ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags23e01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK072762.1| Oryza sativa (japonica cultivar-group) cDNA clon... 250 5e-63
2ref|NM_188785.1| Oryza sativa (japonica cultivar-group), predic... 244 3e-61
3gb|AC007789.1| Oryza sativa BAC OSJNBa0049B20 genomic sequence, ... 159 1e-35
4dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 159 1e-35
5dbj|AP002865.1| Oryza sativa (japonica cultivar-group) genomic D... 159 1e-35
6gb|AY104847.1| Zea mays PCO066525 mRNA sequence 78 4e-11
7ref|NM_192424.1| Oryza sativa (japonica cultivar-group), predic... 76 2e-10
8dbj|AK061752.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 2e-10
9gb|AF155333.2|AF155333 Oryza sativa NADP-specific isocitrate deh... 76 2e-10
10dbj|AP003212.4| Oryza sativa (japonica cultivar-group) genomic D... 68 4e-08
11dbj|AP003709.2| Oryza sativa (japonica cultivar-group) genomic D... 68 4e-08
12ref|XM_473117.1| Oryza sativa (japonica cultivar-group), predic... 62 2e-06
13gb|BT016882.1| Zea mays clone Contig715 mRNA sequence 62 2e-06
14dbj|AK070042.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 2e-06
15gb|AF155334.1|AF155334 Oryza sativa NADP-specific isocitrate deh... 56 1e-04
16ref|NM_104312.2| Arabidopsis thaliana ICDH (isocitrate dehydroge... 54 6e-04
17gb|AC005287.4| Arabidopsis thaliana chromosome I BAC F20D21 geno... 54 6e-04
18emb|BX818521.1|CNS0AE6Z Arabidopsis thaliana Full-length cDNA Co... 54 6e-04
19gb|AF316501.1|AF316501 Arabidopsis thaliana NADP-specific isocit... 54 6e-04
20ref|NM_105265.2| Arabidopsis thaliana isocitrate dehydrogenase (... 50 0.009
21emb|AJ437268.1|ATH437268 Arabidopsis thaliana mRNA for isocitrat... 50 0.009
22gb|AC122587.5| Rattus norvegicus BAC CH230-173H6 (Children's Ho... 50 0.009
23gb|AY097340.1| Arabidopsis thaliana At1g65930/F12P19_10 mRNA, co... 50 0.009
24gb|AY093091.1| Arabidopsis thaliana similar to NADP-specific iso... 50 0.009
25gb|AF419575.1|AF419575 Arabidopsis thaliana At1g65930/F12P19_10 ... 50 0.009
26dbj|AK220845.1| Arabidopsis thaliana mRNA for NADP specific isoc... 50 0.009
27gb|AY045631.1| Arabidopsis thaliana At1g65930/F12P19_10 mRNA, co... 50 0.009
28gb|BT002400.1| Arabidopsis thaliana isocitrate dehydrogenase, pu... 50 0.009
29dbj|AB019327.1| Daucus carota mRNA for NADP specific isocitrate ... 50 0.009
30emb|AJ973130.1| Andrographis paniculata partial idh gene for put... 48 0.035
31emb|Y12540.1|AGIDHC A.graveolens mRNA for isocitrate dehydrogena... 48 0.035
32emb|AL662969.3|OSJN00169 Oryza sativa genomic DNA, chromosome 4,... 48 0.035
33emb|AJ437269.1|CSA437269 Cucumis sativus mRNA for isocitrate deh... 48 0.035
34gb|AY997845.1| Aliciella hutchinsifolia voucher Johnson 96-069 W... 48 0.035
35gb|AY997844.1| Aliciella hutchinsifolia voucher Johnson 96-069 W... 48 0.035
36gb|AY997909.1| Saltugilia splendens subsp. grantii voucher Johns... 48 0.035
37gb|AY997908.1| Saltugilia splendens subsp. grantii voucher Johns... 48 0.035
38gb|AY997907.1| Saltugilia splendens subsp. grantii voucher Johns... 48 0.035
39gb|AY997879.1| Aliciella hutchinsifolia voucher Johnson 93-069 W... 48 0.035
40dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.035
41gb|AF176669.1|AF176669 Citrus limon NADP-isocitrate dehydrogenas... 48 0.035
42emb|X77944.1|NTNIDH N.tabacum (Xanthi) NADP-dependent Isocitrate... 46 0.14
43dbj|AB243085.1| Codonopsis lanceolata mRNA for NADP-isocitrate d... 46 0.14
44gb|AY088129.1| Arabidopsis thaliana clone 41544 mRNA, complete s... 46 0.14
45dbj|AB109115.1| Lupinus albus LaICDH2;1 mRNA for NADP-specific i... 46 0.14
46gb|AY111226.1| Zea mays CL7227_-2 mRNA sequence 46 0.14
47gb|AC104284.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.54
48emb|AL445469.4| Human DNA sequence from clone RP11-254N18 on chr... 44 0.54
49emb|X75638.1|STNICD S.tuberosum mRNA for NADP-dependent isocitr... 44 0.54
50gb|AY997906.1| Saltugilia splendens subsp. grantii voucher Johns... 44 0.54
51dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.54
52gb|AF095445.1|AF095445 Glycine max NADP-dependent isocitrate deh... 44 0.54
53gb|BT017177.1| Zea mays clone EL01N0369B08.c mRNA sequence 42 2.1
54gb|AC125006.9| Mus musculus chromosome 3, clone RP24-157K20, com... 42 2.1
55gb|AC117721.8| Mus musculus chromosome 1, clone RP24-196D2, comp... 42 2.1
56gb|AC135378.2| Mus musculus BAC clone RP24-284L24 from chromosom... 42 2.1
57gb|AC026232.4| Mus musculus strain C57BL6/J chromosome 5 clone R... 42 2.1
58gb|AC131786.3| Mus musculus BAC clone RP24-397H7 from chromosome... 42 2.1
59gb|AC147101.2| Mus musculus BAC clone RP23-455H16 from chromosom... 42 2.1
60gb|AC102769.11| Mus musculus chromosome 17, clone RP23-89A3, com... 42 2.1
61gb|AC117230.3| Mus musculus BAC clone RP23-385F15 from 16, compl... 42 2.1
62gb|AC110169.7| Mus musculus chromosome 9, clone RP23-233D3, comp... 42 2.1
63gb|AC132565.28| Medicago truncatula clone mth2-4a8, complete seq... 42 2.1
64gb|AE016795.2| Vibrio vulnificus CMCP6 chromosome I complete seq... 42 2.1
65gb|AC158960.4| Mus musculus chromosome 1, clone RP23-315O2, comp... 42 2.1
66gb|AC157792.4| Mus musculus chromosome 7, clone RP24-192N20, com... 42 2.1
67emb|AL669912.7| Mouse DNA sequence from clone RP23-147K24 on chr... 42 2.1
68gb|AF510423.1|AF510423S1 Homo sapiens chromosome 5 BAC clone TAR... 42 2.1
69dbj|BA000037.2| Vibrio vulnificus YJ016 DNA, chromosome I, compl... 42 2.1
70gb|AC119807.11| Mus musculus chromosome 8, clone RP23-167I14, co... 42 2.1
71gb|AC091825.4| Homo sapiens chromosome 5 clone CTC-463A16, compl... 42 2.1
72gb|AC007677.3| Homo sapiens BAC clone RP11-86N1 from 2, complete... 42 2.1
73emb|AL732501.8| Mouse DNA sequence from clone RP23-325I22 on chr... 42 2.1
74gb|AC009513.2|F12P19 Sequence of BAC F12P19 from Arabidopsis tha... 42 2.1
75gb|AY107138.1| Zea mays PCO115488 mRNA sequence 42 2.1
76gb|AC026949.21| Mus musculus chromosome 7, clone RP23-103E11, co... 42 2.1
77gb|AC118685.10| Mus musculus chromosome 5, clone RP23-412L2, com... 42 2.1
78gb|AC120438.9| Mus musculus chromosome 7, clone RP24-572G2, comp... 42 2.1
79gb|AC101950.11| Mus musculus chromosome 1, clone RP24-149K4, com... 42 2.1
80gb|AC132422.3| Mus musculus BAC clone RP23-302G15 from 12, compl... 42 2.1
81gb|AC148005.3| Mus musculus BAC clone RP23-295O6 from 12, comple... 42 2.1
82emb|CT025641.10| Mouse DNA sequence from clone RP24-322A17 on ch... 42 2.1
83gb|AC149281.2| Mus musculus BAC clone RP23-287D14 from 19, compl... 42 2.1
84gb|AC173346.1| Mus musculus BAC clone RP23-42N8 from chromosome ... 42 2.1
85emb|AL626771.9| Mouse DNA sequence from clone RP23-281O10 on chr... 42 2.1
86gb|AC130561.11| Rattus norvegicus BAC CH230-161F3 (Children's H... 40 8.4
87ref|XM_420025.1| PREDICTED: Gallus gallus similar to zinc finger... 40 8.4
88gb|AC099589.12| Mus musculus chromosome 1, clone RP23-337A19, co... 40 8.4
89gb|AC127027.13| Mus musculus chromosome 5, clone RP23-236G19, co... 40 8.4
90gb|AY509880.1| Pisum sativum NADP-dependent isocitrate dehydroge... 40 8.4
91emb|AJ973131.1| Andrographis paniculata partial idh gene for put... 40 8.4
92emb|BX005428.7| Human DNA sequence from clone DASS-38I7 on chrom... 40 8.4
93emb|AL844851.4| Human DNA sequence from clone DAQB-335A13 on chr... 40 8.4
94emb|AL669813.6| Human DNA sequence from clone XXbac-231I11 on ch... 40 8.4
95emb|AL645939.6| Human DNA sequence from clone XXbac-170G13 on ch... 40 8.4
96gb|AC067746.7| Homo sapiens chromosome 10 clone RP11-408L20, com... 40 8.4
97gb|AC094241.9| Rattus norvegicus 1 BAC CH230-3C7 (Children's Hos... 40 8.4
98emb|AL022723.4|HS377H14 Human DNA sequence from clone RP3-377H14... 40 8.4
99emb|CR759790.7| Human DNA sequence from clone DAMC-335E20 on chr... 40 8.4
100emb|CR753818.5| Human DNA sequence from clone DADB-68M4 on chrom... 40 8.4
101emb|AL645903.8| Mouse DNA sequence from clone RP23-179M4 on chro... 40 8.4
102emb|BX322610.5| Zebrafish DNA sequence from clone CH211-245M13 i... 40 8.4
103gb|AF367443.1| Prunus persica clone Icdh1 NADP-dependent isocitr... 40 8.4
104dbj|AB227395.1| Aspergillus oryzae cDNA, contig sequence: AoEST4262 40 8.4
105dbj|AP007159.1| Aspergillus oryzae RIB40 genomic DNA, SC026 40 8.4
106gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hilde... 40 8.4
107gb|AC131108.3| Mus musculus BAC clone RP23-351K24 from chromosom... 40 8.4
108gb|AY997878.1| Saltugilia splendens subsp. splendens voucher Joh... 40 8.4
109gb|AY997877.1| Saltugilia splendens subsp. splendens voucher Joh... 40 8.4
110gb|AY997876.1| Saltugilia splendens subsp. grantii voucher Johns... 40 8.4
111gb|AY997874.1| Saltugilia latimeri voucher Johnson 92-021 WS iso... 40 8.4
112gb|AY997873.1| Saltugilia caruifolia voucher Johnson 97-100 BRY ... 40 8.4
113gb|AY997871.1| Saltugilia australis voucher Johnson 92-011 BRY i... 40 8.4
114gb|AY997870.1| Saltugilia australis voucher Johnson 97-049 BRY i... 40 8.4
115gb|AY997869.1| Navarretia mellita voucher Johnson 94-072 BRY iso... 40 8.4
116gb|AY997868.1| Navarretia leptalea voucher Johnson 93-131 BRY is... 40 8.4
117gb|AY997867.1| Navarretia jepsonii voucher Johnson 96-011 BRY is... 40 8.4
118gb|AY997866.1| Navarretia breweri voucher Johnson 93-101 WS isoc... 40 8.4
119gb|AY997862.1| Lathrocasis tenerrima voucher Johnson 93-103 WS c... 40 8.4
120gb|AY997861.1| Lathrocasis tenerrima voucher Johnson 93-103 WS c... 40 8.4
121gb|AY997859.1| Gilia stellata voucher Johnson 97-006 BRY isocitr... 40 8.4
122gb|AY997858.1| Gilia scopulorum voucher Johnson304 BRY isocitrat... 40 8.4
123gb|AY997856.1| Gilia laciniata voucher Morrell 403 RSA clone 1 i... 40 8.4
124gb|AY997855.1| Gilia capitata voucher Johnson 92-015 WS isocitra... 40 8.4
125gb|AY997853.1| Collomia tracyi voucher Johnson 94-075 BRY isocit... 40 8.4
126gb|AY997852.1| Collomia heterophylla voucher Johnson 94-076 BRY ... 40 8.4
127gb|AY997851.1| Collomia diversifolia voucher Johnson 96-013 BRY ... 40 8.4
128gb|AY997850.1| Allophyllum integrifolium voucher Johnson 93-111 ... 40 8.4
129gb|AY997849.1| Allophyllum integrifolium voucher Johnson 93-111 ... 40 8.4
130gb|AY997847.1| Aliciella latifolia voucher Johnson 93-018 WS clo... 40 8.4
131gb|AY997846.1| Aliciella latifolia voucher Johnson 93-018 WS clo... 40 8.4
132gb|AY997843.1| Acanthogilia gloriosa voucher Johnson 95-070 WS i... 40 8.4
133gb|AY997919.1| Saltugilia splendens subsp. splendens voucher Joh... 40 8.4
134gb|AY997918.1| Saltugilia splendens subsp. splendens voucher Joh... 40 8.4
135gb|AY997917.1| Saltugilia splendens subsp. splendens voucher Joh... 40 8.4
136gb|AY997916.1| Saltugilia splendens subsp. grantii voucher Johns... 40 8.4
137gb|AY997915.1| Saltugilia splendens subsp. grantii voucher Johns... 40 8.4
138gb|AY997913.1| Saltugilia splendens subsp. grantii voucher Johns... 40 8.4
139gb|AY997912.1| Saltugilia splendens subsp. grantii voucher Johns... 40 8.4
140gb|AY997911.1| Saltugilia splendens subsp. grantii voucher Johns... 40 8.4
141gb|AY997910.1| Saltugilia splendens subsp. grantii voucher Johns... 40 8.4
142gb|AY997905.1| Saltugilia latimeri voucher Johnson 92-021 WS iso... 40 8.4
143gb|AY997904.1| Saltugilia latimeri voucher Grant 8840 RSA isocit... 40 8.4
144gb|AY997903.1| Saltugilia caruifolia voucher Johnson 97-100 BRY ... 40 8.4
145gb|AY997902.1| Saltugilia caruifolia voucher Johnson 97-099 BRY ... 40 8.4
146gb|AY997901.1| Saltugilia caruifolia voucher Johnson 93-092 BRY ... 40 8.4
147gb|AY997900.1| Saltugilia caruifolia voucher Johnson 93-092 BRY ... 40 8.4
148gb|AY997899.1| Saltugilia caruifolia voucher Johnson 93-092 BRY ... 40 8.4
149gb|AY997898.1| Saltugilia caruifolia voucher Weese 01-032 BRY cl... 40 8.4
150gb|AY997897.1| Saltugilia australis voucher Johnson 97-082 BRY c... 40 8.4
151gb|AY997896.1| Saltugilia australis voucher Johnson 97-065 BRY c... 40 8.4
152gb|AY997895.1| Saltugilia australis voucher Johnson 92-011 BRY c... 40 8.4
153gb|AY997894.1| Saltugilia australis voucher Johnson 97-049 BRY c... 40 8.4
154gb|AY997893.1| Saltugilia australis voucher Johnson 97-049 BRY c... 40 8.4
155gb|AY997892.1| Saltugilia australis voucher Johnson 97-049 BRY c... 40 8.4
156gb|AY997891.1| Saltugilia australis voucher Johnson 97-049 BRY c... 40 8.4
157gb|AY997890.1| Saltugilia australis voucher Johnson 97-049 BRY c... 40 8.4
158gb|AY997889.1| Navarretia leptalea voucher Johnson 93-131 BRY is... 40 8.4
159gb|AY997887.1| Lathrocasis tenerrima voucher Johnson 93-103 WS i... 40 8.4
160gb|AY997885.1| Gilia stellata voucher Johnson 97-006 BRY isocitr... 40 8.4
161gb|AY997883.1| Gilia cana voucher Johnson 93-016 WS isocitrate d... 40 8.4
162gb|AY997881.1| Collomia tracyi voucher Johnson 94-075 BRY isocit... 40 8.4
163gb|AY997880.1| Allophyllum integrifolium voucher Johnson 93-111 ... 40 8.4
164emb|BX927250.5| Human DNA sequence from clone DAMA-364L23 on chr... 40 8.4
165gb|AC026765.22| Homo sapiens 12 BAC RP4-601P9 (Roswell Park Canc... 40 8.4
166dbj|BA000025.2| Homo sapiens genomic DNA, chromosome 6p21.3, HLA... 40 8.4
167emb|BX005464.7| Zebrafish DNA sequence from clone DKEY-24J21, co... 40 8.4
168gb|AF055066.1|AF055066 Homo sapiens MHC class 1 region 40 8.4
169gb|BC082651.1| Xenopus laevis hypothetical LOC494713, mRNA (cDNA... 40 8.4
170gb|AC004213.1|AC004213 Homo sapiens clone UWGC:y19c060 from 6p21... 40 8.4
171gb|AC133651.4| Mus musculus BAC clone RP24-239C15 from 1, comple... 40 8.4
172gb|AC113480.8| Mus musculus chromosome 13, clone RP23-309D8, com... 40 8.4
173emb|AL772306.10| Mouse DNA sequence from clone RP23-89L15 on chr... 40 8.4
174gb|AC163663.3| Mus musculus BAC clone RP24-241H23 from chromosom... 40 8.4
175gb|M93672.1|ALFISDHYA Medicago sativa isocitrate dehydrogenase m... 40 8.4
176dbj|AB023058.1| Homo sapiens genomic DNA, chromosome 6p21.3, HLA... 40 8.4

>dbj|AK072762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023139I05, full
            insert sequence
          Length = 1859

 Score =  250 bits (126), Expect = 5e-63
 Identities = 234/270 (86%)
 Strand = Plus / Minus

                                                                        
Query: 349  ccttcataactttgattttgcggacaatcttgtcctcaactcctcagcaaccgcatcaat 408
            |||||||||||| ||| || | ||||||||||| || || ||||||||||| ||||| ||
Sbjct: 1448 ccttcataacttggatgttactgacaatcttgttcttaaatcctcagcaacagcatcgat 1389

                                                                        
Query: 409  gaactccatggtgttcagatacttatcacgactaacagttggcccatggatgagaagagc 468
            |||||| |  ||||| ||||||||||| || |||||| |||||||||| |  ||||||||
Sbjct: 1388 gaactcaacagtgttaagatacttatctcggctaacatttggcccatgtacaagaagagc 1329

                                                                        
Query: 469  taggtcctttgtcatctttccagattccactgtccccacacaagcagcttcaagtttttg 528
            ||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 1328 tagatcctttgtcatctttccagattccactgttcccacacaagcagcttcaagtttttg 1269

                                                                        
Query: 529  tgtgaaatccaacagtcttttgttgtcatccagctttgccctatgtgctaatccagtaga 588
            |   ||||| ||||||||||| |||||||| ||||||||||||||| ||| ||| || | 
Sbjct: 1268 tacaaaatctaacagtcttttattgtcatcgagctttgccctatgtcctagtccggttgt 1209

                                          
Query: 589  ccatgcaaagattgacgcaatgctgtttgt 618
            ||| ||||| ||||| |||||||| |||||
Sbjct: 1208 ccaagcaaatattgaagcaatgctatttgt 1179



to top

>ref|NM_188785.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1227

 Score =  244 bits (123), Expect = 3e-61
 Identities = 231/267 (86%)
 Strand = Plus / Minus

                                                                        
Query: 352  tcataactttgattttgcggacaatcttgtcctcaactcctcagcaaccgcatcaatgaa 411
            ||||||||| ||| || | ||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 1227 tcataacttggatgttactgacaatcttgttcttaaatcctcagcaacagcatcgatgaa 1168

                                                                        
Query: 412  ctccatggtgttcagatacttatcacgactaacagttggcccatggatgagaagagctag 471
            ||| |  ||||| ||||||||||| || |||||| |||||||||| |  |||||||||||
Sbjct: 1167 ctcaacagtgttaagatacttatctcggctaacatttggcccatgtacaagaagagctag 1108

                                                                        
Query: 472  gtcctttgtcatctttccagattccactgtccccacacaagcagcttcaagtttttgtgt 531
             ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||  
Sbjct: 1107 atcctttgtcatctttccagattccactgttcccacacaagcagcttcaagtttttgtac 1048

                                                                        
Query: 532  gaaatccaacagtcttttgttgtcatccagctttgccctatgtgctaatccagtagacca 591
             ||||| ||||||||||| |||||||| ||||||||||||||| ||| ||| || | |||
Sbjct: 1047 aaaatctaacagtcttttattgtcatcgagctttgccctatgtcctagtccggttgtcca 988

                                       
Query: 592  tgcaaagattgacgcaatgctgtttgt 618
             ||||| ||||| |||||||| |||||
Sbjct: 987  agcaaatattgaagcaatgctatttgt 961



to top

>gb|AC007789.1| Oryza sativa BAC OSJNBa0049B20 genomic sequence, complete sequence
          Length = 182756

 Score =  159 bits (80), Expect = 1e-35
 Identities = 113/124 (91%)
 Strand = Plus / Minus

                                                                          
Query: 447    ttggcccatggatgagaagagctaggtcctttgtcatctttccagattccactgtcccca 506
              |||||||||| |  ||||||||||| ||||||||||||||||||||||||||||| ||||
Sbjct: 138347 ttggcccatgtacaagaagagctagatcctttgtcatctttccagattccactgttccca 138288

                                                                          
Query: 507    cacaagcagcttcaagtttttgtgtgaaatccaacagtcttttgttgtcatccagctttg 566
              |||||||||||||||||||||||   ||||| ||||||||||| |||||||| |||||||
Sbjct: 138287 cacaagcagcttcaagtttttgtacaaaatctaacagtcttttattgtcatcgagctttg 138228

                  
Query: 567    ccct 570
              ||||
Sbjct: 138227 ccct 138224



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 84/99 (84%)
 Strand = Plus / Minus

                                                                          
Query: 347    taccttcataactttgattttgcggacaatcttgtcctcaactcctcagcaaccgcatca 406
              |||||||||||||| ||| || | ||||||||||| || || ||||||||||| ||||| 
Sbjct: 138524 taccttcataacttggatgttactgacaatcttgttcttaaatcctcagcaacagcatcg 138465

                                                     
Query: 407    atgaactccatggtgttcagatacttatcacgactaaca 445
              |||||||| |  ||||| ||||||||||| || ||||||
Sbjct: 138464 atgaactcaacagtgttaagatacttatctcggctaaca 138426



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score =  159 bits (80), Expect = 1e-35
 Identities = 113/124 (91%)
 Strand = Plus / Minus

                                                                           
Query: 447     ttggcccatggatgagaagagctaggtcctttgtcatctttccagattccactgtcccca 506
               |||||||||| |  ||||||||||| ||||||||||||||||||||||||||||| ||||
Sbjct: 8174226 ttggcccatgtacaagaagagctagatcctttgtcatctttccagattccactgttccca 8174167

                                                                           
Query: 507     cacaagcagcttcaagtttttgtgtgaaatccaacagtcttttgttgtcatccagctttg 566
               |||||||||||||||||||||||   ||||| ||||||||||| |||||||| |||||||
Sbjct: 8174166 cacaagcagcttcaagtttttgtacaaaatctaacagtcttttattgtcatcgagctttg 8174107

                   
Query: 567     ccct 570
               ||||
Sbjct: 8174106 ccct 8174103



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 84/99 (84%)
 Strand = Plus / Minus

                                                                           
Query: 347     taccttcataactttgattttgcggacaatcttgtcctcaactcctcagcaaccgcatca 406
               |||||||||||||| ||| || | ||||||||||| || || ||||||||||| ||||| 
Sbjct: 8174403 taccttcataacttggatgttactgacaatcttgttcttaaatcctcagcaacagcatcg 8174344

                                                      
Query: 407     atgaactccatggtgttcagatacttatcacgactaaca 445
               |||||||| |  ||||| ||||||||||| || ||||||
Sbjct: 8174343 atgaactcaacagtgttaagatacttatctcggctaaca 8174305



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                            
Query: 461      agaagagctaggtcctttgtcatctttccagattccactgtccccacacaagcagcttca 520
                |||||||| ||||| || |||||||| ||||||||||| || || || ||||||||||||
Sbjct: 26526912 agaagagcaaggtctttggtcatcttcccagattccacggttccaacgcaagcagcttca 26526971

                      
Query: 521      agtttt 526
                ||||||
Sbjct: 26526972 agtttt 26526977



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                           
Query: 388      ctcctcagcaaccgcatcaatgaactc 414
                |||| ||||||||||||||||||||||
Sbjct: 26526718 ctccgcagcaaccgcatcaatgaactc 26526744



 Score = 44.1 bits (22), Expect = 0.54
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                          
Query: 593      gcaaagattgacgcaatgctgtttgt 618
                ||||||||||| ||||||||||||||
Sbjct: 26527252 gcaaagattgaagcaatgctgtttgt 26527277



to top

>dbj|AP002865.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0034C11
          Length = 139399

 Score =  159 bits (80), Expect = 1e-35
 Identities = 113/124 (91%)
 Strand = Plus / Minus

                                                                         
Query: 447   ttggcccatggatgagaagagctaggtcctttgtcatctttccagattccactgtcccca 506
             |||||||||| |  ||||||||||| ||||||||||||||||||||||||||||| ||||
Sbjct: 91944 ttggcccatgtacaagaagagctagatcctttgtcatctttccagattccactgttccca 91885

                                                                         
Query: 507   cacaagcagcttcaagtttttgtgtgaaatccaacagtcttttgttgtcatccagctttg 566
             |||||||||||||||||||||||   ||||| ||||||||||| |||||||| |||||||
Sbjct: 91884 cacaagcagcttcaagtttttgtacaaaatctaacagtcttttattgtcatcgagctttg 91825

                 
Query: 567   ccct 570
             ||||
Sbjct: 91824 ccct 91821



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 84/99 (84%)
 Strand = Plus / Minus

                                                                         
Query: 347   taccttcataactttgattttgcggacaatcttgtcctcaactcctcagcaaccgcatca 406
             |||||||||||||| ||| || | ||||||||||| || || ||||||||||| ||||| 
Sbjct: 92121 taccttcataacttggatgttactgacaatcttgttcttaaatcctcagcaacagcatcg 92062

                                                    
Query: 407   atgaactccatggtgttcagatacttatcacgactaaca 445
             |||||||| |  ||||| ||||||||||| || ||||||
Sbjct: 92061 atgaactcaacagtgttaagatacttatctcggctaaca 92023



to top

>gb|AY104847.1| Zea mays PCO066525 mRNA sequence
          Length = 1776

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 99/119 (83%)
 Strand = Plus / Minus

                                                                        
Query: 452  ccatggatgagaagagctaggtcctttgtcatctttccagattccactgtccccacacaa 511
            |||||||| ||||| || |||||||| ||||| || ||||||||||| ||  | ||||| 
Sbjct: 1431 ccatggataagaagcgcaaggtccttagtcattttcccagattccaccgtttcaacacat 1372

                                                                       
Query: 512  gcagcttcaagtttttgtgtgaaatccaacagtcttttgttgtcatccagctttgccct 570
            |||| ||||||||| ||||||||||||| ||| || |  || | |||||||||||||||
Sbjct: 1371 gcagattcaagtttgtgtgtgaaatccagcagactatcatttttatccagctttgccct 1313



to top

>ref|NM_192424.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1239

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 128/158 (81%)
 Strand = Plus / Minus

                                                                        
Query: 461  agaagagctaggtcctttgtcatctttccagattccactgtccccacacaagcagcttca 520
            |||||||| ||||| || |||||||| ||||||||||| || || || ||||||||||||
Sbjct: 1136 agaagagcaaggtctttggtcatcttcccagattccacggttccaacgcaagcagcttca 1077

                                                                        
Query: 521  agtttttgtgtgaaatccaacagtcttttgttgtcatccagctttgccctatgtgctaat 580
            |||||| |||  || || |  |||||    ||||| || ||||||||||| ||||| | |
Sbjct: 1076 agttttagtgcaaagtcaagaagtctagcattgtcgtcaagctttgccctgtgtgcaagt 1017

                                                  
Query: 581  ccagtagaccatgcaaagattgacgcaatgctgtttgt 618
            ||  | | ||| ||||||||||| ||||||||||||||
Sbjct: 1016 cctctggtccaagcaaagattgaagcaatgctgtttgt 979



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 388  ctcctcagcaaccgcatcaatgaactc 414
            |||| ||||||||||||||||||||||
Sbjct: 1212 ctccgcagcaaccgcatcaatgaactc 1186



to top

>dbj|AK061752.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-H06, full
            insert sequence
          Length = 1686

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 128/158 (81%)
 Strand = Plus / Minus

                                                                        
Query: 461  agaagagctaggtcctttgtcatctttccagattccactgtccccacacaagcagcttca 520
            |||||||| ||||| || |||||||| ||||||||||| || || || ||||||||||||
Sbjct: 1222 agaagagcaaggtctttggtcatcttcccagattccacggttccaacgcaagcagcttca 1163

                                                                        
Query: 521  agtttttgtgtgaaatccaacagtcttttgttgtcatccagctttgccctatgtgctaat 580
            |||||| |||  || || |  |||||    ||||| || ||||||||||| ||||| | |
Sbjct: 1162 agttttagtgcaaagtcaagaagtctagcattgtcgtcaagctttgccctgtgtgcaagt 1103

                                                  
Query: 581  ccagtagaccatgcaaagattgacgcaatgctgtttgt 618
            ||  | | ||| ||||||||||| ||||||||||||||
Sbjct: 1102 cctctggtccaagcaaagattgaagcaatgctgtttgt 1065



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 388  ctcctcagcaaccgcatcaatgaactc 414
            |||| ||||||||||||||||||||||
Sbjct: 1298 ctccgcagcaaccgcatcaatgaactc 1272



to top

>gb|AF155333.2|AF155333 Oryza sativa NADP-specific isocitrate dehydrogenase mRNA, complete
            cds
          Length = 1594

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 128/158 (81%)
 Strand = Plus / Minus

                                                                        
Query: 461  agaagagctaggtcctttgtcatctttccagattccactgtccccacacaagcagcttca 520
            |||||||| ||||| || |||||||| ||||||||||| || || || ||||||||||||
Sbjct: 1201 agaagagcaaggtctttggtcatcttcccagattccacggttccaacgcaagcagcttca 1142

                                                                        
Query: 521  agtttttgtgtgaaatccaacagtcttttgttgtcatccagctttgccctatgtgctaat 580
            |||||| |||  || || |  |||||    ||||| || ||||||||||| ||||| | |
Sbjct: 1141 agttttagtgcaaagtcaagaagtctagcattgtcgtcaagctttgccctgtgtgcaagt 1082

                                                  
Query: 581  ccagtagaccatgcaaagattgacgcaatgctgtttgt 618
            ||  | | ||| ||||||||||| ||||||||||||||
Sbjct: 1081 cctctggtccaagcaaagattgaagcaatgctgtttgt 1044



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 388  ctcctcagcaaccgcatcaatgaactc 414
            |||| ||||||||||||||||||||||
Sbjct: 1277 ctccgcagcaaccgcatcaatgaactc 1251



to top

>dbj|AP003212.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
           BAC clone:OSJNBa0049H05
          Length = 161934

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                       
Query: 461 agaagagctaggtcctttgtcatctttccagattccactgtccccacacaagcagcttca 520
           |||||||| ||||| || |||||||| ||||||||||| || || || ||||||||||||
Sbjct: 626 agaagagcaaggtctttggtcatcttcccagattccacggttccaacgcaagcagcttca 685

                 
Query: 521 agtttt 526
           ||||||
Sbjct: 686 agtttt 691



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 388 ctcctcagcaaccgcatcaatgaactc 414
           |||| ||||||||||||||||||||||
Sbjct: 432 ctccgcagcaaccgcatcaatgaactc 458



 Score = 44.1 bits (22), Expect = 0.54
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 593 gcaaagattgacgcaatgctgtttgt 618
           ||||||||||| ||||||||||||||
Sbjct: 966 gcaaagattgaagcaatgctgtttgt 991



to top

>dbj|AP003709.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:OSJNBb0006H05
          Length = 154821

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                          
Query: 461    agaagagctaggtcctttgtcatctttccagattccactgtccccacacaagcagcttca 520
              |||||||| ||||| || |||||||| ||||||||||| || || || ||||||||||||
Sbjct: 135531 agaagagcaaggtctttggtcatcttcccagattccacggttccaacgcaagcagcttca 135590

                    
Query: 521    agtttt 526
              ||||||
Sbjct: 135591 agtttt 135596



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 388    ctcctcagcaaccgcatcaatgaactc 414
              |||| ||||||||||||||||||||||
Sbjct: 135337 ctccgcagcaaccgcatcaatgaactc 135363



 Score = 44.1 bits (22), Expect = 0.54
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 593    gcaaagattgacgcaatgctgtttgt 618
              ||||||||||| ||||||||||||||
Sbjct: 135871 gcaaagattgaagcaatgctgtttgt 135896



to top

>ref|XM_473117.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1407

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 133/167 (79%)
 Strand = Plus / Minus

                                                                        
Query: 452  ccatggatgagaagagctaggtcctttgtcatctttccagattccactgtccccacacaa 511
            |||||||| || || || || |||||||||||||| || ||||| |||||  | | ||| 
Sbjct: 1307 ccatggataaggagtgcaagatcctttgtcatcttccccgattcaactgtttcaatacat 1248

                                                                        
Query: 512  gcagcttcaagtttttgtgtgaaatccaacagtcttttgttgtcatccagctttgcccta 571
            |||| ||||||||| | ||||||||||| ||| || |  || | |||||||||||| |||
Sbjct: 1247 gcagattcaagtttctttgtgaaatccagcagcctatcatttttatccagctttgctcta 1188

                                                           
Query: 572  tgtgctaatccagtagaccatgcaaagattgacgcaatgctgtttgt 618
            ||| ||| ||||  || ||| ||||| || || |||||||| |||||
Sbjct: 1187 tgttctagtccacgagtccaagcaaatatagaagcaatgctatttgt 1141



to top

>gb|BT016882.1| Zea mays clone Contig715 mRNA sequence
          Length = 1851

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 97/119 (81%)
 Strand = Plus / Plus

                                                                       
Query: 452 ccatggatgagaagagctaggtcctttgtcatctttccagattccactgtccccacacaa 511
           |||||||| | ||| || ||| |||| ||||| || ||||||||||| ||  | ||||| 
Sbjct: 360 ccatggataaaaagcgcaagggccttagtcattttcccagattccaccgtttcaacacat 419

                                                                      
Query: 512 gcagcttcaagtttttgtgtgaaatccaacagtcttttgttgtcatccagctttgccct 570
           |||| ||||||||| ||||||||||||| ||| || |  || | |||||||||||||||
Sbjct: 420 gcagattcaagtttgtgtgtgaaatccagcagactatcatttttatccagctttgccct 478



to top

>dbj|AK070042.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023038I06, full
            insert sequence
          Length = 1765

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 133/167 (79%)
 Strand = Plus / Minus

                                                                        
Query: 452  ccatggatgagaagagctaggtcctttgtcatctttccagattccactgtccccacacaa 511
            |||||||| || || || || |||||||||||||| || ||||| |||||  | | ||| 
Sbjct: 1389 ccatggataaggagtgcaagatcctttgtcatcttccccgattcaactgtttcaatacat 1330

                                                                        
Query: 512  gcagcttcaagtttttgtgtgaaatccaacagtcttttgttgtcatccagctttgcccta 571
            |||| ||||||||| | ||||||||||| ||| || |  || | |||||||||||| |||
Sbjct: 1329 gcagattcaagtttctttgtgaaatccagcagcctatcatttttatccagctttgctcta 1270

                                                           
Query: 572  tgtgctaatccagtagaccatgcaaagattgacgcaatgctgtttgt 618
            ||| ||| ||||  || ||| ||||| || || |||||||| |||||
Sbjct: 1269 tgttctagtccacgagtccaagcaaatatagaagcaatgctatttgt 1223



to top

>gb|AF155334.1|AF155334 Oryza sativa NADP-specific isocitrate dehydrogenase mRNA, complete
            cds
          Length = 1503

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                        
Query: 551  ttgtcatccagctttgccctatgtgctaatccagtagaccatgcaaagattgacgcaatg 610
            |||||||| ||||||||||| ||||| | |||  | | ||| ||||||||||| ||||||
Sbjct: 1129 ttgtcatctagctttgccctgtgtgcaagtcctcttgtccaggcaaagattgaggcaatg 1070

                    
Query: 611  ctgtttgt 618
            ||||||||
Sbjct: 1069 ctgtttgt 1062



to top

>ref|NM_104312.2| Arabidopsis thaliana ICDH (isocitrate dehydrogenase); isocitrate
            dehydrogenase (NADP+)/ oxidoreductase AT1G54340 (ICDH)
            mRNA, complete cds
          Length = 1571

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                        
Query: 455  tggatgagaagagctaggtcctttgtcatctttccagattccactgtccccacacaagca 514
            ||||| ||||||||||| ||||| ||||| || ||||| ||||| |||||||  ||||| 
Sbjct: 1185 tggatcagaagagctagatccttggtcattttgccagactccaccgtccccatgcaagct 1126

                       
Query: 515  gcttcaagttt 525
            ||||| |||||
Sbjct: 1125 gcttctagttt 1115



to top

>gb|AC005287.4| Arabidopsis thaliana chromosome I BAC F20D21 genomic sequence, complete
             sequence
          Length = 143186

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                         
Query: 455   tggatgagaagagctaggtcctttgtcatctttccagattccactgtccccacacaagca 514
             ||||| ||||||||||| ||||| ||||| || ||||| ||||| |||||||  ||||| 
Sbjct: 57809 tggatcagaagagctagatccttggtcattttgccagactccaccgtccccatgcaagct 57750

                        
Query: 515   gcttcaagttt 525
             ||||| |||||
Sbjct: 57749 gcttctagttt 57739



to top

>emb|BX818521.1|CNS0AE6Z Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL83ZG01 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 679

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 455 tggatgagaagagctaggtcctttgtcatctttccagattccactgtccccacacaagca 514
           ||||| ||||||||||| ||||| ||||| || ||||| ||||| |||||||  ||||| 
Sbjct: 294 tggatcagaagagctagatccttggtcattttgccagactccaccgtccccatgcaagct 235

                      
Query: 515 gcttcaagttt 525
           ||||| |||||
Sbjct: 234 gcttctagttt 224



to top

>gb|AF316501.1|AF316501 Arabidopsis thaliana NADP-specific isocitrate dehydrogenase (ICDH)
            mRNA, complete cds
          Length = 1551

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                        
Query: 455  tggatgagaagagctaggtcctttgtcatctttccagattccactgtccccacacaagca 514
            ||||| ||||||||||| ||||| ||||| || ||||| ||||| |||||||  ||||| 
Sbjct: 1165 tggatcagaagagctagatccttggtcattttgccagactccaccgtccccatgcaagct 1106

                       
Query: 515  gcttcaagttt 525
            ||||| |||||
Sbjct: 1105 gcttctagttt 1095



to top

>ref|NM_105265.2| Arabidopsis thaliana isocitrate dehydrogenase (NADP+)/ oxidoreductase
            AT1G65930 mRNA, complete cds
          Length = 1663

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 100/125 (80%)
 Strand = Plus / Minus

                                                                        
Query: 494  tccactgtccccacacaagcagcttcaagtttttgtgtgaaatccaacagtcttttgttg 553
            ||||||||||| |||||||| ||||| || || |  ||||||||||| ||| ||  ||||
Sbjct: 1267 tccactgtcccaacacaagcggcttccagcttctcagtgaaatccaagagttttgcgttg 1208

                                                                        
Query: 554  tcatccagctttgccctatgtgctaatccagtagaccatgcaaagattgacgcaatgctg 613
            ||||| | ||| ||||| ||||| | ||||  || ||| ||||| || || || ||||||
Sbjct: 1207 tcatctaacttagccctgtgtgcaagtccacgagtccaagcaaaaatagaggctatgctg 1148

                 
Query: 614  tttgt 618
            |||||
Sbjct: 1147 tttgt 1143



to top

>emb|AJ437268.1|ATH437268 Arabidopsis thaliana mRNA for isocitrate dehydrogenase
          Length = 1610

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 100/125 (80%)
 Strand = Plus / Minus

                                                                        
Query: 494  tccactgtccccacacaagcagcttcaagtttttgtgtgaaatccaacagtcttttgttg 553
            ||||||||||| |||||||| ||||| || || |  ||||||||||| ||| ||  ||||
Sbjct: 1267 tccactgtcccaacacaagcggcttccagcttctcagtgaaatccaagagttttgcgttg 1208

                                                                        
Query: 554  tcatccagctttgccctatgtgctaatccagtagaccatgcaaagattgacgcaatgctg 613
            ||||| | ||| ||||| ||||| | ||||  || ||| ||||| || || || ||||||
Sbjct: 1207 tcatctaacttagccctgtgtgcaagtccacgagtccaagcaaaaatagaggctatgctg 1148

                 
Query: 614  tttgt 618
            |||||
Sbjct: 1147 tttgt 1143



to top

>gb|AC122587.5| Rattus norvegicus  BAC CH230-173H6 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 202972

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 25     tactccagcttatttctttggtaca 49
              |||||||||||||||||||||||||
Sbjct: 121919 tactccagcttatttctttggtaca 121895



to top

>gb|AY097340.1| Arabidopsis thaliana At1g65930/F12P19_10 mRNA, complete cds
          Length = 1233

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 100/125 (80%)
 Strand = Plus / Minus

                                                                        
Query: 494  tccactgtccccacacaagcagcttcaagtttttgtgtgaaatccaacagtcttttgttg 553
            ||||||||||| |||||||| ||||| || || |  ||||||||||| ||| ||  ||||
Sbjct: 1103 tccactgtcccaacacaagcggcttccagcttctcagtgaaatccaagagttttgcgttg 1044

                                                                        
Query: 554  tcatccagctttgccctatgtgctaatccagtagaccatgcaaagattgacgcaatgctg 613
            ||||| | ||| ||||| ||||| | ||||  || ||| ||||| || || || ||||||
Sbjct: 1043 tcatctaacttagccctgtgtgcaagtccacgagtccaagcaaaaatagaggctatgctg 984

                 
Query: 614  tttgt 618
            |||||
Sbjct: 983  tttgt 979



to top

>gb|AY093091.1| Arabidopsis thaliana similar to NADP-specific isocitrate
            dehydrogenase (At1g65930) mRNA, complete cds
          Length = 1551

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 100/125 (80%)
 Strand = Plus / Minus

                                                                        
Query: 494  tccactgtccccacacaagcagcttcaagtttttgtgtgaaatccaacagtcttttgttg 553
            ||||||||||| |||||||| ||||| || || |  ||||||||||| ||| ||  ||||
Sbjct: 1257 tccactgtcccaacacaagcggcttccagcttctcagtgaaatccaagagttttgcgttg 1198

                                                                        
Query: 554  tcatccagctttgccctatgtgctaatccagtagaccatgcaaagattgacgcaatgctg 613
            ||||| | ||| ||||| ||||| | ||||  || ||| ||||| || || || ||||||
Sbjct: 1197 tcatctaacttagccctgtgtgcaagtccacgagtccaagcaaaaatagaggctatgctg 1138

                 
Query: 614  tttgt 618
            |||||
Sbjct: 1137 tttgt 1133



to top

>gb|AF419575.1|AF419575 Arabidopsis thaliana At1g65930/F12P19_10 mRNA, complete cds
          Length = 1636

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 100/125 (80%)
 Strand = Plus / Minus

                                                                        
Query: 494  tccactgtccccacacaagcagcttcaagtttttgtgtgaaatccaacagtcttttgttg 553
            ||||||||||| |||||||| ||||| || || |  ||||||||||| ||| ||  ||||
Sbjct: 1256 tccactgtcccaacacaagcggcttccagcttctcagtgaaatccaagagttttgcgttg 1197

                                                                        
Query: 554  tcatccagctttgccctatgtgctaatccagtagaccatgcaaagattgacgcaatgctg 613
            ||||| | ||| ||||| ||||| | ||||  || ||| ||||| || || || ||||||
Sbjct: 1196 tcatctaacttagccctgtgtgcaagtccacgagtccaagcaaaaatagaggctatgctg 1137

                 
Query: 614  tttgt 618
            |||||
Sbjct: 1136 tttgt 1132



to top

>dbj|AK220845.1| Arabidopsis thaliana mRNA for NADP specific isocitrate
           dehydrogenase like protein, partial cds, clone:
           RAFL22-38-I02
          Length = 517

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 100/125 (80%)
 Strand = Plus / Minus

                                                                       
Query: 494 tccactgtccccacacaagcagcttcaagtttttgtgtgaaatccaacagtcttttgttg 553
           ||||||||||| |||||||| ||||| || || |  ||||||||||| ||| ||  ||||
Sbjct: 143 tccactgtcccaacacaagcggcttccagcttctcagtgaaatccaagagttttgcgttg 84

                                                                       
Query: 554 tcatccagctttgccctatgtgctaatccagtagaccatgcaaagattgacgcaatgctg 613
           ||||| | ||| ||||| ||||| | ||||  || ||| ||||| || || || ||||||
Sbjct: 83  tcatctaacttagccctgtgtgcaagtccacgagtccaagcaaaaatagaggctatgctg 24

                
Query: 614 tttgt 618
           |||||
Sbjct: 23  tttgt 19



to top

>gb|AY045631.1| Arabidopsis thaliana At1g65930/F12P19_10 mRNA, complete cds
          Length = 1653

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 100/125 (80%)
 Strand = Plus / Minus

                                                                        
Query: 494  tccactgtccccacacaagcagcttcaagtttttgtgtgaaatccaacagtcttttgttg 553
            ||||||||||| |||||||| ||||| || || |  ||||||||||| ||| ||  ||||
Sbjct: 1256 tccactgtcccaacacaagcggcttccagcttctcagtgaaatccaagagttttgcgttg 1197

                                                                        
Query: 554  tcatccagctttgccctatgtgctaatccagtagaccatgcaaagattgacgcaatgctg 613
            ||||| | ||| ||||| ||||| | ||||  || ||| ||||| || || || ||||||
Sbjct: 1196 tcatctaacttagccctgtgtgcaagtccacgagtccaagcaaaaatagaggctatgctg 1137

                 
Query: 614  tttgt 618
            |||||
Sbjct: 1136 tttgt 1132



to top

>gb|BT002400.1| Arabidopsis thaliana isocitrate dehydrogenase, putative (At1g65930)
            mRNA, complete cds
          Length = 1581

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 100/125 (80%)
 Strand = Plus / Minus

                                                                        
Query: 494  tccactgtccccacacaagcagcttcaagtttttgtgtgaaatccaacagtcttttgttg 553
            ||||||||||| |||||||| ||||| || || |  ||||||||||| ||| ||  ||||
Sbjct: 1256 tccactgtcccaacacaagcggcttccagcttctcagtgaaatccaagagttttgcgttg 1197

                                                                        
Query: 554  tcatccagctttgccctatgtgctaatccagtagaccatgcaaagattgacgcaatgctg 613
            ||||| | ||| ||||| ||||| | ||||  || ||| ||||| || || || ||||||
Sbjct: 1196 tcatctaacttagccctgtgtgcaagtccacgagtccaagcaaaaatagaggctatgctg 1137

                 
Query: 614  tttgt 618
            |||||
Sbjct: 1136 tttgt 1132



to top

>dbj|AB019327.1| Daucus carota mRNA for NADP specific isocitrate dehydrogenase,
            complete cds
          Length = 1512

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 586  agaccatgcaaagattgacgcaatgctgtttgt 618
            |||||||||||||||||| || |||||||||||
Sbjct: 1109 agaccatgcaaagattgatgctatgctgtttgt 1077



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                        
Query: 464  agagctaggtcctttgtcatctttccagattccactgtccccacacaagcagcttcaagt 523
            ||||| || ||||| |||||||| ||||| ||||| || || ||||||||||| ||||| 
Sbjct: 1231 agagcaagatccttagtcatcttcccagactccacagtaccaacacaagcagcctcaagc 1172

                
Query: 524  tttt 527
            ||||
Sbjct: 1171 tttt 1168



to top

>emb|AJ973130.1| Andrographis paniculata partial idh gene for putative isocitrate
            dehydrogenase, exons 1-5, locus 1
          Length = 1264

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 452  ccatggatgagaagagctaggtcctttgtcatctttccagattc 495
            ||||||||||  || || || |||||||||||||||||||||||
Sbjct: 1142 ccatggatgatgagtgcaagatcctttgtcatctttccagattc 1099



to top

>emb|Y12540.1|AGIDHC A.graveolens mRNA for isocitrate dehydrogenase (NADP+)
          Length = 1535

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||||||||||||||| || |||||||||||
Sbjct: 1076 gaccatgcaaagattgatgctatgctgtttgt 1045



 Score = 44.1 bits (22), Expect = 0.54
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                  
Query: 463  aagagctaggtcctttgtcatctttccagattccactgtccccacacaagcagc 516
            |||||| |||||||| |||||| ||||||  ||||| || || |||||||||||
Sbjct: 1200 aagagcaaggtccttggtcatccttccagcctccacagtaccaacacaagcagc 1147



to top

>emb|AL662969.3|OSJN00169 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0043L24,
             complete sequence
          Length = 164577

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 72/88 (81%)
 Strand = Plus / Minus

                                                                         
Query: 452   ccatggatgagaagagctaggtcctttgtcatctttccagattccactgtccccacacaa 511
             |||||||| || || || || |||||||||||||| || ||||| |||||  | | ||| 
Sbjct: 94483 ccatggataaggagtgcaagatcctttgtcatcttccccgattcaactgtttcaatacat 94424

                                         
Query: 512   gcagcttcaagtttttgtgtgaaatcca 539
             |||| ||||||||| | |||||||||||
Sbjct: 94423 gcagattcaagtttctttgtgaaatcca 94396



to top

>emb|AJ437269.1|CSA437269 Cucumis sativus mRNA for isocitrate dehydrogenase
          Length = 1551

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                
Query: 463  aagagctaggtcctttgtcatctttccagattccac 498
            |||||| || ||||| ||||||||||||||||||||
Sbjct: 1192 aagagcaagatccttggtcatctttccagattccac 1157



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 389  tcctcagcaaccgcatcaatgaactcc 415
            ||||||||||| |||||||||||||||
Sbjct: 1266 tcctcagcaacagcatcaatgaactcc 1240



to top

>gb|AY997845.1| Aliciella hutchinsifolia voucher Johnson 96-069 WS clone 2
           isocitrate dehydrogenase gene, exons K-N and partial cds
          Length = 835

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 587 gaccatgcaaagattgacgcaatgctgtttgt 618
           ||||||||||||||||| || |||||||||||
Sbjct: 565 gaccatgcaaagattgaggctatgctgtttgt 534



to top

>gb|AY997844.1| Aliciella hutchinsifolia voucher Johnson 96-069 WS clone 1
           isocitrate dehydrogenase gene, exons K-N and partial cds
          Length = 835

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 587 gaccatgcaaagattgacgcaatgctgtttgt 618
           ||||||||||||||||| || |||||||||||
Sbjct: 565 gaccatgcaaagattgaggctatgctgtttgt 534



to top

>gb|AY997909.1| Saltugilia splendens subsp. grantii voucher Johnson 94-057 BRY clone
            10d isocitrate dehydrogenase gene, exons H-M and partial
            cds
          Length = 1564

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| |||||||||||||| |||||||||||
Sbjct: 1474 gaccaggcaaagattgacgctatgctgtttgt 1443



to top

>gb|AY997908.1| Saltugilia splendens subsp. grantii voucher Johnson 94-057 BRY clone
            10c isocitrate dehydrogenase gene, exons H-M and partial
            cds
          Length = 1564

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| |||||||||||||| |||||||||||
Sbjct: 1474 gaccaggcaaagattgacgctatgctgtttgt 1443



to top

>gb|AY997907.1| Saltugilia splendens subsp. grantii voucher Johnson 94-057 BRY clone
            10b isocitrate dehydrogenase gene, exons H-M and partial
            cds
          Length = 1564

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| |||||||||||||| |||||||||||
Sbjct: 1474 gaccaggcaaagattgacgctatgctgtttgt 1443



to top

>gb|AY997879.1| Aliciella hutchinsifolia voucher Johnson 93-069 WS isocitrate
            dehydrogenase gene, exons H-M and partial cds
          Length = 1434

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||||||||||||||| || |||||||||||
Sbjct: 1253 gaccatgcaaagattgaggctatgctgtttgt 1222



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 72/88 (81%)
 Strand = Plus / Minus

                                                                            
Query: 452      ccatggatgagaagagctaggtcctttgtcatctttccagattccactgtccccacacaa 511
                |||||||| || || || || |||||||||||||| || ||||| |||||  | | ||| 
Sbjct: 25367924 ccatggataaggagtgcaagatcctttgtcatcttccccgattcaactgtttcaatacat 25367865

                                            
Query: 512      gcagcttcaagtttttgtgtgaaatcca 539
                |||| ||||||||| | |||||||||||
Sbjct: 25367864 gcagattcaagtttctttgtgaaatcca 25367837



to top

>gb|AF176669.1|AF176669 Citrus limon NADP-isocitrate dehydrogenase mRNA, complete cds
          Length = 1708

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                        
Query: 452  ccatggatgagaagagctaggtcctttgtcatctttccagattccactgtccccacacaa 511
            |||||||| | ||| || || ||||| |||||||| |||||||| || || || ||||| 
Sbjct: 1305 ccatggataataagtgcaagatccttggtcatcttcccagattcaacagtgccaacacat 1246

                                            
Query: 512  gcagcttcaagtttttgtgtgaaatccaacag 543
            |||||||| ||||| |  || |||||||||||
Sbjct: 1245 gcagcttctagtttctcagtaaaatccaacag 1214



to top

>emb|X77944.1|NTNIDH N.tabacum (Xanthi) NADP-dependent Isocitrate dehydrogenase mRNA
          Length = 1584

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 131/167 (78%)
 Strand = Plus / Minus

                                                                        
Query: 452  ccatggatgagaagagctaggtcctttgtcatctttccagattccactgtccccacacaa 511
            |||||||||| ||| || || || || ||||||||||||||||| ||||  || |  || 
Sbjct: 1235 ccatggatgataagtgcaagatctttggtcatctttccagattcaactgcaccaatgcat 1176

                                                                        
Query: 512  gcagcttcaagtttttgtgtgaaatccaacagtcttttgttgtcatccagctttgcccta 571
            || || || ||||| |  || |||||||| || |||| |||||  || | | ||||||| 
Sbjct: 1175 gctgcctctagtttctcagtaaaatccaagagcctttcgttgttgtctaacgttgccctg 1116

                                                           
Query: 572  tgtgctaatccagtagaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| | ||||  || ||| ||||||||||||||||| ||||||||
Sbjct: 1115 tgtgcaagtccacgagtccaggcaaagattgacgcaatactgtttgt 1069



to top

>dbj|AB243085.1| Codonopsis lanceolata mRNA for NADP-isocitrate dehydrogenase,
            complete cds
          Length = 1500

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                        
Query: 473  tcctttgtcatctttccagattccactgtccccacacaagcagcttcaagtttttgtgtg 532
            |||||||||||||| || |||||||| || || | ||| || ||||| ||||| |  |||
Sbjct: 1221 tcctttgtcatcttccctgattccacagtgccaatacaggctgcttccagtttctcagtg 1162

                                                                        
Query: 533  aaatccaacagtcttttgttgtcatccagctttgccctatgtgctaatccagtagaccat 592
            |||||||| || ||    |||||||||| ||| ||||| || || | |||    | ||| 
Sbjct: 1161 aaatccaaaagcctagcattgtcatccaacttcgccctgtgggcaagtcctcgggtccag 1102

                                   
Query: 593  gcaaagattgacgcaatgctgtt 615
            |||||||||||||||||||||||
Sbjct: 1101 gcaaagattgacgcaatgctgtt 1079



to top

>gb|AY088129.1| Arabidopsis thaliana clone 41544 mRNA, complete sequence
          Length = 1554

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                        
Query: 494  tccactgtccccacacaagcagcttcaagtttttgtgtgaaatccaacagtcttttgttg 553
            ||||||||||| |||||||| ||||| || || |  ||||||||||| ||| ||  ||||
Sbjct: 1256 tccactgtcccaacacaagcggcttccagcttctcagtgaaatccaagagttttgcgttg 1197

                                   
Query: 554  tcatccagctttgccctatgtgc 576
            ||||| | ||| ||||| |||||
Sbjct: 1196 tcatctaacttagccctgtgtgc 1174



to top

>dbj|AB109115.1| Lupinus albus LaICDH2;1 mRNA for NADP-specific isocitrate
            dehydrogenase, complete cds
          Length = 1794

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                       
Query: 458  atgagaagagctaggtcctttgtcatctttccagattccactgtccccacacaagcagc 516
            |||||||| || || || || |||||||||||||| ||||||||| | ||||| |||||
Sbjct: 1406 atgagaagtgcaagatctttggtcatctttccagactccactgtctcaacacatgcagc 1348



to top

>gb|AY111226.1| Zea mays CL7227_-2 mRNA sequence
          Length = 536

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 589 ccatgcaaagattgacgcaatgctgtt 615
           ||||||||||||||| |||||||||||
Sbjct: 138 ccatgcaaagattgaagcaatgctgtt 112



to top

>gb|AC104284.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1735_C10,
              complete sequence
          Length = 187034

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 593    gcaaagattgacgcaatgctgtttgt 618
              ||||||||||| ||||||||||||||
Sbjct: 114512 gcaaagattgaggcaatgctgtttgt 114487



to top

>emb|AL445469.4| Human DNA sequence from clone RP11-254N18 on chromosome 1 Contains part
              of the ACBD6 gene for acyl-Coenzyme A binding domain
              containing 6 and a voltage-dependent anion channel 1
              (VDAC1) pseudogene, complete sequence
          Length = 129504

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 6      ttaaaatgtttaaataaagtactcca 31
              |||||||||||| |||||||||||||
Sbjct: 108420 ttaaaatgtttacataaagtactcca 108445



to top

>emb|X75638.1|STNICD S.tuberosum  mRNA for NADP-dependent isocitrate dehydrogenase
          Length = 1569

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 479  gtcatctttccagattccactg 500
            ||||||||||||||||||||||
Sbjct: 1192 gtcatctttccagattccactg 1171



to top

>gb|AY997906.1| Saltugilia splendens subsp. grantii voucher Johnson 94-057 BRY clone
            10a isocitrate dehydrogenase gene, exons H-M and partial
            cds
          Length = 1564

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 593  gcaaagattgacgcaatgctgtttgt 618
            |||||||||||||| |||||||||||
Sbjct: 1468 gcaaagattgacgctatgctgtttgt 1443



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                          
Query: 593      gcaaagattgacgcaatgctgtttgt 618
                ||||||||||| ||||||||||||||
Sbjct: 28330270 gcaaagattgaggcaatgctgtttgt 28330245



to top

>gb|AF095445.1|AF095445 Glycine max NADP-dependent isocitrate dehydrogenase (IDH1) mRNA,
            complete cds
          Length = 1827

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                        
Query: 473  tcctttgtcatctttccagattccactgtccccacacaagcagcttcaagtttttgtgtg 532
            |||||||||||||||||  |||| ||||| || |  ||||| ||||| ||||| | ||||
Sbjct: 1418 tcctttgtcatctttcccaattcaactgttccaatgcaagctgcttccagtttctctgtg 1359

                      
Query: 533  aaatccaaca 542
            || |||||||
Sbjct: 1358 aagtccaaca 1349



to top

>gb|BT017177.1| Zea mays clone EL01N0369B08.c mRNA sequence
          Length = 1434

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 551 ttgtcatccagctttgccctatgtgctaatccagtagaccatgcaaagattgacgcaatg 610
           |||||||| ||||||||||| ||||| | |||  | | ||| ||||||||||| ||||| 
Sbjct: 951 ttgtcatcaagctttgccctgtgtgcaagtcctcttgtccacgcaaagattgaggcaata 892

                
Query: 611 ctgtt 615
           |||||
Sbjct: 891 ctgtt 887



to top

>gb|AC125006.9| Mus musculus chromosome 3, clone RP24-157K20, complete sequence
          Length = 169078

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 25    tactccagcttatttctttgg 45
             |||||||||||||||||||||
Sbjct: 98329 tactccagcttatttctttgg 98349



to top

>gb|AC117721.8| Mus musculus chromosome 1, clone RP24-196D2, complete sequence
          Length = 170426

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 312    aggatcctaacaagtcacttg 332
              |||||||||||||||||||||
Sbjct: 145127 aggatcctaacaagtcacttg 145107



to top

>gb|AC135378.2| Mus musculus BAC clone RP24-284L24 from chromosome 16, complete
            sequence
          Length = 157430

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 25   tactccagcttatttctttgg 45
            |||||||||||||||||||||
Sbjct: 5870 tactccagcttatttctttgg 5850



to top

>gb|AC026232.4| Mus musculus strain C57BL6/J chromosome 5 clone RP23-396K2, complete
             sequence
          Length = 74340

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 121   aaactgaccaggaatttgatt 141
             |||||||||||||||||||||
Sbjct: 17214 aaactgaccaggaatttgatt 17194



to top

>gb|AC131786.3| Mus musculus BAC clone RP24-397H7 from chromosome 5, complete sequence
          Length = 176338

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 25     tactccagcttatttctttgg 45
              |||||||||||||||||||||
Sbjct: 173005 tactccagcttatttctttgg 173025



to top

>gb|AC147101.2| Mus musculus BAC clone RP23-455H16 from chromosome 12, complete sequence
          Length = 168258

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 25     tactccagcttatttctttgg 45
              |||||||||||||||||||||
Sbjct: 142390 tactccagcttatttctttgg 142410



to top

>gb|AC102769.11| Mus musculus chromosome 17, clone RP23-89A3, complete sequence
          Length = 162417

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 25     tactccagcttatttctttgg 45
              |||||||||||||||||||||
Sbjct: 118683 tactccagcttatttctttgg 118663



to top

>gb|AC117230.3| Mus musculus BAC clone RP23-385F15 from 16, complete sequence
          Length = 184556

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 25    tactccagcttatttctttgg 45
             |||||||||||||||||||||
Sbjct: 54174 tactccagcttatttctttgg 54194



to top

>gb|AC110169.7| Mus musculus chromosome 9, clone RP23-233D3, complete sequence
          Length = 193041

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 12     tgtttaaataaagtactccag 32
              |||||||||||||||||||||
Sbjct: 114146 tgtttaaataaagtactccag 114166



to top

>gb|AC132565.28| Medicago truncatula clone mth2-4a8, complete sequence
          Length = 134155

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                      
Query: 374   aatcttgtcctcaactcctcagcaaccgcatcaatgaactc 414
             |||||||| |||| |||||| || || ||||||||||||||
Sbjct: 32170 aatcttgttctcagctcctcggctacggcatcaatgaactc 32130



to top

>gb|AE016795.2| Vibrio vulnificus CMCP6 chromosome I complete sequence
          Length = 3281944

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 445     agttggcccatggatgagaag 465
               |||||||||||||||||||||
Sbjct: 2220543 agttggcccatggatgagaag 2220563



to top

>gb|AC158960.4| Mus musculus chromosome 1, clone RP23-315O2, complete sequence
          Length = 176947

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 312   aggatcctaacaagtcacttg 332
             |||||||||||||||||||||
Sbjct: 86457 aggatcctaacaagtcacttg 86477



to top

>gb|AC157792.4| Mus musculus chromosome 7, clone RP24-192N20, complete sequence
          Length = 164990

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 25    tactccagcttatttctttgg 45
             |||||||||||||||||||||
Sbjct: 50173 tactccagcttatttctttgg 50153



to top

>emb|AL669912.7| Mouse DNA sequence from clone RP23-147K24 on chromosome 11 Contains a
              serine/threonine kinase 16 (Stk16) pseudogene pseudogene,
              complete sequence
          Length = 174954

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 25     tactccagcttatttctttgg 45
              |||||||||||||||||||||
Sbjct: 157138 tactccagcttatttctttgg 157118



to top

>gb|AF510423.1|AF510423S1 Homo sapiens chromosome 5 BAC clone TAR28, 5' sequence
          Length = 67197

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 471   ggtcctttgtcatctttccag 491
             |||||||||||||||||||||
Sbjct: 49772 ggtcctttgtcatctttccag 49792



to top

>dbj|BA000037.2| Vibrio vulnificus YJ016 DNA, chromosome I, complete sequence
          Length = 3354505

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 445     agttggcccatggatgagaag 465
               |||||||||||||||||||||
Sbjct: 2156897 agttggcccatggatgagaag 2156877



to top

>gb|AC119807.11| Mus musculus chromosome 8, clone RP23-167I14, complete sequence
          Length = 203248

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 25     tactccagcttatttctttgg 45
              |||||||||||||||||||||
Sbjct: 126997 tactccagcttatttctttgg 127017



to top

>gb|AC091825.4| Homo sapiens chromosome 5 clone CTC-463A16, complete sequence
          Length = 200655

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 471    ggtcctttgtcatctttccag 491
              |||||||||||||||||||||
Sbjct: 101340 ggtcctttgtcatctttccag 101320



to top

>gb|AC007677.3| Homo sapiens BAC clone RP11-86N1 from 2, complete sequence
          Length = 166949

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 6     ttaaaatgtttaaataaagta 26
             |||||||||||||||||||||
Sbjct: 75166 ttaaaatgtttaaataaagta 75186



to top

>emb|AL732501.8| Mouse DNA sequence from clone RP23-325I22 on chromosome X, complete
              sequence
          Length = 206856

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 25     tactccagcttatttctttgg 45
              |||||||||||||||||||||
Sbjct: 149129 tactccagcttatttctttgg 149109



to top

>gb|AC009513.2|F12P19 Sequence of BAC F12P19 from Arabidopsis thaliana chromosome 1, complete
             sequence
          Length = 81490

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                         
Query: 494   tccactgtccccacacaagcagcttcaagtttttgtgtgaaatccaacagtcttttgttg 553
             ||||||||||| |||||||| ||||| || || |  ||||||||||| ||| ||  ||||
Sbjct: 47017 tccactgtcccaacacaagcggcttccagcttctcagtgaaatccaagagttttgcgttg 46958

                  
Query: 554   tcatc 558
             |||||
Sbjct: 46957 tcatc 46953



to top

>gb|AY107138.1| Zea mays PCO115488 mRNA sequence
          Length = 1634

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                        
Query: 551  ttgtcatccagctttgccctatgtgctaatccagtagaccatgcaaagattgacgcaatg 610
            |||||||| ||||||||||| ||||| | |||  | | ||| ||||||||||| ||||| 
Sbjct: 1174 ttgtcatcaagctttgccctgtgtgcaagtcctcttgtccacgcaaagattgaggcaata 1115

                 
Query: 611  ctgtt 615
            |||||
Sbjct: 1114 ctgtt 1110



to top

>gb|AC026949.21| Mus musculus chromosome 7, clone RP23-103E11, complete sequence
          Length = 221070

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 25    tactccagcttatttctttgg 45
             |||||||||||||||||||||
Sbjct: 30998 tactccagcttatttctttgg 30978



to top

>gb|AC118685.10| Mus musculus chromosome 5, clone RP23-412L2, complete sequence
          Length = 200341

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 25    tactccagcttatttctttgg 45
             |||||||||||||||||||||
Sbjct: 37493 tactccagcttatttctttgg 37513



to top

>gb|AC120438.9| Mus musculus chromosome 7, clone RP24-572G2, complete sequence
          Length = 169442

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 25     tactccagcttatttctttgg 45
              |||||||||||||||||||||
Sbjct: 151589 tactccagcttatttctttgg 151569



to top

>gb|AC101950.11| Mus musculus chromosome 1, clone RP24-149K4, complete sequence
          Length = 161262

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 25    tactccagcttatttctttgg 45
             |||||||||||||||||||||
Sbjct: 54973 tactccagcttatttctttgg 54993



to top

>gb|AC132422.3| Mus musculus BAC clone RP23-302G15 from 12, complete sequence
          Length = 151358

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 25    tactccagcttatttctttgg 45
             |||||||||||||||||||||
Sbjct: 49029 tactccagcttatttctttgg 49049



to top

>gb|AC148005.3| Mus musculus BAC clone RP23-295O6 from 12, complete sequence
          Length = 151918

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 25    tactccagcttatttctttgg 45
             |||||||||||||||||||||
Sbjct: 69302 tactccagcttatttctttgg 69282



to top

>emb|CT025641.10| Mouse DNA sequence from clone RP24-322A17 on chromosome 17, complete
             sequence
          Length = 122522

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 25    tactccagcttatttctttgg 45
             |||||||||||||||||||||
Sbjct: 36641 tactccagcttatttctttgg 36621



to top

>gb|AC149281.2| Mus musculus BAC clone RP23-287D14 from 19, complete sequence
          Length = 188944

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 25    tactccagcttatttctttgg 45
             |||||||||||||||||||||
Sbjct: 69406 tactccagcttatttctttgg 69386



to top

>gb|AC173346.1| Mus musculus BAC clone RP23-42N8 from chromosome 9, complete sequence
          Length = 219266

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 12    tgtttaaataaagtactccag 32
             |||||||||||||||||||||
Sbjct: 19701 tgtttaaataaagtactccag 19681



to top

>emb|AL626771.9| Mouse DNA sequence from clone RP23-281O10 on chromosome 4, complete
             sequence
          Length = 185594

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 25    tactccagcttatttctttgg 45
             |||||||||||||||||||||
Sbjct: 64044 tactccagcttatttctttgg 64064



to top

>gb|AC130561.11| Rattus norvegicus  BAC CH230-161F3 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 161423

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 26     actccagcttatttctttgg 45
              ||||||||||||||||||||
Sbjct: 121160 actccagcttatttctttgg 121141



to top

>ref|XM_420025.1| PREDICTED: Gallus gallus similar to zinc finger protein 395;
           Huntingtons disease gene regulatory region-binding
           protein 2; papillomavirus regulatory factor PRF-1
           (LOC422018), mRNA
          Length = 553

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 487 tccagattccactgtccccacaca 510
           ||||||||||| ||||||||||||
Sbjct: 165 tccagattccagtgtccccacaca 188



to top

>gb|AC099589.12| Mus musculus chromosome 1, clone RP23-337A19, complete sequence
          Length = 264062

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 4     cattaaaatgtttaaataaa 23
             ||||||||||||||||||||
Sbjct: 22979 cattaaaatgtttaaataaa 22960



to top

>gb|AC127027.13| Mus musculus chromosome 5, clone RP23-236G19, complete sequence
          Length = 195654

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 351    ttcataactttgattttgcggacaatct 378
              ||||||||||||||||||| | ||||||
Sbjct: 167695 ttcataactttgattttgcagccaatct 167668



to top

>gb|AY509880.1| Pisum sativum NADP-dependent isocitrate dehydrogenase mRNA, complete
            cds
          Length = 1564

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 551  ttgtcatccagctttgccctatgtgcta 578
            |||||||| |||||||||||||| ||||
Sbjct: 1130 ttgtcatctagctttgccctatgggcta 1103



to top

>emb|AJ973131.1| Andrographis paniculata partial idh gene for putative isocitrate
           dehydrogenase, exons 1-5, locus 2
          Length = 730

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 447 ttggcccatggatgagaagagctaggtcctttgtcatctttccagattccac 498
           ||||||| || ||||| | ||| ||||| ||||||||||| || ||||||||
Sbjct: 607 ttggcccgtgaatgaggatagcaaggtcttttgtcatcttgcccgattccac 556



to top

>emb|BX005428.7| Human DNA sequence from clone DASS-38I7 on chromosome 6, complete
             sequence
          Length = 130934

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    tgatttggacatcactatga 107
             ||||||||||||||||||||
Sbjct: 33871 tgatttggacatcactatga 33852



to top

>emb|AL844851.4| Human DNA sequence from clone DAQB-335A13 on chromosome 6 Contains the
             HCP5P15 pseudogene for HLA complex P5 pseudogene 15, the
             HLA-F gene for major histocompatibility complex, class I,
             F, the RPL23AP1 pseudogene for ribosomal protein L23a 1,
             the DAQB-335A13.8 locus for novel transcripts sharing
             homology with MICE, the MICE pseudogene for MHC class I
             polypeptide-related sequence E, the HCG9P5 pseudogene for
             HLA complex group 9 pseudogene 5, the IFITM4P pseudogene
             for interferon induced transmembrane protein 4, the
             HCP5P14 pseudogene for HLA complex P5 pseudogene 14, the
             HCG4 gene for HLA complex group 4, the HCP5P13 pseudogene
             for HLA complex P5 pseudogene 13, the DAQB-335A13.14 locus
             for novel transcripts that share homology with HLA-75, the
             pseudogene HLA-75, the HLA-90 pseudogene, the RPL7AP7
             pseudogene for ribosomal protein L7a pseudogene 7, the
             MICG pseudogene for MHC class I polypeptide-related
             sequence G, and 4 CpG islands, complete sequence
          Length = 119030

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    tgatttggacatcactatga 107
             ||||||||||||||||||||
Sbjct: 23914 tgatttggacatcactatga 23895



to top

>emb|AL669813.6| Human DNA sequence from clone XXbac-231I11 on chromosome 6 contains the
             3' end of the gene for myelin oligodendrocyte glycoprotein
             (MOG), a novel KRAB box-containing C2H2 type zinc finger
             protein (fragment), a P5-1 pseudogene, the HLA-F gene for
             major histocompatibility complex, class I, F (HLAF,
             HLA-5.4, HLA-CDA12), a 60S ribosomal protein L23A (RPL23A)
             pseudogene, a MHC class 1 polypeptide-related sequence B
             (MICB) pseudogene, a HCGIX pseudogene, a
             interferon-induced transmembrane protein 3 (IFITM3, 1-8U)
             pseudogene and four CpG islands, complete sequence
          Length = 115133

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    tgatttggacatcactatga 107
             ||||||||||||||||||||
Sbjct: 46736 tgatttggacatcactatga 46717



to top

>emb|AL645939.6| Human DNA sequence from clone XXbac-170G13 on chromosome 6 contains two
             P5-1 pseudogenes, the HLA-F gene for major
             histocompatibility complex, class I, F, a ribosomal
             protein L23A (RPL23A) pseudogene, a MHC class 1
             polypeptide-related sequence B (MICB) pseudogene, a HCGIX
             pseudogene, a interferon-induced transmembrane protein 3
             (IFITM3) pseudogene, a HLA (MHC class 1) pseudogene, a
             putative novel MHC class 1 (HLA) protein, a 60S ribosomal
             protein L7A (RPL7A) pseudogene and five CpG islands,
             complete sequence
          Length = 123768

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    tgatttggacatcactatga 107
             ||||||||||||||||||||
Sbjct: 13132 tgatttggacatcactatga 13113



to top

>gb|AC067746.7| Homo sapiens chromosome 10 clone RP11-408L20, complete sequence
          Length = 189545

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 494   tccactgtccccacacaagc 513
             ||||||||||||||||||||
Sbjct: 83794 tccactgtccccacacaagc 83813



to top

>gb|AC094241.9| Rattus norvegicus 1 BAC CH230-3C7 (Children's Hospital Oakland
            Research Institute) complete sequence
          Length = 215638

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 3    acattaaaatgtttaaataa 22
            ||||||||||||||||||||
Sbjct: 1714 acattaaaatgtttaaataa 1733



to top

>emb|AL022723.4|HS377H14 Human DNA sequence from clone RP3-377H14 on chromosome 6p21.32-22.1
              Contains the HLA-G gene for major histocompatibility
              complex class I G (HLA 6.0) an MHC class I pseudogene, an
              RPL7A (60S Ribosomal Protein L7A) pseudogene, a gene for a
              novel MHC class 1 protein, an interferon-inducible protein
              1-8U pseudogene, an RPL23A (60S Ribosomal Protein L23A)
              pseudogene, an HCGIX pseudogene, an MICB or PERB11.1
              pseudogene,the HLA-F gene for major histocompatibility
              complex class I F (CDA12), and four P5-1 pseudogenes.
              Contains EST, STSs, GSS and six CpG islands, complete
              sequence
          Length = 148834

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 88     tgatttggacatcactatga 107
              ||||||||||||||||||||
Sbjct: 124563 tgatttggacatcactatga 124582



to top

>emb|CR759790.7| Human DNA sequence from clone DAMC-335E20 on chromosome 6, complete
             sequence
          Length = 44002

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    tgatttggacatcactatga 107
             ||||||||||||||||||||
Sbjct: 36702 tgatttggacatcactatga 36683



to top

>emb|CR753818.5| Human DNA sequence from clone DADB-68M4 on chromosome 6, complete
            sequence
          Length = 37833

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 88   tgatttggacatcactatga 107
            ||||||||||||||||||||
Sbjct: 5927 tgatttggacatcactatga 5908



to top

>emb|AL645903.8| Mouse DNA sequence from clone RP23-179M4 on chromosome 11, complete
             sequence
          Length = 181669

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 403   atcaatgaactccatggtgt 422
             ||||||||||||||||||||
Sbjct: 44488 atcaatgaactccatggtgt 44507



to top

>emb|BX322610.5| Zebrafish DNA sequence from clone CH211-245M13 in linkage group 25,
             complete sequence
          Length = 72706

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 5     attaaaatgtttaaataaag 24
             ||||||||||||||||||||
Sbjct: 11652 attaaaatgtttaaataaag 11633



to top

>gb|AF367443.1| Prunus persica clone Icdh1 NADP-dependent isocitrate dehydrogenase
            (icdh1) mRNA, complete cds
          Length = 1561

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 83/104 (79%)
 Strand = Plus / Minus

                                                                        
Query: 473  tcctttgtcatctttccagattccactgtccccacacaagcagcttcaagtttttgtgtg 532
            ||||| ||||| || ||||||||||| || || |  |||||  |||| ||||| || |||
Sbjct: 1130 tccttggtcattttcccagattccacagttccaatgcaagcttcttccagtttctgagtg 1071

                                                        
Query: 533  aaatccaacagtcttttgttgtcatccagctttgccctatgtgc 576
            |||||||| ||  ||   |||||||||| ||||||||| |||||
Sbjct: 1070 aaatccaaaagctttgcattgtcatccaactttgccctgtgtgc 1027



to top

>dbj|AB227395.1| Aspergillus oryzae cDNA, contig sequence: AoEST4262
          Length = 386

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 591 atgcaaagattgacgcaatg 610
           ||||||||||||||||||||
Sbjct: 141 atgcaaagattgacgcaatg 160



to top

>dbj|AP007159.1| Aspergillus oryzae RIB40 genomic DNA, SC026
          Length = 2324132

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 591     atgcaaagattgacgcaatg 610
               ||||||||||||||||||||
Sbjct: 2249637 atgcaaagattgacgcaatg 2249656



to top

>gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough, complete genome
          Length = 3570858

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 366     ttgcggacaatcttgtcctc 385
               ||||||||||||||||||||
Sbjct: 2775512 ttgcggacaatcttgtcctc 2775493



to top

>gb|AC131108.3| Mus musculus BAC clone RP23-351K24 from chromosome 16, complete
             sequence
          Length = 175409

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 529   tgtgaaatccaacagtcttt 548
             ||||||||||||||||||||
Sbjct: 73982 tgtgaaatccaacagtcttt 74001



to top

>gb|AY997878.1| Saltugilia splendens subsp. splendens voucher Johnson 97-121 BRY
           isocitrate dehydrogenase gene, exons K-N and partial cds
          Length = 974

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 587 gaccatgcaaagattgacgcaatgctgtttgt 618
           ||||| ||||||||||| || |||||||||||
Sbjct: 792 gaccaggcaaagattgatgctatgctgtttgt 761



to top

>gb|AY997877.1| Saltugilia splendens subsp. splendens voucher Johnson 97-102 BRY
           isocitrate dehydrogenase gene, exons K-M and partial cds
          Length = 932

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 587 gaccatgcaaagattgacgcaatgctgtttgt 618
           ||||| ||||||||||| || |||||||||||
Sbjct: 802 gaccaggcaaagattgaggctatgctgtttgt 771



to top

>gb|AY997876.1| Saltugilia splendens subsp. grantii voucher Johnson 96-008 BRY
           isocitrate dehydrogenase gene, exons K-N and partial cds
          Length = 974

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 587 gaccatgcaaagattgacgcaatgctgtttgt 618
           ||||| ||||||||||| || |||||||||||
Sbjct: 792 gaccaggcaaagattgatgctatgctgtttgt 761



to top

>gb|AY997874.1| Saltugilia latimeri voucher Johnson 92-021 WS isocitrate
           dehydrogenase gene, exons K-N and partial cds
          Length = 717

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 587 gaccatgcaaagattgacgcaatgctgtttgt 618
           ||||| ||||||||||| || |||||||||||
Sbjct: 483 gaccaggcaaagattgaggctatgctgtttgt 452



to top

>gb|AY997873.1| Saltugilia caruifolia voucher Johnson 97-100 BRY isocitrate
           dehydrogenase gene, exons K-N and partial cds
          Length = 1009

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 587 gaccatgcaaagattgacgcaatgctgtttgt 618
           ||||| ||||||||||| || |||||||||||
Sbjct: 794 gaccaggcaaagattgaggctatgctgtttgt 763



to top

>gb|AY997871.1| Saltugilia australis voucher Johnson 92-011 BRY isocitrate
           dehydrogenase gene, exons K-N and partial cds
          Length = 873

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 587 gaccatgcaaagattgacgcaatgctgtttgt 618
           ||||| ||||||||||| || |||||||||||
Sbjct: 481 gaccaagcaaagattgaggctatgctgtttgt 450



to top

>gb|AY997870.1| Saltugilia australis voucher Johnson 97-049 BRY isocitrate
           dehydrogenase gene, exons K-N and partial cds
          Length = 885

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 587 gaccatgcaaagattgacgcaatgctgtttgt 618
           ||||| ||||||||||| || |||||||||||
Sbjct: 482 gaccaagcaaagattgaggctatgctgtttgt 451



to top

>gb|AY997869.1| Navarretia mellita voucher Johnson 94-072 BRY isocitrate
           dehydrogenase gene, exons K-N and partial cds
          Length = 950

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 587 gaccatgcaaagattgacgcaatgctgtttgt 618
           ||||| ||||||||||| || |||||||||||
Sbjct: 492 gaccaggcaaagattgaagctatgctgtttgt 461



to top

>gb|AY997868.1| Navarretia leptalea voucher Johnson 93-131 BRY isocitrate
           dehydrogenase gene, exons K-N and partial cds
          Length = 730

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 587 gaccatgcaaagattgacgcaatgctgtttgt 618
           ||||| ||||||||||| || |||||||||||
Sbjct: 504 gaccaggcaaagattgaagctatgctgtttgt 473



to top

>gb|AY997867.1| Navarretia jepsonii voucher Johnson 96-011 BRY isocitrate
           dehydrogenase gene, exons K-N and partial cds
          Length = 942

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 587 gaccatgcaaagattgacgcaatgctgtttgt 618
           ||||| ||||||||||| || |||||||||||
Sbjct: 481 gaccaggcaaagattgaggctatgctgtttgt 450



to top

>gb|AY997866.1| Navarretia breweri voucher Johnson 93-101 WS isocitrate
           dehydrogenase gene, exons K-N and partial cds
          Length = 920

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 587 gaccatgcaaagattgacgcaatgctgtttgt 618
           ||||| ||||||||||| || |||||||||||
Sbjct: 503 gaccaggcaaagattgaagctatgctgtttgt 472



to top

>gb|AY997862.1| Lathrocasis tenerrima voucher Johnson 93-103 WS clone 2 isocitrate
           dehydrogenase gene, exons K-N and partial cds
          Length = 464

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 587 gaccatgcaaagattgacgcaatgctgtttgt 618
           ||||| ||||||||||| || |||||||||||
Sbjct: 308 gaccaggcaaagattgaggctatgctgtttgt 277



to top

>gb|AY997861.1| Lathrocasis tenerrima voucher Johnson 93-103 WS clone 1 isocitrate
           dehydrogenase gene, exons K-N and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 587 gaccatgcaaagattgacgcaatgctgtttgt 618
           ||||| ||||||||||| || |||||||||||
Sbjct: 322 gaccaggcaaagattgaggctatgctgtttgt 291



to top

>gb|AY997859.1| Gilia stellata voucher Johnson 97-006 BRY isocitrate dehydrogenase
           gene, exons K-N and partial cds
          Length = 793

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 587 gaccatgcaaagattgacgcaatgctgtttgt 618
           ||||| ||||||||||| || |||||||||||
Sbjct: 381 gaccaggcaaagattgaggctatgctgtttgt 350



to top

>gb|AY997858.1| Gilia scopulorum voucher Johnson304 BRY isocitrate dehydrogenase
           gene, exons K-N and partial cds
          Length = 1258

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 587 gaccatgcaaagattgacgcaatgctgtttgt 618
           ||||| ||||||||||| || |||||||||||
Sbjct: 467 gaccaggcaaagattgaggctatgctgtttgt 436



to top

>gb|AY997856.1| Gilia laciniata voucher Morrell 403 RSA clone 1 isocitrate
           dehydrogenase gene, exons K-N and partial cds
          Length = 567

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 587 gaccatgcaaagattgacgcaatgctgtttgt 618
           ||||| ||||||||||| || |||||||||||
Sbjct: 405 gaccaggcaaagattgaggctatgctgtttgt 374



to top

>gb|AY997855.1| Gilia capitata voucher Johnson 92-015 WS isocitrate dehydrogenase
           gene, exons K-N and partial cds
          Length = 842

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 587 gaccatgcaaagattgacgcaatgctgtttgt 618
           ||||| ||||||||||| || |||||||||||
Sbjct: 444 gaccaggcaaagattgaggctatgctgtttgt 413



to top

>gb|AY997853.1| Collomia tracyi voucher Johnson 94-075 BRY isocitrate dehydrogenase
           gene, exons K-M and partial cds
          Length = 667

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 587 gaccatgcaaagattgacgcaatgctgtttgt 618
           ||||| ||||||||||| || |||||||||||
Sbjct: 512 gaccaggcaaagattgaggctatgctgtttgt 481



to top

>gb|AY997852.1| Collomia heterophylla voucher Johnson 94-076 BRY isocitrate
           dehydrogenase gene, exons K-N and partial cds
          Length = 722

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 587 gaccatgcaaagattgacgcaatgctgtttgt 618
           ||||| ||||||||||| || |||||||||||
Sbjct: 502 gaccaggcaaagattgaggctatgctgtttgt 471



to top

>gb|AY997851.1| Collomia diversifolia voucher Johnson 96-013 BRY isocitrate
           dehydrogenase gene, exons K-N and partial cds
          Length = 713

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 587 gaccatgcaaagattgacgcaatgctgtttgt 618
           ||||| ||||||||||| || |||||||||||
Sbjct: 501 gaccaggcaaagattgaggctatgctgtttgt 470



to top

>gb|AY997850.1| Allophyllum integrifolium voucher Johnson 93-111 WS clone 2
           isocitrate dehydrogenase gene, exons K-N and partial cds
          Length = 673

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 587 gaccatgcaaagattgacgcaatgctgtttgt 618
           ||||| ||||||||||| || |||||||||||
Sbjct: 464 gaccaggcaaagattgaagctatgctgtttgt 433



to top

>gb|AY997849.1| Allophyllum integrifolium voucher Johnson 93-111 WS clone 1
           isocitrate dehydrogenase gene, exons K-N and partial cds
          Length = 673

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 587 gaccatgcaaagattgacgcaatgctgtttgt 618
           ||||| ||||||||||| || |||||||||||
Sbjct: 464 gaccaggcaaagattgaagctatgctgtttgt 433



to top

>gb|AY997847.1| Aliciella latifolia voucher Johnson 93-018 WS clone 2 isocitrate
           dehydrogenase gene, exons K-N and partial cds
          Length = 792

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 587 gaccatgcaaagattgacgcaatgctgtttgt 618
           ||||| ||||||||||| || |||||||||||
Sbjct: 510 gaccacgcaaagattgaggctatgctgtttgt 479



to top

>gb|AY997846.1| Aliciella latifolia voucher Johnson 93-018 WS clone 1 isocitrate
           dehydrogenase gene, exons K-N and partial cds
          Length = 838

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 587 gaccatgcaaagattgacgcaatgctgtttgt 618
           ||||| ||||||||||| || |||||||||||
Sbjct: 575 gaccacgcaaagattgaggctatgctgtttgt 544



to top

>gb|AY997843.1| Acanthogilia gloriosa voucher Johnson 95-070 WS isocitrate
           dehydrogenase gene, exons K-N and partial cds
          Length = 806

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 587 gaccatgcaaagattgacgcaatgctgtttgt 618
           ||||| ||||||||||| || |||||||||||
Sbjct: 518 gaccacgcaaagattgaggctatgctgtttgt 487



to top

>gb|AY997919.1| Saltugilia splendens subsp. splendens voucher Johnson 97-121 BRY
            isocitrate dehydrogenase gene, exons H-M and partial cds
          Length = 1564

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| ||||||||||| || |||||||||||
Sbjct: 1474 gaccaggcaaagattgatgctatgctgtttgt 1443



to top

>gb|AY997918.1| Saltugilia splendens subsp. splendens voucher Johnson 97-120 BRY
            isocitrate dehydrogenase gene, exons H-M and partial cds
          Length = 1553

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| ||||||||||| || |||||||||||
Sbjct: 1463 gaccaggcaaagattgatgctatgctgtttgt 1432



to top

>gb|AY997917.1| Saltugilia splendens subsp. splendens voucher Johnson 97-102 BRY
            isocitrate dehydrogenase gene, exons H-M and partial cds
          Length = 1605

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| ||||||||||| || |||||||||||
Sbjct: 1479 gaccaggcaaagattgaggctatgctgtttgt 1448



to top

>gb|AY997916.1| Saltugilia splendens subsp. grantii voucher Johnson 97-107 BRY
            isocitrate dehydrogenase gene, exons H-M and partial cds
          Length = 1564

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| ||||||||||| || |||||||||||
Sbjct: 1474 gaccaggcaaagattgatgctatgctgtttgt 1443



to top

>gb|AY997915.1| Saltugilia splendens subsp. grantii voucher Johnson 96-008 BRY
            isocitrate dehydrogenase gene, exons H-M and partial cds
          Length = 1564

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| ||||||||||| || |||||||||||
Sbjct: 1474 gaccaggcaaagattgatgctatgctgtttgt 1443



to top

>gb|AY997913.1| Saltugilia splendens subsp. grantii voucher Johnson 94-057 BRY clone
            9 isocitrate dehydrogenase gene, exons H-M and partial
            cds
          Length = 1564

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| ||||||||||| || |||||||||||
Sbjct: 1474 gaccaggcaaagattgatgctatgctgtttgt 1443



to top

>gb|AY997912.1| Saltugilia splendens subsp. grantii voucher Johnson 94-057 BRY clone
            13 isocitrate dehydrogenase gene, exons H-M and partial
            cds
          Length = 1562

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| ||||||||||| || |||||||||||
Sbjct: 1472 gaccaggcaaagattgatgctatgctgtttgt 1441



to top

>gb|AY997911.1| Saltugilia splendens subsp. grantii voucher Johnson 94-057 BRY clone
            12 isocitrate dehydrogenase gene, exons H-M and partial
            cds
          Length = 1542

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| ||||||||||| || |||||||||||
Sbjct: 1452 gaccaggcaaagattgatgctatgctgtttgt 1421



to top

>gb|AY997910.1| Saltugilia splendens subsp. grantii voucher Johnson 94-057 BRY clone
            11 isocitrate dehydrogenase gene, exons H-M and partial
            cds
          Length = 1542

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| ||||||||||| || |||||||||||
Sbjct: 1452 gaccaggcaaagattgatgctatgctgtttgt 1421



to top

>gb|AY997905.1| Saltugilia latimeri voucher Johnson 92-021 WS isocitrate
            dehydrogenase gene, exons H-M and partial cds
          Length = 1282

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| ||||||||||| || |||||||||||
Sbjct: 1140 gaccaggcaaagattgaggctatgctgtttgt 1109



to top

>gb|AY997904.1| Saltugilia latimeri voucher Grant 8840 RSA isocitrate dehydrogenase
            gene, exons H-M and partial cds
          Length = 1934

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| ||||||||||| || |||||||||||
Sbjct: 1624 gaccaagcaaagattgaggctatgctgtttgt 1593



to top

>gb|AY997903.1| Saltugilia caruifolia voucher Johnson 97-100 BRY clone 97100
            isocitrate dehydrogenase gene, exons H-M and partial cds
          Length = 1612

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| ||||||||||| || |||||||||||
Sbjct: 1482 gaccaggcaaagattgaggctatgctgtttgt 1451



to top

>gb|AY997902.1| Saltugilia caruifolia voucher Johnson 97-099 BRY clone 97099
            isocitrate dehydrogenase gene, exons H-M and partial cds
          Length = 1306

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| ||||||||||| || |||||||||||
Sbjct: 1163 gaccaggcaaagattgaggctatgctgtttgt 1132



to top

>gb|AY997901.1| Saltugilia caruifolia voucher Johnson 93-092 BRY clone 15c isocitrate
            dehydrogenase gene, exons H-M and partial cds
          Length = 1537

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| ||||||||||| || |||||||||||
Sbjct: 1166 gaccaggcaaagattgaggctatgctgtttgt 1135



to top

>gb|AY997900.1| Saltugilia caruifolia voucher Johnson 93-092 BRY clone 15b isocitrate
            dehydrogenase gene, exons H-M and partial cds
          Length = 1537

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| ||||||||||| || |||||||||||
Sbjct: 1166 gaccaggcaaagattgaggctatgctgtttgt 1135



to top

>gb|AY997899.1| Saltugilia caruifolia voucher Johnson 93-092 BRY clone 15a isocitrate
            dehydrogenase gene, exons H-M and partial cds
          Length = 1537

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| ||||||||||| || |||||||||||
Sbjct: 1166 gaccaggcaaagattgaggctatgctgtttgt 1135



to top

>gb|AY997898.1| Saltugilia caruifolia voucher Weese 01-032 BRY clone 01032 isocitrate
            dehydrogenase gene, exons H-M and partial cds
          Length = 1575

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| ||||||||||| || |||||||||||
Sbjct: 1435 gaccaggcaaagattgaggctatgctgtttgt 1404



to top

>gb|AY997897.1| Saltugilia australis voucher Johnson 97-082 BRY clone 97082
            isocitrate dehydrogenase gene, exons H-M and partial cds
          Length = 1470

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| ||||||||||| || |||||||||||
Sbjct: 1159 gaccaagcaaagattgaggctatgctgtttgt 1128



to top

>gb|AY997896.1| Saltugilia australis voucher Johnson 97-065 BRY clone 97065
            isocitrate dehydrogenase gene, exons H-M and partial cds
          Length = 1470

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| ||||||||||| || |||||||||||
Sbjct: 1159 gaccaagcaaagattgaggctatgctgtttgt 1128



to top

>gb|AY997895.1| Saltugilia australis voucher Johnson 92-011 BRY clone 9211 isocitrate
            dehydrogenase gene, exons H-M and partial cds
          Length = 1458

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| ||||||||||| || |||||||||||
Sbjct: 1158 gaccaagcaaagattgaggctatgctgtttgt 1127



to top

>gb|AY997894.1| Saltugilia australis voucher Johnson 97-049 BRY clone 41 isocitrate
            dehydrogenase gene, exons H-M and partial cds
          Length = 1469

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| ||||||||||| || |||||||||||
Sbjct: 1159 gaccaagcaaagattgaggctatgctgtttgt 1128



to top

>gb|AY997893.1| Saltugilia australis voucher Johnson 97-049 BRY clone 40 isocitrate
            dehydrogenase gene, exons H-M and partial cds
          Length = 1470

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| ||||||||||| || |||||||||||
Sbjct: 1159 gaccaagcaaagattgaggctatgctgtttgt 1128



to top

>gb|AY997892.1| Saltugilia australis voucher Johnson 97-049 BRY clone 39 isocitrate
            dehydrogenase gene, exons H-M and partial cds
          Length = 1470

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| ||||||||||| || |||||||||||
Sbjct: 1159 gaccaagcaaagattgaggctatgctgtttgt 1128



to top

>gb|AY997891.1| Saltugilia australis voucher Johnson 97-049 BRY clone 37 isocitrate
            dehydrogenase gene, exons H-M and partial cds
          Length = 1470

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| ||||||||||| || |||||||||||
Sbjct: 1159 gaccaagcaaagattgaggctatgctgtttgt 1128



to top

>gb|AY997890.1| Saltugilia australis voucher Johnson 97-049 BRY clone 36 isocitrate
            dehydrogenase gene, exons H-M and partial cds
          Length = 1470

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| ||||||||||| || |||||||||||
Sbjct: 1159 gaccaagcaaagattgaggctatgctgtttgt 1128



to top

>gb|AY997889.1| Navarretia leptalea voucher Johnson 93-131 BRY isocitrate
            dehydrogenase gene, exons H-M and partial cds
          Length = 1262

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| ||||||||||| || |||||||||||
Sbjct: 1137 gaccaggcaaagattgaagctatgctgtttgt 1106



to top

>gb|AY997887.1| Lathrocasis tenerrima voucher Johnson 93-103 WS isocitrate
           dehydrogenase gene, exons H-M and partial cds
          Length = 1046

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 587 gaccatgcaaagattgacgcaatgctgtttgt 618
           ||||| ||||||||||| || |||||||||||
Sbjct: 988 gaccaggcaaagattgaggctatgctgtttgt 957



to top

>gb|AY997885.1| Gilia stellata voucher Johnson 97-006 BRY isocitrate dehydrogenase
            gene, exons H-M and partial cds
          Length = 2016

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| ||||||||||| || |||||||||||
Sbjct: 1472 gaccaggcaaagattgaggctatgctgtttgt 1441



to top

>gb|AY997883.1| Gilia cana voucher Johnson 93-016 WS isocitrate dehydrogenase gene,
            exons H-M and partial cds
          Length = 2001

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| ||||||||||| || |||||||||||
Sbjct: 1459 gaccaggcaaagattgaggctatgctgtttgt 1428



to top

>gb|AY997881.1| Collomia tracyi voucher Johnson 94-075 BRY isocitrate dehydrogenase
            gene, exons H-M and partial cds
          Length = 1266

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| ||||||||||| || |||||||||||
Sbjct: 1143 gaccaggcaaagattgaggctatgctgtttgt 1112



to top

>gb|AY997880.1| Allophyllum integrifolium voucher Johnson 93-111 WS isocitrate
            dehydrogenase gene, exons H-M and partial cds
          Length = 1252

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 587  gaccatgcaaagattgacgcaatgctgtttgt 618
            ||||| ||||||||||| || |||||||||||
Sbjct: 1127 gaccaggcaaagattgaagctatgctgtttgt 1096



to top

>emb|BX927250.5| Human DNA sequence from clone DAMA-364L23 on chromosome 6, complete
             sequence
          Length = 92630

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    tgatttggacatcactatga 107
             ||||||||||||||||||||
Sbjct: 66258 tgatttggacatcactatga 66239



to top

>gb|AC026765.22| Homo sapiens 12 BAC RP4-601P9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 129225

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 5     attaaaatgtttaaataaag 24
             ||||||||||||||||||||
Sbjct: 67804 attaaaatgtttaaataaag 67823



to top

>dbj|BA000025.2| Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region
          Length = 2229817

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 88      tgatttggacatcactatga 107
               ||||||||||||||||||||
Sbjct: 2221447 tgatttggacatcactatga 2221466



to top

>emb|BX005464.7| Zebrafish DNA sequence from clone DKEY-24J21, complete sequence
          Length = 199639

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 5      attaaaatgtttaaataaag 24
              ||||||||||||||||||||
Sbjct: 115689 attaaaatgtttaaataaag 115708



to top

>gb|AF055066.1|AF055066 Homo sapiens MHC class 1 region
          Length = 319486

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 88     tgatttggacatcactatga 107
              ||||||||||||||||||||
Sbjct: 315993 tgatttggacatcactatga 316012



to top

>gb|BC082651.1| Xenopus laevis hypothetical LOC494713, mRNA (cDNA clone MGC:81807
            IMAGE:7007876), complete cds
          Length = 2264

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 587  gaccatgcaaagattgacgcaatg 610
            ||||||||||||||||| ||||||
Sbjct: 1040 gaccatgcaaagattgaagcaatg 1017



to top

>gb|AC004213.1|AC004213 Homo sapiens clone UWGC:y19c060 from 6p21, complete sequence
          Length = 41617

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 88    tgatttggacatcactatga 107
             ||||||||||||||||||||
Sbjct: 16003 tgatttggacatcactatga 16022



to top

>gb|AC133651.4| Mus musculus BAC clone RP24-239C15 from 1, complete sequence
          Length = 178756

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 4     cattaaaatgtttaaataaa 23
             ||||||||||||||||||||
Sbjct: 73271 cattaaaatgtttaaataaa 73290



to top

>gb|AC113480.8| Mus musculus chromosome 13, clone RP23-309D8, complete sequence
          Length = 181457

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   agctagacagcatcttcctt 193
             ||||||||||||||||||||
Sbjct: 25076 agctagacagcatcttcctt 25095



to top

>emb|AL772306.10| Mouse DNA sequence from clone RP23-89L15 on chromosome 4, complete
             sequence
          Length = 210648

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    tactccagcttatttctttg 44
             ||||||||||||||||||||
Sbjct: 28280 tactccagcttatttctttg 28299



to top

>gb|AC163663.3| Mus musculus BAC clone RP24-241H23 from chromosome 6, complete sequence
          Length = 176956

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 5     attaaaatgtttaaataaag 24
             ||||||||||||||||||||
Sbjct: 51967 attaaaatgtttaaataaag 51948



to top

>gb|M93672.1|ALFISDHYA Medicago sativa isocitrate dehydrogenase mRNA, 3' end cds
          Length = 1577

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 551  ttgtcatccagctttgccctatgtgcta 578
            ||||||||||| ||||||||||| ||||
Sbjct: 1117 ttgtcatccagttttgccctatgggcta 1090



to top

>dbj|AB023058.1| Homo sapiens genomic DNA, chromosome 6p21.3, HLA class I region,
              clone:950A3, complete sequence
          Length = 114450

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 88     tgatttggacatcactatga 107
              ||||||||||||||||||||
Sbjct: 106080 tgatttggacatcactatga 106099


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,466,200
Number of Sequences: 3902068
Number of extensions: 5466200
Number of successful extensions: 131630
Number of sequences better than 10.0: 176
Number of HSP's better than 10.0 without gapping: 174
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 131104
Number of HSP's gapped (non-prelim): 519
length of query: 618
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 595
effective length of database: 17,143,297,704
effective search space: 10200262133880
effective search space used: 10200262133880
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top