcaggcggg 263 |||||||||||||||||||||| Sbjct: 208704 ggcgggcgggcaggcaggcggg 208683
>gb|AC114487.2| Homo sapiens chromosome 1 clone RP4-706L14, complete sequence Length = 160957 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Plus Query: 239 gaaggcgggcgggcaggcaggc 260 |||||||||||||||||||||| Sbjct: 135833 gaaggcgggcgggcaggcaggc 135854
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome Length = 5513844 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Minus Query: 520 tcgatgtacttctttgcgttgtccca 545 |||||||||||||| ||||||||||| Sbjct: 2901773 tcgatgtacttcttggcgttgtccca 2901748 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Minus Query: 520 tcgatgtacttctttgcgttgtccca 545 |||||||||||||| ||||||||||| Sbjct: 2896307 tcgatgtacttcttggcgttgtccca 2896282
>gb|AE005811.1| Caulobacter crescentus CB15 section 137 of 359 of the complete genome Length = 10363 Score = 44.1 bits (22), Expect = 0.55 Identities = 46/54 (85%) Strand = Plus / Minus Query: 415 gaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtgg 468 |||||||||||| |||||| |||| |||||| ||| | ||||| ||||||||| Sbjct: 8796 gaggtgtccttgtaggggtcgccgacggtgtcgccggtgacggccgccttgtgg 8743
>dbj|AK134191.1| Mus musculus adult male thymus cDNA, RIKEN full-length enriched library, clone:5830469J19 product:LUC7-like 2 (S. cerevisiae), full insert sequence Length = 2071 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 244 cgggcgggcaggcaggcggggg 265 |||||||||||||||||||||| Sbjct: 293 cgggcgggcaggcaggcggggg 272
>dbj|AK147889.1| Mus musculus melanocyte cDNA, RIKEN full-length enriched library, clone:G270081I19 product:LUC7-like 2 (S. cerevisiae), full insert sequence Length = 2861 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 244 cgggcgggcaggcaggcggggg 265 |||||||||||||||||||||| Sbjct: 310 cgggcgggcaggcaggcggggg 289
>dbj|AK156688.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched library, clone:F830037L18 product:unclassifiable, full insert sequence Length = 2892 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 243 gcgggcgggcaggcaggcgggg 264 |||||||||||||||||||||| Sbjct: 1663 gcgggcgggcaggcaggcgggg 1642
>dbj|AK155264.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630212I17 product:LUC7-like 2 (S. cerevisiae), full insert sequence Length = 3394 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 244 cgggcgggcaggcaggcggggg 265 |||||||||||||||||||||| Sbjct: 369 cgggcgggcaggcaggcggggg 348
>dbj|AK163879.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length enriched library, clone:C230006F22 product:unclassifiable, full insert sequence Length = 2357 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 243 gcgggcgggcaggcaggcgggg 264 |||||||||||||||||||||| Sbjct: 1128 gcgggcgggcaggcaggcgggg 1107
>dbj|AK166155.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-length enriched library, clone:G730048C18 product:LUC7-like 2 (S. cerevisiae), full insert sequence Length = 3491 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 244 cgggcgggcaggcaggcggggg 265 |||||||||||||||||||||| Sbjct: 335 cgggcgggcaggcaggcggggg 314
>gb|AC161147.6| Mus musculus BAC clone RP23-357G12 from chromosome 6, complete sequence Length = 225957 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Plus Query: 244 cgggcgggcaggcaggcggggg 265 |||||||||||||||||||||| Sbjct: 204291 cgggcgggcaggcaggcggggg 204312
>dbj|AK172459.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched library, clone:F830208F22 product:hypothetical protein, full insert sequence Length = 2892 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 243 gcgggcgggcaggcaggcgggg 264 |||||||||||||||||||||| Sbjct: 1663 gcgggcgggcaggcaggcgggg 1642
>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome Length = 4352825 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Plus Query: 520 tcgatgtacttctttgcgttgtccca 545 |||||||||||||| ||||||||||| Sbjct: 2117089 tcgatgtacttcttggcgttgtccca 2117114
>dbj|AK046307.1| Mus musculus adult male corpora quadrigemina cDNA, RIKEN full-length enriched library, clone:B230368A09 product:similar to CDNA FLJ10657 FIS, CLONE NT2RP2006043, WEAKLY SIMILAR TO SPLICING FACTOR, ARGININE/SERINE-RICH 4 [Homo sapiens], full insert sequence Length = 3145 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 244 cgggcgggcaggcaggcggggg 265 |||||||||||||||||||||| Sbjct: 490 cgggcgggcaggcaggcggggg 469
>dbj|AK038543.1| Mus musculus adult male hypothalamus cDNA, RIKEN full-length enriched library, clone:A230031O05 product:RIKEN cDNA 4930471C18 gene, full insert sequence Length = 2299 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 244 cgggcgggcaggcaggcggggg 265 |||||||||||||||||||||| Sbjct: 293 cgggcgggcaggcaggcggggg 272
>dbj|AK044839.1| Mus musculus 9.5 days embryo parthenogenote cDNA, RIKEN full-length enriched library, clone:B130007I01 product:unclassifiable, full insert sequence Length = 2934 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 244 cgggcgggcaggcaggcggggg 265 |||||||||||||||||||||| Sbjct: 380 cgggcgggcaggcaggcggggg 359
>dbj|AK048581.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched library, clone:C130080B05 product:unclassifiable, full insert sequence Length = 2815 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 244 cgggcgggcaggcaggcggggg 265 |||||||||||||||||||||| Sbjct: 293 cgggcgggcaggcaggcggggg 272
>dbj|AK053863.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched library, clone:E130315L24 product:unclassifiable, full insert sequence Length = 2816 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 244 cgggcgggcaggcaggcggggg 265 |||||||||||||||||||||| Sbjct: 293 cgggcgggcaggcaggcggggg 272
>gb|AF377340.1| Myxococcus xanthus AraC (araC) and serine/threonine kinase associate protein KapC (kapC) genes, complete cds; and unknown genes Length = 7622 Score = 44.1 bits (22), Expect = 0.55 Identities = 46/54 (85%) Strand = Plus / Plus Query: 415 gaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtgg 468 ||||||||||||| ||||| |||| ||||||||| ||||||||||||||| Sbjct: 6872 gaggtgtccttgaacgggtcaccgaccatgtcaccgacgacggcggccttgtgg 6925
>gb|AC073916.41| Homo sapiens 12 BAC RP11-408I18 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 205283 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Plus Query: 242 ggcgggcgggcaggcaggcgggggag 267 ||||||||||||||| |||||||||| Sbjct: 104610 ggcgggcgggcaggcgggcgggggag 104635
>gb|AF318301.1|AF318301 Mus musculus CGI-74-like SR-rich protein mRNA, complete cds Length = 2622 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 244 cgggcgggcaggcaggcggggg 265 |||||||||||||||||||||| Sbjct: 304 cgggcgggcaggcaggcggggg 283
>gb|AF044912.1|AF044912 Rhodospirillum rubrum H+ translocating pyrophosphate synthase (RrPP) mRNA, complete cds Length = 2381 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Minus Query: 520 tcgatgtacttctttgcgttgtccca 545 |||||||||||||| ||||||||||| Sbjct: 2084 tcgatgtacttcttggcgttgtccca 2059
>gb|AC124762.4| Mus musculus BAC clone RP23-155A10 from 6, complete sequence Length = 199207 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Plus Query: 244 cgggcgggcaggcaggcggggg 265 |||||||||||||||||||||| Sbjct: 23344 cgggcgggcaggcaggcggggg 23365
>emb|CR974444.18| Mouse DNA sequence from clone RP23-115O3 on chromosome 17, complete sequence Length = 190041 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 242 ggcgggcgggcaggcaggcggg 263 |||||||||||||||||||||| Sbjct: 36082 ggcgggcgggcaggcaggcggg 36061
>gb|U68299.1|MCU68299 Mouse cytomegalovirus 1 complete genomic sequence Length = 230278 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Plus Query: 242 ggcgggcgggcaggcaggcggg 263 |||||||||||||||||||||| Sbjct: 23591 ggcgggcgggcaggcaggcggg 23612
>gb|AC139573.4| Mus musculus BAC clone RP23-472H13 from 16, complete sequence Length = 189632 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Plus Query: 242 ggcgggcgggcaggcaggcggg 263 |||||||||||||||||||||| Sbjct: 10235 ggcgggcgggcaggcaggcggg 10256
>gb|AC134329.3| Mus musculus BAC clone RP24-310D17 from 10, complete sequence Length = 159173 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Plus Query: 242 ggcgggcgggcaggcaggcgggggag 267 ||||||||||||||| |||||||||| Sbjct: 106316 ggcgggcgggcaggctggcgggggag 106341
>ref|NM_138680.1| Mus musculus LUC7-like 2 (S. cerevisiae) (Luc7l2), mRNA Length = 2622 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 244 cgggcgggcaggcaggcggggg 265 |||||||||||||||||||||| Sbjct: 304 cgggcgggcaggcaggcggggg 283
>emb|AL732613.10| Mouse DNA sequence from clone RP23-193A21 on chromosome 4, complete sequence Length = 204012 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 242 ggcgggcgggcaggcaggcggg 263 |||||||||||||||||||||| Sbjct: 162541 ggcgggcgggcaggcaggcggg 162520
>gb|CP000148.1| Geobacter metallireducens GS-15, complete genome Length = 3997420 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Plus Query: 513 gccggcctcgatgtacttctttgcgttgtccca 545 |||| |||||||||||||||| ||||| ||||| Sbjct: 3644658 gccgtcctcgatgtacttcttggcgttatccca 3644690
>gb|BT017471.1| Zea mays clone EL01N0408D01.c mRNA sequence Length = 1159 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 243 gcgggcgggcaggcaggcggg 263 ||||||||||||||||||||| Sbjct: 875 gcgggcgggcaggcaggcggg 855
>gb|AY773965.1| Homo sapiens glutamate-cysteine ligase, modifier subunit (GCLM) gene, complete cds Length = 24112 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 242 ggcgggcgggcaggcaggcgg 262 ||||||||||||||||||||| Sbjct: 2179 ggcgggcgggcaggcaggcgg 2159
>gb|AY382196.1| Homo sapiens glutamate-cysteine ligase modifier subunit gene, promoter region and partial cds Length = 3319 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 242 ggcgggcgggcaggcaggcgg 262 ||||||||||||||||||||| Sbjct: 3221 ggcgggcgggcaggcaggcgg 3201
>gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome Length = 3814139 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Plus Query: 513 gccggcctcgatgtacttctttgcgttgtccca 545 |||| ||||||||||||| || ||||||||||| Sbjct: 3609503 gccgtcctcgatgtactttttggcgttgtccca 3609535
>gb|AC149221.2| Mus musculus BAC clone RP23-402P22 from chromosome 7, complete sequence Length = 202580 Score = 42.1 bits (21), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 gggttnaacattatcgtcgtcatc 35 ||||| |||||||||||||||||| Sbjct: 32677 gggttgaacattatcgtcgtcatc 32700
>ref|NM_002061.2| Homo sapiens glutamate-cysteine ligase, modifier subunit (GCLM), mRNA Length = 3074 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 242 ggcgggcgggcaggcaggcgg 262 ||||||||||||||||||||| Sbjct: 253 ggcgggcgggcaggcaggcgg 233
>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome Length = 3402093 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Plus Query: 513 gccggcctcgatgtacttctttgcgttgtccca 545 |||| |||||||||||||||| ||||| ||||| Sbjct: 1915065 gccgtcctcgatgtacttcttggcgttatccca 1915097
>gb|AY480047.1| Homo sapiens plectin 6 mRNA, complete cds Length = 15249 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 241 aggcgggcgggcaggcaggcggggg 265 |||||||||||||||||||| |||| Sbjct: 49 aggcgggcgggcaggcaggctgggg 25
>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome Length = 5178466 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 513 gccggcctcgatgtacttctttgcgttgtccca 545 |||| |||||||||| ||||| ||||||||||| Sbjct: 4088683 gccgtcctcgatgtatttcttggcgttgtccca 4088651
>gb|AC134603.4| Mus musculus BAC clone RP23-246L24 from chromosome 7, complete sequence Length = 229312 Score = 42.1 bits (21), Expect = 2.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 gggttnaacattatcgtcgtcatc 35 ||||| |||||||||||||||||| Sbjct: 196392 gggttgaacattatcgtcgtcatc 196415
>ref|NM_201380.2| Homo sapiens plectin 1, intermediate filament binding protein 500kDa (PLEC1), transcript variant 6, mRNA Length = 15249 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 241 aggcgggcgggcaggcaggcggggg 265 |||||||||||||||||||| |||| Sbjct: 49 aggcgggcgggcaggcaggctgggg 25
>emb|AL117351.12|HSJ837O21 Human DNA sequence from clone RP5-837O21 on chromosome 1p22 Contains the 5' end of the GCLM gene for glutamate-cysteine ligase modifier subunit, a pseudogene similar to part of NADH dehydrogenase 4 (MTND4), a NADH dehydrogenase 3 (MTND3) pseudogene, a cytochrome c oxidase III (MTCO3) pseudogene, a ATP synthase 6 (MTATP6) pseudogene, a cytochrome c oxidase II (MTCO2) pseudogene, a pseudogene similar to part of cytochrome c oxidase I (MTCO1), a pseudogene similar to part of NADH dehydrogenase 2 (MTND2), a coiled-coil-helix-coiled-coil-helix domain containing 2 (CHCHD2) pseudogene and a CpG island, complete sequence Length = 93800 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 242 ggcgggcgggcaggcaggcgg 262 ||||||||||||||||||||| Sbjct: 74262 ggcgggcgggcaggcaggcgg 74242
>gb|BC041809.1| Homo sapiens glutamate-cysteine ligase, modifier subunit, mRNA (cDNA clone MGC:41886 IMAGE:5311598), complete cds Length = 1613 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 242 ggcgggcgggcaggcaggcgg 262 ||||||||||||||||||||| Sbjct: 196 ggcgggcgggcaggcaggcgg 176
>gb|AC109322.16| Homo sapiens chromosome 8, clone CTD-3065J16, complete sequence Length = 215342 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 241 aggcgggcgggcaggcaggcggggg 265 |||||||||||||||||||| |||| Sbjct: 121067 aggcgggcgggcaggcaggctgggg 121043
>emb|BX957342.5| Zebrafish DNA sequence from clone CH211-120P12 in linkage group 13, complete sequence Length = 182888 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 84 tggtctctctcttctactaca 104 ||||||||||||||||||||| Sbjct: 109831 tggtctctctcttctactaca 109851
>gb|AE011990.1| Xanthomonas axonopodis pv. citri str. 306, section 368 of 469 of the complete genome Length = 12292 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 513 gccggcctcgatgtacttctttgcgttgtccca 545 |||| |||||||||| ||||| ||||||||||| Sbjct: 5096 gccgtcctcgatgtatttcttggcgttgtccca 5064
>gb|CP000232.1| Moorella thermoacetica ATCC 39073, complete genome Length = 2628784 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Plus Query: 519 ctcgatgtacttctttgcgttgtcccatgcacc 551 |||||| |||||||| ||||||||||| ||||| Sbjct: 419608 ctcgatatacttcttggcgttgtcccaggcacc 419640
>emb|BX247887.6| Zebrafish DNA sequence from clone CH211-142L10, complete sequence Length = 143903 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 243 gcgggcgggcaggcaggcggg 263 ||||||||||||||||||||| Sbjct: 54645 gcgggcgggcaggcaggcggg 54625
>gb|AF320282.1| Toxoplasma gondii H+-translocating inorganic pyrophosphatase TVP1 (TVP1) gene, complete cds Length = 6965 Score = 42.1 bits (21), Expect = 2.2 Identities = 45/53 (84%) Strand = Plus / Minus Query: 523 atgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggc 575 ||||||||||| ||||||||||| |||| || | | |||| ||||||||||| Sbjct: 5477 atgtacttcttggcgttgtcccaagcactgcctgaggtggacgcagagatggc 5425
>gb|AF320281.1| Toxoplasma gondii H+-translocating inorganic pyrophosphatase TVP1 (TVP1) mRNA, complete cds Length = 2451 Score = 42.1 bits (21), Expect = 2.2 Identities = 45/53 (84%) Strand = Plus / Minus Query: 523 atgtacttctttgcgttgtcccatgcaccaccggtgttggaagcagagatggc 575 ||||||||||| ||||||||||| |||| || | | |||| ||||||||||| Sbjct: 2231 atgtacttcttggcgttgtcccaagcactgcctgaggtggacgcagagatggc 2179
>gb|U72210.1|HSU72210 Human gamma-glutamylcysteine synthetase light subunit gene, 5'flanking sequence and partial cds Length = 3314 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 242 ggcgggcgggcaggcaggcgg 262 ||||||||||||||||||||| Sbjct: 3217 ggcgggcgggcaggcaggcgg 3197
>gb|AF028815.1|AF028815 Homo sapiens gamma-glutamylcysteine synthetase regulatory subunit (GLCLR) gene, 5' flanking region Length = 1930 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 242 ggcgggcgggcaggcaggcgg 262 ||||||||||||||||||||| Sbjct: 1887 ggcgggcgggcaggcaggcgg 1867
>gb|U36439.1|RHU36439 Rubus hispidus H+-pyrophosphatase mRNA, partial cds Length = 479 Score = 42.1 bits (21), Expect = 2.2 Identities = 46/53 (86%), Gaps = 1/53 (1%) Strand = Plus / Minus Query: 517 gcctcgatgtacttctttgcgttgtcccatgcaccaccggtgttggaagcaga 569 ||||| ||||||||||| || |||| ||||||||| || |||||||| ||||| Sbjct: 393 gcctcaatgtacttcttggcattgt-ccatgcaccgccagtgttggaggcaga 342 Score = 40.1 bits (20), Expect = 8.6 Identities = 26/28 (92%) Strand = Plus / Minus Query: 602 cagccagaacaccagacagggtttccac 629 |||||||||||||||| ||||| ||||| Sbjct: 314 cagccagaacaccagagagggtctccac 287
>gb|L35546.1|HUMGCSL Homo sapiens gamma-glutamylcysteine synthetase light subunit mRNA, complete cds Length = 1610 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 242 ggcgggcgggcaggcaggcgg 262 ||||||||||||||||||||| Sbjct: 214 ggcgggcgggcaggcaggcgg 194
>gb|AC160538.8| Mus musculus chromosome 15, clone RP24-156D3, complete sequence Length = 158943 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 201 acattgacaaccaaaaataa 220 |||||||||||||||||||| Sbjct: 66522 acattgacaaccaaaaataa 66503
>gb|AC114649.9| Mus musculus chromosome 5, clone RP24-150M14, complete sequence Length = 154765 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 87 tctctctcttctactacatg 106 |||||||||||||||||||| Sbjct: 137646 tctctctcttctactacatg 137627
>gb|AC146132.3| Pan troglodytes BAC clone RP43-23H13 from 7, complete sequence Length = 164355 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 150 ttcaagaggccaggggaaag 169 |||||||||||||||||||| Sbjct: 84354 ttcaagaggccaggggaaag 84335
>ref|XM_001000399.1| PREDICTED: Mus musculus similar to Protein C1orf77 homolog (LOC622845), mRNA Length = 2049 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 241 aggcgggcgggcaggcaggc 260 |||||||||||||||||||| Sbjct: 1259 aggcgggcgggcaggcaggc 1240
>ref|XM_908936.2| PREDICTED: Mus musculus similar to Protein C1orf77 homolog (LOC634257), mRNA Length = 2053 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 241 aggcgggcgggcaggcaggc 260 |||||||||||||||||||| Sbjct: 1263 aggcgggcgggcaggcaggc 1244
>ref|XM_890379.2| PREDICTED: Mus musculus similar to Protein C1orf77 homolog, transcript variant 1 (LOC622845), mRNA Length = 2049 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 241 aggcgggcgggcaggcaggc 260 |||||||||||||||||||| Sbjct: 1259 aggcgggcgggcaggcaggc 1240
>gb|AC144822.2| Danio rerio clone CH211-13O4, complete sequence Length = 164460 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 579 ctgcactccagaaacgaggg 598 |||||||||||||||||||| Sbjct: 116658 ctgcactccagaaacgaggg 116639
>gb|AC115800.13| Mus musculus chromosome 8, clone RP23-407E22, complete sequence Length = 228513 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 241 aggcgggcgggcaggcaggc 260 |||||||||||||||||||| Sbjct: 31686 aggcgggcgggcaggcaggc 31667
>gb|AC105947.11| Mus musculus chromosome 18, clone RP24-66N1, complete sequence Length = 207139 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 88 ctctctcttctactacatgg 107 |||||||||||||||||||| Sbjct: 166627 ctctctcttctactacatgg 166608
>gb|AC132255.3| Mus musculus BAC clone RP24-472I15 from chromosome 5, complete sequence Length = 168528 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 241 aggcgggcgggcaggcaggc 260 |||||||||||||||||||| Sbjct: 23756 aggcgggcgggcaggcaggc 23775
>gb|AC140316.3| Mus musculus BAC clone RP23-419L10 from chromosome 18, complete sequence Length = 195911 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 88 ctctctcttctactacatgg 107 |||||||||||||||||||| Sbjct: 178571 ctctctcttctactacatgg 178590
>gb|BC020058.1| Mus musculus LUC7-like 2 (S. cerevisiae), mRNA (cDNA clone IMAGE:4009362), containing frame-shift errors Length = 2411 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 244 cgggcgggcaggcaggcggg 263 |||||||||||||||||||| Sbjct: 20 cgggcgggcaggcaggcggg 1
>ref|XM_808881.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053506661.50) partial mRNA Length = 2991 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 tcatgggacgaggaaaattt 53 |||||||||||||||||||| Sbjct: 1392 tcatgggacgaggaaaattt 1411
>gb|AC072039.19| Homo sapiens 3 BAC RP11-305O4 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 154964 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 82 tctggtctctctcttctact 101 |||||||||||||||||||| Sbjct: 108378 tctggtctctctcttctact 108359
>ref|XM_812966.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053511245.110) partial mRNA Length = 2988 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 tcatgggacgaggaaaattt 53 |||||||||||||||||||| Sbjct: 1392 tcatgggacgaggaaaattt 1411
>gb|AC084054.12| Mus Musculus Strain C57BL6/J chromosome 5 BAC, RP23-137N6, complete sequence Length = 231589 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 242 ggcgggcgggcaggcaggcg 261 |||||||||||||||||||| Sbjct: 146 ggcgggcgggcaggcaggcg 127
>gb|AC124464.3| Mus musculus BAC clone RP24-155I15 from chromosome 19, complete sequence Length = 188587 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 241 aggcgggcgggcaggcaggc 260 |||||||||||||||||||| Sbjct: 2722 aggcgggcgggcaggcaggc 2741
>gb|AC126266.3| Mus musculus BAC clone RP23-402N17 from chromosome 19, complete sequence Length = 205037 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 241 aggcgggcgggcaggcaggc 260 |||||||||||||||||||| Sbjct: 147742 aggcgggcgggcaggcaggc 147761
>gb|AC113976.13| Mus musculus chromosome 15, clone RP23-146F23, complete sequence Length = 184010 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 201 acattgacaaccaaaaataa 220 |||||||||||||||||||| Sbjct: 38446 acattgacaaccaaaaataa 38465
>gb|AC142299.1| Pan troglodytes BAC clone RP43-121O18 from 7, complete sequence Length = 146878 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 150 ttcaagaggccaggggaaag 169 |||||||||||||||||||| Sbjct: 105556 ttcaagaggccaggggaaag 105575
>ref|NM_131059.2| Danio rerio catenin (cadherin-associated protein), beta 1 (ctnnb1), mRNA Length = 3375 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 579 ctgcactccagaaacgaggg 598 |||||||||||||||||||| Sbjct: 2122 ctgcactccagaaacgaggg 2141
>gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, complete sequence Length = 3363523 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 512 tgccggcctcgatgtacttc 531 |||||||||||||||||||| Sbjct: 146029 tgccggcctcgatgtacttc 146048
>emb|AL353621.19| Human DNA sequence from clone RP11-490D19 on chromosome 9 Contains a novel pseudogene, the MRPL50 gene for mitochondrial ribosomal protein L50, the ZNF189 gene for zinc finger protein 189, the ALDOB gene for aldolase B, fructose-bisphosphate, a NADH dehydrogenase (ubiquinone) 1 alpha subcomplex (NDUFA4) pseudogene, three novel genes, the 5' end of the RNF20 gene for ring finger protein 20 and three CpG islands, complete sequence Length = 164115 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 242 ggcgggcgggcaggcaggcg 261 |||||||||||||||||||| Sbjct: 72831 ggcgggcgggcaggcaggcg 72850
>emb|AL035692.10|HS329N18 Human DNA sequence from clone RP3-329N18 on chromosome 6q22.1-22.33, complete sequence Length = 84764 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 82 tctggtctctctcttctact 101 |||||||||||||||||||| Sbjct: 50835 tctggtctctctcttctact 50816
>gb|DQ133470.1| Pan paniscus ribosomal RNA intergenic spacer, partial sequence Length = 4544 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 241 aggcgggcgggcaggcaggc 260 |||||||||||||||||||| Sbjct: 110 aggcgggcgggcaggcaggc 129
>gb|AC121765.2| Homo sapiens chromosome 3 clone RP11-767D18, complete sequence Length = 194455 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 201 acattgacaaccaaaaataa 220 |||||||||||||||||||| Sbjct: 77255 acattgacaaccaaaaataa 77274
>emb|CR377210.7| Zebrafish DNA sequence from clone CH211-195C22 in linkage group 5, complete sequence Length = 170134 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 241 aggcgggcgggcaggcaggc 260 |||||||||||||||||||| Sbjct: 77535 aggcgggcgggcaggcaggc 77516
>gb|AC107464.5| Homo sapiens BAC clone RP11-1191J2 from 4, complete sequence Length = 219357 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 241 aggcgggcgggcaggcaggc 260 |||||||||||||||||||| Sbjct: 26460 aggcgggcgggcaggcaggc 26441
>gb|AC105266.2| Homo sapiens chromosome 3 clone RP11-796K6, complete sequence Length = 181462 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 201 acattgacaaccaaaaataa 220 |||||||||||||||||||| Sbjct: 33181 acattgacaaccaaaaataa 33200
>gb|AC080043.5| Homo sapiens chromosome , clone RP11-45M9, complete sequence Length = 161443 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 241 aggcgggcgggcaggcaggc 260 |||||||||||||||||||| Sbjct: 44687 aggcgggcgggcaggcaggc 44668
>gb|AC023566.11| Homo sapiens chromosome 8, clone RP11-660D5, complete sequence Length = 184543 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 241 aggcgggcgggcaggcaggc 260 |||||||||||||||||||| Sbjct: 94243 aggcgggcgggcaggcaggc 94224
>gb|AC093925.5| Genomic sequence for Mus musculus, clone RP23-304H5, complete sequence Length = 227242 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 241 aggcgggcgggcaggcaggc 260 |||||||||||||||||||| Sbjct: 132663 aggcgggcgggcaggcaggc 132644
>gb|AF005042.1|AF005042 Homo sapiens cGMP-phosphodiesterase beta-subunit (PDE6E) gene, complete intron 2 sequence Length = 952 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 241 aggcgggcgggcaggcaggc 260 |||||||||||||||||||| Sbjct: 63 aggcgggcgggcaggcaggc 44
>gb|AF005041.1|AF005041 Homo sapiens cGMP-phosphodiesterase beta-subunit (PDE6E) gene, complete intron 2 sequence Length = 906 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 241 aggcgggcgggcaggcaggc 260 |||||||||||||||||||| Sbjct: 63 aggcgggcgggcaggcaggc 44
>ref|XM_696864.1| PREDICTED: Danio rerio hypothetical protein LOC554592 (LOC554592), mRNA Length = 3358 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 579 ctgcactccagaaacgaggg 598 |||||||||||||||||||| Sbjct: 2123 ctgcactccagaaacgaggg 2142
>emb|BX571666.10| Zebrafish DNA sequence from clone DKEY-221F8 in linkage group 5, complete sequence Length = 115940 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 241 aggcgggcgggcaggcaggc 260 |||||||||||||||||||| Sbjct: 6671 aggcgggcgggcaggcaggc 6652
>emb|BX005480.12| Mouse DNA sequence from clone RP23-142M12 on chromosome X, complete sequence Length = 196326 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 241 aggcgggcgggcaggcaggc 260 |||||||||||||||||||| Sbjct: 135612 aggcgggcgggcaggcaggc 135593
>gb|BC047815.1| Danio rerio catenin (cadherin-associated protein), beta 1, mRNA (cDNA clone MGC:56048 IMAGE:3820256), complete cds Length = 3375 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 579 ctgcactccagaaacgaggg 598 |||||||||||||||||||| Sbjct: 2122 ctgcactccagaaacgaggg 2141
>gb|AC131664.3| Mus musculus BAC clone RP23-274J16 from chromosome 5, complete sequence Length = 189996 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 241 aggcgggcgggcaggcaggc 260 |||||||||||||||||||| Sbjct: 79800 aggcgggcgggcaggcaggc 79781
>gb|AC113484.14| Mus musculus chromosome 8, clone RP23-343H23, complete sequence Length = 176303 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 241 aggcgggcgggcaggcaggc 260 |||||||||||||||||||| Sbjct: 158826 aggcgggcgggcaggcaggc 158807
>gb|AC009198.8|AC009198 Drosophila melanogaster, chromosome 2L, region 33B-33C, BAC clone BACR19C12, complete sequence Length = 171134 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 311 tctagatgtacttgaacagc 330 |||||||||||||||||||| Sbjct: 76960 tctagatgtacttgaacagc 76941
>gb|DQ164097.1| Callithrix jacchus gamma-glutamylcysteine synthetase regulatory subunit mRNA, complete cds Length = 1202 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 243 gcgggcgggcaggcaggcgg 262 |||||||||||||||||||| Sbjct: 257 gcgggcgggcaggcaggcgg 238
>gb|AC134025.2| Homo sapiens 3 BAC RP11-231I13 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 183111 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 201 acattgacaaccaaaaataa 220 |||||||||||||||||||| Sbjct: 80094 acattgacaaccaaaaataa 80075
>gb|AC016700.8| Homo sapiens BAC clone RP11-175A7 from 2, complete sequence Length = 177995 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 242 ggcgggcgggcaggcaggcg 261 |||||||||||||||||||| Sbjct: 174868 ggcgggcgggcaggcaggcg 174887
>gb|AY148158.1| Mus musculus lamin B receptor gene, partial cds Length = 29007 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 241 aggcgggcgggcaggcaggc 260 |||||||||||||||||||| Sbjct: 15874 aggcgggcgggcaggcaggc 15855
>gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome Length = 3052398 Score = 40.1 bits (20), Expect = 8.6 Identities = 32/36 (88%) Strand = Plus / Plus Query: 510 gttgccggcctcgatgtacttctttgcgttgtccca 545 ||||||| | |||||||||||||| ||||| ||||| Sbjct: 556087 gttgccgtcttcgatgtacttcttcgcgttatccca 556122
>gb|AC092586.2| Homo sapiens BAC clone RP11-30H15 from 2, complete sequence Length = 130636 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 595 agggcaccagccagaacacc 614 |||||||||||||||||||| Sbjct: 69522 agggcaccagccagaacacc 69503
>dbj|AP004753.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0508B05 Length = 166165 Score = 40.1 bits (20), Expect = 8.6 Identities = 32/36 (88%) Strand = Plus / Plus Query: 519 ctcgatgtacttctttgcgttgtcccatgcaccacc 554 ||||||||||||||| || || ||||| |||||||| Sbjct: 110222 ctcgatgtacttcttagcattatcccaggcaccacc 110257
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome Length = 7036071 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 598 gcaccagccagaacaccaga 617 |||||||||||||||||||| Sbjct: 1099928 gcaccagccagaacaccaga 1099947
>gb|AC093540.3| Pan troglodytes clone RP43-84M6, complete sequence Length = 171092 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 244 cgggcgggcaggcaggcggg 263 |||||||||||||||||||| Sbjct: 114785 cgggcgggcaggcaggcggg 114766
>dbj|AP005609.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0014M17 Length = 156778 Score = 40.1 bits (20), Expect = 8.6 Identities = 32/36 (88%) Strand = Plus / Plus Query: 519 ctcgatgtacttctttgcgttgtcccatgcaccacc 554 ||||||||||||||| || || ||||| |||||||| Sbjct: 36742 ctcgatgtacttcttagcattatcccaggcaccacc 36777
>dbj|AK070310.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023047F16, full insert sequence Length = 3048 Score = 40.1 bits (20), Expect = 8.6 Identities = 32/36 (88%) Strand = Plus / Minus Query: 519 ctcgatgtacttctttgcgttgtcccatgcaccacc 554 ||||||||||||||| || || ||||| |||||||| Sbjct: 2735 ctcgatgtacttcttagcattatcccaggcaccacc 2700
>gb|AE003635.2| Drosophila melanogaster chromosome 2L, section 44 of 83 of the complete sequence Length = 308012 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 311 tctagatgtacttgaacagc 330 |||||||||||||||||||| Sbjct: 137931 tctagatgtacttgaacagc 137912
>emb|X62693.1|HSCGMP2 H.sapiens DNA for cGMP phosphodiesterase exon 2 Length = 556 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 241 aggcgggcgggcaggcaggc 260 |||||||||||||||||||| Sbjct: 417 aggcgggcgggcaggcaggc 398
>emb|AJ872270.1| Thermotoga sp. RQ7 16S rRNA gene, 23S rRNA gene, 5S rRNA gene, folC gene, deoB gene, leuS gene, ORF4, ORF5, ORF6, ahcY gene, topG gene, hppa gene, acp gene, ORF11, ORF12, priA gene, ORF13, ORF14, ORF15, ORF16, ORF17, mrsA gene, ORF19, rrp2 gene, fsr gene, ORF22, fbpA gene, fepD gene, ORF26, ORF27, ORF28 (partial), tRNA-Ala gene, tRNA-Arg gene, tRNA-His gene, tRNA-Arg gene, tRNA-Gly gene, group I intron, IGS, ITS1 and ITS2, strain RQ7 Length = 36963 Score = 40.1 bits (20), Expect = 8.6 Identities = 32/36 (88%) Strand = Plus / Minus Query: 510 gttgccggcctcgatgtacttctttgcgttgtccca 545 |||||| ||||||| | ||||||| ||||||||||| Sbjct: 12863 gttgcccgcctcgaggaacttcttggcgttgtccca 12828
>emb|AJ872267.1| Thermotoga neapolitana 16S rRNA gene, 23S rRNA gene, 5S rRNA gene, ORF1, ORF2, ORF3, ruva gene, folC gene, deoB gene, leuS gene, ORF8, ORF9, ORF10, ahcY gene, topG gene, hppa gene, acp gene, ORF15, ORF16, priA gene, ORF18, ORF10, ORF20, ORF21 (partial), tRNA-Ile gene, tRNA-Ala gene, group I intron, IGS, ITS1 and ITS2, strain LA10 Length = 30468 Score = 40.1 bits (20), Expect = 8.6 Identities = 32/36 (88%) Strand = Plus / Minus Query: 510 gttgccggcctcgatgtacttctttgcgttgtccca 545 |||||| ||||||| | ||||||| ||||||||||| Sbjct: 17330 gttgcccgcctcgaggaacttcttggcgttgtccca 17295
>emb|AJ872266.1| Thermotoga neapolitana 16S rRNA gene, 23S rRNA gene, 5S rRNA gene, ORF1 (partial), ORF2, ahcY gene, topG gene, hppa gene, acp gene, ORF7, ORF8, priA gene, ORF9, ORF10, ORF11, ORF12 (partial), tRNA-Ile gene, tRNA-Ala gene, group I intron, IGS, ITS1 and ITS2, strain LA4 Length = 19759 Score = 40.1 bits (20), Expect = 8.6 Identities = 32/36 (88%) Strand = Plus / Minus Query: 510 gttgccggcctcgatgtacttctttgcgttgtccca 545 |||||| ||||||| | ||||||| ||||||||||| Sbjct: 7090 gttgcccgcctcgaggaacttcttggcgttgtccca 7055
>gb|U41081.1|DRU41081 Danio rerio b-catenin mRNA, complete cds Length = 2553 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 579 ctgcactccagaaacgaggg 598 |||||||||||||||||||| Sbjct: 2011 ctgcactccagaaacgaggg 2030
>gb|AC105072.9| Mus musculus chromosome 5, clone RP24-167C6, complete sequence Length = 173710 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 242 ggcgggcgggcaggcaggcg 261 |||||||||||||||||||| Sbjct: 17283 ggcgggcgggcaggcaggcg 17302
>emb|AL844566.8| Mouse DNA sequence from clone RP23-173H17 on chromosome 2, complete sequence Length = 229583 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 241 aggcgggcgggcaggcaggc 260 |||||||||||||||||||| Sbjct: 113280 aggcgggcgggcaggcaggc 113299
>gb|BC065336.1| Danio rerio cDNA clone IMAGE:6965986, containing frame-shift errors Length = 3410 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 579 ctgcactccagaaacgaggg 598 |||||||||||||||||||| Sbjct: 2108 ctgcactccagaaacgaggg 2127
>gb|AC151735.3| Mus musculus BAC clone RP23-24D16 from 9, complete sequence Length = 201762 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 241 aggcgggcgggcaggcaggc 260 |||||||||||||||||||| Sbjct: 139401 aggcgggcgggcaggcaggc 139382
>emb|AL845513.9| Zebrafish DNA sequence from clone CH211-13O4 in linkage group 16, complete sequence Length = 164117 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 579 ctgcactccagaaacgaggg 598 |||||||||||||||||||| Sbjct: 47781 ctgcactccagaaacgaggg 47800
>emb|AL603706.13| Mouse DNA sequence from clone RP23-407I21 on chromosome 11, complete sequence Length = 220242 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 241 aggcgggcgggcaggcaggc 260 |||||||||||||||||||| Sbjct: 43459 aggcgggcgggcaggcaggc 43478
>emb|AL807399.5| Mouse DNA sequence from clone RP23-382O11 on chromosome 4, complete sequence Length = 181004 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 241 aggcgggcgggcaggcaggc 260 |||||||||||||||||||| Sbjct: 160196 aggcgggcgggcaggcaggc 160177
>emb|AL589870.30| Mouse DNA sequence from clone RP23-118A2 on chromosome 2, complete sequence Length = 202686 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 242 ggcgggcgggcaggcaggcg 261 |||||||||||||||||||| Sbjct: 135217 ggcgggcgggcaggcaggcg 135236
>dbj|AB044479.1| Volvox rousseletii chloroplast psbC gene for photosystem II CP43 apoprotein, strain:UTEX 1862 Length = 780 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 209 aaccaaaaataacagcagcg 228 |||||||||||||||||||| Sbjct: 370 aaccaaaaataacagcagcg 351
>dbj|AB044478.1| Volvox globator chloroplast psbC gene for photosystem II CP43 apoprotein, strain:UTEX 955 Length = 780 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 209 aaccaaaaataacagcagcg 228 |||||||||||||||||||| Sbjct: 370 aaccaaaaataacagcagcg 351
>dbj|AB044477.1| Volvox barberi chloroplast psbC gene for photosystem II CP43 apoprotein, strain:UTEX 804 Length = 780 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 209 aaccaaaaataacagcagcg 228 |||||||||||||||||||| Sbjct: 370 aaccaaaaataacagcagcg 351 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,482,446 Number of Sequences: 3902068 Number of extensions: 5482446 Number of successful extensions: 104185 Number of sequences better than 10.0: 243 Number of HSP's better than 10.0 without gapping: 245 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 102456 Number of HSP's gapped (non-prelim): 1699 length of query: 629 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 606 effective length of database: 17,143,297,704 effective search space: 10388838408624 effective search space used: 10388838408624 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
