ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags22l02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X62724.1|HVRNPL171 H.vulgare mRNA for ribosomal protein L17-1 1205 0.0
2gb|AF264022.1| Poa secunda ribosomal protein L17-1 mRNA, complet... 682 0.0
3gb|BT017485.1| Zea mays clone EL01N0412G01.c mRNA sequence 351 2e-93
4ref|XM_450351.1| Oryza sativa (japonica cultivar-group), mRNA 345 1e-91
5ref|XM_507427.1| PREDICTED Oryza sativa (japonica cultivar-group... 345 1e-91
6ref|XM_506642.2| PREDICTED Oryza sativa (japonica cultivar-group... 345 1e-91
7dbj|AK120273.1| Oryza sativa (japonica cultivar-group) cDNA clon... 345 1e-91
8dbj|AK105087.1| Oryza sativa (japonica cultivar-group) cDNA clon... 345 1e-91
9dbj|AK072488.1| Oryza sativa (japonica cultivar-group) cDNA clon... 345 1e-91
10gb|AY109488.1| Zea mays CL9529_1 mRNA sequence 337 3e-89
11gb|AY103585.1| Zea mays PCO123564 mRNA sequence 283 4e-73
12emb|X62725.1|HVRNPL172 H.vulgare mRNA for ribosomal protein L17-2 244 3e-61
13ref|NM_105410.2| Arabidopsis thaliana structural constituent of ... 200 4e-48
14gb|AY081524.1| Arabidopsis thaliana unknown protein mRNA, comple... 200 4e-48
15gb|AY042862.1| Arabidopsis thaliana ribosomal protein L17-like p... 200 4e-48
16emb|BX817777.1|CNS0AE81 Arabidopsis thaliana Full-length cDNA Co... 192 1e-45
17ref|NM_102503.2| Arabidopsis thaliana structural constituent of ... 161 4e-36
18gb|AY077651.1| Arabidopsis thaliana At1g27400/F17L21_20 mRNA, co... 161 4e-36
19gb|AF428449.1|AF428449 Arabidopsis thaliana At1g27400/F17L21_20 ... 161 4e-36
20gb|AF428271.1|AF428271 Arabidopsis thaliana At1g27400/F17L21_20 ... 161 4e-36
21gb|AY037249.1| Arabidopsis thaliana At1g27400/F17L21_20 mRNA, co... 161 4e-36
22gb|AY088522.1| Arabidopsis thaliana clone 749 mRNA, complete seq... 161 4e-36
23gb|AF034948.1|AF034948 Zea mays ribosomal protein L17 (rpl17) mR... 153 9e-34
24dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 131 3e-27
25dbj|AP006441.3| Oryza sativa (japonica cultivar-group) genomic D... 131 3e-27
26dbj|AP005589.2| Oryza sativa (japonica cultivar-group) genomic D... 131 3e-27
27ref|XM_483472.1| Oryza sativa (japonica cultivar-group), mRNA 121 3e-24
28dbj|AK120448.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 3e-24
29dbj|AK062052.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 3e-24
30gb|AF076975.1|AF076975 Populus alba unknown mRNA, partial cds 119 1e-23
31gb|AF307336.1|AF307336 Petunia x hybrida ribosomal protein (PETR... 107 5e-20
32emb|AJ876806.1| Acanthamoeba polyphaga mRNA for putative ribosom... 103 7e-19
33ref|XM_323004.1| Neurospora crassa OR74A 60S RIBOSOMAL PROTEIN L... 94 7e-16
34ref|XM_956386.1| Neurospora crassa OR74A 60S RIBOSOMAL PROTEIN L... 94 7e-16
35ref|XM_382047.1| Gibberella zeae PH-1 chromosome 1 RL17_NEUCR 60... 94 7e-16
36gb|DQ207869.1| Solanum tuberosum clone 086A10 ribosomal protein ... 86 2e-13
37gb|AY496096.1| Capsicum annuum ribosomal protein PETRP mRNA, com... 86 2e-13
38gb|DQ252494.1| Solanum tuberosum clone 063E12 ribosomal protein ... 86 2e-13
39dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 84 7e-13
40dbj|AP003920.3| Oryza sativa (japonica cultivar-group) genomic D... 84 7e-13
41dbj|AP004015.3| Oryza sativa (japonica cultivar-group) genomic D... 84 7e-13
42gb|AC004393.2|T1F15 Arabidopsis thaliana chromosome 1 BAC T1F15 ... 82 3e-12
43gb|DQ235197.1| Solanum tuberosum clone 168G07 ribosomal protein ... 80 1e-11
44gb|AY853172.1| Pectinaria gouldii ribosomal protein L17 mRNA, co... 78 4e-11
45gb|AC004557.2|AC004557 Genomic sequence for Arabidopsis thaliana... 78 4e-11
46ref|XM_747718.1| Aspergillus fumigatus Af293 60s ribosomal prote... 70 1e-08
47dbj|AB226154.1| Aspergillus oryzae cDNA, contig sequence: AoEST3012 70 1e-08
48gb|AY389972.1| Xenopus laevis ribosomal protein L17 mRNA, partia... 68 4e-08
49gb|BC043971.1| Xenopus laevis similar to ribosomal protein L17, ... 68 4e-08
50gb|AF401571.1| Ictalurus punctatus ribosomal protein L17 mRNA, c... 68 4e-08
51gb|BC053781.1| Xenopus laevis cDNA clone IMAGE:6876276, containi... 66 2e-07
52gb|BC055097.1| Danio rerio zgc:65996, mRNA (cDNA clone MGC:65996... 64 6e-07
53ref|XM_653288.1| Aspergillus nidulans FGSC A4 hypothetical prote... 64 6e-07
54ref|NM_212760.1| Danio rerio zgc:65996 (zgc:65996), mRNA 64 6e-07
55ref|XM_866977.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 62 2e-06
56ref|XM_613874.2| PREDICTED: Bos taurus similar to 60S ribosomal ... 62 2e-06
57ref|XM_879331.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 62 2e-06
58gb|BC102600.1| Bos taurus similar to 60S ribosomal protein L17 (... 62 2e-06
59dbj|AB099057.1| Bos taurus mRNA for similar to ribosomal protein... 62 2e-06
60dbj|AB099047.1| Bos taurus mRNA for similar to ribosomal protein... 62 2e-06
61dbj|AB099021.1| Bos taurus mRNA for similar to ribosomal protein... 62 2e-06
62dbj|AB098996.1| Bos taurus mRNA for similar to ribosomal protein... 62 2e-06
63dbj|AB098987.1| Bos taurus mRNA for similar to ribosomal protein... 62 2e-06
64dbj|AB098888.1| Bos taurus mRNA for similar to ribosomal protein... 62 2e-06
65ref|NM_001034459.1| Bos taurus similar to 60S ribosomal protein ... 62 2e-06
66gb|AF443188.1| Paracoccidioides brasiliensis sorbitol dehydrogen... 60 1e-05
67emb|AL451014.1|NCB9B15 Neurospora crassa DNA linkage group V BAC... 60 1e-05
68gb|DQ066273.1| Ixodes scapularis isolate is-all-clu554 ribosomal... 60 1e-05
69gb|BC077192.1| Xenopus laevis MGC78885 protein, mRNA (cDNA clone... 56 1e-04
70gb|BC049299.1| Danio rerio cDNA clone IMAGE:5914772, **** WARNIN... 56 1e-04
71ref|XM_680042.1| PREDICTED: Danio rerio similar to Ribosomal pro... 56 1e-04
72emb|BX000991.8| Zebrafish DNA sequence from clone CH211-203L7 in... 56 1e-04
73emb|BX005111.4| Zebrafish DNA sequence from clone CH211-273E17 i... 56 1e-04
74gb|AY769286.1| Bombyx mori ribosomal protein L17 (RpL17) mRNA, c... 54 6e-04
75ref|XM_599030.2| PREDICTED: Bos taurus similar to 60S ribosomal ... 54 6e-04
76ref|XM_869475.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 54 6e-04
77gb|AY310814.1| Nicotiana benthamiana clone 12-173 unknown mRNA 52 0.002
78emb|BX649607.1| Aspergillus fumigatus BAC pilot project supercon... 52 0.002
79dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011 52 0.002
80emb|AL115613.1|CNS01CJP Botrytis cinerea strain T4 cDNA library 52 0.002
81emb|AL114989.1|CNS01C2D Botrytis cinerea strain T4 cDNA library 52 0.002
82emb|AL114758.1|CNS01BVY Botrytis cinerea strain T4 cDNA library 52 0.002
83emb|AL114552.1|CNS01BQ8 Botrytis cinerea strain T4 cDNA library 52 0.002
84emb|AL113871.1|CNS01B7B Botrytis cinerea strain T4 cDNA library 52 0.002
85emb|AL113217.1|CNS01AP5 Botrytis cinerea strain T4 cDNA library 52 0.002
86emb|AL113064.1|CNS01AKW Botrytis cinerea strain T4 cDNA library 52 0.002
87emb|AL112375.1|CNS01A1R Botrytis cinerea strain T4 cDNA library 52 0.002
88emb|AL112009.1|CNS019RL Botrytis cinerea strain T4 cDNA library 52 0.002
89emb|AL111981.1|CNS019QT Botrytis cinerea strain T4 cDNA library 52 0.002
90emb|AL111483.1|CNS019CZ Botrytis cinerea strain T4 cDNA library 52 0.002
91emb|AL111750.1|CNS019KE Botrytis cinerea strain T4 cDNA library 52 0.002
92emb|AL111381.1|CNS019A5 Botrytis cinerea strain T4 cDNA library 52 0.002
93emb|AL110722.1|CNS018RV Botrytis cinerea strain T4 cDNA library 52 0.002
94emb|AL110976.1|CNS018YX Botrytis cinerea strain T4 cDNA library 52 0.002
95gb|AY130354.1| Branchiostoma lanceolatum ribosomal protein L17 m... 52 0.002
96ref|XM_865349.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 50 0.009
97gb|AY389929.1| Latimeria chalumnae ribosomal protein L17 mRNA, p... 50 0.009
98ref|XM_871477.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 48 0.037
99ref|XM_868142.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 48 0.037
100ref|XM_424454.1| PREDICTED: Gallus gallus similar to 60S ribosom... 48 0.037
101ref|XM_427732.1| PREDICTED: Gallus gallus similar to 60S ribosom... 48 0.037
102ref|XM_869796.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 48 0.037
103ref|XM_584664.2| PREDICTED: Bos taurus similar to 60S ribosomal ... 48 0.037
104gb|AY389962.1| Gallus gallus ribosomal protein L17 mRNA, partial... 48 0.037
105ref|NM_205014.1| Gallus gallus T-cell leukemia homeobox 3 (TLX3)... 48 0.037
106emb|CR352619.1| Gallus gallus finished cDNA, clone ChEST14e6 48 0.037
107gb|AY130351.1| Scyliorhinus canicula ribosomal protein L17 mRNA,... 48 0.037
108gb|DQ223555.1| Ovis aries clone TO-DOWN-E18-5 ribosomal protein ... 48 0.037
109gb|AF071875.1|AF071875 Gallus gallus homeodomain protein (Tlx-3)... 48 0.037
110emb|X71382.1|PCRPL17 P.carnea mRNA for 60S ribosomal protein L17 46 0.14
111gb|AC023722.4| Drosophila melanogaster X BAC RP98-48O24 (Roswell... 46 0.14
112gb|AC023699.4| Drosophila melanogaster X BAC RP98-11K20 (Roswell... 46 0.14
113ref|NM_167089.1| Drosophila melanogaster Ribosomal protein L17 C... 46 0.14
114ref|NM_167088.1| Drosophila melanogaster Ribosomal protein L17 C... 46 0.14
115ref|NM_167087.1| Drosophila melanogaster Ribosomal protein L17 C... 46 0.14
116ref|NM_132118.2| Drosophila melanogaster Ribosomal protein L17 C... 46 0.14
117gb|AY060845.1| Drosophila melanogaster GM02242 full length cDNA 46 0.14
118emb|AL111872.1|CNS019NS Botrytis cinerea strain T4 cDNA library 46 0.14
119gb|AE003438.3| Drosophila melanogaster chromosome X, section 22 ... 46 0.14
120gb|BC077000.1| Xenopus tropicalis MGC89639 protein, mRNA (cDNA c... 44 0.57
121emb|CT025372.2| Xenopus tropicalis finished cDNA, clone TNeu098j06 44 0.57
122emb|Z83836.2|HS111J24 Human DNA sequence from clone RP1-111J24 o... 44 0.57
123ref|NM_171832.2| Caenorhabditis elegans Ribosomal Protein, Large... 44 0.57
124ref|NM_170799.2| Caenorhabditis elegans Ribosomal Protein, Large... 44 0.57
125ref|NM_001005078.1| Xenopus tropicalis MGC89639 protein (MGC8963... 44 0.57
126dbj|AK110522.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.57
127gb|AY833083.1| Taeniopygia guttata ribosomal protein L17 mRNA, c... 42 2.3
128gb|DQ214552.1| Taeniopygia guttata clone 0058P0043B12 ribosomal ... 42 2.3
129gb|DQ214551.1| Taeniopygia guttata clone 0058P0013B11 ribosomal ... 42 2.3
130emb|AL392172.9| Human DNA sequence from clone RP11-452F19 on chr... 42 2.3
131ref|XM_786536.1| PREDICTED: Strongylocentrotus purpuratus simila... 42 2.3
132dbj|AK171782.1| Mus musculus activated spleen cDNA, RIKEN full-l... 42 2.3
133gb|AC092155.3| Homo sapiens BAC clone RP11-312H10 from 2, comple... 42 2.3
134gb|AY909403.1| Siniperca chuatsi clone C176 ribosomal protein L1... 42 2.3
135gb|AF220552.1|AF220552 Paralichthys olivaceus ribosomal protein ... 42 2.3
136emb|AL603829.5| Mouse DNA sequence from clone RP23-416G21 on chr... 42 2.3
137gb|CP000110.1| Synechococcus sp. CC9605, complete genome 40 8.9
138gb|AF064857.1| Homo sapiens BAC derived from chromosome 21q22.3,... 40 8.9
139gb|AC103376.7| Mus musculus chromosome 8, clone RP24-226P5, comp... 40 8.9
140gb|CP000082.1| Psychrobacter arcticus 273-4, complete genome 40 8.9
141gb|AC122528.3| Mus musculus BAC clone RP24-506F15 from chromosom... 40 8.9
142ref|NM_007783.2| Mus musculus c-src tyrosine kinase (Csk), mRNA 40 8.9
143gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome 40 8.9
144gb|AC025794.9| Mus musculus chromosome 19, clone RP23-62O7, comp... 40 8.9
145gb|AY382669.1| Cryptosporidium hominis isolate A13 60kDa glycopr... 40 8.9
146gb|AC126244.3| Mus musculus BAC clone RP24-319A6 from chromosome... 40 8.9
147gb|AC123063.4| Mus musculus BAC clone RP23-219I20 from 5, comple... 40 8.9
148gb|AY278946.1| Branchiostoma belcheri tsingtaunese ribosomal pro... 40 8.9
149emb|CR391962.5| Zebrafish DNA sequence from clone CH211-215K15 i... 40 8.9
150emb|AL163281.2|HS21C081 Homo sapiens chromosome 21 segment HS21C081 40 8.9
151gb|AE016795.2| Vibrio vulnificus CMCP6 chromosome I complete seq... 40 8.9
152gb|AC129292.4| Mus musculus chromosome 5 clone RP24-507A8, compl... 40 8.9
153emb|BX640439.1| Bordetella bronchiseptica strain RB50, complete ... 40 8.9
154emb|BX640420.1| Bordetella pertussis strain Tohama I, complete g... 40 8.9
155gb|AC067931.16| Homo sapiens chromosome 8, clone RP11-642A1, com... 40 8.9
156gb|AC108751.10| Homo sapiens 3 BAC RP11-278L15 (Roswell Park Can... 40 8.9
157ref|NM_001003629.1| Danio rerio zgc:100933 (zgc:100933), mRNA 40 8.9
158dbj|BA000037.2| Vibrio vulnificus YJ016 DNA, chromosome I, compl... 40 8.9
159dbj|AK137297.1| Mus musculus adult male urinary bladder cDNA, RI... 40 8.9
160gb|AC098685.7| Mus musculus clone ct7-393l21, complete sequence 40 8.9
161dbj|AK136876.1| Mus musculus adult male diencephalon cDNA, RIKEN... 40 8.9
162dbj|AK135445.1| Mus musculus 12 days embryo female mullerian duc... 40 8.9
163gb|AC108089.2| Homo sapiens chromosome 5 clone CTD-2313B8, compl... 40 8.9
164dbj|AK156058.1| Mus musculus activated spleen cDNA, RIKEN full-l... 40 8.9
165gb|AC022139.5| Homo sapiens chromosome 5 clone CTD-2255L15, comp... 40 8.9
166dbj|AK170893.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 40 8.9
167dbj|AK170815.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 40 8.9
168gb|BC052006.1| Mus musculus c-src tyrosine kinase, mRNA (cDNA cl... 40 8.9
169gb|AC157822.2| Mus musculus BAC clone RP23-392J15 from chromosom... 40 8.9
170dbj|AK013057.1| Mus musculus 10, 11 days embryo whole body cDNA,... 40 8.9
171gb|BC095962.1| Mus musculus c-src tyrosine kinase, mRNA (cDNA cl... 40 8.9
172dbj|BS000162.1| Pan troglodytes chromosome 22 clone:PTB-060F12, ... 40 8.9
173gb|BC078194.1| Danio rerio zgc:100933, mRNA (cDNA clone MGC:1009... 40 8.9
174gb|BC018394.1| Mus musculus c-src tyrosine kinase, mRNA (cDNA cl... 40 8.9
175emb|AL954228.1|CH179K04 Pan troglodytes chromosome 22 BAC CH251-... 40 8.9
176dbj|AP000852.4| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 8.9
177emb|AL954380.9| Mouse DNA sequence from clone RP23-156O9 on chro... 40 8.9
178gb|AC122515.5| Mus musculus BAC clone RP24-455N18 from 9, comple... 40 8.9
179emb|AL844180.6| Mouse DNA sequence from clone RP23-403A4 on chro... 40 8.9

>emb|X62724.1|HVRNPL171 H.vulgare mRNA for ribosomal protein L17-1
          Length = 785

 Score = 1205 bits (608), Expect = 0.0
 Identities = 646/652 (99%), Gaps = 5/652 (0%)
 Strand = Plus / Minus

                                                                       
Query: 1   aaaaatattccaaaacacaaccagatcgaatccattagaagagactttcacaaagtatga 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 731 aaaaatattccaaaacacaaccagatcgaatccattagaagagactttcacaaagtatga 672

                                                                       
Query: 61  gctagcagtatttagacgacagataacagggcaaaaattccactcagccaaaccagatgc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 671 gctagcagtatttagacgacagataacagggcaaaaattccactcagccaaaccagatgc 612

                                                                       
Query: 121 tacaaagtgctctaacgaataggtggacagatgatgtagagcttccttctctaggccttc 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 611 tacaaagtgctctaacgaataggtggacagatgatgtagagcttccttctctaggccttc 552

                                                                       
Query: 181 ctggcaatctgggactcagcctccttcttcaccggctcttccttctcagacaagatcagc 240
           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 551 ctggcaatatgggactcagcctccttcttcaccggctcttccttctcagacaagatcagc 492

                                                                       
Query: 241 tcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggtcctg 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 491 tcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggtcctg 432

                                                                       
Query: 301 cgccgctgcttctgggcctggttcacttggatgtgcgaaatgtagagagcatccacatca 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 431 cgccgctgcttctgggcctggttcacttggatgtgcgaaatgtagagagcatccacatca 372

                                                                       
Query: 361 agacctttcacctcagcattgctctctgcgttctttagaagatccagaacgaacttagca 420
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 371 agacctttcacctcagcattgctctctgcgttctttagaagatccagaacgaacttagca 312

                                                                       
Query: 421 gacttggcaggcccagcgtccctgaccatttggctgacggttcttaacctgggcccgtgc 480
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 311 gacttggcagg-ccagcgtccctgaccatttggctgacggttcttaacctggg-ccgtgc 254

                                                                       
Query: 481 gtccaacaccacggcagtacctccggaaggggatggcttgctttgtgtgccaacacatcc 540
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 253 gtccaacaccacggcagtacctccggaaggggatggcttgc-ttgtgtgccaacacatcc 195

                                                                       
Query: 541 ttcaaggtacctcttagccttgttcagcggcatcttcctcagggcaaacgctgtttccct 600
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 194 -tcaaggtacctcttagccttgttcagcggcatcttcctcagggcaaacgctgtttccc- 137

                                                               
Query: 601 tagtgttcttgaaatgaacacgcaggtcgcggcccatggccttggcggactt 652
           ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 136 tagtgttcttgaaatgaacacgcaggtcgcggcccatggccttggcggactt 85



to top

>gb|AF264022.1| Poa secunda ribosomal protein L17-1 mRNA, complete cds
          Length = 808

 Score =  682 bits (344), Expect = 0.0
 Identities = 556/614 (90%), Gaps = 17/614 (2%)
 Strand = Plus / Minus

                                                                       
Query: 50  acaaagtatgagctagcagtatttagacga---cagat---aacagggcaaaaattccac 103
           ||||||||||||||||||||||||||| ||   |||||   |||||| |||||||||| |
Sbjct: 666 acaaagtatgagctagcagtatttagaagatgacagatgataacaggccaaaaattcccc 607

                                                                       
Query: 104 tcagccaaa-ccagatgctacaaagtgctctaacgaataggtggacagatgatgtagagc 162
           ||||||||| |||||||||||||| |||||||||||||||||||||| |  |||  ||||
Sbjct: 606 tcagccaaagccagatgctacaaactgctctaacgaataggtggaca-agtatgccgagc 548

                                                                       
Query: 163 ttcctt-ctctaggccttcctg---gcaatctgggactcagcctccttcttcaccggctc 218
           || ||| |||||||||||||||   |||||||||||||||||||| |||||||| |||||
Sbjct: 547 tttcttcctctaggccttcctgggcgcaatctgggactcagcctctttcttcactggctc 488

                                                                       
Query: 219 ttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcg 278
            |||||||| |||||||| |||||||||||||| ||||| |||||||||||||| |||||
Sbjct: 487 ctccttctcggacaagatgagctcaatgtggcacgggttagacatgtaggggttaatgcg 428

                                                                       
Query: 279 tccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgcga 338
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 427 tccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgtga 368

                                                                       
Query: 339 aatgtagagagcatccacatcaagacctttcacctcagcattgctctctgcgttctttag 398
            |||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| ||
Sbjct: 367 gatgtagagagcatcaacatccagacctttcacctcagcattgctctctgcgttcttgag 308

                                                                       
Query: 399 aagatccagaacgaacttagcagacttggcaggcccagcgtccctgaccatttggctgac 458
           |||||||||||| |||| ||||||||||||||| |||||| ||||||||||||||||| |
Sbjct: 307 aagatccagaacaaactgagcagacttggcagg-ccagcgaccctgaccatttggctggc 249

                                                                       
Query: 459 ggttcttaacctgggcccgtgcgtccaacaccacggcagtacctccggaaggggatggct 518
           |||||||| | || | | || ||||||||||||||||||||||| |||||||||||||| 
Sbjct: 248 ggttcttagcttgag-cggtacgtccaacaccacggcagtacctgcggaaggggatggcc 190

                                                                       
Query: 519 tgctttgtgtgccaacacatccttcaaggtacctcttagccttgttcagcggcatcttcc 578
           ||| |||||||| | ||||||| || ||||||||||||||||||||||| ||||||||||
Sbjct: 189 tgc-ttgtgtgcaagcacatcc-tccaggtacctcttagccttgttcagtggcatcttcc 132

                                                                       
Query: 579 tcagggcaaacgctgtttcccttagtgttcttgaaatgaacacgcaggtcgcggcccatg 638
           | ||||| ||||||||||||| |||| ||||||||||||||||||||||| |||||||||
Sbjct: 131 tgagggcgaacgctgtttccc-tagtattcttgaaatgaacacgcaggtcccggcccatg 73

                         
Query: 639 gccttggcggactt 652
           ||||||||||||||
Sbjct: 72  gccttggcggactt 59



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 1   aaaaatattccaaaacacaaccagat 26
           |||||||| |||||||||||||||||
Sbjct: 726 aaaaatatcccaaaacacaaccagat 701



to top

>gb|BT017485.1| Zea mays clone EL01N0412G01.c mRNA sequence
          Length = 640

 Score =  351 bits (177), Expect = 2e-93
 Identities = 418/491 (85%), Gaps = 8/491 (1%)
 Strand = Plus / Minus

                                                                       
Query: 165 ccttctctaggccttcctgg---caatctgggactcagcctccttcttcaccggctcttc 221
           ||||||||| ||||||||||   | ||||| ||||||||||| |||||||| ||||||||
Sbjct: 527 ccttctctaagccttcctggttgcgatctgagactcagcctctttcttcactggctcttc 468

                                                                       
Query: 222 cttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtcc 281
           |||||| |||||||| ||||| ||||||||||||  ||||||||| ||||||||||||||
Sbjct: 467 cttctccgacaagatgagctctatgtggcatggggaggacatgtaagggttgatgcgtcc 408

                                                                       
Query: 282 atgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgcgaaat 341
           |||||||||||| |||||||| ||||||||||| ||||| || ||||| |||||||| | 
Sbjct: 407 atgagcacggtatgtcctgcgtcgctgcttctgagcctgattaacttgaatgtgcgacac 348

                                                                       
Query: 342 gtagagagcatccacatcaagacctttcacctcagcattgctctctgcgttctttagaag 401
            ||||| | |||||||||||| |||||||||||||||||||||||||| ||||| |||||
Sbjct: 347 atagagggtatccacatcaagtcctttcacctcagcattgctctctgcattcttgagaag 288

                                                                       
Query: 402 atccagaacgaacttagcagacttggcaggcccagcgtccctgaccatttggctgacggt 461
            || |||| ||| ||||||||||||||||| ||||||||||||||||||||  || ||  
Sbjct: 287 gtctagaatgaatttagcagacttggcagg-ccagcgtccctgaccatttgagtggcgag 229

                                                                       
Query: 462 tcttaacctgggcccgtgcgtccaacaccacggcagtacctccggaaggggatggcttgc 521
            |||| |||| | | || || ||||||||||  || ||||| ||||| |||||||| |||
Sbjct: 228 acttagcctgag-cagtacgcccaacaccaccacaatacctgcggaacgggatggcctgc 170

                                                                       
Query: 522 tttgtgtgccaacacatccttcaaggtacctcttagccttgttcagcggcatcttcctca 581
            ||||| || | ||||||| |||||||| || || |||||| | || | || |||||| |
Sbjct: 169 -ttgtgggcgatcacatcc-tcaaggtaacttttggccttggtgagtgacaacttcctaa 112

                                                                       
Query: 582 gggcaaacgctgtttcccttagtgttcttgaaatgaacacgcaggtcgcggcccatggcc 641
           ||||||| ||||| || | | ||||||||||| |||||||| ||||| ||||||||||||
Sbjct: 111 gggcaaaagctgtctcacgt-gtgttcttgaagtgaacacgtaggtcacggcccatggcc 53

                      
Query: 642 ttggcggactt 652
           |||||||||||
Sbjct: 52  ttggcggactt 42



to top

>ref|XM_450351.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 813

 Score =  345 bits (174), Expect = 1e-91
 Identities = 421/496 (84%), Gaps = 8/496 (1%)
 Strand = Plus / Minus

                                                                       
Query: 160 agcttccttctctaggccttcctggca---atctgggactcagcctccttcttcaccggc 216
           ||||||||||||||||||||||||||    ||||| ||||||| ||| |||||||| || 
Sbjct: 605 agcttccttctctaggccttcctggctgcgatctgagactcaggctctttcttcactggt 546

                                                                       
Query: 217 tcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatg 276
           ||||||||||| |||| ||| |||||||||||||| |||  ||||||||| |||||||||
Sbjct: 545 tcttccttctctgacaggataagctcaatgtggcacggggaggacatgtaagggttgatg 486

                                                                       
Query: 277 cgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
           |||||||||||||||||||| | ||||| |||||||||||||||||| ||||| ||||| 
Sbjct: 485 cgtccatgagcacggtaggtacggcgcctctgcttctgggcctggttaacttgaatgtgg 426

                                                                       
Query: 337 gaaatgtagagagcatccacatcaagacctttcacctcagcattgctctctgcgttcttt 396
           || |  || |||| ||| ||||| ||||||||||||||||||||||||||||| ||||| 
Sbjct: 425 gacacataaagagtatcaacatccagacctttcacctcagcattgctctctgcattctta 366

                                                                       
Query: 397 agaagatccagaacgaacttagcagacttggcaggcccagcgtccctgaccatttggctg 456
           ||||||||||||| |||  |||||||||||||||| ||||||||||||||| ||||  ||
Sbjct: 365 agaagatccagaatgaatctagcagacttggcagg-ccagcgtccctgaccgtttgaatg 307

                                                                       
Query: 457 acggttcttaacctgggcccgtgcgtccaacaccacggcagtacctccggaaggggatgg 516
            ||   |||| | || | | ||||| |||||||||| ||||||||| ||||||||||| |
Sbjct: 306 gcgtgacttagcttgag-cagtgcggccaacaccaccgcagtacctacggaaggggatag 248

                                                                       
Query: 517 cttgctttgtgtgccaacacatccttcaaggtacctcttagccttgttcagcggcatctt 576
           ||||| ||||| || | ||||||| |||||||||||||| ||||||  ||| |||| |||
Sbjct: 247 cttgc-ttgtgggcaatcacatcc-tcaaggtacctcttggccttgcccagaggcaactt 190

                                                                       
Query: 577 cctcagggcaaacgctgtttcccttagtgttcttgaaatgaacacgcaggtcgcggccca 636
           ||| |  ||||| ||||| || |   ||||||||||| || ||||||| ||| |||||||
Sbjct: 189 cctgatagcaaaagctgtctcac-gggtgttcttgaagtgcacacgcaagtcccggccca 131

                           
Query: 637 tggccttggcggactt 652
           ||||||||| ||||||
Sbjct: 130 tggccttggaggactt 115



to top

>ref|XM_507427.1| PREDICTED Oryza sativa (japonica cultivar-group), P0523B07.46 mRNA
          Length = 914

 Score =  345 bits (174), Expect = 1e-91
 Identities = 421/496 (84%), Gaps = 8/496 (1%)
 Strand = Plus / Minus

                                                                       
Query: 160 agcttccttctctaggccttcctggca---atctgggactcagcctccttcttcaccggc 216
           ||||||||||||||||||||||||||    ||||| ||||||| ||| |||||||| || 
Sbjct: 606 agcttccttctctaggccttcctggctgcgatctgagactcaggctctttcttcactggt 547

                                                                       
Query: 217 tcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatg 276
           ||||||||||| |||| ||| |||||||||||||| |||  ||||||||| |||||||||
Sbjct: 546 tcttccttctctgacaggataagctcaatgtggcacggggaggacatgtaagggttgatg 487

                                                                       
Query: 277 cgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
           |||||||||||||||||||| | ||||| |||||||||||||||||| ||||| ||||| 
Sbjct: 486 cgtccatgagcacggtaggtacggcgcctctgcttctgggcctggttaacttgaatgtgg 427

                                                                       
Query: 337 gaaatgtagagagcatccacatcaagacctttcacctcagcattgctctctgcgttcttt 396
           || |  || |||| ||| ||||| ||||||||||||||||||||||||||||| ||||| 
Sbjct: 426 gacacataaagagtatcaacatccagacctttcacctcagcattgctctctgcattctta 367

                                                                       
Query: 397 agaagatccagaacgaacttagcagacttggcaggcccagcgtccctgaccatttggctg 456
           ||||||||||||| |||  |||||||||||||||| ||||||||||||||| ||||  ||
Sbjct: 366 agaagatccagaatgaatctagcagacttggcagg-ccagcgtccctgaccgtttgaatg 308

                                                                       
Query: 457 acggttcttaacctgggcccgtgcgtccaacaccacggcagtacctccggaaggggatgg 516
            ||   |||| | || | | ||||| |||||||||| ||||||||| ||||||||||| |
Sbjct: 307 gcgtgacttagcttgag-cagtgcggccaacaccaccgcagtacctacggaaggggatag 249

                                                                       
Query: 517 cttgctttgtgtgccaacacatccttcaaggtacctcttagccttgttcagcggcatctt 576
           ||||| ||||| || | ||||||| |||||||||||||| ||||||  ||| |||| |||
Sbjct: 248 cttgc-ttgtgggcaatcacatcc-tcaaggtacctcttggccttgcccagaggcaactt 191

                                                                       
Query: 577 cctcagggcaaacgctgtttcccttagtgttcttgaaatgaacacgcaggtcgcggccca 636
           ||| |  ||||| ||||| || |   ||||||||||| || ||||||| ||| |||||||
Sbjct: 190 cctgatagcaaaagctgtctcac-gggtgttcttgaagtgcacacgcaagtcccggccca 132

                           
Query: 637 tggccttggcggactt 652
           ||||||||| ||||||
Sbjct: 131 tggccttggaggactt 116



to top

>ref|XM_506642.2| PREDICTED Oryza sativa (japonica cultivar-group), P0523B07.46 mRNA
          Length = 936

 Score =  345 bits (174), Expect = 1e-91
 Identities = 421/496 (84%), Gaps = 8/496 (1%)
 Strand = Plus / Minus

                                                                       
Query: 160 agcttccttctctaggccttcctggca---atctgggactcagcctccttcttcaccggc 216
           ||||||||||||||||||||||||||    ||||| ||||||| ||| |||||||| || 
Sbjct: 592 agcttccttctctaggccttcctggctgcgatctgagactcaggctctttcttcactggt 533

                                                                       
Query: 217 tcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatg 276
           ||||||||||| |||| ||| |||||||||||||| |||  ||||||||| |||||||||
Sbjct: 532 tcttccttctctgacaggataagctcaatgtggcacggggaggacatgtaagggttgatg 473

                                                                       
Query: 277 cgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
           |||||||||||||||||||| | ||||| |||||||||||||||||| ||||| ||||| 
Sbjct: 472 cgtccatgagcacggtaggtacggcgcctctgcttctgggcctggttaacttgaatgtgg 413

                                                                       
Query: 337 gaaatgtagagagcatccacatcaagacctttcacctcagcattgctctctgcgttcttt 396
           || |  || |||| ||| ||||| ||||||||||||||||||||||||||||| ||||| 
Sbjct: 412 gacacataaagagtatcaacatccagacctttcacctcagcattgctctctgcattctta 353

                                                                       
Query: 397 agaagatccagaacgaacttagcagacttggcaggcccagcgtccctgaccatttggctg 456
           ||||||||||||| |||  |||||||||||||||| ||||||||||||||| ||||  ||
Sbjct: 352 agaagatccagaatgaatctagcagacttggcagg-ccagcgtccctgaccgtttgaatg 294

                                                                       
Query: 457 acggttcttaacctgggcccgtgcgtccaacaccacggcagtacctccggaaggggatgg 516
            ||   |||| | || | | ||||| |||||||||| ||||||||| ||||||||||| |
Sbjct: 293 gcgtgacttagcttgag-cagtgcggccaacaccaccgcagtacctacggaaggggatag 235

                                                                       
Query: 517 cttgctttgtgtgccaacacatccttcaaggtacctcttagccttgttcagcggcatctt 576
           ||||| ||||| || | ||||||| |||||||||||||| ||||||  ||| |||| |||
Sbjct: 234 cttgc-ttgtgggcaatcacatcc-tcaaggtacctcttggccttgcccagaggcaactt 177

                                                                       
Query: 577 cctcagggcaaacgctgtttcccttagtgttcttgaaatgaacacgcaggtcgcggccca 636
           ||| |  ||||| ||||| || |   ||||||||||| || ||||||| ||| |||||||
Sbjct: 176 cctgatagcaaaagctgtctcac-gggtgttcttgaagtgcacacgcaagtcccggccca 118

                           
Query: 637 tggccttggcggactt 652
           ||||||||| ||||||
Sbjct: 117 tggccttggaggactt 102



to top

>dbj|AK120273.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013048E22, full
           insert sequence
          Length = 915

 Score =  345 bits (174), Expect = 1e-91
 Identities = 421/496 (84%), Gaps = 8/496 (1%)
 Strand = Plus / Minus

                                                                       
Query: 160 agcttccttctctaggccttcctggca---atctgggactcagcctccttcttcaccggc 216
           ||||||||||||||||||||||||||    ||||| ||||||| ||| |||||||| || 
Sbjct: 606 agcttccttctctaggccttcctggctgcgatctgagactcaggctctttcttcactggt 547

                                                                       
Query: 217 tcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatg 276
           ||||||||||| |||| ||| |||||||||||||| |||  ||||||||| |||||||||
Sbjct: 546 tcttccttctctgacaggataagctcaatgtggcacggggaggacatgtaagggttgatg 487

                                                                       
Query: 277 cgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
           |||||||||||||||||||| | ||||| |||||||||||||||||| ||||| ||||| 
Sbjct: 486 cgtccatgagcacggtaggtacggcgcctctgcttctgggcctggttaacttgaatgtgg 427

                                                                       
Query: 337 gaaatgtagagagcatccacatcaagacctttcacctcagcattgctctctgcgttcttt 396
           || |  || |||| ||| ||||| ||||||||||||||||||||||||||||| ||||| 
Sbjct: 426 gacacataaagagtatcaacatccagacctttcacctcagcattgctctctgcattctta 367

                                                                       
Query: 397 agaagatccagaacgaacttagcagacttggcaggcccagcgtccctgaccatttggctg 456
           ||||||||||||| |||  |||||||||||||||| ||||||||||||||| ||||  ||
Sbjct: 366 agaagatccagaatgaatctagcagacttggcagg-ccagcgtccctgaccgtttgaatg 308

                                                                       
Query: 457 acggttcttaacctgggcccgtgcgtccaacaccacggcagtacctccggaaggggatgg 516
            ||   |||| | || | | ||||| |||||||||| ||||||||| ||||||||||| |
Sbjct: 307 gcgtgacttagcttgag-cagtgcggccaacaccaccgcagtacctacggaaggggatag 249

                                                                       
Query: 517 cttgctttgtgtgccaacacatccttcaaggtacctcttagccttgttcagcggcatctt 576
           ||||| ||||| || | ||||||| |||||||||||||| ||||||  ||| |||| |||
Sbjct: 248 cttgc-ttgtgggcaatcacatcc-tcaaggtacctcttggccttgcccagaggcaactt 191

                                                                       
Query: 577 cctcagggcaaacgctgtttcccttagtgttcttgaaatgaacacgcaggtcgcggccca 636
           ||| |  ||||| ||||| || |   ||||||||||| || ||||||| ||| |||||||
Sbjct: 190 cctgatagcaaaagctgtctcac-gggtgttcttgaagtgcacacgcaagtcccggccca 132

                           
Query: 637 tggccttggcggactt 652
           ||||||||| ||||||
Sbjct: 131 tggccttggaggactt 116



to top

>dbj|AK105087.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-047-A12, full
           insert sequence
          Length = 834

 Score =  345 bits (174), Expect = 1e-91
 Identities = 421/496 (84%), Gaps = 8/496 (1%)
 Strand = Plus / Minus

                                                                       
Query: 160 agcttccttctctaggccttcctggca---atctgggactcagcctccttcttcaccggc 216
           ||||||||||||||||||||||||||    ||||| ||||||| ||| |||||||| || 
Sbjct: 626 agcttccttctctaggccttcctggctgcgatctgagactcaggctctttcttcactggt 567

                                                                       
Query: 217 tcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatg 276
           ||||||||||| |||| ||| |||||||||||||| |||  ||||||||| |||||||||
Sbjct: 566 tcttccttctctgacaggataagctcaatgtggcacggggaggacatgtaagggttgatg 507

                                                                       
Query: 277 cgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
           |||||||||||||||||||| | ||||| |||||||||||||||||| ||||| ||||| 
Sbjct: 506 cgtccatgagcacggtaggtacggcgcctctgcttctgggcctggttaacttgaatgtgg 447

                                                                       
Query: 337 gaaatgtagagagcatccacatcaagacctttcacctcagcattgctctctgcgttcttt 396
           || |  || |||| ||| ||||| ||||||||||||||||||||||||||||| ||||| 
Sbjct: 446 gacacataaagagtatcaacatccagacctttcacctcagcattgctctctgcattctta 387

                                                                       
Query: 397 agaagatccagaacgaacttagcagacttggcaggcccagcgtccctgaccatttggctg 456
           ||||||||||||| |||  |||||||||||||||| ||||||||||||||| ||||  ||
Sbjct: 386 agaagatccagaatgaatctagcagacttggcagg-ccagcgtccctgaccgtttgaatg 328

                                                                       
Query: 457 acggttcttaacctgggcccgtgcgtccaacaccacggcagtacctccggaaggggatgg 516
            ||   |||| | || | | ||||| |||||||||| ||||||||| ||||||||||| |
Sbjct: 327 gcgtgacttagcttgag-cagtgcggccaacaccaccgcagtacctacggaaggggatag 269

                                                                       
Query: 517 cttgctttgtgtgccaacacatccttcaaggtacctcttagccttgttcagcggcatctt 576
           ||||| ||||| || | ||||||| |||||||||||||| ||||||  ||| |||| |||
Sbjct: 268 cttgc-ttgtgggcaatcacatcc-tcaaggtacctcttggccttgcccagaggcaactt 211

                                                                       
Query: 577 cctcagggcaaacgctgtttcccttagtgttcttgaaatgaacacgcaggtcgcggccca 636
           ||| |  ||||| ||||| || |   ||||||||||| || ||||||| ||| |||||||
Sbjct: 210 cctgatagcaaaagctgtctcac-gggtgttcttgaagtgcacacgcaagtcccggccca 152

                           
Query: 637 tggccttggcggactt 652
           ||||||||| ||||||
Sbjct: 151 tggccttggaggactt 136



to top

>dbj|AK072488.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023134I03, full
           insert sequence
          Length = 936

 Score =  345 bits (174), Expect = 1e-91
 Identities = 421/496 (84%), Gaps = 8/496 (1%)
 Strand = Plus / Minus

                                                                       
Query: 160 agcttccttctctaggccttcctggca---atctgggactcagcctccttcttcaccggc 216
           ||||||||||||||||||||||||||    ||||| ||||||| ||| |||||||| || 
Sbjct: 592 agcttccttctctaggccttcctggctgcgatctgagactcaggctctttcttcactggt 533

                                                                       
Query: 217 tcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatg 276
           ||||||||||| |||| ||| |||||||||||||| |||  ||||||||| |||||||||
Sbjct: 532 tcttccttctctgacaggataagctcaatgtggcacggggaggacatgtaagggttgatg 473

                                                                       
Query: 277 cgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
           |||||||||||||||||||| | ||||| |||||||||||||||||| ||||| ||||| 
Sbjct: 472 cgtccatgagcacggtaggtacggcgcctctgcttctgggcctggttaacttgaatgtgg 413

                                                                       
Query: 337 gaaatgtagagagcatccacatcaagacctttcacctcagcattgctctctgcgttcttt 396
           || |  || |||| ||| ||||| ||||||||||||||||||||||||||||| ||||| 
Sbjct: 412 gacacataaagagtatcaacatccagacctttcacctcagcattgctctctgcattctta 353

                                                                       
Query: 397 agaagatccagaacgaacttagcagacttggcaggcccagcgtccctgaccatttggctg 456
           ||||||||||||| |||  |||||||||||||||| ||||||||||||||| ||||  ||
Sbjct: 352 agaagatccagaatgaatctagcagacttggcagg-ccagcgtccctgaccgtttgaatg 294

                                                                       
Query: 457 acggttcttaacctgggcccgtgcgtccaacaccacggcagtacctccggaaggggatgg 516
            ||   |||| | || | | ||||| |||||||||| ||||||||| ||||||||||| |
Sbjct: 293 gcgtgacttagcttgag-cagtgcggccaacaccaccgcagtacctacggaaggggatag 235

                                                                       
Query: 517 cttgctttgtgtgccaacacatccttcaaggtacctcttagccttgttcagcggcatctt 576
           ||||| ||||| || | ||||||| |||||||||||||| ||||||  ||| |||| |||
Sbjct: 234 cttgc-ttgtgggcaatcacatcc-tcaaggtacctcttggccttgcccagaggcaactt 177

                                                                       
Query: 577 cctcagggcaaacgctgtttcccttagtgttcttgaaatgaacacgcaggtcgcggccca 636
           ||| |  ||||| ||||| || |   ||||||||||| || ||||||| ||| |||||||
Sbjct: 176 cctgatagcaaaagctgtctcac-gggtgttcttgaagtgcacacgcaagtcccggccca 118

                           
Query: 637 tggccttggcggactt 652
           ||||||||| ||||||
Sbjct: 117 tggccttggaggactt 102



to top

>gb|AY109488.1| Zea mays CL9529_1 mRNA sequence
          Length = 1024

 Score =  337 bits (170), Expect = 3e-89
 Identities = 397/466 (85%), Gaps = 5/466 (1%)
 Strand = Plus / Plus

                                                                       
Query: 187 atctgggactcagcctccttcttcaccggctcttccttctcagacaagatcagctcaatg 246
           ||||| ||||||||||| |||||||| |||||||||||||| |||||||| ||||| |||
Sbjct: 421 atctgagactcagcctctttcttcactggctcttccttctccgacaagatgagctcgatg 480

                                                                       
Query: 247 tggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgc 306
           |||||||||  ||||||||| |||||||||||||||||||||||||| |||||||| |||
Sbjct: 481 tggcatggggaggacatgtaagggttgatgcgtccatgagcacggtatgtcctgcgtcgc 540

                                                                       
Query: 307 tgcttctgggcctggttcacttggatgtgcgaaatgtagagagcatccacatcaagacct 366
           |||||||| ||||| || ||||| |||||||| |  ||||| | |||||||||||| |||
Sbjct: 541 tgcttctgagcctgattaacttgaatgtgcgacacatagagggtatccacatcaagtcct 600

                                                                       
Query: 367 ttcacctcagcattgctctctgcgttctttagaagatccagaacgaacttagcagacttg 426
           ||||||||||||||||||||||| ||||| ||||| || |||| ||| ||||||||||||
Sbjct: 601 ttcacctcagcattgctctctgcattcttgagaaggtctagaatgaatttagcagacttg 660

                                                                       
Query: 427 gcaggcccagcgtccctgaccatttggctgacggttcttaacctgggcccgtgcgtccaa 486
            |||| ||||||||||||||||||||  || ||   |||| |||| | | || |||||||
Sbjct: 661 acagg-ccagcgtccctgaccatttgagtggcgagacttagcctgag-cagtacgtccaa 718

                                                                       
Query: 487 caccacggcagtacctccggaaggggatggcttgctttgtgtgccaacacatccttcaag 546
           |||| |  || ||||| ||||| |||||||| ||| ||||| || | ||||||| |||||
Sbjct: 719 caccgccacaatacctgcggaacgggatggcctgc-ttgtgggcgatcacatcc-tcaag 776

                                                                       
Query: 547 gtacctcttagccttgttcagcggcatcttcctcagggcaaacgctgtttcccttagtgt 606
           ||| || || |||||| | || | || |||||| |||||||| ||||| || | | ||||
Sbjct: 777 gtaacttttggccttggtgagtgacaacttcctaagggcaaaagctgtctcacgt-gtgt 835

                                                         
Query: 607 tcttgaaatgaacacgcaggtcgcggcccatggccttggcggactt 652
           ||||||| |||||||| ||||| |||||||||||||||||||||||
Sbjct: 836 tcttgaagtgaacacgtaggtcacggcccatggccttggcggactt 881



to top

>gb|AY103585.1| Zea mays PCO123564 mRNA sequence
          Length = 1953

 Score =  283 bits (143), Expect = 4e-73
 Identities = 385/459 (83%), Gaps = 5/459 (1%)
 Strand = Plus / Plus

                                                                        
Query: 187  atctgggactcagcctccttcttcaccggctcttccttctcagacaagatcagctcaatg 246
            ||||| ||||||||||| |||||||| |||||||||||||| |||||||| || || |||
Sbjct: 1233 atctgagactcagcctctttcttcacgggctcttccttctctgacaagatgagttcgatg 1292

                                                                        
Query: 247  tggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgc 306
            ||||| |||  ||||||||| ||||||||||| |||||||| ||||||||||||||||||
Sbjct: 1293 tggcacggggaggacatgtaagggttgatgcgcccatgagcgcggtaggtcctgcgccgc 1352

                                                                        
Query: 307  tgcttctgggcctggttcacttggatgtgcgaaatgtagagagcatccacatcaagacct 366
            |||||||| |||||||||||||| ||||| || |  ||||| | ||| ||||||||||||
Sbjct: 1353 tgcttctgagcctggttcacttgaatgtgtgacacatagagggtatcgacatcaagacct 1412

                                                                        
Query: 367  ttcacctcagcattgctctctgcgttctttagaagatccagaacgaacttagcagacttg 426
            || ||||||||||||||||| || ||||| ||||| || |||| |||  ||||||| |||
Sbjct: 1413 tttacctcagcattgctctcagcattcttgagaaggtctagaatgaatctagcagatttg 1472

                                                                        
Query: 427  gcaggcccagcgtccctgaccatttggctgacggttcttaacctgggcccgtgcgtccaa 486
             |||| |||||||||||| |||||||  |||||   |||| |||| | | || |||||||
Sbjct: 1473 acagg-ccagcgtccctgcccatttgagtgacgagacttagcctgag-cggtacgtccaa 1530

                                                                        
Query: 487  caccacggcagtacctccggaaggggatggcttgctttgtgtgccaacacatccttcaag 546
            |||| |  || ||||| ||||| |||||||| ||| ||||| || | ||||||| |||||
Sbjct: 1531 caccgccacaatacctgcggaacgggatggcctgc-ttgtgggcaatcacatcc-tcaag 1588

                                                                        
Query: 547  gtacctcttagccttgttcagcggcatcttcctcagggcaaacgctgtttcccttagtgt 606
            |||||| || |||||| | || | || |||||| |||||||| ||||| || |   ||||
Sbjct: 1589 gtaccttttggccttggtgagtgacaacttcctaagggcaaaagctgtctcac-gggtgt 1647

                                                   
Query: 607  tcttgaaatgaacacgcaggtcgcggcccatggccttgg 645
            ||||||| |||||||| ||||| ||||||||||||||||
Sbjct: 1648 tcttgaagtgaacacgtaggtcacggcccatggccttgg 1686



to top

>emb|X62725.1|HVRNPL172 H.vulgare mRNA for ribosomal protein L17-2
          Length = 854

 Score =  244 bits (123), Expect = 3e-61
 Identities = 310/367 (84%), Gaps = 4/367 (1%)
 Strand = Plus / Minus

                                                                       
Query: 196 tcagcctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatggg 255
           ||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |||
Sbjct: 530 tcagcctccttcttcacaggctcttccttctctgacaagatcagctcaatgtggcagggg 471

                                                                       
Query: 256 ttggacatgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgg 315
           ||||||||||| |||||||||||||||||||||||||| |||| ||||| |||||| |||
Sbjct: 470 ttggacatgtaagggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgg 411

                                                                       
Query: 316 gcctggttcacttggatgtgcgaaatgtagagagcatccacatcaagacctttcacctca 375
           || |||||||| |||||||| |||||||||||    || ||||| |  ||||| || |||
Sbjct: 410 gcttggttcacctggatgtgtgaaatgtagaggttgtcgacatccaagcctttaacttca 351

                                                                       
Query: 376 gcattgctctctgcgttctttagaagatccagaacgaacttagcagacttggcaggccca 435
           || || ||||| || ||||| || | |||||| |||||||  || ||||| ||||| |||
Sbjct: 350 gcgttactctcagcattcttcagcaaatccagcacgaactgggccgactttgcagg-cca 292

                                                                       
Query: 436 gcgtccctgaccatttggctgacggttcttaacctgggcccgtgcgtccaacaccacggc 495
           ||| ||||| ||||||||||| |||||||| || || | | || || || ||||| | ||
Sbjct: 291 gcgaccctgcccatttggctggcggttctttacttgtg-cagtacggcccacacctctgc 233

                                                                       
Query: 496 agtacctccggaaggggatggcttgctttgtgtgccaacacatccttcaaggtacctctt 555
           |||| || |||||||| || |||||| ||||| || |  |||||| ||||||||||||||
Sbjct: 232 agtatctacggaagggaattgcttgc-ttgtgagcgagaacatcc-tcaaggtacctctt 175

                  
Query: 556 agccttg 562
           |||||||
Sbjct: 174 agccttg 168



to top

>ref|NM_105410.2| Arabidopsis thaliana structural constituent of ribosome AT1G67430
           mRNA, complete cds
          Length = 713

 Score =  200 bits (101), Expect = 4e-48
 Identities = 204/237 (86%), Gaps = 1/237 (0%)
 Strand = Plus / Minus

                                                                       
Query: 214 ggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttg 273
           |||||||||||||| ||||| |||| ||||||||||||||||||||||||||| ||||||
Sbjct: 502 ggctcttccttctctgacaaaatcaactcaatgtggcatgggttggacatgtaagggttg 443

                                                                       
Query: 274 atgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatg 333
           || | ||| ||||||||||| ||||| | ||  |||||   |||||||||||||||||||
Sbjct: 442 attcttccgtgagcacggtaagtccttctcctttgctttgcggcctggttcacttggatg 383

                                                                       
Query: 334 tgcgaaatgtagagagcatccacatcaagacctttcacctcagcattgctctctgcgttc 393
           || || ||| |||| ||||| ||||| | |||||||||||||||||||||||| ||||||
Sbjct: 382 tgtgatatgaagagggcatcaacatccaaacctttcacctcagcattgctctcagcgttc 323

                                                                    
Query: 394 tttagaagatccagaacgaacttagcagacttggcaggcccagcgtccctgaccatt 450
           || || | ||| ||||| |||| |||||||||||| || ||| ||||| ||||||||
Sbjct: 322 ttgagcaaatcaagaacaaactgagcagacttggctgg-ccaacgtccttgaccatt 267



to top

>gb|AY081524.1| Arabidopsis thaliana unknown protein mRNA, complete cds
          Length = 564

 Score =  200 bits (101), Expect = 4e-48
 Identities = 204/237 (86%), Gaps = 1/237 (0%)
 Strand = Plus / Minus

                                                                       
Query: 214 ggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttg 273
           |||||||||||||| ||||| |||| ||||||||||||||||||||||||||| ||||||
Sbjct: 470 ggctcttccttctctgacaaaatcaactcaatgtggcatgggttggacatgtaagggttg 411

                                                                       
Query: 274 atgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatg 333
           || | ||| ||||||||||| ||||| | ||  |||||   |||||||||||||||||||
Sbjct: 410 attcttccgtgagcacggtaagtccttctcctttgctttgcggcctggttcacttggatg 351

                                                                       
Query: 334 tgcgaaatgtagagagcatccacatcaagacctttcacctcagcattgctctctgcgttc 393
           || || ||| |||| ||||| ||||| | |||||||||||||||||||||||| ||||||
Sbjct: 350 tgtgatatgaagagggcatcaacatccaaacctttcacctcagcattgctctcagcgttc 291

                                                                    
Query: 394 tttagaagatccagaacgaacttagcagacttggcaggcccagcgtccctgaccatt 450
           || || | ||| ||||| |||| |||||||||||| || ||| ||||| ||||||||
Sbjct: 290 ttgagcaaatcaagaacaaactgagcagacttggctgg-ccaacgtccttgaccatt 235



to top

>gb|AY042862.1| Arabidopsis thaliana ribosomal protein L17-like protein (T1F15.11)
           mRNA, complete cds
          Length = 711

 Score =  200 bits (101), Expect = 4e-48
 Identities = 204/237 (86%), Gaps = 1/237 (0%)
 Strand = Plus / Minus

                                                                       
Query: 214 ggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttg 273
           |||||||||||||| ||||| |||| ||||||||||||||||||||||||||| ||||||
Sbjct: 502 ggctcttccttctctgacaaaatcaactcaatgtggcatgggttggacatgtaagggttg 443

                                                                       
Query: 274 atgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatg 333
           || | ||| ||||||||||| ||||| | ||  |||||   |||||||||||||||||||
Sbjct: 442 attcttccgtgagcacggtaagtccttctcctttgctttgcggcctggttcacttggatg 383

                                                                       
Query: 334 tgcgaaatgtagagagcatccacatcaagacctttcacctcagcattgctctctgcgttc 393
           || || ||| |||| ||||| ||||| | |||||||||||||||||||||||| ||||||
Sbjct: 382 tgtgatatgaagagggcatcaacatccaaacctttcacctcagcattgctctcagcgttc 323

                                                                    
Query: 394 tttagaagatccagaacgaacttagcagacttggcaggcccagcgtccctgaccatt 450
           || || | ||| ||||| |||| |||||||||||| || ||| ||||| ||||||||
Sbjct: 322 ttgagcaaatcaagaacaaactgagcagacttggctgg-ccaacgtccttgaccatt 267



to top

>emb|BX817777.1|CNS0AE81 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL40ZG06 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 680

 Score =  192 bits (97), Expect = 1e-45
 Identities = 203/237 (85%), Gaps = 1/237 (0%)
 Strand = Plus / Minus

                                                                       
Query: 214 ggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttg 273
           |||||||||||||| ||||| |||| ||||||||||||||||||||||||||| ||||||
Sbjct: 490 ggctcttccttctctgacaaaatcaactcaatgtggcatgggttggacatgtaagggttg 431

                                                                       
Query: 274 atgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatg 333
           || | ||| ||||||||||| ||||| | ||  |||||   ||||||||| |||||||||
Sbjct: 430 attcttccgtgagcacggtaagtccttctcctttgctttgcggcctggttaacttggatg 371

                                                                       
Query: 334 tgcgaaatgtagagagcatccacatcaagacctttcacctcagcattgctctctgcgttc 393
           || || ||| |||| ||||| ||||| | |||||||||||||||||||||||| ||||||
Sbjct: 370 tgtgatatgaagagggcatcaacatccaaacctttcacctcagcattgctctcagcgttc 311

                                                                    
Query: 394 tttagaagatccagaacgaacttagcagacttggcaggcccagcgtccctgaccatt 450
           || || | ||| ||||| |||| |||||||||||| || ||| ||||| ||||||||
Sbjct: 310 ttgagcaaatcaagaacaaactgagcagacttggctgg-ccaacgtccttgaccatt 255



to top

>ref|NM_102503.2| Arabidopsis thaliana structural constituent of ribosome AT1G27400
           mRNA, complete cds
          Length = 826

 Score =  161 bits (81), Expect = 4e-36
 Identities = 192/229 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 ttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatg 264
           |||||||| |||||||| ||||| ||||| |||| |||||||||||||||||| ||||||
Sbjct: 574 ttcttcacaggctcttctttctctgacaaaatcaactcaatgtggcatgggtttgacatg 515

                                                                       
Query: 265 taggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttc 324
           || || ||||| | |||||||||||| || ||||| | || ||| ||    || ||||||
Sbjct: 514 taaggattgattcttccatgagcacgatatgtccttctcctctgttttgctgcttggttc 455

                                                                       
Query: 325 acttggatgtgcgaaatgtagagagcatccacatcaagacctttcacctcagcattgctc 384
           ||||||||||| |||||| | || ||||| ||||| | |||||| |||||||||||||||
Sbjct: 454 acttggatgtgagaaatgaaaagggcatcgacatccaaacctttgacctcagcattgctc 395

                                                            
Query: 385 tctgcgttctttagaagatccagaacgaacttagcagacttggcaggcc 433
           || || ||||| |||||||| |||||||| | |||||| || |||||||
Sbjct: 394 tcagcattcttgagaagatcaagaacgaattgagcagatttagcaggcc 346



to top

>gb|AY077651.1| Arabidopsis thaliana At1g27400/F17L21_20 mRNA, complete cds
          Length = 531

 Score =  161 bits (81), Expect = 4e-36
 Identities = 192/229 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 ttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatg 264
           |||||||| |||||||| ||||| ||||| |||| |||||||||||||||||| ||||||
Sbjct: 479 ttcttcacaggctcttctttctctgacaaaatcaactcaatgtggcatgggtttgacatg 420

                                                                       
Query: 265 taggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttc 324
           || || ||||| | |||||||||||| || ||||| | || ||| ||    || ||||||
Sbjct: 419 taaggattgattcttccatgagcacgatatgtccttctcctctgttttgctgcttggttc 360

                                                                       
Query: 325 acttggatgtgcgaaatgtagagagcatccacatcaagacctttcacctcagcattgctc 384
           ||||||||||| |||||| | || ||||| ||||| | |||||| |||||||||||||||
Sbjct: 359 acttggatgtgagaaatgaaaagggcatcgacatccaaacctttgacctcagcattgctc 300

                                                            
Query: 385 tctgcgttctttagaagatccagaacgaacttagcagacttggcaggcc 433
           || || ||||| |||||||| |||||||| | |||||| || |||||||
Sbjct: 299 tcagcattcttgagaagatcaagaacgaattgagcagatttagcaggcc 251



to top

>gb|AF428449.1|AF428449 Arabidopsis thaliana At1g27400/F17L21_20 mRNA, complete cds
          Length = 712

 Score =  161 bits (81), Expect = 4e-36
 Identities = 192/229 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 ttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatg 264
           |||||||| |||||||| ||||| ||||| |||| |||||||||||||||||| ||||||
Sbjct: 514 ttcttcacaggctcttctttctctgacaaaatcaactcaatgtggcatgggtttgacatg 455

                                                                       
Query: 265 taggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttc 324
           || || ||||| | |||||||||||| || ||||| | || ||| ||    || ||||||
Sbjct: 454 taaggattgattcttccatgagcacgatatgtccttctcctctgttttgctgcttggttc 395

                                                                       
Query: 325 acttggatgtgcgaaatgtagagagcatccacatcaagacctttcacctcagcattgctc 384
           ||||||||||| |||||| | || ||||| ||||| | |||||| |||||||||||||||
Sbjct: 394 acttggatgtgagaaatgaaaagggcatcgacatccaaacctttgacctcagcattgctc 335

                                                            
Query: 385 tctgcgttctttagaagatccagaacgaacttagcagacttggcaggcc 433
           || || ||||| |||||||| |||||||| | |||||| || |||||||
Sbjct: 334 tcagcattcttgagaagatcaagaacgaattgagcagatttagcaggcc 286



to top

>gb|AF428271.1|AF428271 Arabidopsis thaliana At1g27400/F17L21_20 mRNA, complete cds
          Length = 762

 Score =  161 bits (81), Expect = 4e-36
 Identities = 192/229 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 ttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatg 264
           |||||||| |||||||| ||||| ||||| |||| |||||||||||||||||| ||||||
Sbjct: 514 ttcttcacaggctcttctttctctgacaaaatcaactcaatgtggcatgggtttgacatg 455

                                                                       
Query: 265 taggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttc 324
           || || ||||| | |||||||||||| || ||||| | || ||| ||    || ||||||
Sbjct: 454 taaggattgattcttccatgagcacgatatgtccttctcctctgttttgctgcttggttc 395

                                                                       
Query: 325 acttggatgtgcgaaatgtagagagcatccacatcaagacctttcacctcagcattgctc 384
           ||||||||||| |||||| | || ||||| ||||| | |||||| |||||||||||||||
Sbjct: 394 acttggatgtgagaaatgaaaagggcatcgacatccaaacctttgacctcagcattgctc 335

                                                            
Query: 385 tctgcgttctttagaagatccagaacgaacttagcagacttggcaggcc 433
           || || ||||| |||||||| |||||||| | |||||| || |||||||
Sbjct: 334 tcagcattcttgagaagatcaagaacgaattgagcagatttagcaggcc 286



to top

>gb|AY037249.1| Arabidopsis thaliana At1g27400/F17L21_20 mRNA, complete cds
          Length = 767

 Score =  161 bits (81), Expect = 4e-36
 Identities = 192/229 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 ttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatg 264
           |||||||| |||||||| ||||| ||||| |||| |||||||||||||||||| ||||||
Sbjct: 514 ttcttcacaggctcttctttctctgacaaaatcaactcaatgtggcatgggtttgacatg 455

                                                                       
Query: 265 taggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttc 324
           || || ||||| | |||||||||||| || ||||| | || ||| ||    || ||||||
Sbjct: 454 taaggattgattcttccatgagcacgatatgtccttctcctctgttttgctgcttggttc 395

                                                                       
Query: 325 acttggatgtgcgaaatgtagagagcatccacatcaagacctttcacctcagcattgctc 384
           ||||||||||| |||||| | || ||||| ||||| | |||||| |||||||||||||||
Sbjct: 394 acttggatgtgagaaatgaaaagggcatcgacatccaaacctttgacctcagcattgctc 335

                                                            
Query: 385 tctgcgttctttagaagatccagaacgaacttagcagacttggcaggcc 433
           || || ||||| |||||||| |||||||| | |||||| || |||||||
Sbjct: 334 tcagcattcttgagaagatcaagaacgaattgagcagatttagcaggcc 286



to top

>gb|AY088522.1| Arabidopsis thaliana clone 749 mRNA, complete sequence
          Length = 747

 Score =  161 bits (81), Expect = 4e-36
 Identities = 192/229 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 ttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatg 264
           |||||||| |||||||| ||||| ||||| |||| |||||||||||||||||| ||||||
Sbjct: 574 ttcttcacaggctcttctttctctgacaaaatcaactcaatgtggcatgggtttgacatg 515

                                                                       
Query: 265 taggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttc 324
           || || ||||| | |||||||||||| || ||||| | || ||| ||    || ||||||
Sbjct: 514 taaggattgattcttccatgagcacgatatgtccttctcctctgttttgctgcttggttc 455

                                                                       
Query: 325 acttggatgtgcgaaatgtagagagcatccacatcaagacctttcacctcagcattgctc 384
           ||||||||||| |||||| | || ||||| ||||| | |||||| |||||||||||||||
Sbjct: 454 acttggatgtgagaaatgaaaagggcatcgacatccaaacctttgacctcagcattgctc 395

                                                            
Query: 385 tctgcgttctttagaagatccagaacgaacttagcagacttggcaggcc 433
           || || ||||| |||||||| |||||||| | |||||| || |||||||
Sbjct: 394 tcagcattcttgagaagatcaagaacgaattgagcagatttagcaggcc 346



to top

>gb|AF034948.1|AF034948 Zea mays ribosomal protein L17 (rpl17) mRNA, complete cds
          Length = 746

 Score =  153 bits (77), Expect = 9e-34
 Identities = 128/145 (88%)
 Strand = Plus / Minus

                                                                       
Query: 196 tcagcctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatggg 255
           |||||||| |||||||| |||||||||||||| ||||  ||||||||||||||||| |||
Sbjct: 528 tcagcctctttcttcacaggctcttccttctctgacagaatcagctcaatgtggcaaggg 469

                                                                       
Query: 256 ttggacatgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgg 315
             ||||||||| ||||| |||||||| |||||||||||||| | ||||| ||||||||||
Sbjct: 468 gaggacatgtaagggttaatgcgtccgtgagcacggtaggtgcggcgcctctgcttctgg 409

                                    
Query: 316 gcctggttcacttggatgtgcgaaa 340
           || |||||||| |||||||| ||||
Sbjct: 408 gcttggttcacctggatgtgtgaaa 384



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 136/170 (80%), Gaps = 3/170 (1%)
 Strand = Plus / Minus

                                                                       
Query: 477 gtgcgtccaacaccacggcagtacctccggaaggggatggcttgctttgtgtgccaacac 536
           ||||| |||||||| |  ||||| ||||||||||| || || ||||| ||| || |  ||
Sbjct: 249 gtgcgaccaacacctccacagtatctccggaagggaattgcctgctt-gtgagcaataac 191

                                                                       
Query: 537 atccttcaaggtacctcttagccttgttcagcggcatcttcctcagggcaaacgctgttt 596
           ||||| ||||||| | |||||||||| |||  |||| ||| |  || ||||| ||||| |
Sbjct: 190 atcct-caaggtatcgcttagccttggtcaaaggcagcttgcgaagcgcaaaagctgtct 132

                                                             
Query: 597 cccttagtgttcttgaaatgaacacgcaggtcgcggcccatggccttggc 646
           ||||| ||||||||||| || || | |||||| |  ||||||||||||||
Sbjct: 131 ccctt-gtgttcttgaagtggaccctcaggtcccttcccatggccttggc 83



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
               sequence
          Length = 22696651

 Score =  131 bits (66), Expect = 3e-27
 Identities = 178/210 (84%), Gaps = 4/210 (1%)
 Strand = Plus / Plus

                                                                           
Query: 370     acctcagcattgctctctgcgttctttagaagatccagaacgaacttagcagacttggca 429
               |||||||||||||||||||| ||||| ||||||||||||| |||  ||||||||||||||
Sbjct: 4337505 acctcagcattgctctctgcattcttaagaagatccagaatgaatctagcagacttggca 4337564

                                                                           
Query: 430     ggcccagcgtccctgaccatttggctgacggttcttaacctgggcccgtgcgtccaacac 489
               || ||||||||||||||| ||||  || ||   |||| | || | | ||||| |||||||
Sbjct: 4337565 gg-ccagcgtccctgaccgtttgaatggcgtgacttagcttgag-cagtgcggccaacac 4337622

                                                                           
Query: 490     cacggcagtacctccggaaggggatggcttgctttgtgtgccaacacatccttcaaggta 549
               ||| ||||||||| ||||||||||| |||||| ||||| || | ||||||| ||||||||
Sbjct: 4337623 caccgcagtacctacggaaggggatagcttgc-ttgtgggcaatcacatcc-tcaaggta 4337680

                                             
Query: 550     cctcttagccttgttcagcggcatcttcct 579
               |||||| ||||||  ||| |||| ||||||
Sbjct: 4337681 cctcttggccttgcccagaggcaacttcct 4337710



 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                           
Query: 269     ggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcactt 328
               |||||||||||||||||||||||||||| | ||||| |||||||||||||||||| ||||
Sbjct: 4337323 ggttgatgcgtccatgagcacggtaggtacggcgcctctgcttctgggcctggttaactt 4337382

                                                            
Query: 329     ggatgtgcgaaatgtagagagcatccacatcaagacctttcacct 373
               | ||||| || |  || |||| ||| ||||| |||||||||||||
Sbjct: 4337383 gaatgtgggacacataaagagtatcaacatccagacctttcacct 4337427



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                           
Query: 200     cctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatgggttgg 259
               |||| |||||||| || ||||||||||| |||| ||| |||||||||||||| |||  ||
Sbjct: 4337174 cctctttcttcactggttcttccttctctgacaggataagctcaatgtggcacggggagg 4337233

                      
Query: 260     acatgta 266
               |||||||
Sbjct: 4337234 acatgta 4337240



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                         
Query: 160     agcttccttctctaggccttcctggc 185
               ||||||||||||||||||||||||||
Sbjct: 4337036 agcttccttctctaggccttcctggc 4337061



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                     
Query: 608     cttgaaatgaacacgcaggtcgcggcccatggccttgg 645
               |||||| || ||||||| ||| ||||||||||||||||
Sbjct: 4339307 cttgaagtgcacacgcaagtcccggcccatggccttgg 4339344



to top

>dbj|AP006441.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:B1279D09
          Length = 134793

 Score =  131 bits (66), Expect = 3e-27
 Identities = 178/210 (84%), Gaps = 4/210 (1%)
 Strand = Plus / Plus

                                                                         
Query: 370   acctcagcattgctctctgcgttctttagaagatccagaacgaacttagcagacttggca 429
             |||||||||||||||||||| ||||| ||||||||||||| |||  ||||||||||||||
Sbjct: 40323 acctcagcattgctctctgcattcttaagaagatccagaatgaatctagcagacttggca 40382

                                                                         
Query: 430   ggcccagcgtccctgaccatttggctgacggttcttaacctgggcccgtgcgtccaacac 489
             || ||||||||||||||| ||||  || ||   |||| | || | | ||||| |||||||
Sbjct: 40383 gg-ccagcgtccctgaccgtttgaatggcgtgacttagcttgag-cagtgcggccaacac 40440

                                                                         
Query: 490   cacggcagtacctccggaaggggatggcttgctttgtgtgccaacacatccttcaaggta 549
             ||| ||||||||| ||||||||||| |||||| ||||| || | ||||||| ||||||||
Sbjct: 40441 caccgcagtacctacggaaggggatagcttgc-ttgtgggcaatcacatcc-tcaaggta 40498

                                           
Query: 550   cctcttagccttgttcagcggcatcttcct 579
             |||||| ||||||  ||| |||| ||||||
Sbjct: 40499 cctcttggccttgcccagaggcaacttcct 40528



 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                         
Query: 269   ggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcactt 328
             |||||||||||||||||||||||||||| | ||||| |||||||||||||||||| ||||
Sbjct: 40141 ggttgatgcgtccatgagcacggtaggtacggcgcctctgcttctgggcctggttaactt 40200

                                                          
Query: 329   ggatgtgcgaaatgtagagagcatccacatcaagacctttcacct 373
             | ||||| || |  || |||| ||| ||||| |||||||||||||
Sbjct: 40201 gaatgtgggacacataaagagtatcaacatccagacctttcacct 40245



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                         
Query: 200   cctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatgggttgg 259
             |||| |||||||| || ||||||||||| |||| ||| |||||||||||||| |||  ||
Sbjct: 39992 cctctttcttcactggttcttccttctctgacaggataagctcaatgtggcacggggagg 40051

                    
Query: 260   acatgta 266
             |||||||
Sbjct: 40052 acatgta 40058



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 160   agcttccttctctaggccttcctggc 185
             ||||||||||||||||||||||||||
Sbjct: 39854 agcttccttctctaggccttcctggc 39879



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                   
Query: 608   cttgaaatgaacacgcaggtcgcggcccatggccttgg 645
             |||||| || ||||||| ||| ||||||||||||||||
Sbjct: 42125 cttgaagtgcacacgcaagtcccggcccatggccttgg 42162



to top

>dbj|AP005589.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
              clone:P0523B07
          Length = 170510

 Score =  131 bits (66), Expect = 3e-27
 Identities = 178/210 (84%), Gaps = 4/210 (1%)
 Strand = Plus / Plus

                                                                          
Query: 370    acctcagcattgctctctgcgttctttagaagatccagaacgaacttagcagacttggca 429
              |||||||||||||||||||| ||||| ||||||||||||| |||  ||||||||||||||
Sbjct: 161264 acctcagcattgctctctgcattcttaagaagatccagaatgaatctagcagacttggca 161323

                                                                          
Query: 430    ggcccagcgtccctgaccatttggctgacggttcttaacctgggcccgtgcgtccaacac 489
              || ||||||||||||||| ||||  || ||   |||| | || | | ||||| |||||||
Sbjct: 161324 gg-ccagcgtccctgaccgtttgaatggcgtgacttagcttgag-cagtgcggccaacac 161381

                                                                          
Query: 490    cacggcagtacctccggaaggggatggcttgctttgtgtgccaacacatccttcaaggta 549
              ||| ||||||||| ||||||||||| |||||| ||||| || | ||||||| ||||||||
Sbjct: 161382 caccgcagtacctacggaaggggatagcttgc-ttgtgggcaatcacatcc-tcaaggta 161439

                                            
Query: 550    cctcttagccttgttcagcggcatcttcct 579
              |||||| ||||||  ||| |||| ||||||
Sbjct: 161440 cctcttggccttgcccagaggcaacttcct 161469



 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                          
Query: 269    ggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcactt 328
              |||||||||||||||||||||||||||| | ||||| |||||||||||||||||| ||||
Sbjct: 161082 ggttgatgcgtccatgagcacggtaggtacggcgcctctgcttctgggcctggttaactt 161141

                                                           
Query: 329    ggatgtgcgaaatgtagagagcatccacatcaagacctttcacct 373
              | ||||| || |  || |||| ||| ||||| |||||||||||||
Sbjct: 161142 gaatgtgggacacataaagagtatcaacatccagacctttcacct 161186



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                          
Query: 200    cctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatgggttgg 259
              |||| |||||||| || ||||||||||| |||| ||| |||||||||||||| |||  ||
Sbjct: 160933 cctctttcttcactggttcttccttctctgacaggataagctcaatgtggcacggggagg 160992

                     
Query: 260    acatgta 266
              |||||||
Sbjct: 160993 acatgta 160999



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                        
Query: 160    agcttccttctctaggccttcctggc 185
              ||||||||||||||||||||||||||
Sbjct: 160795 agcttccttctctaggccttcctggc 160820



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                    
Query: 608    cttgaaatgaacacgcaggtcgcggcccatggccttgg 645
              |||||| || ||||||| ||| ||||||||||||||||
Sbjct: 163066 cttgaagtgcacacgcaagtcccggcccatggccttgg 163103



to top

>ref|XM_483472.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 755

 Score =  121 bits (61), Expect = 3e-24
 Identities = 124/145 (85%)
 Strand = Plus / Minus

                                                                       
Query: 196 tcagcctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatggg 255
           |||| ||| |||||||| | |||||||||||| |||||||| ||||| | |||||| || 
Sbjct: 557 tcaggctctttcttcacggcctcttccttctctgacaagataagctcgacgtggcagggt 498

                                                                       
Query: 256 ttggacatgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgg 315
             ||||||||| || ||||||||||||||||||||||| |||| ||| | ||||||||||
Sbjct: 497 gaggacatgtaaggattgatgcgtccatgagcacggtatgtccggcgtctctgcttctgg 438

                                    
Query: 316 gcctggttcacttggatgtgcgaaa 340
           || |||||||| |||||||| ||||
Sbjct: 437 gcttggttcacctggatgtgtgaaa 413



to top

>dbj|AK120448.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013100M19, full
           insert sequence
          Length = 839

 Score =  121 bits (61), Expect = 3e-24
 Identities = 124/145 (85%)
 Strand = Plus / Minus

                                                                       
Query: 196 tcagcctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatggg 255
           |||| ||| |||||||| | |||||||||||| |||||||| ||||| | |||||| || 
Sbjct: 614 tcaggctctttcttcacggcctcttccttctctgacaagataagctcgacgtggcagggt 555

                                                                       
Query: 256 ttggacatgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgg 315
             ||||||||| || ||||||||||||||||||||||| |||| ||| | ||||||||||
Sbjct: 554 gaggacatgtaaggattgatgcgtccatgagcacggtatgtccggcgtctctgcttctgg 495

                                    
Query: 316 gcctggttcacttggatgtgcgaaa 340
           || |||||||| |||||||| ||||
Sbjct: 494 gcttggttcacctggatgtgtgaaa 470



to top

>dbj|AK062052.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-044-B07, full
           insert sequence
          Length = 755

 Score =  121 bits (61), Expect = 3e-24
 Identities = 124/145 (85%)
 Strand = Plus / Minus

                                                                       
Query: 196 tcagcctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatggg 255
           |||| ||| |||||||| | |||||||||||| |||||||| ||||| | |||||| || 
Sbjct: 557 tcaggctctttcttcacggcctcttccttctctgacaagataagctcgacgtggcagggt 498

                                                                       
Query: 256 ttggacatgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgg 315
             ||||||||| || ||||||||||||||||||||||| |||| ||| | ||||||||||
Sbjct: 497 gaggacatgtaaggattgatgcgtccatgagcacggtatgtccggcgtctctgcttctgg 438

                                    
Query: 316 gcctggttcacttggatgtgcgaaa 340
           || |||||||| |||||||| ||||
Sbjct: 437 gcttggttcacctggatgtgtgaaa 413



to top

>gb|AF076975.1|AF076975 Populus alba unknown mRNA, partial cds
          Length = 578

 Score =  119 bits (60), Expect = 1e-23
 Identities = 111/128 (86%)
 Strand = Plus / Minus

                                                                       
Query: 306 ctgcttctgggcctggttcacttggatgtgcgaaatgtagagagcatccacatcaagacc 365
           ||||||||| ||||| ||||| |||||||| ||||||||||| ||||||||||| | |||
Sbjct: 258 ctgcttctgtgcctgattcacctggatgtgagaaatgtagagtgcatccacatccaaacc 199

                                                                       
Query: 366 tttcacctcagcattgctctctgcgttctttagaagatccagaacgaacttagcagactt 425
            || ||||||||||||||||| || ||||| || | |||||| | |||||| ||||||||
Sbjct: 198 cttgacctcagcattgctctcggcattcttgagtaaatccaggatgaacttggcagactt 139

                   
Query: 426 ggcaggcc 433
           ||||||||
Sbjct: 138 ggcaggcc 131



to top

>gb|AF307336.1|AF307336 Petunia x hybrida ribosomal protein (PETRP) mRNA, complete cds
          Length = 819

 Score =  107 bits (54), Expect = 5e-20
 Identities = 141/170 (82%)
 Strand = Plus / Minus

                                                                       
Query: 217 tcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatg 276
           |||||||| |||||||| |||| |||||| ||||| || || ||||||||||| ||||| 
Sbjct: 498 tcttccttttcagacaatatcaactcaatatggcagggattagacatgtagggattgatt 439

                                                                       
Query: 277 cgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
           | ||||||||||||||| |||| ||||| ||| ||||| || ||||| ||||||||||| 
Sbjct: 438 cttccatgagcacggtatgtccggcgcctctgtttctgtgcttggtttacttggatgtga 379

                                                             
Query: 337 gaaatgtagagagcatccacatcaagacctttcacctcagcattgctctc 386
              || || || | ||||||||| | |||||| || ||||||||||||||
Sbjct: 378 cttatataaagtgaatccacatccaaacctttaacttcagcattgctctc 329



to top

>emb|AJ876806.1| Acanthamoeba polyphaga mRNA for putative ribosomal L17-like protein
          Length = 545

 Score =  103 bits (52), Expect = 7e-19
 Identities = 127/152 (83%)
 Strand = Plus / Minus

                                                                       
Query: 244 atgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggtcctgcgc 303
           |||||||| ||||||||||||||||||||||| |  || || || ||||||||||| | |
Sbjct: 423 atgtggcaggggttggacatgtaggggttgatcctaccgtgggcgcggtaggtcctcctc 364

                                                                       
Query: 304 cgctgcttctgggcctggttcacttggatgtgcgaaatgtagagagcatccacatcaaga 363
           | |||||||||||||| ||| || || |    ||||| |||||| || ||||||||||||
Sbjct: 363 ctctgcttctgggccttgttgacctgaacccacgaaacgtagagggcgtccacatcaaga 304

                                           
Query: 364 cctttcacctcagcattgctctctgcgttctt 395
           || || |||||||| |||||||| ||||||||
Sbjct: 303 cccttgacctcagcgttgctctcggcgttctt 272



to top

>ref|XM_323004.1| Neurospora crassa OR74A 60S RIBOSOMAL PROTEIN L17 [MIPS]
           (NCU03703.1) partial mRNA
          Length = 585

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                       
Query: 238 agctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggtc 297
           ||||| |||||||| |||||||||||||||||||||||||| || ||||| ||||| || 
Sbjct: 467 agctcgatgtggcaggggttggacatgtaggggttgatgcgaccgtgagcgcggtaagtg 408

                                                  
Query: 298 ctgcgccgctgcttctgggcctggttcacttggatgtgc 336
           | ||| ||||||||  |||||||||| || |||||||||
Sbjct: 407 cggcggcgctgcttgggggcctggttgacctggatgtgc 369



to top

>ref|XM_956386.1| Neurospora crassa OR74A 60S RIBOSOMAL PROTEIN L17 [MIPS]
           (NCU03703.1) partial mRNA
          Length = 585

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                       
Query: 238 agctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggtc 297
           ||||| |||||||| |||||||||||||||||||||||||| || ||||| ||||| || 
Sbjct: 467 agctcgatgtggcaggggttggacatgtaggggttgatgcgaccgtgagcgcggtaagtg 408

                                                  
Query: 298 ctgcgccgctgcttctgggcctggttcacttggatgtgc 336
           | ||| ||||||||  |||||||||| || |||||||||
Sbjct: 407 cggcggcgctgcttgggggcctggttgacctggatgtgc 369



to top

>ref|XM_382047.1| Gibberella zeae PH-1 chromosome 1 RL17_NEUCR 60S ribosomal protein
           L17 (FG01871.1) partial mRNA
          Length = 558

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                       
Query: 238 agctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggtc 297
           ||||| |||||||| |||||||||||||| |||||||| || || ||||||||||| |||
Sbjct: 443 agctcgatgtggcaggggttggacatgtaagggttgatacgaccgtgagcacggtatgtc 384

                                                  
Query: 298 ctgcgccgctgcttctgggcctggttcacttggatgtgc 336
           || || ||||||||  |||||||||| || |||||||||
Sbjct: 383 cttcgtcgctgcttgggggcctggttgacctggatgtgc 345



to top

>gb|DQ207869.1| Solanum tuberosum clone 086A10 ribosomal protein PETRP-like mRNA,
           complete cds
          Length = 729

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 139/171 (81%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgat 275
           ||||||||||||||| || |||| |||||| ||||| ||||  ||||| |||||||| ||
Sbjct: 498 ctcttccttctcagataaaatcaactcaatatggcaggggtgagacatataggggttaat 439

                                                                       
Query: 276 gcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtg 335
            | |||||| ||||||||||| |  || | ||| || || || |  ||||||||||||||
Sbjct: 438 tcttccatgtgcacggtaggtacgacgtctctgtttttgagcttcattcacttggatgtg 379

                                                              
Query: 336 cgaaatgtagagagcatccacatcaagacctttcacctcagcattgctctc 386
            || || || || | ||||||||| | ||||||||||||||| ||||||||
Sbjct: 378 agatatataaagtgaatccacatccaaacctttcacctcagcgttgctctc 328



to top

>gb|AY496096.1| Capsicum annuum ribosomal protein PETRP mRNA, complete cds
          Length = 765

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 139/171 (81%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgat 275
           |||||||||||||||||| | || |||||| ||||| ||||  ||||| |||||||| ||
Sbjct: 512 ctcttccttctcagacaataccaactcaatatggcaagggtgagacatataggggttaat 453

                                                                       
Query: 276 gcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtg 335
            | ||| || || ||||| || | ||||| ||| || || |||||||| |||||||||||
Sbjct: 452 tcttccgtgtgctcggtatgtgcggcgcctctgtttttgtgcctggtttacttggatgtg 393

                                                              
Query: 336 cgaaatgtagagagcatccacatcaagacctttcacctcagcattgctctc 386
            || ||| | || | ||||||||| |  ||||| |||||||||||||||||
Sbjct: 392 agatatgaaaagtgaatccacatccaagcctttaacctcagcattgctctc 342



to top

>gb|DQ252494.1| Solanum tuberosum clone 063E12 ribosomal protein PETRP-like mRNA,
           complete cds
          Length = 760

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 139/171 (81%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgat 275
           ||||||||||||||| || |||| |||||| ||||| ||||  ||||| |||||||| ||
Sbjct: 509 ctcttccttctcagataaaatcaactcaatatggcaggggtgagacatataggggttaat 450

                                                                       
Query: 276 gcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtg 335
            | ||| || ||||||||||| |  |||| ||| || || || |  ||||||||||||||
Sbjct: 449 tcttccgtgtgcacggtaggtacgacgcctctgtttttgagcttcattcacttggatgtg 390

                                                              
Query: 336 cgaaatgtagagagcatccacatcaagacctttcacctcagcattgctctc 386
            || || || || | ||||||||| | ||||||||||||||| ||||||||
Sbjct: 389 agatatataaagtgaatccacatccaaacctttcacctcagcgttgctctc 339



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 63/70 (90%)
 Strand = Plus / Plus

                                                                            
Query: 271      ttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttgg 330
                ||||||||||||||||||||||| |||| ||| | |||||||||||| |||||||| |||
Sbjct: 26399460 ttgatgcgtccatgagcacggtatgtccggcgtctctgcttctgggcttggttcacctgg 26399519

                          
Query: 331      atgtgcgaaa 340
                ||||| ||||
Sbjct: 26399520 atgtgtgaaa 26399529



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                    
Query: 200      cctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggca 251
                |||| |||||||| | |||||||||||| |||||||| ||||| | ||||||
Sbjct: 26399319 cctctttcttcacggcctcttccttctctgacaagataagctcgacgtggca 26399370



to top

>dbj|AP003920.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1789_C07
          Length = 138944

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 63/70 (90%)
 Strand = Plus / Plus

                                                                         
Query: 271   ttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttgg 330
             ||||||||||||||||||||||| |||| ||| | |||||||||||| |||||||| |||
Sbjct: 49012 ttgatgcgtccatgagcacggtatgtccggcgtctctgcttctgggcttggttcacctgg 49071

                       
Query: 331   atgtgcgaaa 340
             ||||| ||||
Sbjct: 49072 atgtgtgaaa 49081



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                 
Query: 200   cctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggca 251
             |||| |||||||| | |||||||||||| |||||||| ||||| | ||||||
Sbjct: 48871 cctctttcttcacggcctcttccttctctgacaagataagctcgacgtggca 48922



to top

>dbj|AP004015.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OJ1770_H02
          Length = 170648

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 63/70 (90%)
 Strand = Plus / Plus

                                                                          
Query: 271    ttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttgg 330
              ||||||||||||||||||||||| |||| ||| | |||||||||||| |||||||| |||
Sbjct: 129041 ttgatgcgtccatgagcacggtatgtccggcgtctctgcttctgggcttggttcacctgg 129100

                        
Query: 331    atgtgcgaaa 340
              ||||| ||||
Sbjct: 129101 atgtgtgaaa 129110



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                  
Query: 200    cctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggca 251
              |||| |||||||| | |||||||||||| |||||||| ||||| | ||||||
Sbjct: 128900 cctctttcttcacggcctcttccttctctgacaagataagctcgacgtggca 128951



to top

>gb|AC004393.2|T1F15 Arabidopsis thaliana chromosome 1 BAC T1F15 sequence, complete sequence
          Length = 60066

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 50/53 (94%)
 Strand = Plus / Plus

                                                                  
Query: 214   ggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatgta 266
             |||||||||||||| ||||| |||| |||||||||||||||||||||||||||
Sbjct: 43909 ggctcttccttctctgacaaaatcaactcaatgtggcatgggttggacatgta 43961



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 72/83 (86%), Gaps = 1/83 (1%)
 Strand = Plus / Plus

                                                                         
Query: 368   tcacctcagcattgctctctgcgttctttagaagatccagaacgaacttagcagacttgg 427
             ||||||||||||||||||| |||||||| || | ||| ||||| |||| |||||||||||
Sbjct: 44239 tcacctcagcattgctctcagcgttcttgagcaaatcaagaacaaactgagcagacttgg 44298

                                    
Query: 428   caggcccagcgtccctgaccatt 450
             | || ||| ||||| ||||||||
Sbjct: 44299 ctgg-ccaacgtccttgaccatt 44320



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 87/105 (82%)
 Strand = Plus / Plus

                                                                         
Query: 269   ggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcactt 328
             ||||||| | ||| ||||||||||| ||||| | ||  |||||   ||||||||||||||
Sbjct: 44048 ggttgattcttccgtgagcacggtaagtccttctcctttgctttgcggcctggttcactt 44107

                                                          
Query: 329   ggatgtgcgaaatgtagagagcatccacatcaagacctttcacct 373
             ||||||| || ||| |||| ||||| ||||| | |||||||||||
Sbjct: 44108 ggatgtgtgatatgaagagggcatcaacatccaaacctttcacct 44152



to top

>gb|DQ235197.1| Solanum tuberosum clone 168G07 ribosomal protein PETRP-like mRNA,
           complete cds
          Length = 774

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 136/168 (80%)
 Strand = Plus / Minus

                                                                       
Query: 216 ctcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgat 275
           |||||||||||| || || |||| |||||| ||||| ||||  ||||| |||||||| ||
Sbjct: 503 ctcttccttctcggataaaatcaactcaatatggcaggggtgagacatataggggttaat 444

                                                                       
Query: 276 gcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtg 335
            | ||| || ||||||||||| |  |||| ||| || || || |  ||||||||||||||
Sbjct: 443 tcttccgtgtgcacggtaggtacgacgcctctgtttttgagcttcattcacttggatgtg 384

                                                           
Query: 336 cgaaatgtagagagcatccacatcaagacctttcacctcagcattgct 383
            || || || || | ||||||||| | |||||||||||||||||||||
Sbjct: 383 agatatataaagtgaatccacatccaaacctttcacctcagcattgct 336



to top

>gb|AY853172.1| Pectinaria gouldii ribosomal protein L17 mRNA, complete cds
          Length = 666

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 237 cagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggt 296
           ||||||||||||||||||| ||  |||||||||||||||||| |||||||| | ||||||
Sbjct: 472 cagctcaatgtggcatgggctgctcatgtaggggttgatgcgaccatgagccctgtaggt 413

              
Query: 297 cct 299
           |||
Sbjct: 412 cct 410



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 372 ctcagcattgctctctgcgttctttagaag 401
           ||||||||||||||| |||||||| |||||
Sbjct: 337 ctcagcattgctctcagcgttcttcagaag 308



to top

>gb|AC004557.2|AC004557 Genomic sequence for Arabidopsis thaliana BAC F17L21 from chromosome I,
             complete sequence
          Length = 99690

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 60/67 (89%)
 Strand = Plus / Minus

                                                                         
Query: 200   cctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatgggttgg 259
             |||| |||||||| |||||||| ||||| ||||| |||| |||||||||||||||||| |
Sbjct: 60465 cctctttcttcacaggctcttctttctctgacaaaatcaactcaatgtggcatgggtttg 60406

                    
Query: 260   acatgta 266
             |||||||
Sbjct: 60405 acatgta 60399



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 56/64 (87%)
 Strand = Plus / Minus

                                                                         
Query: 370   acctcagcattgctctctgcgttctttagaagatccagaacgaacttagcagacttggca 429
             ||||||||||||||||| || ||||| |||||||| |||||||| | |||||| || |||
Sbjct: 60121 acctcagcattgctctcagcattcttgagaagatcaagaacgaattgagcagatttagca 60062

                 
Query: 430   ggcc 433
             ||||
Sbjct: 60061 ggcc 60058



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                    
Query: 319   tggttcacttggatgtgcgaaatgtagagagcatccacatcaagacctttcacct 373
             ||||||||||||||||| |||||| | || ||||| ||||| | |||||| ||||
Sbjct: 60256 tggttcacttggatgtgagaaatgaaaagggcatcgacatccaaacctttgacct 60202



to top

>ref|XM_747718.1| Aspergillus fumigatus Af293 60s ribosomal protein yL17-b
           (Afu1g14410) partial mRNA
          Length = 585

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 238 agctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggt 296
           ||||| |||||||| ||||||| ||||||||||||||| || || ||||||||||||||
Sbjct: 464 agctcgatgtggcaggggttggtcatgtaggggttgatacgaccgtgagcacggtaggt 406



to top

>dbj|AB226154.1| Aspergillus oryzae cDNA, contig sequence: AoEST3012
          Length = 1075

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 238 agctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggt 296
           ||||| |||||||| ||||||| ||||||||||||||| || || ||||||||||||||
Sbjct: 501 agctcgatgtggcaagggttggtcatgtaggggttgatacgaccgtgagcacggtaggt 443



to top

>gb|AY389972.1| Xenopus laevis ribosomal protein L17 mRNA, partial cds
          Length = 472

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 67/78 (85%)
 Strand = Plus / Minus

                                                                       
Query: 219 ttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcg 278
           |||||||||||  | |||||  || ||||||||||||  |  ||||||||||||||||||
Sbjct: 436 ttccttctcagtaaggatcatttcgatgtggcatggggagctcatgtaggggttgatgcg 377

                             
Query: 279 tccatgagcacggtaggt 296
            |||||||||||||||||
Sbjct: 376 accatgagcacggtaggt 359



to top

>gb|BC043971.1| Xenopus laevis similar to ribosomal protein L17, mRNA (cDNA clone
           IMAGE:5571114), partial cds
          Length = 627

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 67/78 (85%)
 Strand = Plus / Minus

                                                                       
Query: 219 ttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcg 278
           |||||||||||  | |||||  || ||||||||||||  |  ||||||||||||||||||
Sbjct: 473 ttccttctcagtaaggatcatttcgatgtggcatggggagctcatgtaggggttgatgcg 414

                             
Query: 279 tccatgagcacggtaggt 296
            |||||||||||||||||
Sbjct: 413 accatgagcacggtaggt 396



to top

>gb|AF401571.1| Ictalurus punctatus ribosomal protein L17 mRNA, complete cds
          Length = 600

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 67/78 (85%)
 Strand = Plus / Minus

                                                                       
Query: 219 ttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcg 278
           |||||||||||  | ||||| |||||||||||| |||  |  ||||||||||||||||||
Sbjct: 478 ttccttctcagtgaggatcatctcaatgtggcagggggagctcatgtaggggttgatgcg 419

                             
Query: 279 tccatgagcacggtaggt 296
           ||| || |||||||||||
Sbjct: 418 tccgtgggcacggtaggt 401



to top

>gb|BC053781.1| Xenopus laevis cDNA clone IMAGE:6876276, containing frame-shift
           errors
          Length = 651

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 244 atgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggt 296
           ||||||||||||  |  |||||||||||||||||| |||||||||||||||||
Sbjct: 467 atgtggcatggggagctcatgtaggggttgatgcgaccatgagcacggtaggt 415



to top

>gb|BC055097.1| Danio rerio zgc:65996, mRNA (cDNA clone MGC:65996 IMAGE:6792826),
           complete cds
          Length = 636

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 261 catgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctg 320
           ||||||||||||||||||||| ||||| |||||||| |  ||||||  |||  |||||| 
Sbjct: 428 catgtaggggttgatgcgtccgtgagcgcggtaggtacgtcgccgcatctttggggcctt 369

                           
Query: 321 gttcacttggatgtgc 336
           |||||| |||||||||
Sbjct: 368 gttcacctggatgtgc 353



to top

>ref|XM_653288.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN0776.2), mRNA
          Length = 555

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                       
Query: 225 ctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatg 284
           ||||| || ||| ||||| |||||||| ||||||| |||||| |||||||| || || ||
Sbjct: 456 ctcagtcaggatgagctcgatgtggcaggggttggtcatgtaagggttgatacgaccgtg 397

                       
Query: 285 agcacggtaggt 296
           ||||||||||||
Sbjct: 396 agcacggtaggt 385



to top

>ref|NM_212760.1| Danio rerio zgc:65996 (zgc:65996), mRNA
          Length = 636

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 261 catgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctg 320
           ||||||||||||||||||||| ||||| |||||||| |  ||||||  |||  |||||| 
Sbjct: 428 catgtaggggttgatgcgtccgtgagcgcggtaggtacgtcgccgcatctttggggcctt 369

                           
Query: 321 gttcacttggatgtgc 336
           |||||| |||||||||
Sbjct: 368 gttcacctggatgtgc 353



to top

>ref|XM_866977.1| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI),
           transcript variant 3 (LOC534195), mRNA
          Length = 643

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                       
Query: 234 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 293
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 482 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 423

                                                      
Query: 294 ggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
            ||||||||||||  |||  |||| | ||||||||||||||||
Sbjct: 422 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 380



to top

>ref|XM_613874.2| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI),
           transcript variant 1 (LOC534195), mRNA
          Length = 548

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                       
Query: 234 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 293
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 404 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 345

                                                      
Query: 294 ggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
            ||||||||||||  |||  |||| | ||||||||||||||||
Sbjct: 344 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 302



to top

>ref|XM_879331.1| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI),
           transcript variant 4 (LOC534195), mRNA
          Length = 515

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                       
Query: 234 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 293
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 371 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 312

                                                      
Query: 294 ggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
            ||||||||||||  |||  |||| | ||||||||||||||||
Sbjct: 311 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 269



to top

>gb|BC102600.1| Bos taurus similar to 60S ribosomal protein L17 (L23) (Amino acid
           starvation-induced protein) (ASI), mRNA (cDNA clone
           MGC:128012 IMAGE:30957113), complete cds
          Length = 642

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                       
Query: 234 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 293
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 488 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 429

                                                      
Query: 294 ggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
            ||||||||||||  |||  |||| | ||||||||||||||||
Sbjct: 428 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 386



to top

>dbj|AB099057.1| Bos taurus mRNA for similar to ribosomal protein L17, partial cds,
           clone: ORCS13090
          Length = 608

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                       
Query: 234 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 293
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 470 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 411

                                                      
Query: 294 ggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
            ||||||||||||  |||  |||| | ||||||||||||||||
Sbjct: 410 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 368



to top

>dbj|AB099047.1| Bos taurus mRNA for similar to ribosomal protein L17, partial cds,
           clone: ORCS12904
          Length = 615

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                       
Query: 234 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 293
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 469 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 410

                                                      
Query: 294 ggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
            ||||||||||||  |||  |||| | ||||||||||||||||
Sbjct: 409 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 367



to top

>dbj|AB099021.1| Bos taurus mRNA for similar to ribosomal protein L17, partial cds,
           clone: ORCS12459
          Length = 509

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                       
Query: 234 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 293
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 383 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 324

                                                      
Query: 294 ggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
            ||||||||||||  |||  |||| | ||||||||||||||||
Sbjct: 323 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 281



to top

>dbj|AB098996.1| Bos taurus mRNA for similar to ribosomal protein L17, partial cds,
           clone: ORCS11762
          Length = 586

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                       
Query: 234 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 293
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 474 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 415

                                                      
Query: 294 ggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
            ||||||||||||  |||  |||| | ||||||||||||||||
Sbjct: 414 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 372



to top

>dbj|AB098987.1| Bos taurus mRNA for similar to ribosomal protein L17, partial cds,
           clone: ORCS11689
          Length = 567

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                       
Query: 234 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 293
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 454 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 395

                                                      
Query: 294 ggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
            ||||||||||||  |||  |||| | ||||||||||||||||
Sbjct: 394 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 352



to top

>dbj|AB098888.1| Bos taurus mRNA for similar to ribosomal protein L17, partial cds,
           clone: ORCS10039
          Length = 589

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                       
Query: 234 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 293
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 466 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 407

                                                      
Query: 294 ggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
            ||||||||||||  |||  |||| | ||||||||||||||||
Sbjct: 406 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 364



to top

>ref|NM_001034459.1| Bos taurus similar to 60S ribosomal protein L17 (L23) (Amino acid
           starvation-induced protein) (ASI) (MGC128012), mRNA
          Length = 642

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                       
Query: 234 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 293
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 488 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 429

                                                      
Query: 294 ggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
            ||||||||||||  |||  |||| | ||||||||||||||||
Sbjct: 428 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 386



to top

>gb|AF443188.1| Paracoccidioides brasiliensis sorbitol dehydrogenase (SOR1) gene;
            hydroxyacid dehydrogenase protein Ynl274c (YNL274c) gene;
            and 60S ribosomal protein Rpl17A (RPL17A) gene, partial
            cds
          Length = 6361

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                  
Query: 238  agctcaatgtggcatgggttggacatgtaggggttgat 275
            ||||| |||||||||||| |||||||||||||||||||
Sbjct: 6360 agctcgatgtggcatgggctggacatgtaggggttgat 6323



to top

>emb|AL451014.1|NCB9B15 Neurospora crassa DNA linkage group V BAC clone B9B15
          Length = 81650

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                   
Query: 238   agctcaatgtggcatgggttggacatgtaggggttgat 275
             ||||| |||||||| |||||||||||||||||||||||
Sbjct: 76796 agctcgatgtggcaggggttggacatgtaggggttgat 76759



to top

>gb|DQ066273.1| Ixodes scapularis isolate is-all-clu554 ribosomal protein L17 mRNA,
           complete cds
          Length = 558

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 84/102 (82%)
 Strand = Plus / Minus

                                                                       
Query: 234 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 293
           ||||| |||||||||||| ||| ||  |||||| |||||||||||||| || || |||||
Sbjct: 447 gatcacctcaatgtggcacgggctgctcatgtacgggttgatgcgtccgtgggcgcggta 388

                                                     
Query: 294 ggtcctgcgccgctgcttctgggcctggttcacttggatgtg 335
           |||||| |  |||  |||  ||||| |||| |||||||||||
Sbjct: 387 ggtcctcctgcgcatcttgggggcccggttgacttggatgtg 346



to top

>gb|BC077192.1| Xenopus laevis MGC78885 protein, mRNA (cDNA clone MGC:78885
           IMAGE:4174034), complete cds
          Length = 678

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 261 catgtaggggttgatgcgtccatgagcacggtaggt 296
           |||||||||||||||||| |||||||| ||||||||
Sbjct: 443 catgtaggggttgatgcgaccatgagcgcggtaggt 408



to top

>gb|BC049299.1| Danio rerio cDNA clone IMAGE:5914772, **** WARNING: chimeric clone
            ****
          Length = 1854

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                
Query: 261  catgtaggggttgatgcgtccatgagcacggtaggt 296
            ||||||||||||||||||||| ||||| ||||||||
Sbjct: 1672 catgtaggggttgatgcgtccgtgagcgcggtaggt 1637



to top

>ref|XM_680042.1| PREDICTED: Danio rerio similar to Ribosomal protein L17
           (LOC572750), mRNA
          Length = 631

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 261 catgtaggggttgatgcgtccatgagcacggtaggt 296
           ||||||||||||||||||||| ||||| ||||||||
Sbjct: 462 catgtaggggttgatgcgtccgtgagcgcggtaggt 427



to top

>emb|BX000991.8| Zebrafish DNA sequence from clone CH211-203L7 in linkage group 6,
              complete sequence
          Length = 170966

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                  
Query: 261    catgtaggggttgatgcgtccatgagcacggtaggt 296
              ||||||||||||||||||||| ||||| ||||||||
Sbjct: 121973 catgtaggggttgatgcgtccgtgagcgcggtaggt 122008



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 372    ctcagcattgctctctgcgttctt 395
              |||||||||||| |||||||||||
Sbjct: 122232 ctcagcattgctttctgcgttctt 122255



to top

>emb|BX005111.4| Zebrafish DNA sequence from clone CH211-273E17 in linkage group 21,
            complete sequence
          Length = 169747

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                
Query: 261  catgtaggggttgatgcgtccatgagcacggtaggt 296
            ||||||||||||||||||||| ||||| ||||||||
Sbjct: 5500 catgtaggggttgatgcgtccgtgagcgcggtaggt 5535



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 372  ctcagcattgctctctgcgttctt 395
            |||||||||||| |||||||||||
Sbjct: 5759 ctcagcattgctttctgcgttctt 5782



to top

>gb|AY769286.1| Bombyx mori ribosomal protein L17 (RpL17) mRNA, complete cds
          Length = 620

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 259 gacatgtaggggttgatgcgtccatgagcacggta 293
           |||||||||||||||||||| || |||||||||||
Sbjct: 437 gacatgtaggggttgatgcgaccgtgagcacggta 403



to top

>ref|XM_599030.2| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23)
           (LOC520780), mRNA
          Length = 500

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 84/103 (81%)
 Strand = Plus / Minus

                                                                       
Query: 234 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 293
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 354 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 295

                                                      
Query: 294 ggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
            ||||||||||||  | |  |||| | ||||||||||||||||
Sbjct: 294 agtcctgcgccgcatcctgggggctttgttcacttggatgtgc 252



to top

>ref|XM_869475.1| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI)
           (LOC617250), mRNA
          Length = 483

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 84/103 (81%)
 Strand = Plus / Minus

                                                                       
Query: 234 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 293
           ||||| |||||||||||| |||  |  |||||||||| |||| || || ||||| | |||
Sbjct: 339 gatcatctcaatgtggcagggggagctcatgtaggggctgatccgaccgtgagctctgta 280

                                                      
Query: 294 ggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
            ||||||||||||  |||  |||| | ||||||||||||||||
Sbjct: 279 agtcctgcgccgcgtcttgggggctttgttcacttggatgtgc 237



to top

>gb|AY310814.1| Nicotiana benthamiana clone 12-173 unknown mRNA
          Length = 202

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 322 ttcacttggatgtgcgaaatgtagagagcatccacatcaagacctttcacctcagcattg 381
           |||||||||||||| || ||| | || | ||||||||| |  ||||| ||||||||||||
Sbjct: 154 ttcacttggatgtgagatatgaaaagtgaatccacatccaagcctttaacctcagcattg 95

                         
Query: 382 ctctctgcgttctt 395
           ||||| || |||||
Sbjct: 94  ctctcagcattctt 81



to top

>emb|BX649607.1| Aspergillus fumigatus BAC pilot project supercontig; segment 3/3
          Length = 227448

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                    
Query: 238    agctcaatgtggcatgggttggacatgtaggggttgat 275
              ||||| |||||||| ||||||| |||||||||||||||
Sbjct: 202049 agctcgatgtggcaggggttggtcatgtaggggttgat 202012



to top

>dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011
          Length = 2505489

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                    
Query: 238    agctcaatgtggcatgggttggacatgtaggggttgat 275
              ||||| |||||||| ||||||| |||||||||||||||
Sbjct: 944438 agctcgatgtggcaagggttggtcatgtaggggttgat 944475



to top

>emb|AL115613.1|CNS01CJP Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 231 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 290
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 474 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 415

                                                         
Query: 291 gtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 414 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 369



to top

>emb|AL114989.1|CNS01C2D Botrytis cinerea strain T4 cDNA library
          Length = 420

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 231 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 290
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 198 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 139

                                                         
Query: 291 gtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 138 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 93



to top

>emb|AL114758.1|CNS01BVY Botrytis cinerea strain T4 cDNA library
          Length = 840

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 231 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 290
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 460 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 401

                                                         
Query: 291 gtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 400 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 355



to top

>emb|AL114552.1|CNS01BQ8 Botrytis cinerea strain T4 cDNA library
          Length = 456

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 231 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 290
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 200 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 141

                                                         
Query: 291 gtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 140 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 95



to top

>emb|AL113871.1|CNS01B7B Botrytis cinerea strain T4 cDNA library
          Length = 600

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 231 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 290
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 371 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 312

                                                         
Query: 291 gtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 311 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 266



to top

>emb|AL113217.1|CNS01AP5 Botrytis cinerea strain T4 cDNA library
          Length = 516

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 231 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 290
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 286 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 227

                                                         
Query: 291 gtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 226 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 181



to top

>emb|AL113064.1|CNS01AKW Botrytis cinerea strain T4 cDNA library
          Length = 636

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 231 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 290
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 454 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 395

                                                         
Query: 291 gtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 394 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 349



to top

>emb|AL112375.1|CNS01A1R Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 231 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 290
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 480 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 421

                                                         
Query: 291 gtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 420 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 375



to top

>emb|AL112009.1|CNS019RL Botrytis cinerea strain T4 cDNA library
          Length = 636

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 231 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 290
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 501 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 442

                                                         
Query: 291 gtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 441 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 396



to top

>emb|AL111981.1|CNS019QT Botrytis cinerea strain T4 cDNA library
          Length = 636

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 231 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 290
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 372 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 313

                                                         
Query: 291 gtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 312 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 267



to top

>emb|AL111483.1|CNS019CZ Botrytis cinerea strain T4 cDNA library
          Length = 696

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 231 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 290
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 461 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 402

                                                         
Query: 291 gtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 401 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 356



to top

>emb|AL111750.1|CNS019KE Botrytis cinerea strain T4 cDNA library
          Length = 636

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 231 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 290
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 480 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 421

                                                         
Query: 291 gtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 420 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 375



to top

>emb|AL111381.1|CNS019A5 Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 231 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 290
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 466 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 407

                                                         
Query: 291 gtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 406 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 361



to top

>emb|AL110722.1|CNS018RV Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 231 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 290
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 469 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 410

                                                         
Query: 291 gtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 409 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 364



to top

>emb|AL110976.1|CNS018YX Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 231 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 290
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 463 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 404

                                                         
Query: 291 gtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 336
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 403 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 358



to top

>gb|AY130354.1| Branchiostoma lanceolatum ribosomal protein L17 mRNA, partial cds
          Length = 472

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 346 agagcatccacatcaagacctttcacctcagcattgctctctgcgttctt 395
           |||| ||||||||| ||||| || |  |||||||||||||||||||||||
Sbjct: 309 agagaatccacatccagacccttgaattcagcattgctctctgcgttctt 260



to top

>ref|XM_865349.1| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI)
           (LOC614032), mRNA
          Length = 442

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 61/73 (83%)
 Strand = Plus / Minus

                                                                       
Query: 264 gtaggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggtt 323
           |||||||||||| || || ||||| | ||| ||||||||||||  |||  |||| | |||
Sbjct: 267 gtaggggttgatccgaccgtgagctctgtaagtcctgcgccgcatcttgggggctttgtt 208

                        
Query: 324 cacttggatgtgc 336
           |||||||||||||
Sbjct: 207 cacttggatgtgc 195



to top

>gb|AY389929.1| Latimeria chalumnae ribosomal protein L17 mRNA, partial cds
          Length = 472

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                       
Query: 220 tccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgt 279
           ||||||||||  | |||||  ||||||||||| |||  |  |||||| ||||||||||| 
Sbjct: 435 tccttctcagttaggatcatttcaatgtggcaaggggagctcatgtaagggttgatgcgg 376

                            
Query: 280 ccatgagcacggtaggt 296
           || ||||||||||||||
Sbjct: 375 ccgtgagcacggtaggt 359



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 372 ctcagcattgctctctgcgttctt 395
           |||||||||||||||||| |||||
Sbjct: 283 ctcagcattgctctctgcattctt 260



to top

>ref|XM_871477.1| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI)
           (LOC619156), mRNA
          Length = 627

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 60/72 (83%)
 Strand = Plus / Minus

                                                                       
Query: 265 taggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttc 324
           ||||||||||| || |||||||| | ||| |||| |||||||  |||  |||| | ||||
Sbjct: 445 taggggttgatacgaccatgagctctgtaagtcccgcgccgcatcttgggggctttgttc 386

                       
Query: 325 acttggatgtgc 336
           ||||||||||||
Sbjct: 385 acttggatgtgc 374



to top

>ref|XM_868142.1| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI)
           (LOC616175), mRNA
          Length = 398

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                       
Query: 261 catgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctg 320
           ||||||||||||||| || |  ||||| | ||| ||||||||||||  |||  |||| | 
Sbjct: 219 catgtaggggttgatccgactgtgagctctgtaagtcctgcgccgcatcttgggggcttt 160

                           
Query: 321 gttcacttggatgtgc 336
           ||||||||||||||||
Sbjct: 159 gttcacttggatgtgc 144



to top

>ref|XM_424454.1| PREDICTED: Gallus gallus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI)
           (LOC426845), mRNA
          Length = 726

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 346 agagcatccacatcaagacctttcacctcagcattgctctctgc 389
           |||| ||||||||| ||||| || | ||||||||||||||||||
Sbjct: 456 agagaatccacatcgagacccttgagctcagcattgctctctgc 413



to top

>ref|XM_427732.1| PREDICTED: Gallus gallus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI)
           (LOC430175), partial mRNA
          Length = 530

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 346 agagcatccacatcaagacctttcacctcagcattgctctctgc 389
           |||| ||||||||| ||||| || | ||||||||||||||||||
Sbjct: 119 agagaatccacatcgagacccttaagctcagcattgctctctgc 76



to top

>ref|XM_869796.1| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI)
           (LOC617520), mRNA
          Length = 570

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                       
Query: 261 catgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctg 320
           ||||||||||||||| || || ||||| | ||| ||||||||||||  | |  |||| | 
Sbjct: 327 catgtaggggttgatccgaccgtgagctctgtaagtcctgcgccgcatcgtgggggcttt 268

                           
Query: 321 gttcacttggatgtgc 336
           ||||||||||||||||
Sbjct: 267 gttcacttggatgtgc 252



to top

>ref|XM_584664.2| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI)
           (LOC507961), mRNA
          Length = 590

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                       
Query: 261 catgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctg 320
           ||||||||||||||| || || ||||| | ||| ||||||||||||  |||  |||| | 
Sbjct: 436 catgtaggggttgatccgaccgtgagctctgtaagtcctgcgccgcatcttgggggcttt 377

                           
Query: 321 gttcacttggatgtgc 336
           |||||| |||||||||
Sbjct: 376 gttcacctggatgtgc 361



to top

>gb|AY389962.1| Gallus gallus ribosomal protein L17 mRNA, partial cds
          Length = 472

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 346 agagcatccacatcaagacctttcacctcagcattgctctctgc 389
           |||| ||||||||| ||||| || | ||||||||||||||||||
Sbjct: 309 agagaatccacatcgagacccttgagctcagcattgctctctgc 266



to top

>ref|NM_205014.1| Gallus gallus T-cell leukemia homeobox 3 (TLX3), mRNA
          Length = 1603

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 346  agagcatccacatcaagacctttcacctcagcattgctctctgc 389
            |||| ||||||||| ||||| || | ||||||||||||||||||
Sbjct: 1319 agagaatccacatcgagacccttgagctcagcattgctctctgc 1276



to top

>emb|CR352619.1| Gallus gallus finished cDNA, clone ChEST14e6
          Length = 715

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 346 agagcatccacatcaagacctttcacctcagcattgctctctgc 389
           |||| ||||||||| ||||| || | ||||||||||||||||||
Sbjct: 452 agagaatccacatcgagacccttaagctcagcattgctctctgc 409



to top

>gb|AY130351.1| Scyliorhinus canicula ribosomal protein L17 mRNA, partial cds
          Length = 472

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 351 atccacatcaagacctttcacctcagcattgctctctgcgttctttag 398
           ||||||||| ||||| || |  ||||||||||| ||||||||||||||
Sbjct: 304 atccacatccagacccttgagttcagcattgctttctgcgttctttag 257



to top

>gb|DQ223555.1| Ovis aries clone TO-DOWN-E18-5 ribosomal protein L17 mRNA, partial
           cds
          Length = 538

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                       
Query: 261 catgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctg 320
           ||||||||||||||| || || ||||| | ||| |||||||| |||  |||  |||| | 
Sbjct: 349 catgtaggggttgatccgaccgtgagctctgtaagtcctgcgtcgcatcttgggggcttt 290

                           
Query: 321 gttcacttggatgtgc 336
           ||||||||||||||||
Sbjct: 289 gttcacttggatgtgc 274



to top

>gb|AF071875.1|AF071875 Gallus gallus homeodomain protein (Tlx-3) mRNA, complete cds
          Length = 1603

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 346  agagcatccacatcaagacctttcacctcagcattgctctctgc 389
            |||| ||||||||| ||||| || | ||||||||||||||||||
Sbjct: 1319 agagaatccacatcgagacccttgagctcagcattgctctctgc 1276



to top

>emb|X71382.1|PCRPL17 P.carnea mRNA for 60S ribosomal protein L17
          Length = 577

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 244 atgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 290
           |||||||||||  | |||||||| || |||||||| |||||||||||
Sbjct: 447 atgtggcatggactcgacatgtatggattgatgcgaccatgagcacg 401



to top

>gb|AC023722.4| Drosophila melanogaster X BAC RP98-48O24 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 191590

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 259   gacatgtaggggttgatgcgtccatgagcacggta 293
             ||||||||||| |||||||| ||||| ||||||||
Sbjct: 56271 gacatgtagggattgatgcgaccatgggcacggta 56305



to top

>gb|AC023699.4| Drosophila melanogaster X BAC RP98-11K20 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 177941

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                 
Query: 259    gacatgtaggggttgatgcgtccatgagcacggta 293
              ||||||||||| |||||||| ||||| ||||||||
Sbjct: 160375 gacatgtagggattgatgcgaccatgggcacggta 160409



to top

>ref|NM_167089.1| Drosophila melanogaster Ribosomal protein L17 CG3203-RC, transcript
           variant C (RpL17), mRNA
          Length = 919

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 259 gacatgtaggggttgatgcgtccatgagcacggta 293
           ||||||||||| |||||||| ||||| ||||||||
Sbjct: 540 gacatgtagggattgatgcgaccatgggcacggta 506



to top

>ref|NM_167088.1| Drosophila melanogaster Ribosomal protein L17 CG3203-RB, transcript
           variant B (RpL17), mRNA
          Length = 873

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 259 gacatgtaggggttgatgcgtccatgagcacggta 293
           ||||||||||| |||||||| ||||| ||||||||
Sbjct: 494 gacatgtagggattgatgcgaccatgggcacggta 460



to top

>ref|NM_167087.1| Drosophila melanogaster Ribosomal protein L17 CG3203-RA, transcript
           variant A (RpL17), mRNA
          Length = 837

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 259 gacatgtaggggttgatgcgtccatgagcacggta 293
           ||||||||||| |||||||| ||||| ||||||||
Sbjct: 458 gacatgtagggattgatgcgaccatgggcacggta 424



to top

>ref|NM_132118.2| Drosophila melanogaster Ribosomal protein L17 CG3203-RD, transcript
           variant D (RpL17), mRNA
          Length = 1065

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 259 gacatgtaggggttgatgcgtccatgagcacggta 293
           ||||||||||| |||||||| ||||| ||||||||
Sbjct: 686 gacatgtagggattgatgcgaccatgggcacggta 652



to top

>gb|AY060845.1| Drosophila melanogaster GM02242 full length cDNA
          Length = 885

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 259 gacatgtaggggttgatgcgtccatgagcacggta 293
           ||||||||||| |||||||| ||||| ||||||||
Sbjct: 686 gacatgtagggattgatgcgaccatgggcacggta 652



to top

>emb|AL111872.1|CNS019NS Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 290
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 461 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 402

              
Query: 291 gta 293
           |||
Sbjct: 401 gta 399



to top

>gb|AE003438.3| Drosophila melanogaster chromosome X, section 22 of 74 of the complete
              sequence
          Length = 299943

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                 
Query: 259    gacatgtaggggttgatgcgtccatgagcacggta 293
              ||||||||||| |||||||| ||||| ||||||||
Sbjct: 202262 gacatgtagggattgatgcgaccatgggcacggta 202296



to top

>gb|BC077000.1| Xenopus tropicalis MGC89639 protein, mRNA (cDNA clone MGC:89639
           IMAGE:7025713), complete cds
          Length = 653

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 64/78 (82%)
 Strand = Plus / Minus

                                                                       
Query: 219 ttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcg 278
           |||||||||||  | |||||  || ||||||||||||  |  ||| ||||| ||||| ||
Sbjct: 499 ttccttctcagtaaggatcaattcgatgtggcatggggagctcatatagggattgatacg 440

                             
Query: 279 tccatgagcacggtaggt 296
            |||||||||||||||||
Sbjct: 439 accatgagcacggtaggt 422



to top

>emb|CT025372.2| Xenopus tropicalis finished cDNA, clone TNeu098j06
          Length = 658

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 64/78 (82%)
 Strand = Plus / Minus

                                                                       
Query: 219 ttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcg 278
           |||||||||||  | |||||  || ||||||||||||  |  ||| ||||| ||||| ||
Sbjct: 476 ttccttctcagtaaggatcaattcgatgtggcatggggagctcatatagggattgatacg 417

                             
Query: 279 tccatgagcacggtaggt 296
            |||||||||||||||||
Sbjct: 416 accatgagcacggtaggt 399



to top

>emb|Z83836.2|HS111J24 Human DNA sequence from clone RP1-111J24 on chromosome 22 Contains
             GSSs, complete sequence
          Length = 119008

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 302   gccgctgcttctgggcctggtt 323
             ||||||||||||||||||||||
Sbjct: 44838 gccgctgcttctgggcctggtt 44859



to top

>ref|NM_171832.2| Caenorhabditis elegans Ribosomal Protein, Large subunit family
           member (rpl-17) (rpl-17) mRNA, complete cds
          Length = 543

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                       
Query: 220 tccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgt 279
           |||||||| | |||||| | ||| ||||||||||||   |||||||| |||||||| | |
Sbjct: 403 tccttctcggccaagatgacctcgatgtggcatggggaagacatgtatgggttgattctt 344

                         
Query: 280 ccatgagcacggta 293
           || || ||||||||
Sbjct: 343 ccgtgggcacggta 330



to top

>ref|NM_170799.2| Caenorhabditis elegans Ribosomal Protein, Large subunit family
           member (rpl-17) (rpl-17) mRNA, complete cds
          Length = 621

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                       
Query: 220 tccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgt 279
           |||||||| | |||||| | ||| ||||||||||||   |||||||| |||||||| | |
Sbjct: 487 tccttctcggccaagatgacctcgatgtggcatggggaagacatgtatgggttgattctt 428

                         
Query: 280 ccatgagcacggta 293
           || || ||||||||
Sbjct: 427 ccgtgggcacggta 414



to top

>ref|NM_001005078.1| Xenopus tropicalis MGC89639 protein (MGC89639), mRNA
          Length = 653

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 64/78 (82%)
 Strand = Plus / Minus

                                                                       
Query: 219 ttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcg 278
           |||||||||||  | |||||  || ||||||||||||  |  ||| ||||| ||||| ||
Sbjct: 499 ttccttctcagtaaggatcaattcgatgtggcatggggagctcatatagggattgatacg 440

                             
Query: 279 tccatgagcacggtaggt 296
            |||||||||||||||||
Sbjct: 439 accatgagcacggtaggt 422



to top

>dbj|AK110522.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-167-H04, full
           insert sequence
          Length = 944

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 64/78 (82%)
 Strand = Plus / Minus

                                                                       
Query: 259 gacatgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcc 318
           ||||||||||||||||| || || || |||||||| ||||  |  ||||||||  | |||
Sbjct: 480 gacatgtaggggttgatacgaccgtgggcacggtacgtccgcctgcgctgcttgggagcc 421

                             
Query: 319 tggttcacttggatgtgc 336
           ||||| || |||||||||
Sbjct: 420 tggttgacctggatgtgc 403



to top

>gb|AY833083.1| Taeniopygia guttata ribosomal protein L17 mRNA, complete cds
          Length = 633

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 603 gtgttcttgaaatgaacacgcaggt 627
           |||||||||||||| ||||||||||
Sbjct: 103 gtgttcttgaaatgcacacgcaggt 79



to top

>gb|DQ214552.1| Taeniopygia guttata clone 0058P0043B12 ribosomal protein L17
           variant 2-like mRNA, complete sequence
          Length = 753

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 603 gtgttcttgaaatgaacacgcaggt 627
           |||||||||||||| ||||||||||
Sbjct: 225 gtgttcttgaaatgcacacgcaggt 201



to top

>gb|DQ214551.1| Taeniopygia guttata clone 0058P0013B11 ribosomal protein L17
           variant 1-like mRNA, complete sequence
          Length = 651

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 603 gtgttcttgaaatgaacacgcaggt 627
           |||||||||||||| ||||||||||
Sbjct: 124 gtgttcttgaaatgcacacgcaggt 100



to top

>emb|AL392172.9| Human DNA sequence from clone RP11-452F19 on chromosome 1 Contains the 5'
              end of the gene for a novel protein (FLJ12806), the gene
              for a novel protein (FLJ32421), two novel genes, the 5' end
              of two variants of the DISP1 gene for dispatched homolog 1
              (Drosophila) and a CpG island, complete sequence
          Length = 195849

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 353    ccacatcaagacctttcacct 373
              |||||||||||||||||||||
Sbjct: 167508 ccacatcaagacctttcacct 167528



to top

>ref|XM_786536.1| PREDICTED: Strongylocentrotus purpuratus similar to 60S ribosomal
           protein L17 (L23) (Amino acid starvation-induced
           protein) (ASI) (LOC586769), mRNA
          Length = 631

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 234 gatcagctcaatgtggcatgg 254
           |||||||||||||||||||||
Sbjct: 457 gatcagctcaatgtggcatgg 437



to top

>dbj|AK171782.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
            library, clone:F830010M10 product:unclassifiable, full
            insert sequence
          Length = 6121

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 390  gttctttagaagatccagaac 410
            |||||||||||||||||||||
Sbjct: 5302 gttctttagaagatccagaac 5282



to top

>gb|AC092155.3| Homo sapiens BAC clone RP11-312H10 from 2, complete sequence
          Length = 153304

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 600   ttagtgttcttgaaatgaaca 620
             |||||||||||||||||||||
Sbjct: 20751 ttagtgttcttgaaatgaaca 20731



to top

>gb|AY909403.1| Siniperca chuatsi clone C176 ribosomal protein L17 mRNA, partial
           cds
          Length = 441

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 63/77 (81%)
 Strand = Plus / Minus

                                                                       
Query: 220 tccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgt 279
           |||||||| | || ||||| ||| |||||||| |||  |  |||||||||||||||||| 
Sbjct: 322 tccttctcggtcaggatcatctcgatgtggcagggggagctcatgtaggggttgatgcgg 263

                            
Query: 280 ccatgagcacggtaggt 296
           || || || ||||||||
Sbjct: 262 ccgtgggcgcggtaggt 246



to top

>gb|AF220552.1|AF220552 Paralichthys olivaceus ribosomal protein L17 mRNA, complete cds
          Length = 601

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 352 tccacatcaagacctttcacctcagcattgctctctgcgtt 392
           |||||||| ||||| || | |||||| ||||||||||||||
Sbjct: 341 tccacatccagacccttgagctcagcgttgctctctgcgtt 301



to top

>emb|AL603829.5| Mouse DNA sequence from clone RP23-416G21 on chromosome 11, complete
             sequence
          Length = 226220

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 390   gttctttagaagatccagaac 410
             |||||||||||||||||||||
Sbjct: 23800 gttctttagaagatccagaac 23820



to top

>gb|CP000110.1| Synechococcus sp. CC9605, complete genome
          Length = 2510659

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 622     gcaggtcgcggcccatggcc 641
               ||||||||||||||||||||
Sbjct: 1926603 gcaggtcgcggcccatggcc 1926622



to top

>gb|AF064857.1| Homo sapiens BAC derived from chromosome 21q22.3, complete sequence,
             containing PEP19 (PCP4) gene
          Length = 199665

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 598   ccttagtgttcttgaaatga 617
             ||||||||||||||||||||
Sbjct: 98927 ccttagtgttcttgaaatga 98946



to top

>gb|AC103376.7| Mus musculus chromosome 8, clone RP24-226P5, complete sequence
          Length = 165714

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 224   tctcagacaagatcagctca 243
             ||||||||||||||||||||
Sbjct: 93352 tctcagacaagatcagctca 93333



to top

>gb|CP000082.1| Psychrobacter arcticus 273-4, complete genome
          Length = 2650701

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 614    atgaacacgcaggtcgcggc 633
              ||||||||||||||||||||
Sbjct: 540343 atgaacacgcaggtcgcggc 540362



to top

>gb|AC122528.3| Mus musculus BAC clone RP24-506F15 from chromosome 9, complete sequence
          Length = 142071

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 630   cggcccatggccttggcgga 649
             ||||||||||||||||||||
Sbjct: 42826 cggcccatggccttggcgga 42807



to top

>ref|NM_007783.2| Mus musculus c-src tyrosine kinase (Csk), mRNA
          Length = 2292

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 630  cggcccatggccttggcgga 649
            ||||||||||||||||||||
Sbjct: 1629 cggcccatggccttggcgga 1610



to top

>gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome
          Length = 5650368

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 203     ccttcttcaccggctcttcc 222
               ||||||||||||||||||||
Sbjct: 2470354 ccttcttcaccggctcttcc 2470335



to top

>gb|AC025794.9| Mus musculus chromosome 19, clone RP23-62O7, complete sequence
          Length = 242418

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 96     aattccactcagccaaacca 115
              ||||||||||||||||||||
Sbjct: 205775 aattccactcagccaaacca 205756



to top

>gb|AY382669.1| Cryptosporidium hominis isolate A13 60kDa glycoprotein (GP60) gene,
           GP60-Id allele, partial cds
          Length = 523

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 535 acatccttcaaggtacctcttagc 558
           |||||||||||||| |||||||||
Sbjct: 41  acatccttcaaggtgcctcttagc 18



to top

>gb|AC126244.3| Mus musculus BAC clone RP24-319A6 from chromosome 12, complete sequence
          Length = 175549

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 173   aggccttcctggcaatctgg 192
             ||||||||||||||||||||
Sbjct: 98933 aggccttcctggcaatctgg 98914



to top

>gb|AC123063.4| Mus musculus BAC clone RP23-219I20 from 5, complete sequence
          Length = 204795

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 189   ctgggactcagcctccttcttcac 212
             |||| |||||||||||||||||||
Sbjct: 51513 ctggcactcagcctccttcttcac 51490



to top

>gb|AY278946.1| Branchiostoma belcheri tsingtaunese ribosomal protein L17 mRNA,
           complete cds
          Length = 683

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 352 tccacatcaagacctttcacctcagcattgctctctgcgttctt 395
           |||||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 367 tccacatccagacccttgaattcagcattgctctctgcattctt 324



to top

>emb|CR391962.5| Zebrafish DNA sequence from clone CH211-215K15 in linkage group 16,
              complete sequence
          Length = 144859

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 3      aaatattccaaaacacaacc 22
              ||||||||||||||||||||
Sbjct: 123621 aaatattccaaaacacaacc 123640



to top

>emb|AL163281.2|HS21C081 Homo sapiens chromosome 21 segment HS21C081
          Length = 340000

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 598   ccttagtgttcttgaaatga 617
             ||||||||||||||||||||
Sbjct: 46628 ccttagtgttcttgaaatga 46647



to top

>gb|AE016795.2| Vibrio vulnificus CMCP6 chromosome I complete sequence
          Length = 3281944

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 97      attccactcagccaaaccagatgc 120
               ||||||||||||||||||| ||||
Sbjct: 1353301 attccactcagccaaaccatatgc 1353278



to top

>gb|AC129292.4| Mus musculus chromosome 5 clone RP24-507A8, complete sequence
          Length = 186200

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 189    ctgggactcagcctccttcttcac 212
              |||| |||||||||||||||||||
Sbjct: 126406 ctggcactcagcctccttcttcac 126383



to top

>emb|BX640439.1| Bordetella bronchiseptica strain RB50, complete genome; segment 3/16
          Length = 346362

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 623   caggtcgcggcccatggcct 642
             ||||||||||||||||||||
Sbjct: 92931 caggtcgcggcccatggcct 92950



to top

>emb|BX640420.1| Bordetella pertussis strain Tohama I, complete genome; segment 10/12
          Length = 348134

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 623    caggtcgcggcccatggcct 642
              ||||||||||||||||||||
Sbjct: 271189 caggtcgcggcccatggcct 271208



to top

>gb|AC067931.16| Homo sapiens chromosome 8, clone RP11-642A1, complete sequence
          Length = 206466

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 1      aaaaatattccaaaacacaa 20
              ||||||||||||||||||||
Sbjct: 165912 aaaaatattccaaaacacaa 165931



to top

>gb|AC108751.10| Homo sapiens 3 BAC RP11-278L15 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 131894

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 194   actcagcctccttcttcacc 213
             ||||||||||||||||||||
Sbjct: 88424 actcagcctccttcttcacc 88405



to top

>ref|NM_001003629.1| Danio rerio zgc:100933 (zgc:100933), mRNA
          Length = 1675

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 235  atcagctcaatgtggcatgg 254
            ||||||||||||||||||||
Sbjct: 1034 atcagctcaatgtggcatgg 1015



to top

>dbj|BA000037.2| Vibrio vulnificus YJ016 DNA, chromosome I, complete sequence
          Length = 3354505

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 97      attccactcagccaaaccagatgc 120
               ||||||||||||||||||| ||||
Sbjct: 3079457 attccactcagccaaaccatatgc 3079480



to top

>dbj|AK137297.1| Mus musculus adult male urinary bladder cDNA, RIKEN full-length
            enriched library, clone:9530099L19 product:c-src tyrosine
            kinase, full insert sequence
          Length = 2163

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 630  cggcccatggccttggcgga 649
            ||||||||||||||||||||
Sbjct: 1516 cggcccatggccttggcgga 1497



to top

>gb|AC098685.7| Mus musculus clone ct7-393l21, complete sequence
          Length = 73632

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 600   ttagtgttcttgaaatgaac 619
             ||||||||||||||||||||
Sbjct: 35517 ttagtgttcttgaaatgaac 35536



to top

>dbj|AK136876.1| Mus musculus adult male diencephalon cDNA, RIKEN full-length enriched
            library, clone:9330161F16 product:c-src tyrosine kinase,
            full insert sequence
          Length = 2752

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 630  cggcccatggccttggcgga 649
            ||||||||||||||||||||
Sbjct: 2103 cggcccatggccttggcgga 2084



to top

>dbj|AK135445.1| Mus musculus 12 days embryo female mullerian duct includes
            surrounding region cDNA, RIKEN full-length enriched
            library, clone:6820422B21 product:syntaxin 5A, full
            insert sequence
          Length = 2722

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 96   aattccactcagccaaacca 115
            ||||||||||||||||||||
Sbjct: 1200 aattccactcagccaaacca 1181



to top

>gb|AC108089.2| Homo sapiens chromosome 5 clone CTD-2313B8, complete sequence
          Length = 133225

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 112    accagatgctacaaagtgct 131
              ||||||||||||||||||||
Sbjct: 127666 accagatgctacaaagtgct 127685



to top

>dbj|AK156058.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
            library, clone:F830006C15 product:c-src tyrosine kinase,
            full insert sequence
          Length = 2027

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 630  cggcccatggccttggcgga 649
            ||||||||||||||||||||
Sbjct: 1654 cggcccatggccttggcgga 1635



to top

>gb|AC022139.5| Homo sapiens chromosome 5 clone CTD-2255L15, complete sequence
          Length = 112978

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 112   accagatgctacaaagtgct 131
             ||||||||||||||||||||
Sbjct: 26901 accagatgctacaaagtgct 26920



to top

>dbj|AK170893.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
            full-length enriched library, clone:F630208A14
            product:syntaxin 5A, full insert sequence
          Length = 3017

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 96   aattccactcagccaaacca 115
            ||||||||||||||||||||
Sbjct: 1495 aattccactcagccaaacca 1476



to top

>dbj|AK170815.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
            full-length enriched library, clone:F630201N11
            product:c-src tyrosine kinase, full insert sequence
          Length = 2316

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 630  cggcccatggccttggcgga 649
            ||||||||||||||||||||
Sbjct: 1670 cggcccatggccttggcgga 1651



to top

>gb|BC052006.1| Mus musculus c-src tyrosine kinase, mRNA (cDNA clone MGC:62329
            IMAGE:5685297), complete cds
          Length = 2363

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 630  cggcccatggccttggcgga 649
            ||||||||||||||||||||
Sbjct: 1687 cggcccatggccttggcgga 1668



to top

>gb|AC157822.2| Mus musculus BAC clone RP23-392J15 from chromosome 12, complete
             sequence
          Length = 185536

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 173   aggccttcctggcaatctgg 192
             ||||||||||||||||||||
Sbjct: 79561 aggccttcctggcaatctgg 79542



to top

>dbj|AK013057.1| Mus musculus 10, 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2810409K13 product:c-src
           tyrosine kinase, full insert sequence
          Length = 1323

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 630 cggcccatggccttggcgga 649
           ||||||||||||||||||||
Sbjct: 678 cggcccatggccttggcgga 659



to top

>gb|BC095962.1| Mus musculus c-src tyrosine kinase, mRNA (cDNA clone IMAGE:5400767),
            with apparent retained intron
          Length = 2489

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 630  cggcccatggccttggcgga 649
            ||||||||||||||||||||
Sbjct: 2010 cggcccatggccttggcgga 1991



to top

>dbj|BS000162.1| Pan troglodytes chromosome 22 clone:PTB-060F12, map 22, complete
              sequences
          Length = 156288

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 598    ccttagtgttcttgaaatga 617
              ||||||||||||||||||||
Sbjct: 111540 ccttagtgttcttgaaatga 111559



to top

>gb|BC078194.1| Danio rerio zgc:100933, mRNA (cDNA clone MGC:100933 IMAGE:7145844),
            complete cds
          Length = 1675

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 235  atcagctcaatgtggcatgg 254
            ||||||||||||||||||||
Sbjct: 1034 atcagctcaatgtggcatgg 1015



to top

>gb|BC018394.1| Mus musculus c-src tyrosine kinase, mRNA (cDNA clone MGC:25873
            IMAGE:4206879), complete cds
          Length = 2292

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 630  cggcccatggccttggcgga 649
            ||||||||||||||||||||
Sbjct: 1629 cggcccatggccttggcgga 1610



to top

>emb|AL954228.1|CH179K04 Pan troglodytes chromosome 22 BAC CH251-179K04, complete sequence
          Length = 182532

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 598    ccttagtgttcttgaaatga 617
              ||||||||||||||||||||
Sbjct: 129464 ccttagtgttcttgaaatga 129483



to top

>dbj|AP000852.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-851M3, complete
              sequence
          Length = 166277

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 225    ctcagacaagatcagctcaa 244
              ||||||||||||||||||||
Sbjct: 153596 ctcagacaagatcagctcaa 153615



to top

>emb|AL954380.9| Mouse DNA sequence from clone RP23-156O9 on chromosome 2, complete
             sequence
          Length = 105996

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 144   tggacagatgatgtagagct 163
             ||||||||||||||||||||
Sbjct: 43551 tggacagatgatgtagagct 43570



to top

>gb|AC122515.5| Mus musculus BAC clone RP24-455N18 from 9, complete sequence
          Length = 164271

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 630    cggcccatggccttggcgga 649
              ||||||||||||||||||||
Sbjct: 155426 cggcccatggccttggcgga 155407



to top

>emb|AL844180.6| Mouse DNA sequence from clone RP23-403A4 on chromosome 4, complete
              sequence
          Length = 213870

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 600    ttagtgttcttgaaatgaac 619
              ||||||||||||||||||||
Sbjct: 148376 ttagtgttcttgaaatgaac 148395


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,549,186
Number of Sequences: 3902068
Number of extensions: 5549186
Number of successful extensions: 95251
Number of sequences better than 10.0: 179
Number of HSP's better than 10.0 without gapping: 179
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 94709
Number of HSP's gapped (non-prelim): 479
length of query: 652
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 629
effective length of database: 17,143,297,704
effective search space: 10783134255816
effective search space used: 10783134255816
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top