>gb|BT009232.1| Triticum aestivum clone wle1n.pk0102.g9:fis, full insert mRNA
           sequence
          Length = 1023

 Score = 61.9 bits (31), Expect = 3e-07
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                              
Query: 25  tggttccattcgaacaacagtaggcagaaactcag 59
           |||||||||||||||||||||||||| ||||||||
Sbjct: 949 tggttccattcgaacaacagtaggcacaaactcag 915

>gb|AC158601.5| Mus musculus 10 BAC RP23-119L9 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 249420

 Score = 42.1 bits (21), Expect = 0.30
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 68     atgattcatggatgatgatga 88
              |||||||||||||||||||||
Sbjct: 127080 atgattcatggatgatgatga 127060

>emb|AL627143.13| Human DNA sequence from clone RP11-14O9 on chromosome X Contains the
            3' end of the RP2 gene for retinitis pigmentosa 2
            (X-linked recessive), a novel gene, the 5' end of a novel
            gene (KIAA0215) and a CpG island, complete sequence
          Length = 81195

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 43   agtaggcagaaactcagcaaggat 66
            |||||||||||| |||||||||||
Sbjct: 1922 agtaggcagaaaatcagcaaggat 1899

>emb|AL050307.13|HSDJ689N3 Human DNA sequence from clone RP4-689N3 on chromosome Xp11.1-11.4
           Contains the 5' end of the RP2 gene for retinitis
           pigmentosa 2 (X-linked recessive), the 5' end of the
           SLC9A7 gene for solute carrier family 9 (sodium/hydrogen
           exchanger), isoform 7 (NHE7), and two CpG Islands,
           complete sequence
          Length = 121502

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 43  agtaggcagaaactcagcaaggat 66
           |||||||||||| |||||||||||
Sbjct: 79  agtaggcagaaaatcagcaaggat 102

>gb|AC132419.3| Mus musculus BAC clone RP23-252B17 from chromosome 18, complete
            sequence
          Length = 190421

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 79   atgatgatgacagcatcag 97
            |||||||||||||||||||
Sbjct: 8492 atgatgatgacagcatcag 8474

>gb|AC126807.4| Mus musculus BAC clone RP23-306D4 from chromosome 18, complete sequence
          Length = 244566

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 79    atgatgatgacagcatcag 97
             |||||||||||||||||||
Sbjct: 16667 atgatgatgacagcatcag 16685

>gb|AC123555.4| Mus musculus BAC clone RP23-139L20 from 1, complete sequence
          Length = 205623

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 2    ttggtatctctgaagtctg 20
            |||||||||||||||||||
Sbjct: 9390 ttggtatctctgaagtctg 9372

>emb|AL607001.4|OSJN00128 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0088I22,
              complete sequence
          Length = 164572

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 4      ggtatctctgaagtctgaa 22
              |||||||||||||||||||
Sbjct: 145561 ggtatctctgaagtctgaa 145579

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                   
Query: 4        ggtatctctgaagtctgaa 22
                |||||||||||||||||||
Sbjct: 28645397 ggtatctctgaagtctgaa 28645379

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
               sequence
          Length = 29644043

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 65      atcatgattcatggatgat 83
               |||||||||||||||||||
Sbjct: 2871472 atcatgattcatggatgat 2871454

>gb|AY144861.1| Saccharomyces bayanus SFB2 gene, complete cds
          Length = 2658

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 78   gatgatgatgacagcatca 96
            |||||||||||||||||||
Sbjct: 982  gatgatgatgacagcatca 1000

>dbj|AP005632.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OSJNBb0050B07
          Length = 142134

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 65    atcatgattcatggatgat 83
             |||||||||||||||||||
Sbjct: 41759 atcatgattcatggatgat 41741

>gb|AC148007.3| Mus musculus BAC clone RP23-273G4 from 1, complete sequence
          Length = 184937

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 2      ttggtatctctgaagtctg 20
              |||||||||||||||||||
Sbjct: 103909 ttggtatctctgaagtctg 103927


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,014,247
Number of Sequences: 3902068
Number of extensions: 1014247
Number of successful extensions: 72787
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 72701
Number of HSP's gapped (non-prelim): 86
length of query: 105
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 84
effective length of database: 17,151,101,840
effective search space: 1440692554560
effective search space used: 1440692554560
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)