ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags23d13
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_190977.1| Oryza sativa (japonica cultivar-group), predic... 56 4e-05
2dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 56 4e-05
3dbj|AP003232.3| Oryza sativa (japonica cultivar-group) genomic D... 56 4e-05
4gb|DP000024.1| Eulemur macaco macaco target 1 genomic scaffold 40 2.5
5gb|AC172859.1| Brassica rapa subsp. pekinensis clone KBrB023K01,... 40 2.5
6gb|AC147083.2| Mus musculus BAC clone RP23-349M16 from chromosom... 38 9.8
7gb|AC117701.10| Mus musculus chromosome 16, clone RP23-463N5, co... 38 9.8
8gb|AC122051.2| Mus musculus BAC clone RP24-459B17 from 18, compl... 38 9.8
9gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 38 9.8
10gb|AC010314.6| Homo sapiens chromosome 5 clone CTB-83L16, comple... 38 9.8
11gb|AC121306.12| Mus musculus chromosome 3, clone RP24-100C12, co... 38 9.8
12dbj|AB094665.1| Seriola quinqueradiata YGHL1 gene for putative g... 38 9.8
13dbj|AB083198.1| Seriola quinqueradiata YGHL1 gene for hypoxia in... 38 9.8
14dbj|AB073640.1| Seriola quinqueradiata gene for yghl1, complete cds 38 9.8

>ref|NM_190977.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 480

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 64/76 (84%)
 Strand = Plus / Minus

                                                                       
Query: 123 tcccagtgggtgagtttgactttgtgcagaggatcttccttcctttgtcacgtctacgct 182
           |||||||||| ||||| | |||||||||||| | | | ||||||||| | ||||| ||||
Sbjct: 463 tcccagtgggggagttcgtctttgtgcagagaacccttcttcctttggcgcgtctgcgct 404

                           
Query: 183 tcagaacccttcttcc 198
           |||| ||| |||||||
Sbjct: 403 tcaggacctttcttcc 388



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                            
Query: 123      tcccagtgggtgagtttgactttgtgcagaggatcttccttcctttgtcacgtctacgct 182
                |||||||||| ||||| | |||||||||||| | | | ||||||||| | ||||| ||||
Sbjct: 34127268 tcccagtgggggagttcgtctttgtgcagagaacccttcttcctttggcgcgtctgcgct 34127327

                                
Query: 183      tcagaacccttcttcc 198
                |||| ||| |||||||
Sbjct: 34127328 tcaggacctttcttcc 34127343



to top

>dbj|AP003232.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0034E02
          Length = 165497

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                          
Query: 123    tcccagtgggtgagtttgactttgtgcagaggatcttccttcctttgtcacgtctacgct 182
              |||||||||| ||||| | |||||||||||| | | | ||||||||| | ||||| ||||
Sbjct: 123746 tcccagtgggggagttcgtctttgtgcagagaacccttcttcctttggcgcgtctgcgct 123805

                              
Query: 183    tcagaacccttcttcc 198
              |||| ||| |||||||
Sbjct: 123806 tcaggacctttcttcc 123821



to top

>gb|DP000024.1| Eulemur macaco macaco target 1 genomic scaffold
          Length = 1570569

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 98     acattgcgctgtaatcaata 117
              ||||||||||||||||||||
Sbjct: 944054 acattgcgctgtaatcaata 944035



to top

>gb|AC172859.1| Brassica rapa subsp. pekinensis clone KBrB023K01, complete sequence
          Length = 102061

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 133  tgagtttgactttgtgcaga 152
            ||||||||||||||||||||
Sbjct: 7777 tgagtttgactttgtgcaga 7758



to top

>gb|AC147083.2| Mus musculus BAC clone RP23-349M16 from chromosome 18, complete sequence
          Length = 211199

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 152    aggatcttccttcctttgt 170
              |||||||||||||||||||
Sbjct: 197663 aggatcttccttcctttgt 197681



to top

>gb|AC117701.10| Mus musculus chromosome 16, clone RP23-463N5, complete sequence
          Length = 170497

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 36    catggctgctgaacatggc 54
             |||||||||||||||||||
Sbjct: 93710 catggctgctgaacatggc 93692



to top

>gb|AC122051.2| Mus musculus BAC clone RP24-459B17 from 18, complete sequence
          Length = 177747

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 152  aggatcttccttcctttgt 170
            |||||||||||||||||||
Sbjct: 9928 aggatcttccttcctttgt 9946



to top

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 40      gctgctgaacatggcgtgc 58
               |||||||||||||||||||
Sbjct: 3229001 gctgctgaacatggcgtgc 3229019



to top

>gb|AC010314.6| Homo sapiens chromosome 5 clone CTB-83L16, complete sequence
          Length = 124861

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 152   aggatcttccttcctttgt 170
             |||||||||||||||||||
Sbjct: 83574 aggatcttccttcctttgt 83556



to top

>gb|AC121306.12| Mus musculus chromosome 3, clone RP24-100C12, complete sequence
          Length = 195059

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 34    aacatggctgctgaacatg 52
             |||||||||||||||||||
Sbjct: 79574 aacatggctgctgaacatg 79556



to top

>dbj|AB094665.1| Seriola quinqueradiata YGHL1 gene for putative growth hormone like
            protein-1, complete cds
          Length = 6658

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 119  tttgtcccagtgggtgagt 137
            |||||||||||||||||||
Sbjct: 2723 tttgtcccagtgggtgagt 2741



to top

>dbj|AB083198.1| Seriola quinqueradiata YGHL1 gene for hypoxia inducible gene homolog,
            complete cds
          Length = 2932

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 119  tttgtcccagtgggtgagt 137
            |||||||||||||||||||
Sbjct: 1166 tttgtcccagtgggtgagt 1184



to top

>dbj|AB073640.1| Seriola quinqueradiata gene for yghl1, complete cds
          Length = 2418

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 119 tttgtcccagtgggtgagt 137
           |||||||||||||||||||
Sbjct: 657 tttgtcccagtgggtgagt 675


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,992,924
Number of Sequences: 3902068
Number of extensions: 1992924
Number of successful extensions: 102407
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 102312
Number of HSP's gapped (non-prelim): 92
length of query: 198
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 176
effective length of database: 17,147,199,772
effective search space: 3017907159872
effective search space used: 3017907159872
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top