ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags22l01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X62724.1|HVRNPL171 H.vulgare mRNA for ribosomal protein L17-1 1118 0.0
2gb|AF264022.1| Poa secunda ribosomal protein L17-1 mRNA, complet... 587 e-164
3gb|BT017485.1| Zea mays clone EL01N0412G01.c mRNA sequence 289 6e-75
4ref|XM_450351.1| Oryza sativa (japonica cultivar-group), mRNA 276 9e-71
5ref|XM_507427.1| PREDICTED Oryza sativa (japonica cultivar-group... 276 9e-71
6ref|XM_506642.2| PREDICTED Oryza sativa (japonica cultivar-group... 276 9e-71
7dbj|AK120273.1| Oryza sativa (japonica cultivar-group) cDNA clon... 276 9e-71
8dbj|AK105087.1| Oryza sativa (japonica cultivar-group) cDNA clon... 276 9e-71
9dbj|AK072488.1| Oryza sativa (japonica cultivar-group) cDNA clon... 276 9e-71
10gb|AY109488.1| Zea mays CL9529_1 mRNA sequence 276 9e-71
11gb|AY103585.1| Zea mays PCO123564 mRNA sequence 228 2e-56
12emb|X62725.1|HVRNPL172 H.vulgare mRNA for ribosomal protein L17-2 220 4e-54
13ref|NM_105410.2| Arabidopsis thaliana structural constituent of ... 186 6e-44
14gb|AY081524.1| Arabidopsis thaliana unknown protein mRNA, comple... 186 6e-44
15gb|AY042862.1| Arabidopsis thaliana ribosomal protein L17-like p... 186 6e-44
16emb|BX817777.1|CNS0AE81 Arabidopsis thaliana Full-length cDNA Co... 178 1e-41
17gb|AF034948.1|AF034948 Zea mays ribosomal protein L17 (rpl17) mR... 153 8e-34
18ref|NM_102503.2| Arabidopsis thaliana structural constituent of ... 147 5e-32
19gb|AY077651.1| Arabidopsis thaliana At1g27400/F17L21_20 mRNA, co... 147 5e-32
20gb|AF428449.1|AF428449 Arabidopsis thaliana At1g27400/F17L21_20 ... 147 5e-32
21gb|AF428271.1|AF428271 Arabidopsis thaliana At1g27400/F17L21_20 ... 147 5e-32
22gb|AY037249.1| Arabidopsis thaliana At1g27400/F17L21_20 mRNA, co... 147 5e-32
23gb|AY088522.1| Arabidopsis thaliana clone 749 mRNA, complete seq... 147 5e-32
24ref|XM_483472.1| Oryza sativa (japonica cultivar-group), mRNA 121 3e-24
25dbj|AK120448.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 3e-24
26dbj|AK062052.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 3e-24
27gb|AF307336.1|AF307336 Petunia x hybrida ribosomal protein (PETR... 105 2e-19
28dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 105 2e-19
29dbj|AP006441.3| Oryza sativa (japonica cultivar-group) genomic D... 105 2e-19
30dbj|AP005589.2| Oryza sativa (japonica cultivar-group) genomic D... 105 2e-19
31gb|AF076975.1|AF076975 Populus alba unknown mRNA, partial cds 105 2e-19
32ref|XM_323004.1| Neurospora crassa OR74A 60S RIBOSOMAL PROTEIN L... 94 7e-16
33ref|XM_956386.1| Neurospora crassa OR74A 60S RIBOSOMAL PROTEIN L... 94 7e-16
34ref|XM_382047.1| Gibberella zeae PH-1 chromosome 1 RL17_NEUCR 60... 94 7e-16
35emb|AJ876806.1| Acanthamoeba polyphaga mRNA for putative ribosom... 92 3e-15
36gb|DQ207869.1| Solanum tuberosum clone 086A10 ribosomal protein ... 84 7e-13
37gb|AY496096.1| Capsicum annuum ribosomal protein PETRP mRNA, com... 84 7e-13
38dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 84 7e-13
39dbj|AP003920.3| Oryza sativa (japonica cultivar-group) genomic D... 84 7e-13
40dbj|AP004015.3| Oryza sativa (japonica cultivar-group) genomic D... 84 7e-13
41gb|DQ252494.1| Solanum tuberosum clone 063E12 ribosomal protein ... 84 7e-13
42gb|AC004393.2|T1F15 Arabidopsis thaliana chromosome 1 BAC T1F15 ... 82 3e-12
43gb|DQ235197.1| Solanum tuberosum clone 168G07 ribosomal protein ... 80 1e-11
44gb|AY853172.1| Pectinaria gouldii ribosomal protein L17 mRNA, co... 78 4e-11
45gb|AC004557.2|AC004557 Genomic sequence for Arabidopsis thaliana... 78 4e-11
46ref|XM_747718.1| Aspergillus fumigatus Af293 60s ribosomal prote... 70 1e-08
47dbj|AB226154.1| Aspergillus oryzae cDNA, contig sequence: AoEST3012 70 1e-08
48gb|AY389972.1| Xenopus laevis ribosomal protein L17 mRNA, partia... 68 4e-08
49gb|BC043971.1| Xenopus laevis similar to ribosomal protein L17, ... 68 4e-08
50gb|AF401571.1| Ictalurus punctatus ribosomal protein L17 mRNA, c... 68 4e-08
51gb|BC053781.1| Xenopus laevis cDNA clone IMAGE:6876276, containi... 66 2e-07
52gb|BC055097.1| Danio rerio zgc:65996, mRNA (cDNA clone MGC:65996... 64 6e-07
53ref|XM_653288.1| Aspergillus nidulans FGSC A4 hypothetical prote... 64 6e-07
54ref|NM_212760.1| Danio rerio zgc:65996 (zgc:65996), mRNA 64 6e-07
55ref|XM_866977.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 62 2e-06
56ref|XM_613874.2| PREDICTED: Bos taurus similar to 60S ribosomal ... 62 2e-06
57ref|XM_879331.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 62 2e-06
58gb|BC102600.1| Bos taurus similar to 60S ribosomal protein L17 (... 62 2e-06
59dbj|AB099057.1| Bos taurus mRNA for similar to ribosomal protein... 62 2e-06
60dbj|AB099047.1| Bos taurus mRNA for similar to ribosomal protein... 62 2e-06
61dbj|AB099021.1| Bos taurus mRNA for similar to ribosomal protein... 62 2e-06
62dbj|AB098996.1| Bos taurus mRNA for similar to ribosomal protein... 62 2e-06
63dbj|AB098987.1| Bos taurus mRNA for similar to ribosomal protein... 62 2e-06
64dbj|AB098888.1| Bos taurus mRNA for similar to ribosomal protein... 62 2e-06
65ref|NM_001034459.1| Bos taurus similar to 60S ribosomal protein ... 62 2e-06
66gb|AF443188.1| Paracoccidioides brasiliensis sorbitol dehydrogen... 60 9e-06
67emb|AL451014.1|NCB9B15 Neurospora crassa DNA linkage group V BAC... 60 9e-06
68gb|DQ066273.1| Ixodes scapularis isolate is-all-clu554 ribosomal... 60 9e-06
69gb|BC077192.1| Xenopus laevis MGC78885 protein, mRNA (cDNA clone... 56 1e-04
70gb|BC049299.1| Danio rerio cDNA clone IMAGE:5914772, **** WARNIN... 56 1e-04
71ref|XM_680042.1| PREDICTED: Danio rerio similar to Ribosomal pro... 56 1e-04
72emb|BX000991.8| Zebrafish DNA sequence from clone CH211-203L7 in... 56 1e-04
73emb|BX005111.4| Zebrafish DNA sequence from clone CH211-273E17 i... 56 1e-04
74gb|AY769286.1| Bombyx mori ribosomal protein L17 (RpL17) mRNA, c... 54 6e-04
75ref|XM_599030.2| PREDICTED: Bos taurus similar to 60S ribosomal ... 54 6e-04
76ref|XM_869475.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 54 6e-04
77emb|BX649607.1| Aspergillus fumigatus BAC pilot project supercon... 52 0.002
78dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011 52 0.002
79emb|AL115613.1|CNS01CJP Botrytis cinerea strain T4 cDNA library 52 0.002
80emb|AL114989.1|CNS01C2D Botrytis cinerea strain T4 cDNA library 52 0.002
81emb|AL114758.1|CNS01BVY Botrytis cinerea strain T4 cDNA library 52 0.002
82emb|AL114552.1|CNS01BQ8 Botrytis cinerea strain T4 cDNA library 52 0.002
83emb|AL113871.1|CNS01B7B Botrytis cinerea strain T4 cDNA library 52 0.002
84emb|AL113217.1|CNS01AP5 Botrytis cinerea strain T4 cDNA library 52 0.002
85emb|AL113064.1|CNS01AKW Botrytis cinerea strain T4 cDNA library 52 0.002
86emb|AL112375.1|CNS01A1R Botrytis cinerea strain T4 cDNA library 52 0.002
87emb|AL112009.1|CNS019RL Botrytis cinerea strain T4 cDNA library 52 0.002
88emb|AL111981.1|CNS019QT Botrytis cinerea strain T4 cDNA library 52 0.002
89emb|AL111483.1|CNS019CZ Botrytis cinerea strain T4 cDNA library 52 0.002
90emb|AL111750.1|CNS019KE Botrytis cinerea strain T4 cDNA library 52 0.002
91emb|AL111381.1|CNS019A5 Botrytis cinerea strain T4 cDNA library 52 0.002
92emb|AL110722.1|CNS018RV Botrytis cinerea strain T4 cDNA library 52 0.002
93emb|AL110976.1|CNS018YX Botrytis cinerea strain T4 cDNA library 52 0.002
94ref|XM_865349.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 50 0.009
95gb|AY389929.1| Latimeria chalumnae ribosomal protein L17 mRNA, p... 50 0.009
96ref|XM_871477.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 48 0.036
97ref|XM_868142.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 48 0.036
98ref|XM_869796.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 48 0.036
99ref|XM_584664.2| PREDICTED: Bos taurus similar to 60S ribosomal ... 48 0.036
100gb|AY310814.1| Nicotiana benthamiana clone 12-173 unknown mRNA 48 0.036
101gb|DQ223555.1| Ovis aries clone TO-DOWN-E18-5 ribosomal protein ... 48 0.036
102emb|X71382.1|PCRPL17 P.carnea mRNA for 60S ribosomal protein L17 46 0.14
103gb|AC023722.4| Drosophila melanogaster X BAC RP98-48O24 (Roswell... 46 0.14
104gb|AC023699.4| Drosophila melanogaster X BAC RP98-11K20 (Roswell... 46 0.14
105ref|NM_167089.1| Drosophila melanogaster Ribosomal protein L17 C... 46 0.14
106ref|NM_167088.1| Drosophila melanogaster Ribosomal protein L17 C... 46 0.14
107ref|NM_167087.1| Drosophila melanogaster Ribosomal protein L17 C... 46 0.14
108ref|NM_132118.2| Drosophila melanogaster Ribosomal protein L17 C... 46 0.14
109gb|AY060845.1| Drosophila melanogaster GM02242 full length cDNA 46 0.14
110emb|AL111872.1|CNS019NS Botrytis cinerea strain T4 cDNA library 46 0.14
111gb|AE003438.3| Drosophila melanogaster chromosome X, section 22 ... 46 0.14
112gb|BC077000.1| Xenopus tropicalis MGC89639 protein, mRNA (cDNA c... 44 0.56
113emb|CT025372.2| Xenopus tropicalis finished cDNA, clone TNeu098j06 44 0.56
114emb|Z83836.2|HS111J24 Human DNA sequence from clone RP1-111J24 o... 44 0.56
115ref|NM_171832.2| Caenorhabditis elegans Ribosomal Protein, Large... 44 0.56
116ref|NM_170799.2| Caenorhabditis elegans Ribosomal Protein, Large... 44 0.56
117ref|NM_001005078.1| Xenopus tropicalis MGC89639 protein (MGC8963... 44 0.56
118dbj|AK110522.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.56
119ref|XM_758557.1| Theileria parva strain Muguga chromosome 4 hypo... 42 2.2
120emb|AL392172.9| Human DNA sequence from clone RP11-452F19 on chr... 42 2.2
121ref|XM_786536.1| PREDICTED: Strongylocentrotus purpuratus simila... 42 2.2
122dbj|AK171782.1| Mus musculus activated spleen cDNA, RIKEN full-l... 42 2.2
123gb|AC092155.3| Homo sapiens BAC clone RP11-312H10 from 2, comple... 42 2.2
124gb|AY130351.1| Scyliorhinus canicula ribosomal protein L17 mRNA,... 42 2.2
125gb|AY909403.1| Siniperca chuatsi clone C176 ribosomal protein L1... 42 2.2
126emb|AL603829.5| Mouse DNA sequence from clone RP23-416G21 on chr... 42 2.2
127gb|AC152753.1| Mus musculus chromosome 17 clone RP23-65L9, compl... 40 8.8
128gb|AF064857.1| Homo sapiens BAC derived from chromosome 21q22.3,... 40 8.8
129gb|AC103376.7| Mus musculus chromosome 8, clone RP24-226P5, comp... 40 8.8
130ref|XM_424454.1| PREDICTED: Gallus gallus similar to 60S ribosom... 40 8.8
131ref|XM_427732.1| PREDICTED: Gallus gallus similar to 60S ribosom... 40 8.8
132gb|AY389962.1| Gallus gallus ribosomal protein L17 mRNA, partial... 40 8.8
133ref|NM_205014.1| Gallus gallus T-cell leukemia homeobox 3 (TLX3)... 40 8.8
134gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome 40 8.8
135gb|AC025794.9| Mus musculus chromosome 19, clone RP23-62O7, comp... 40 8.8
136gb|AY382669.1| Cryptosporidium hominis isolate A13 60kDa glycopr... 40 8.8
137gb|AC126244.3| Mus musculus BAC clone RP24-319A6 from chromosome... 40 8.8
138gb|AC114824.5| Mus musculus BAC clone RP23-342J11 from chromosom... 40 8.8
139gb|AC123063.4| Mus musculus BAC clone RP23-219I20 from 5, comple... 40 8.8
140emb|AL163281.2|HS21C081 Homo sapiens chromosome 21 segment HS21C081 40 8.8
141gb|AE016795.2| Vibrio vulnificus CMCP6 chromosome I complete seq... 40 8.8
142gb|AC129292.4| Mus musculus chromosome 5 clone RP24-507A8, compl... 40 8.8
143gb|AC067931.16| Homo sapiens chromosome 8, clone RP11-642A1, com... 40 8.8
144gb|AC108751.10| Homo sapiens 3 BAC RP11-278L15 (Roswell Park Can... 40 8.8
145ref|NM_001003629.1| Danio rerio zgc:100933 (zgc:100933), mRNA 40 8.8
146dbj|BA000037.2| Vibrio vulnificus YJ016 DNA, chromosome I, compl... 40 8.8
147gb|AC098685.7| Mus musculus clone ct7-393l21, complete sequence 40 8.8
148dbj|AK135445.1| Mus musculus 12 days embryo female mullerian duc... 40 8.8
149gb|AC108089.2| Homo sapiens chromosome 5 clone CTD-2313B8, compl... 40 8.8
150gb|AC022139.5| Homo sapiens chromosome 5 clone CTD-2255L15, comp... 40 8.8
151dbj|AK170893.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 40 8.8
152gb|AC157822.2| Mus musculus BAC clone RP23-392J15 from chromosom... 40 8.8
153emb|CR352619.1| Gallus gallus finished cDNA, clone ChEST14e6 40 8.8
154dbj|BS000162.1| Pan troglodytes chromosome 22 clone:PTB-060F12, ... 40 8.8
155gb|BC078194.1| Danio rerio zgc:100933, mRNA (cDNA clone MGC:1009... 40 8.8
156emb|AL954228.1|CH179K04 Pan troglodytes chromosome 22 BAC CH251-... 40 8.8
157dbj|AP000852.4| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 8.8
158gb|AF071875.1|AF071875 Gallus gallus homeodomain protein (Tlx-3)... 40 8.8
159emb|AL954380.9| Mouse DNA sequence from clone RP23-156O9 on chro... 40 8.8
160emb|AL844180.6| Mouse DNA sequence from clone RP23-403A4 on chro... 40 8.8

>emb|X62724.1|HVRNPL171 H.vulgare mRNA for ribosomal protein L17-1
          Length = 785

 Score = 1118 bits (564), Expect = 0.0
 Identities = 632/643 (98%), Gaps = 10/643 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   ccataagatacgatgaaaaatattccaaaacacaactcagatcgaatccattagaagaga 60
           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 746 ccataagatacgatgaaaaatattccaaaacacaac-cagatcgaatccattagaagaga 688

                                                                       
Query: 61  ctttcacaaagtatgagctagcagtatttagacgacagataacagggcaaaaattccact 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 687 ctttcacaaagtatgagctagcagtatttagacgacagataacagggcaaaaattccact 628

                                                                       
Query: 121 cagccaaaccagatgctacaaagtgctctaacgaataggtggacagatgatgtagagctt 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 627 cagccaaaccagatgctacaaagtgctctaacgaataggtggacagatgatgtagagctt 568

                                                                       
Query: 181 ccttctctaggccttcctggcaatctgggactcagcctccttcttcaccggctcttcctt 240
           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 567 ccttctctaggccttcctggcaatatgggactcagcctccttcttcaccggctcttcctt 508

                                                                       
Query: 241 ctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatg 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 507 ctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatg 448

                                                                       
Query: 301 agcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgcgaaatgta 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 447 agcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgcgaaatgta 388

                                                                       
Query: 361 gagagcatccacatcaagacctttcacctcagcattgctcttctgcgttctttagaagat 420
           |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 387 gagagcatccacatcaagacctttcacctcagcattgctc-tctgcgttctttagaagat 329

                                                                       
Query: 421 ccagaacgaacttagcagacttggcaggcccagcgtccctgaccatttggctgacggttc 480
           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 328 ccagaacgaacttagcagacttggcagg-ccagcgtccctgaccatttggctgacggttc 270

                                                                       
Query: 481 ttaacctggggcccgtgcgtccaacaccacggcagtacctccggaaggggatggcttgct 540
           ||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 269 ttaacctggg--ccgtgcgtccaacaccacggcagtacctccggaaggggatggcttgc- 213

                                                                       
Query: 541 ttgtgtgccaacacatccttcaaggtacctcttagcccttgttcagcggcatcttcctca 600
           |||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||
Sbjct: 212 ttgtgtgccaacacatcc-tcaaggtacctcttag-ccttgttcagcggcatcttcctca 155

                                                      
Query: 601 gggcaaaacgctgtttcccttagtgttcttgaaatgaacacgc 643
           |||| |||||||||||||| |||||||||||||||||||||||
Sbjct: 154 gggc-aaacgctgtttccc-tagtgttcttgaaatgaacacgc 114



to top

>gb|AF264022.1| Poa secunda ribosomal protein L17-1 mRNA, complete cds
          Length = 808

 Score =  587 bits (296), Expect = e-164
 Identities = 528/589 (89%), Gaps = 21/589 (3%)
 Strand = Plus / Minus

                                                                       
Query: 66  acaaagtatgagctagcagtatttagacga---cagat---aacagggcaaaaattccac 119
           ||||||||||||||||||||||||||| ||   |||||   |||||| |||||||||| |
Sbjct: 666 acaaagtatgagctagcagtatttagaagatgacagatgataacaggccaaaaattcccc 607

                                                                       
Query: 120 tcagccaaa-ccagatgctacaaagtgctctaacgaataggtggacagatgatgtagagc 178
           ||||||||| |||||||||||||| |||||||||||||||||||||| |  |||  ||||
Sbjct: 606 tcagccaaagccagatgctacaaactgctctaacgaataggtggaca-agtatgccgagc 548

                                                                       
Query: 179 ttcctt-ctctaggccttcctg---gcaatctgggactcagcctccttcttcaccggctc 234
           || ||| |||||||||||||||   |||||||||||||||||||| |||||||| |||||
Sbjct: 547 tttcttcctctaggccttcctgggcgcaatctgggactcagcctctttcttcactggctc 488

                                                                       
Query: 235 ttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcg 294
            |||||||| |||||||| |||||||||||||| ||||| |||||||||||||| |||||
Sbjct: 487 ctccttctcggacaagatgagctcaatgtggcacgggttagacatgtaggggttaatgcg 428

                                                                       
Query: 295 tccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgcga 354
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 427 tccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgtga 368

                                                                       
Query: 355 aatgtagagagcatccacatcaagacctttcacctcagcattgctcttctgcgttcttta 414
            |||||||||||||| ||||| |||||||||||||||||||||||| ||||||||||| |
Sbjct: 367 gatgtagagagcatcaacatccagacctttcacctcagcattgctc-tctgcgttcttga 309

                                                                       
Query: 415 gaagatccagaacgaacttagcagacttggcaggcccagcgtccctgaccatttggctga 474
           ||||||||||||| |||| ||||||||||||||| |||||| ||||||||||||||||| 
Sbjct: 308 gaagatccagaacaaactgagcagacttggcagg-ccagcgaccctgaccatttggctgg 250

                                                                       
Query: 475 cggttcttaacctggggcccgtgcgtccaacaccacggcagtacctccggaaggggatgg 534
           ||||||||| | || |  | || ||||||||||||||||||||||| |||||||||||||
Sbjct: 249 cggttcttagcttgag--cggtacgtccaacaccacggcagtacctgcggaaggggatgg 192

                                                                       
Query: 535 cttgctttgtgtgccaacacatccttcaaggtacctcttagcccttgttcagcggcatct 594
           | ||| |||||||| | ||||||| || ||||||||||||| |||||||||| |||||||
Sbjct: 191 cctgc-ttgtgtgcaagcacatcc-tccaggtacctcttag-ccttgttcagtggcatct 135

                                                            
Query: 595 tcctcagggcaaaacgctgtttcccttagtgttcttgaaatgaacacgc 643
           |||| |||||  ||||||||||||| |||| ||||||||||||||||||
Sbjct: 134 tcctgagggc-gaacgctgtttccc-tagtattcttgaaatgaacacgc 88



 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 13  atgaaaaatattccaaaacacaac 36
           ||||||||||| ||||||||||||
Sbjct: 729 atgaaaaatatcccaaaacacaac 706



to top

>gb|BT017485.1| Zea mays clone EL01N0412G01.c mRNA sequence
          Length = 640

 Score =  289 bits (146), Expect = 6e-75
 Identities = 258/292 (88%), Gaps = 5/292 (1%)
 Strand = Plus / Minus

                                                                       
Query: 181 ccttctctaggccttcctgg---caatctgggactcagcctccttcttcaccggctcttc 237
           ||||||||| ||||||||||   | ||||| ||||||||||| |||||||| ||||||||
Sbjct: 527 ccttctctaagccttcctggttgcgatctgagactcagcctctttcttcactggctcttc 468

                                                                       
Query: 238 cttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtcc 297
           |||||| |||||||| ||||| ||||||||||||  ||||||||| ||||||||||||||
Sbjct: 467 cttctccgacaagatgagctctatgtggcatggggaggacatgtaagggttgatgcgtcc 408

                                                                       
Query: 298 atgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgcgaaat 357
           |||||||||||| |||||||| ||||||||||| ||||| || ||||| |||||||| | 
Sbjct: 407 atgagcacggtatgtcctgcgtcgctgcttctgagcctgattaacttgaatgtgcgacac 348

                                                                       
Query: 358 gtagagagcatccacatcaagacctttcacctcagcattgctcttctgcgttctttagaa 417
            ||||| | |||||||||||| ||||||||||||||||||||| ||||| ||||| ||||
Sbjct: 347 atagagggtatccacatcaagtcctttcacctcagcattgctc-tctgcattcttgagaa 289

                                                               
Query: 418 gatccagaacgaacttagcagacttggcaggcccagcgtccctgaccatttg 469
           | || |||| ||| ||||||||||||||||| ||||||||||||||||||||
Sbjct: 288 ggtctagaatgaatttagcagacttggcagg-ccagcgtccctgaccatttg 238



to top

>ref|XM_450351.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 813

 Score =  276 bits (139), Expect = 9e-71
 Identities = 260/297 (87%), Gaps = 5/297 (1%)
 Strand = Plus / Minus

                                                                       
Query: 176 agcttccttctctaggccttcctggca---atctgggactcagcctccttcttcaccggc 232
           ||||||||||||||||||||||||||    ||||| ||||||| ||| |||||||| || 
Sbjct: 605 agcttccttctctaggccttcctggctgcgatctgagactcaggctctttcttcactggt 546

                                                                       
Query: 233 tcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatg 292
           ||||||||||| |||| ||| |||||||||||||| |||  ||||||||| |||||||||
Sbjct: 545 tcttccttctctgacaggataagctcaatgtggcacggggaggacatgtaagggttgatg 486

                                                                       
Query: 293 cgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
           |||||||||||||||||||| | ||||| |||||||||||||||||| ||||| ||||| 
Sbjct: 485 cgtccatgagcacggtaggtacggcgcctctgcttctgggcctggttaacttgaatgtgg 426

                                                                       
Query: 353 gaaatgtagagagcatccacatcaagacctttcacctcagcattgctcttctgcgttctt 412
           || |  || |||| ||| ||||| |||||||||||||||||||||||| ||||| |||||
Sbjct: 425 gacacataaagagtatcaacatccagacctttcacctcagcattgctc-tctgcattctt 367

                                                                    
Query: 413 tagaagatccagaacgaacttagcagacttggcaggcccagcgtccctgaccatttg 469
            ||||||||||||| |||  |||||||||||||||| ||||||||||||||| ||||
Sbjct: 366 aagaagatccagaatgaatctagcagacttggcagg-ccagcgtccctgaccgtttg 311



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 70/79 (88%), Gaps = 2/79 (2%)
 Strand = Plus / Minus

                                                                       
Query: 495 gtgcgtccaacaccacggcagtacctccggaaggggatggcttgctttgtgtgccaacac 554
           ||||| |||||||||| ||||||||| ||||||||||| |||||| ||||| || | |||
Sbjct: 287 gtgcggccaacaccaccgcagtacctacggaaggggatagcttgc-ttgtgggcaatcac 229

                              
Query: 555 atccttcaaggtacctctt 573
           |||| ||||||||||||||
Sbjct: 228 atcc-tcaaggtacctctt 211



to top

>ref|XM_507427.1| PREDICTED Oryza sativa (japonica cultivar-group), P0523B07.46 mRNA
          Length = 914

 Score =  276 bits (139), Expect = 9e-71
 Identities = 260/297 (87%), Gaps = 5/297 (1%)
 Strand = Plus / Minus

                                                                       
Query: 176 agcttccttctctaggccttcctggca---atctgggactcagcctccttcttcaccggc 232
           ||||||||||||||||||||||||||    ||||| ||||||| ||| |||||||| || 
Sbjct: 606 agcttccttctctaggccttcctggctgcgatctgagactcaggctctttcttcactggt 547

                                                                       
Query: 233 tcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatg 292
           ||||||||||| |||| ||| |||||||||||||| |||  ||||||||| |||||||||
Sbjct: 546 tcttccttctctgacaggataagctcaatgtggcacggggaggacatgtaagggttgatg 487

                                                                       
Query: 293 cgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
           |||||||||||||||||||| | ||||| |||||||||||||||||| ||||| ||||| 
Sbjct: 486 cgtccatgagcacggtaggtacggcgcctctgcttctgggcctggttaacttgaatgtgg 427

                                                                       
Query: 353 gaaatgtagagagcatccacatcaagacctttcacctcagcattgctcttctgcgttctt 412
           || |  || |||| ||| ||||| |||||||||||||||||||||||| ||||| |||||
Sbjct: 426 gacacataaagagtatcaacatccagacctttcacctcagcattgctc-tctgcattctt 368

                                                                    
Query: 413 tagaagatccagaacgaacttagcagacttggcaggcccagcgtccctgaccatttg 469
            ||||||||||||| |||  |||||||||||||||| ||||||||||||||| ||||
Sbjct: 367 aagaagatccagaatgaatctagcagacttggcagg-ccagcgtccctgaccgtttg 312



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 70/79 (88%), Gaps = 2/79 (2%)
 Strand = Plus / Minus

                                                                       
Query: 495 gtgcgtccaacaccacggcagtacctccggaaggggatggcttgctttgtgtgccaacac 554
           ||||| |||||||||| ||||||||| ||||||||||| |||||| ||||| || | |||
Sbjct: 288 gtgcggccaacaccaccgcagtacctacggaaggggatagcttgc-ttgtgggcaatcac 230

                              
Query: 555 atccttcaaggtacctctt 573
           |||| ||||||||||||||
Sbjct: 229 atcc-tcaaggtacctctt 212



to top

>ref|XM_506642.2| PREDICTED Oryza sativa (japonica cultivar-group), P0523B07.46 mRNA
          Length = 936

 Score =  276 bits (139), Expect = 9e-71
 Identities = 260/297 (87%), Gaps = 5/297 (1%)
 Strand = Plus / Minus

                                                                       
Query: 176 agcttccttctctaggccttcctggca---atctgggactcagcctccttcttcaccggc 232
           ||||||||||||||||||||||||||    ||||| ||||||| ||| |||||||| || 
Sbjct: 592 agcttccttctctaggccttcctggctgcgatctgagactcaggctctttcttcactggt 533

                                                                       
Query: 233 tcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatg 292
           ||||||||||| |||| ||| |||||||||||||| |||  ||||||||| |||||||||
Sbjct: 532 tcttccttctctgacaggataagctcaatgtggcacggggaggacatgtaagggttgatg 473

                                                                       
Query: 293 cgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
           |||||||||||||||||||| | ||||| |||||||||||||||||| ||||| ||||| 
Sbjct: 472 cgtccatgagcacggtaggtacggcgcctctgcttctgggcctggttaacttgaatgtgg 413

                                                                       
Query: 353 gaaatgtagagagcatccacatcaagacctttcacctcagcattgctcttctgcgttctt 412
           || |  || |||| ||| ||||| |||||||||||||||||||||||| ||||| |||||
Sbjct: 412 gacacataaagagtatcaacatccagacctttcacctcagcattgctc-tctgcattctt 354

                                                                    
Query: 413 tagaagatccagaacgaacttagcagacttggcaggcccagcgtccctgaccatttg 469
            ||||||||||||| |||  |||||||||||||||| ||||||||||||||| ||||
Sbjct: 353 aagaagatccagaatgaatctagcagacttggcagg-ccagcgtccctgaccgtttg 298



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 70/79 (88%), Gaps = 2/79 (2%)
 Strand = Plus / Minus

                                                                       
Query: 495 gtgcgtccaacaccacggcagtacctccggaaggggatggcttgctttgtgtgccaacac 554
           ||||| |||||||||| ||||||||| ||||||||||| |||||| ||||| || | |||
Sbjct: 274 gtgcggccaacaccaccgcagtacctacggaaggggatagcttgc-ttgtgggcaatcac 216

                              
Query: 555 atccttcaaggtacctctt 573
           |||| ||||||||||||||
Sbjct: 215 atcc-tcaaggtacctctt 198



to top

>dbj|AK120273.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013048E22, full
           insert sequence
          Length = 915

 Score =  276 bits (139), Expect = 9e-71
 Identities = 260/297 (87%), Gaps = 5/297 (1%)
 Strand = Plus / Minus

                                                                       
Query: 176 agcttccttctctaggccttcctggca---atctgggactcagcctccttcttcaccggc 232
           ||||||||||||||||||||||||||    ||||| ||||||| ||| |||||||| || 
Sbjct: 606 agcttccttctctaggccttcctggctgcgatctgagactcaggctctttcttcactggt 547

                                                                       
Query: 233 tcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatg 292
           ||||||||||| |||| ||| |||||||||||||| |||  ||||||||| |||||||||
Sbjct: 546 tcttccttctctgacaggataagctcaatgtggcacggggaggacatgtaagggttgatg 487

                                                                       
Query: 293 cgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
           |||||||||||||||||||| | ||||| |||||||||||||||||| ||||| ||||| 
Sbjct: 486 cgtccatgagcacggtaggtacggcgcctctgcttctgggcctggttaacttgaatgtgg 427

                                                                       
Query: 353 gaaatgtagagagcatccacatcaagacctttcacctcagcattgctcttctgcgttctt 412
           || |  || |||| ||| ||||| |||||||||||||||||||||||| ||||| |||||
Sbjct: 426 gacacataaagagtatcaacatccagacctttcacctcagcattgctc-tctgcattctt 368

                                                                    
Query: 413 tagaagatccagaacgaacttagcagacttggcaggcccagcgtccctgaccatttg 469
            ||||||||||||| |||  |||||||||||||||| ||||||||||||||| ||||
Sbjct: 367 aagaagatccagaatgaatctagcagacttggcagg-ccagcgtccctgaccgtttg 312



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 70/79 (88%), Gaps = 2/79 (2%)
 Strand = Plus / Minus

                                                                       
Query: 495 gtgcgtccaacaccacggcagtacctccggaaggggatggcttgctttgtgtgccaacac 554
           ||||| |||||||||| ||||||||| ||||||||||| |||||| ||||| || | |||
Sbjct: 288 gtgcggccaacaccaccgcagtacctacggaaggggatagcttgc-ttgtgggcaatcac 230

                              
Query: 555 atccttcaaggtacctctt 573
           |||| ||||||||||||||
Sbjct: 229 atcc-tcaaggtacctctt 212



to top

>dbj|AK105087.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-047-A12, full
           insert sequence
          Length = 834

 Score =  276 bits (139), Expect = 9e-71
 Identities = 260/297 (87%), Gaps = 5/297 (1%)
 Strand = Plus / Minus

                                                                       
Query: 176 agcttccttctctaggccttcctggca---atctgggactcagcctccttcttcaccggc 232
           ||||||||||||||||||||||||||    ||||| ||||||| ||| |||||||| || 
Sbjct: 626 agcttccttctctaggccttcctggctgcgatctgagactcaggctctttcttcactggt 567

                                                                       
Query: 233 tcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatg 292
           ||||||||||| |||| ||| |||||||||||||| |||  ||||||||| |||||||||
Sbjct: 566 tcttccttctctgacaggataagctcaatgtggcacggggaggacatgtaagggttgatg 507

                                                                       
Query: 293 cgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
           |||||||||||||||||||| | ||||| |||||||||||||||||| ||||| ||||| 
Sbjct: 506 cgtccatgagcacggtaggtacggcgcctctgcttctgggcctggttaacttgaatgtgg 447

                                                                       
Query: 353 gaaatgtagagagcatccacatcaagacctttcacctcagcattgctcttctgcgttctt 412
           || |  || |||| ||| ||||| |||||||||||||||||||||||| ||||| |||||
Sbjct: 446 gacacataaagagtatcaacatccagacctttcacctcagcattgctc-tctgcattctt 388

                                                                    
Query: 413 tagaagatccagaacgaacttagcagacttggcaggcccagcgtccctgaccatttg 469
            ||||||||||||| |||  |||||||||||||||| ||||||||||||||| ||||
Sbjct: 387 aagaagatccagaatgaatctagcagacttggcagg-ccagcgtccctgaccgtttg 332



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 70/79 (88%), Gaps = 2/79 (2%)
 Strand = Plus / Minus

                                                                       
Query: 495 gtgcgtccaacaccacggcagtacctccggaaggggatggcttgctttgtgtgccaacac 554
           ||||| |||||||||| ||||||||| ||||||||||| |||||| ||||| || | |||
Sbjct: 308 gtgcggccaacaccaccgcagtacctacggaaggggatagcttgc-ttgtgggcaatcac 250

                              
Query: 555 atccttcaaggtacctctt 573
           |||| ||||||||||||||
Sbjct: 249 atcc-tcaaggtacctctt 232



to top

>dbj|AK072488.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023134I03, full
           insert sequence
          Length = 936

 Score =  276 bits (139), Expect = 9e-71
 Identities = 260/297 (87%), Gaps = 5/297 (1%)
 Strand = Plus / Minus

                                                                       
Query: 176 agcttccttctctaggccttcctggca---atctgggactcagcctccttcttcaccggc 232
           ||||||||||||||||||||||||||    ||||| ||||||| ||| |||||||| || 
Sbjct: 592 agcttccttctctaggccttcctggctgcgatctgagactcaggctctttcttcactggt 533

                                                                       
Query: 233 tcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatg 292
           ||||||||||| |||| ||| |||||||||||||| |||  ||||||||| |||||||||
Sbjct: 532 tcttccttctctgacaggataagctcaatgtggcacggggaggacatgtaagggttgatg 473

                                                                       
Query: 293 cgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
           |||||||||||||||||||| | ||||| |||||||||||||||||| ||||| ||||| 
Sbjct: 472 cgtccatgagcacggtaggtacggcgcctctgcttctgggcctggttaacttgaatgtgg 413

                                                                       
Query: 353 gaaatgtagagagcatccacatcaagacctttcacctcagcattgctcttctgcgttctt 412
           || |  || |||| ||| ||||| |||||||||||||||||||||||| ||||| |||||
Sbjct: 412 gacacataaagagtatcaacatccagacctttcacctcagcattgctc-tctgcattctt 354

                                                                    
Query: 413 tagaagatccagaacgaacttagcagacttggcaggcccagcgtccctgaccatttg 469
            ||||||||||||| |||  |||||||||||||||| ||||||||||||||| ||||
Sbjct: 353 aagaagatccagaatgaatctagcagacttggcagg-ccagcgtccctgaccgtttg 298



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 70/79 (88%), Gaps = 2/79 (2%)
 Strand = Plus / Minus

                                                                       
Query: 495 gtgcgtccaacaccacggcagtacctccggaaggggatggcttgctttgtgtgccaacac 554
           ||||| |||||||||| ||||||||| ||||||||||| |||||| ||||| || | |||
Sbjct: 274 gtgcggccaacaccaccgcagtacctacggaaggggatagcttgc-ttgtgggcaatcac 216

                              
Query: 555 atccttcaaggtacctctt 573
           |||| ||||||||||||||
Sbjct: 215 atcc-tcaaggtacctctt 198



to top

>gb|AY109488.1| Zea mays CL9529_1 mRNA sequence
          Length = 1024

 Score =  276 bits (139), Expect = 9e-71
 Identities = 237/267 (88%), Gaps = 2/267 (0%)
 Strand = Plus / Plus

                                                                       
Query: 203 atctgggactcagcctccttcttcaccggctcttccttctcagacaagatcagctcaatg 262
           ||||| ||||||||||| |||||||| |||||||||||||| |||||||| ||||| |||
Sbjct: 421 atctgagactcagcctctttcttcactggctcttccttctccgacaagatgagctcgatg 480

                                                                       
Query: 263 tggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgc 322
           |||||||||  ||||||||| |||||||||||||||||||||||||| |||||||| |||
Sbjct: 481 tggcatggggaggacatgtaagggttgatgcgtccatgagcacggtatgtcctgcgtcgc 540

                                                                       
Query: 323 tgcttctgggcctggttcacttggatgtgcgaaatgtagagagcatccacatcaagacct 382
           |||||||| ||||| || ||||| |||||||| |  ||||| | |||||||||||| |||
Sbjct: 541 tgcttctgagcctgattaacttgaatgtgcgacacatagagggtatccacatcaagtcct 600

                                                                       
Query: 383 ttcacctcagcattgctcttctgcgttctttagaagatccagaacgaacttagcagactt 442
           |||||||||||||||||| ||||| ||||| ||||| || |||| ||| |||||||||||
Sbjct: 601 ttcacctcagcattgctc-tctgcattcttgagaaggtctagaatgaatttagcagactt 659

                                      
Query: 443 ggcaggcccagcgtccctgaccatttg 469
           | |||| ||||||||||||||||||||
Sbjct: 660 gacagg-ccagcgtccctgaccatttg 685



to top

>gb|AY103585.1| Zea mays PCO123564 mRNA sequence
          Length = 1953

 Score =  228 bits (115), Expect = 2e-56
 Identities = 231/267 (86%), Gaps = 2/267 (0%)
 Strand = Plus / Plus

                                                                        
Query: 203  atctgggactcagcctccttcttcaccggctcttccttctcagacaagatcagctcaatg 262
            ||||| ||||||||||| |||||||| |||||||||||||| |||||||| || || |||
Sbjct: 1233 atctgagactcagcctctttcttcacgggctcttccttctctgacaagatgagttcgatg 1292

                                                                        
Query: 263  tggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgc 322
            ||||| |||  ||||||||| ||||||||||| |||||||| ||||||||||||||||||
Sbjct: 1293 tggcacggggaggacatgtaagggttgatgcgcccatgagcgcggtaggtcctgcgccgc 1352

                                                                        
Query: 323  tgcttctgggcctggttcacttggatgtgcgaaatgtagagagcatccacatcaagacct 382
            |||||||| |||||||||||||| ||||| || |  ||||| | ||| ||||||||||||
Sbjct: 1353 tgcttctgagcctggttcacttgaatgtgtgacacatagagggtatcgacatcaagacct 1412

                                                                        
Query: 383  ttcacctcagcattgctcttctgcgttctttagaagatccagaacgaacttagcagactt 442
            || ||||||||||||||| || || ||||| ||||| || |||| |||  ||||||| ||
Sbjct: 1413 tttacctcagcattgctc-tcagcattcttgagaaggtctagaatgaatctagcagattt 1471

                                       
Query: 443  ggcaggcccagcgtccctgaccatttg 469
            | |||| |||||||||||| |||||||
Sbjct: 1472 gacagg-ccagcgtccctgcccatttg 1497



to top

>emb|X62725.1|HVRNPL172 H.vulgare mRNA for ribosomal protein L17-2
          Length = 854

 Score =  220 bits (111), Expect = 4e-54
 Identities = 233/271 (85%), Gaps = 2/271 (0%)
 Strand = Plus / Minus

                                                                       
Query: 212 tcagcctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatggg 271
           ||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |||
Sbjct: 530 tcagcctccttcttcacaggctcttccttctctgacaagatcagctcaatgtggcagggg 471

                                                                       
Query: 272 ttggacatgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgg 331
           ||||||||||| |||||||||||||||||||||||||| |||| ||||| |||||| |||
Sbjct: 470 ttggacatgtaagggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgg 411

                                                                       
Query: 332 gcctggttcacttggatgtgcgaaatgtagagagcatccacatcaagacctttcacctca 391
           || |||||||| |||||||| |||||||||||    || ||||| |  ||||| || |||
Sbjct: 410 gcttggttcacctggatgtgtgaaatgtagaggttgtcgacatccaagcctttaacttca 351

                                                                       
Query: 392 gcattgctcttctgcgttctttagaagatccagaacgaacttagcagacttggcaggccc 451
           || || ||| || || ||||| || | |||||| |||||||  || ||||| ||||| ||
Sbjct: 350 gcgttactc-tcagcattcttcagcaaatccagcacgaactgggccgactttgcagg-cc 293

                                          
Query: 452 agcgtccctgaccatttggctgacggttctt 482
           |||| ||||| ||||||||||| ||||||||
Sbjct: 292 agcgaccctgcccatttggctggcggttctt 262



to top

>ref|NM_105410.2| Arabidopsis thaliana structural constituent of ribosome AT1G67430
           mRNA, complete cds
          Length = 713

 Score =  186 bits (94), Expect = 6e-44
 Identities = 204/238 (85%), Gaps = 2/238 (0%)
 Strand = Plus / Minus

                                                                       
Query: 230 ggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttg 289
           |||||||||||||| ||||| |||| ||||||||||||||||||||||||||| ||||||
Sbjct: 502 ggctcttccttctctgacaaaatcaactcaatgtggcatgggttggacatgtaagggttg 443

                                                                       
Query: 290 atgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatg 349
           || | ||| ||||||||||| ||||| | ||  |||||   |||||||||||||||||||
Sbjct: 442 attcttccgtgagcacggtaagtccttctcctttgctttgcggcctggttcacttggatg 383

                                                                       
Query: 350 tgcgaaatgtagagagcatccacatcaagacctttcacctcagcattgctcttctgcgtt 409
           || || ||| |||| ||||| ||||| | |||||||||||||||||||||| || |||||
Sbjct: 382 tgtgatatgaagagggcatcaacatccaaacctttcacctcagcattgctc-tcagcgtt 324

                                                                     
Query: 410 ctttagaagatccagaacgaacttagcagacttggcaggcccagcgtccctgaccatt 467
           ||| || | ||| ||||| |||| |||||||||||| || ||| ||||| ||||||||
Sbjct: 323 cttgagcaaatcaagaacaaactgagcagacttggctgg-ccaacgtccttgaccatt 267



to top

>gb|AY081524.1| Arabidopsis thaliana unknown protein mRNA, complete cds
          Length = 564

 Score =  186 bits (94), Expect = 6e-44
 Identities = 204/238 (85%), Gaps = 2/238 (0%)
 Strand = Plus / Minus

                                                                       
Query: 230 ggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttg 289
           |||||||||||||| ||||| |||| ||||||||||||||||||||||||||| ||||||
Sbjct: 470 ggctcttccttctctgacaaaatcaactcaatgtggcatgggttggacatgtaagggttg 411

                                                                       
Query: 290 atgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatg 349
           || | ||| ||||||||||| ||||| | ||  |||||   |||||||||||||||||||
Sbjct: 410 attcttccgtgagcacggtaagtccttctcctttgctttgcggcctggttcacttggatg 351

                                                                       
Query: 350 tgcgaaatgtagagagcatccacatcaagacctttcacctcagcattgctcttctgcgtt 409
           || || ||| |||| ||||| ||||| | |||||||||||||||||||||| || |||||
Sbjct: 350 tgtgatatgaagagggcatcaacatccaaacctttcacctcagcattgctc-tcagcgtt 292

                                                                     
Query: 410 ctttagaagatccagaacgaacttagcagacttggcaggcccagcgtccctgaccatt 467
           ||| || | ||| ||||| |||| |||||||||||| || ||| ||||| ||||||||
Sbjct: 291 cttgagcaaatcaagaacaaactgagcagacttggctgg-ccaacgtccttgaccatt 235



to top

>gb|AY042862.1| Arabidopsis thaliana ribosomal protein L17-like protein (T1F15.11)
           mRNA, complete cds
          Length = 711

 Score =  186 bits (94), Expect = 6e-44
 Identities = 204/238 (85%), Gaps = 2/238 (0%)
 Strand = Plus / Minus

                                                                       
Query: 230 ggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttg 289
           |||||||||||||| ||||| |||| ||||||||||||||||||||||||||| ||||||
Sbjct: 502 ggctcttccttctctgacaaaatcaactcaatgtggcatgggttggacatgtaagggttg 443

                                                                       
Query: 290 atgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatg 349
           || | ||| ||||||||||| ||||| | ||  |||||   |||||||||||||||||||
Sbjct: 442 attcttccgtgagcacggtaagtccttctcctttgctttgcggcctggttcacttggatg 383

                                                                       
Query: 350 tgcgaaatgtagagagcatccacatcaagacctttcacctcagcattgctcttctgcgtt 409
           || || ||| |||| ||||| ||||| | |||||||||||||||||||||| || |||||
Sbjct: 382 tgtgatatgaagagggcatcaacatccaaacctttcacctcagcattgctc-tcagcgtt 324

                                                                     
Query: 410 ctttagaagatccagaacgaacttagcagacttggcaggcccagcgtccctgaccatt 467
           ||| || | ||| ||||| |||| |||||||||||| || ||| ||||| ||||||||
Sbjct: 323 cttgagcaaatcaagaacaaactgagcagacttggctgg-ccaacgtccttgaccatt 267



to top

>emb|BX817777.1|CNS0AE81 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL40ZG06 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 680

 Score =  178 bits (90), Expect = 1e-41
 Identities = 203/238 (85%), Gaps = 2/238 (0%)
 Strand = Plus / Minus

                                                                       
Query: 230 ggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttg 289
           |||||||||||||| ||||| |||| ||||||||||||||||||||||||||| ||||||
Sbjct: 490 ggctcttccttctctgacaaaatcaactcaatgtggcatgggttggacatgtaagggttg 431

                                                                       
Query: 290 atgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatg 349
           || | ||| ||||||||||| ||||| | ||  |||||   ||||||||| |||||||||
Sbjct: 430 attcttccgtgagcacggtaagtccttctcctttgctttgcggcctggttaacttggatg 371

                                                                       
Query: 350 tgcgaaatgtagagagcatccacatcaagacctttcacctcagcattgctcttctgcgtt 409
           || || ||| |||| ||||| ||||| | |||||||||||||||||||||| || |||||
Sbjct: 370 tgtgatatgaagagggcatcaacatccaaacctttcacctcagcattgctc-tcagcgtt 312

                                                                     
Query: 410 ctttagaagatccagaacgaacttagcagacttggcaggcccagcgtccctgaccatt 467
           ||| || | ||| ||||| |||| |||||||||||| || ||| ||||| ||||||||
Sbjct: 311 cttgagcaaatcaagaacaaactgagcagacttggctgg-ccaacgtccttgaccatt 255



to top

>gb|AF034948.1|AF034948 Zea mays ribosomal protein L17 (rpl17) mRNA, complete cds
          Length = 746

 Score =  153 bits (77), Expect = 8e-34
 Identities = 128/145 (88%)
 Strand = Plus / Minus

                                                                       
Query: 212 tcagcctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatggg 271
           |||||||| |||||||| |||||||||||||| ||||  ||||||||||||||||| |||
Sbjct: 528 tcagcctctttcttcacaggctcttccttctctgacagaatcagctcaatgtggcaaggg 469

                                                                       
Query: 272 ttggacatgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgg 331
             ||||||||| ||||| |||||||| |||||||||||||| | ||||| ||||||||||
Sbjct: 468 gaggacatgtaagggttaatgcgtccgtgagcacggtaggtgcggcgcctctgcttctgg 409

                                    
Query: 332 gcctggttcacttggatgtgcgaaa 356
           || |||||||| |||||||| ||||
Sbjct: 408 gcttggttcacctggatgtgtgaaa 384



to top

>ref|NM_102503.2| Arabidopsis thaliana structural constituent of ribosome AT1G27400
           mRNA, complete cds
          Length = 826

 Score =  147 bits (74), Expect = 5e-32
 Identities = 192/230 (83%), Gaps = 1/230 (0%)
 Strand = Plus / Minus

                                                                       
Query: 221 ttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatg 280
           |||||||| |||||||| ||||| ||||| |||| |||||||||||||||||| ||||||
Sbjct: 574 ttcttcacaggctcttctttctctgacaaaatcaactcaatgtggcatgggtttgacatg 515

                                                                       
Query: 281 taggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttc 340
           || || ||||| | |||||||||||| || ||||| | || ||| ||    || ||||||
Sbjct: 514 taaggattgattcttccatgagcacgatatgtccttctcctctgttttgctgcttggttc 455

                                                                       
Query: 341 acttggatgtgcgaaatgtagagagcatccacatcaagacctttcacctcagcattgctc 400
           ||||||||||| |||||| | || ||||| ||||| | |||||| |||||||||||||||
Sbjct: 454 acttggatgtgagaaatgaaaagggcatcgacatccaaacctttgacctcagcattgctc 395

                                                             
Query: 401 ttctgcgttctttagaagatccagaacgaacttagcagacttggcaggcc 450
            || || ||||| |||||||| |||||||| | |||||| || |||||||
Sbjct: 394 -tcagcattcttgagaagatcaagaacgaattgagcagatttagcaggcc 346



to top

>gb|AY077651.1| Arabidopsis thaliana At1g27400/F17L21_20 mRNA, complete cds
          Length = 531

 Score =  147 bits (74), Expect = 5e-32
 Identities = 192/230 (83%), Gaps = 1/230 (0%)
 Strand = Plus / Minus

                                                                       
Query: 221 ttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatg 280
           |||||||| |||||||| ||||| ||||| |||| |||||||||||||||||| ||||||
Sbjct: 479 ttcttcacaggctcttctttctctgacaaaatcaactcaatgtggcatgggtttgacatg 420

                                                                       
Query: 281 taggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttc 340
           || || ||||| | |||||||||||| || ||||| | || ||| ||    || ||||||
Sbjct: 419 taaggattgattcttccatgagcacgatatgtccttctcctctgttttgctgcttggttc 360

                                                                       
Query: 341 acttggatgtgcgaaatgtagagagcatccacatcaagacctttcacctcagcattgctc 400
           ||||||||||| |||||| | || ||||| ||||| | |||||| |||||||||||||||
Sbjct: 359 acttggatgtgagaaatgaaaagggcatcgacatccaaacctttgacctcagcattgctc 300

                                                             
Query: 401 ttctgcgttctttagaagatccagaacgaacttagcagacttggcaggcc 450
            || || ||||| |||||||| |||||||| | |||||| || |||||||
Sbjct: 299 -tcagcattcttgagaagatcaagaacgaattgagcagatttagcaggcc 251



to top

>gb|AF428449.1|AF428449 Arabidopsis thaliana At1g27400/F17L21_20 mRNA, complete cds
          Length = 712

 Score =  147 bits (74), Expect = 5e-32
 Identities = 192/230 (83%), Gaps = 1/230 (0%)
 Strand = Plus / Minus

                                                                       
Query: 221 ttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatg 280
           |||||||| |||||||| ||||| ||||| |||| |||||||||||||||||| ||||||
Sbjct: 514 ttcttcacaggctcttctttctctgacaaaatcaactcaatgtggcatgggtttgacatg 455

                                                                       
Query: 281 taggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttc 340
           || || ||||| | |||||||||||| || ||||| | || ||| ||    || ||||||
Sbjct: 454 taaggattgattcttccatgagcacgatatgtccttctcctctgttttgctgcttggttc 395

                                                                       
Query: 341 acttggatgtgcgaaatgtagagagcatccacatcaagacctttcacctcagcattgctc 400
           ||||||||||| |||||| | || ||||| ||||| | |||||| |||||||||||||||
Sbjct: 394 acttggatgtgagaaatgaaaagggcatcgacatccaaacctttgacctcagcattgctc 335

                                                             
Query: 401 ttctgcgttctttagaagatccagaacgaacttagcagacttggcaggcc 450
            || || ||||| |||||||| |||||||| | |||||| || |||||||
Sbjct: 334 -tcagcattcttgagaagatcaagaacgaattgagcagatttagcaggcc 286



to top

>gb|AF428271.1|AF428271 Arabidopsis thaliana At1g27400/F17L21_20 mRNA, complete cds
          Length = 762

 Score =  147 bits (74), Expect = 5e-32
 Identities = 192/230 (83%), Gaps = 1/230 (0%)
 Strand = Plus / Minus

                                                                       
Query: 221 ttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatg 280
           |||||||| |||||||| ||||| ||||| |||| |||||||||||||||||| ||||||
Sbjct: 514 ttcttcacaggctcttctttctctgacaaaatcaactcaatgtggcatgggtttgacatg 455

                                                                       
Query: 281 taggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttc 340
           || || ||||| | |||||||||||| || ||||| | || ||| ||    || ||||||
Sbjct: 454 taaggattgattcttccatgagcacgatatgtccttctcctctgttttgctgcttggttc 395

                                                                       
Query: 341 acttggatgtgcgaaatgtagagagcatccacatcaagacctttcacctcagcattgctc 400
           ||||||||||| |||||| | || ||||| ||||| | |||||| |||||||||||||||
Sbjct: 394 acttggatgtgagaaatgaaaagggcatcgacatccaaacctttgacctcagcattgctc 335

                                                             
Query: 401 ttctgcgttctttagaagatccagaacgaacttagcagacttggcaggcc 450
            || || ||||| |||||||| |||||||| | |||||| || |||||||
Sbjct: 334 -tcagcattcttgagaagatcaagaacgaattgagcagatttagcaggcc 286



to top

>gb|AY037249.1| Arabidopsis thaliana At1g27400/F17L21_20 mRNA, complete cds
          Length = 767

 Score =  147 bits (74), Expect = 5e-32
 Identities = 192/230 (83%), Gaps = 1/230 (0%)
 Strand = Plus / Minus

                                                                       
Query: 221 ttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatg 280
           |||||||| |||||||| ||||| ||||| |||| |||||||||||||||||| ||||||
Sbjct: 514 ttcttcacaggctcttctttctctgacaaaatcaactcaatgtggcatgggtttgacatg 455

                                                                       
Query: 281 taggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttc 340
           || || ||||| | |||||||||||| || ||||| | || ||| ||    || ||||||
Sbjct: 454 taaggattgattcttccatgagcacgatatgtccttctcctctgttttgctgcttggttc 395

                                                                       
Query: 341 acttggatgtgcgaaatgtagagagcatccacatcaagacctttcacctcagcattgctc 400
           ||||||||||| |||||| | || ||||| ||||| | |||||| |||||||||||||||
Sbjct: 394 acttggatgtgagaaatgaaaagggcatcgacatccaaacctttgacctcagcattgctc 335

                                                             
Query: 401 ttctgcgttctttagaagatccagaacgaacttagcagacttggcaggcc 450
            || || ||||| |||||||| |||||||| | |||||| || |||||||
Sbjct: 334 -tcagcattcttgagaagatcaagaacgaattgagcagatttagcaggcc 286



to top

>gb|AY088522.1| Arabidopsis thaliana clone 749 mRNA, complete sequence
          Length = 747

 Score =  147 bits (74), Expect = 5e-32
 Identities = 192/230 (83%), Gaps = 1/230 (0%)
 Strand = Plus / Minus

                                                                       
Query: 221 ttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatg 280
           |||||||| |||||||| ||||| ||||| |||| |||||||||||||||||| ||||||
Sbjct: 574 ttcttcacaggctcttctttctctgacaaaatcaactcaatgtggcatgggtttgacatg 515

                                                                       
Query: 281 taggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttc 340
           || || ||||| | |||||||||||| || ||||| | || ||| ||    || ||||||
Sbjct: 514 taaggattgattcttccatgagcacgatatgtccttctcctctgttttgctgcttggttc 455

                                                                       
Query: 341 acttggatgtgcgaaatgtagagagcatccacatcaagacctttcacctcagcattgctc 400
           ||||||||||| |||||| | || ||||| ||||| | |||||| |||||||||||||||
Sbjct: 454 acttggatgtgagaaatgaaaagggcatcgacatccaaacctttgacctcagcattgctc 395

                                                             
Query: 401 ttctgcgttctttagaagatccagaacgaacttagcagacttggcaggcc 450
            || || ||||| |||||||| |||||||| | |||||| || |||||||
Sbjct: 394 -tcagcattcttgagaagatcaagaacgaattgagcagatttagcaggcc 346



to top

>ref|XM_483472.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 755

 Score =  121 bits (61), Expect = 3e-24
 Identities = 124/145 (85%)
 Strand = Plus / Minus

                                                                       
Query: 212 tcagcctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatggg 271
           |||| ||| |||||||| | |||||||||||| |||||||| ||||| | |||||| || 
Sbjct: 557 tcaggctctttcttcacggcctcttccttctctgacaagataagctcgacgtggcagggt 498

                                                                       
Query: 272 ttggacatgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgg 331
             ||||||||| || ||||||||||||||||||||||| |||| ||| | ||||||||||
Sbjct: 497 gaggacatgtaaggattgatgcgtccatgagcacggtatgtccggcgtctctgcttctgg 438

                                    
Query: 332 gcctggttcacttggatgtgcgaaa 356
           || |||||||| |||||||| ||||
Sbjct: 437 gcttggttcacctggatgtgtgaaa 413



to top

>dbj|AK120448.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013100M19, full
           insert sequence
          Length = 839

 Score =  121 bits (61), Expect = 3e-24
 Identities = 124/145 (85%)
 Strand = Plus / Minus

                                                                       
Query: 212 tcagcctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatggg 271
           |||| ||| |||||||| | |||||||||||| |||||||| ||||| | |||||| || 
Sbjct: 614 tcaggctctttcttcacggcctcttccttctctgacaagataagctcgacgtggcagggt 555

                                                                       
Query: 272 ttggacatgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgg 331
             ||||||||| || ||||||||||||||||||||||| |||| ||| | ||||||||||
Sbjct: 554 gaggacatgtaaggattgatgcgtccatgagcacggtatgtccggcgtctctgcttctgg 495

                                    
Query: 332 gcctggttcacttggatgtgcgaaa 356
           || |||||||| |||||||| ||||
Sbjct: 494 gcttggttcacctggatgtgtgaaa 470



to top

>dbj|AK062052.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-044-B07, full
           insert sequence
          Length = 755

 Score =  121 bits (61), Expect = 3e-24
 Identities = 124/145 (85%)
 Strand = Plus / Minus

                                                                       
Query: 212 tcagcctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatggg 271
           |||| ||| |||||||| | |||||||||||| |||||||| ||||| | |||||| || 
Sbjct: 557 tcaggctctttcttcacggcctcttccttctctgacaagataagctcgacgtggcagggt 498

                                                                       
Query: 272 ttggacatgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgg 331
             ||||||||| || ||||||||||||||||||||||| |||| ||| | ||||||||||
Sbjct: 497 gaggacatgtaaggattgatgcgtccatgagcacggtatgtccggcgtctctgcttctgg 438

                                    
Query: 332 gcctggttcacttggatgtgcgaaa 356
           || |||||||| |||||||| ||||
Sbjct: 437 gcttggttcacctggatgtgtgaaa 413



to top

>gb|AF307336.1|AF307336 Petunia x hybrida ribosomal protein (PETRP) mRNA, complete cds
          Length = 819

 Score =  105 bits (53), Expect = 2e-19
 Identities = 140/169 (82%)
 Strand = Plus / Minus

                                                                       
Query: 233 tcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatg 292
           |||||||| |||||||| |||| |||||| ||||| || || ||||||||||| ||||| 
Sbjct: 498 tcttccttttcagacaatatcaactcaatatggcagggattagacatgtagggattgatt 439

                                                                       
Query: 293 cgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
           | ||||||||||||||| |||| ||||| ||| ||||| || ||||| ||||||||||| 
Sbjct: 438 cttccatgagcacggtatgtccggcgcctctgtttctgtgcttggtttacttggatgtga 379

                                                            
Query: 353 gaaatgtagagagcatccacatcaagacctttcacctcagcattgctct 401
              || || || | ||||||||| | |||||| || |||||||||||||
Sbjct: 378 cttatataaagtgaatccacatccaaacctttaacttcagcattgctct 330



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
               sequence
          Length = 22696651

 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                           
Query: 285     ggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcactt 344
               |||||||||||||||||||||||||||| | ||||| |||||||||||||||||| ||||
Sbjct: 4337323 ggttgatgcgtccatgagcacggtaggtacggcgcctctgcttctgggcctggttaactt 4337382

                                                            
Query: 345     ggatgtgcgaaatgtagagagcatccacatcaagacctttcacct 389
               | ||||| || |  || |||| ||| ||||| |||||||||||||
Sbjct: 4337383 gaatgtgggacacataaagagtatcaacatccagacctttcacct 4337427



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 76/84 (90%), Gaps = 2/84 (2%)
 Strand = Plus / Plus

                                                                           
Query: 386     acctcagcattgctcttctgcgttctttagaagatccagaacgaacttagcagacttggc 445
               |||||||||||||||| |||| ||||| ||||||||||||| |||  |||||||||||||
Sbjct: 4337505 acctcagcattgctct-ctgcattcttaagaagatccagaatgaatctagcagacttggc 4337563

                                       
Query: 446     aggcccagcgtccctgaccatttg 469
               ||| ||||||||||||||| ||||
Sbjct: 4337564 agg-ccagcgtccctgaccgtttg 4337586



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 70/79 (88%), Gaps = 2/79 (2%)
 Strand = Plus / Plus

                                                                           
Query: 495     gtgcgtccaacaccacggcagtacctccggaaggggatggcttgctttgtgtgccaacac 554
               ||||| |||||||||| ||||||||| ||||||||||| |||||| ||||| || | |||
Sbjct: 4337610 gtgcggccaacaccaccgcagtacctacggaaggggatagcttgc-ttgtgggcaatcac 4337668

                                  
Query: 555     atccttcaaggtacctctt 573
               |||| ||||||||||||||
Sbjct: 4337669 atcc-tcaaggtacctctt 4337686



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                           
Query: 216     cctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatgggttgg 275
               |||| |||||||| || ||||||||||| |||| ||| |||||||||||||| |||  ||
Sbjct: 4337174 cctctttcttcactggttcttccttctctgacaggataagctcaatgtggcacggggagg 4337233

                      
Query: 276     acatgta 282
               |||||||
Sbjct: 4337234 acatgta 4337240



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                         
Query: 176     agcttccttctctaggccttcctggc 201
               ||||||||||||||||||||||||||
Sbjct: 4337036 agcttccttctctaggccttcctggc 4337061



to top

>dbj|AP006441.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:B1279D09
          Length = 134793

 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                         
Query: 285   ggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcactt 344
             |||||||||||||||||||||||||||| | ||||| |||||||||||||||||| ||||
Sbjct: 40141 ggttgatgcgtccatgagcacggtaggtacggcgcctctgcttctgggcctggttaactt 40200

                                                          
Query: 345   ggatgtgcgaaatgtagagagcatccacatcaagacctttcacct 389
             | ||||| || |  || |||| ||| ||||| |||||||||||||
Sbjct: 40201 gaatgtgggacacataaagagtatcaacatccagacctttcacct 40245



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 76/84 (90%), Gaps = 2/84 (2%)
 Strand = Plus / Plus

                                                                         
Query: 386   acctcagcattgctcttctgcgttctttagaagatccagaacgaacttagcagacttggc 445
             |||||||||||||||| |||| ||||| ||||||||||||| |||  |||||||||||||
Sbjct: 40323 acctcagcattgctct-ctgcattcttaagaagatccagaatgaatctagcagacttggc 40381

                                     
Query: 446   aggcccagcgtccctgaccatttg 469
             ||| ||||||||||||||| ||||
Sbjct: 40382 agg-ccagcgtccctgaccgtttg 40404



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 70/79 (88%), Gaps = 2/79 (2%)
 Strand = Plus / Plus

                                                                         
Query: 495   gtgcgtccaacaccacggcagtacctccggaaggggatggcttgctttgtgtgccaacac 554
             ||||| |||||||||| ||||||||| ||||||||||| |||||| ||||| || | |||
Sbjct: 40428 gtgcggccaacaccaccgcagtacctacggaaggggatagcttgc-ttgtgggcaatcac 40486

                                
Query: 555   atccttcaaggtacctctt 573
             |||| ||||||||||||||
Sbjct: 40487 atcc-tcaaggtacctctt 40504



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                         
Query: 216   cctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatgggttgg 275
             |||| |||||||| || ||||||||||| |||| ||| |||||||||||||| |||  ||
Sbjct: 39992 cctctttcttcactggttcttccttctctgacaggataagctcaatgtggcacggggagg 40051

                    
Query: 276   acatgta 282
             |||||||
Sbjct: 40052 acatgta 40058



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 176   agcttccttctctaggccttcctggc 201
             ||||||||||||||||||||||||||
Sbjct: 39854 agcttccttctctaggccttcctggc 39879



to top

>dbj|AP005589.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
              clone:P0523B07
          Length = 170510

 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                          
Query: 285    ggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcactt 344
              |||||||||||||||||||||||||||| | ||||| |||||||||||||||||| ||||
Sbjct: 161082 ggttgatgcgtccatgagcacggtaggtacggcgcctctgcttctgggcctggttaactt 161141

                                                           
Query: 345    ggatgtgcgaaatgtagagagcatccacatcaagacctttcacct 389
              | ||||| || |  || |||| ||| ||||| |||||||||||||
Sbjct: 161142 gaatgtgggacacataaagagtatcaacatccagacctttcacct 161186



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 76/84 (90%), Gaps = 2/84 (2%)
 Strand = Plus / Plus

                                                                          
Query: 386    acctcagcattgctcttctgcgttctttagaagatccagaacgaacttagcagacttggc 445
              |||||||||||||||| |||| ||||| ||||||||||||| |||  |||||||||||||
Sbjct: 161264 acctcagcattgctct-ctgcattcttaagaagatccagaatgaatctagcagacttggc 161322

                                      
Query: 446    aggcccagcgtccctgaccatttg 469
              ||| ||||||||||||||| ||||
Sbjct: 161323 agg-ccagcgtccctgaccgtttg 161345



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 70/79 (88%), Gaps = 2/79 (2%)
 Strand = Plus / Plus

                                                                          
Query: 495    gtgcgtccaacaccacggcagtacctccggaaggggatggcttgctttgtgtgccaacac 554
              ||||| |||||||||| ||||||||| ||||||||||| |||||| ||||| || | |||
Sbjct: 161369 gtgcggccaacaccaccgcagtacctacggaaggggatagcttgc-ttgtgggcaatcac 161427

                                 
Query: 555    atccttcaaggtacctctt 573
              |||| ||||||||||||||
Sbjct: 161428 atcc-tcaaggtacctctt 161445



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                          
Query: 216    cctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatgggttgg 275
              |||| |||||||| || ||||||||||| |||| ||| |||||||||||||| |||  ||
Sbjct: 160933 cctctttcttcactggttcttccttctctgacaggataagctcaatgtggcacggggagg 160992

                     
Query: 276    acatgta 282
              |||||||
Sbjct: 160993 acatgta 160999



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                        
Query: 176    agcttccttctctaggccttcctggc 201
              ||||||||||||||||||||||||||
Sbjct: 160795 agcttccttctctaggccttcctggc 160820



to top

>gb|AF076975.1|AF076975 Populus alba unknown mRNA, partial cds
          Length = 578

 Score =  105 bits (53), Expect = 2e-19
 Identities = 111/129 (86%), Gaps = 1/129 (0%)
 Strand = Plus / Minus

                                                                       
Query: 322 ctgcttctgggcctggttcacttggatgtgcgaaatgtagagagcatccacatcaagacc 381
           ||||||||| ||||| ||||| |||||||| ||||||||||| ||||||||||| | |||
Sbjct: 258 ctgcttctgtgcctgattcacctggatgtgagaaatgtagagtgcatccacatccaaacc 199

                                                                       
Query: 382 tttcacctcagcattgctcttctgcgttctttagaagatccagaacgaacttagcagact 441
            || ||||||||||||||| || || ||||| || | |||||| | |||||| |||||||
Sbjct: 198 cttgacctcagcattgctc-tcggcattcttgagtaaatccaggatgaacttggcagact 140

                    
Query: 442 tggcaggcc 450
           |||||||||
Sbjct: 139 tggcaggcc 131



to top

>ref|XM_323004.1| Neurospora crassa OR74A 60S RIBOSOMAL PROTEIN L17 [MIPS]
           (NCU03703.1) partial mRNA
          Length = 585

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                       
Query: 254 agctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggtc 313
           ||||| |||||||| |||||||||||||||||||||||||| || ||||| ||||| || 
Sbjct: 467 agctcgatgtggcaggggttggacatgtaggggttgatgcgaccgtgagcgcggtaagtg 408

                                                  
Query: 314 ctgcgccgctgcttctgggcctggttcacttggatgtgc 352
           | ||| ||||||||  |||||||||| || |||||||||
Sbjct: 407 cggcggcgctgcttgggggcctggttgacctggatgtgc 369



to top

>ref|XM_956386.1| Neurospora crassa OR74A 60S RIBOSOMAL PROTEIN L17 [MIPS]
           (NCU03703.1) partial mRNA
          Length = 585

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                       
Query: 254 agctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggtc 313
           ||||| |||||||| |||||||||||||||||||||||||| || ||||| ||||| || 
Sbjct: 467 agctcgatgtggcaggggttggacatgtaggggttgatgcgaccgtgagcgcggtaagtg 408

                                                  
Query: 314 ctgcgccgctgcttctgggcctggttcacttggatgtgc 352
           | ||| ||||||||  |||||||||| || |||||||||
Sbjct: 407 cggcggcgctgcttgggggcctggttgacctggatgtgc 369



to top

>ref|XM_382047.1| Gibberella zeae PH-1 chromosome 1 RL17_NEUCR 60S ribosomal protein
           L17 (FG01871.1) partial mRNA
          Length = 558

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                       
Query: 254 agctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggtc 313
           ||||| |||||||| |||||||||||||| |||||||| || || ||||||||||| |||
Sbjct: 443 agctcgatgtggcaggggttggacatgtaagggttgatacgaccgtgagcacggtatgtc 384

                                                  
Query: 314 ctgcgccgctgcttctgggcctggttcacttggatgtgc 352
           || || ||||||||  |||||||||| || |||||||||
Sbjct: 383 cttcgtcgctgcttgggggcctggttgacctggatgtgc 345



to top

>emb|AJ876806.1| Acanthamoeba polyphaga mRNA for putative ribosomal L17-like protein
          Length = 545

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 118/142 (83%)
 Strand = Plus / Minus

                                                                       
Query: 260 atgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggtcctgcgc 319
           |||||||| ||||||||||||||||||||||| |  || || || ||||||||||| | |
Sbjct: 423 atgtggcaggggttggacatgtaggggttgatcctaccgtgggcgcggtaggtcctcctc 364

                                                                       
Query: 320 cgctgcttctgggcctggttcacttggatgtgcgaaatgtagagagcatccacatcaaga 379
           | |||||||||||||| ||| || || |    ||||| |||||| || ||||||||||||
Sbjct: 363 ctctgcttctgggccttgttgacctgaacccacgaaacgtagagggcgtccacatcaaga 304

                                 
Query: 380 cctttcacctcagcattgctct 401
           || || |||||||| |||||||
Sbjct: 303 cccttgacctcagcgttgctct 282



to top

>gb|DQ207869.1| Solanum tuberosum clone 086A10 ribosomal protein PETRP-like mRNA,
           complete cds
          Length = 729

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 138/170 (81%)
 Strand = Plus / Minus

                                                                       
Query: 232 ctcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgat 291
           ||||||||||||||| || |||| |||||| ||||| ||||  ||||| |||||||| ||
Sbjct: 498 ctcttccttctcagataaaatcaactcaatatggcaggggtgagacatataggggttaat 439

                                                                       
Query: 292 gcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtg 351
            | |||||| ||||||||||| |  || | ||| || || || |  ||||||||||||||
Sbjct: 438 tcttccatgtgcacggtaggtacgacgtctctgtttttgagcttcattcacttggatgtg 379

                                                             
Query: 352 cgaaatgtagagagcatccacatcaagacctttcacctcagcattgctct 401
            || || || || | ||||||||| | ||||||||||||||| |||||||
Sbjct: 378 agatatataaagtgaatccacatccaaacctttcacctcagcgttgctct 329



to top

>gb|AY496096.1| Capsicum annuum ribosomal protein PETRP mRNA, complete cds
          Length = 765

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 138/170 (81%)
 Strand = Plus / Minus

                                                                       
Query: 232 ctcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgat 291
           |||||||||||||||||| | || |||||| ||||| ||||  ||||| |||||||| ||
Sbjct: 512 ctcttccttctcagacaataccaactcaatatggcaagggtgagacatataggggttaat 453

                                                                       
Query: 292 gcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtg 351
            | ||| || || ||||| || | ||||| ||| || || |||||||| |||||||||||
Sbjct: 452 tcttccgtgtgctcggtatgtgcggcgcctctgtttttgtgcctggtttacttggatgtg 393

                                                             
Query: 352 cgaaatgtagagagcatccacatcaagacctttcacctcagcattgctct 401
            || ||| | || | ||||||||| |  ||||| ||||||||||||||||
Sbjct: 392 agatatgaaaagtgaatccacatccaagcctttaacctcagcattgctct 343



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 63/70 (90%)
 Strand = Plus / Plus

                                                                            
Query: 287      ttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttgg 346
                ||||||||||||||||||||||| |||| ||| | |||||||||||| |||||||| |||
Sbjct: 26399460 ttgatgcgtccatgagcacggtatgtccggcgtctctgcttctgggcttggttcacctgg 26399519

                          
Query: 347      atgtgcgaaa 356
                ||||| ||||
Sbjct: 26399520 atgtgtgaaa 26399529



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                    
Query: 216      cctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggca 267
                |||| |||||||| | |||||||||||| |||||||| ||||| | ||||||
Sbjct: 26399319 cctctttcttcacggcctcttccttctctgacaagataagctcgacgtggca 26399370



to top

>dbj|AP003920.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1789_C07
          Length = 138944

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 63/70 (90%)
 Strand = Plus / Plus

                                                                         
Query: 287   ttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttgg 346
             ||||||||||||||||||||||| |||| ||| | |||||||||||| |||||||| |||
Sbjct: 49012 ttgatgcgtccatgagcacggtatgtccggcgtctctgcttctgggcttggttcacctgg 49071

                       
Query: 347   atgtgcgaaa 356
             ||||| ||||
Sbjct: 49072 atgtgtgaaa 49081



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                 
Query: 216   cctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggca 267
             |||| |||||||| | |||||||||||| |||||||| ||||| | ||||||
Sbjct: 48871 cctctttcttcacggcctcttccttctctgacaagataagctcgacgtggca 48922



to top

>dbj|AP004015.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OJ1770_H02
          Length = 170648

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 63/70 (90%)
 Strand = Plus / Plus

                                                                          
Query: 287    ttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttgg 346
              ||||||||||||||||||||||| |||| ||| | |||||||||||| |||||||| |||
Sbjct: 129041 ttgatgcgtccatgagcacggtatgtccggcgtctctgcttctgggcttggttcacctgg 129100

                        
Query: 347    atgtgcgaaa 356
              ||||| ||||
Sbjct: 129101 atgtgtgaaa 129110



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                  
Query: 216    cctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggca 267
              |||| |||||||| | |||||||||||| |||||||| ||||| | ||||||
Sbjct: 128900 cctctttcttcacggcctcttccttctctgacaagataagctcgacgtggca 128951



to top

>gb|DQ252494.1| Solanum tuberosum clone 063E12 ribosomal protein PETRP-like mRNA,
           complete cds
          Length = 760

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 138/170 (81%)
 Strand = Plus / Minus

                                                                       
Query: 232 ctcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgat 291
           ||||||||||||||| || |||| |||||| ||||| ||||  ||||| |||||||| ||
Sbjct: 509 ctcttccttctcagataaaatcaactcaatatggcaggggtgagacatataggggttaat 450

                                                                       
Query: 292 gcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtg 351
            | ||| || ||||||||||| |  |||| ||| || || || |  ||||||||||||||
Sbjct: 449 tcttccgtgtgcacggtaggtacgacgcctctgtttttgagcttcattcacttggatgtg 390

                                                             
Query: 352 cgaaatgtagagagcatccacatcaagacctttcacctcagcattgctct 401
            || || || || | ||||||||| | ||||||||||||||| |||||||
Sbjct: 389 agatatataaagtgaatccacatccaaacctttcacctcagcgttgctct 340



to top

>gb|AC004393.2|T1F15 Arabidopsis thaliana chromosome 1 BAC T1F15 sequence, complete sequence
          Length = 60066

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 50/53 (94%)
 Strand = Plus / Plus

                                                                  
Query: 230   ggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatgta 282
             |||||||||||||| ||||| |||| |||||||||||||||||||||||||||
Sbjct: 43909 ggctcttccttctctgacaaaatcaactcaatgtggcatgggttggacatgta 43961



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 87/105 (82%)
 Strand = Plus / Plus

                                                                         
Query: 285   ggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcactt 344
             ||||||| | ||| ||||||||||| ||||| | ||  |||||   ||||||||||||||
Sbjct: 44048 ggttgattcttccgtgagcacggtaagtccttctcctttgctttgcggcctggttcactt 44107

                                                          
Query: 345   ggatgtgcgaaatgtagagagcatccacatcaagacctttcacct 389
             ||||||| || ||| |||| ||||| ||||| | |||||||||||
Sbjct: 44108 ggatgtgtgatatgaagagggcatcaacatccaaacctttcacct 44152



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 72/84 (85%), Gaps = 2/84 (2%)
 Strand = Plus / Plus

                                                                         
Query: 384   tcacctcagcattgctcttctgcgttctttagaagatccagaacgaacttagcagacttg 443
             |||||||||||||||||| | |||||||| || | ||| ||||| |||| ||||||||||
Sbjct: 44239 tcacctcagcattgctct-cagcgttcttgagcaaatcaagaacaaactgagcagacttg 44297

                                     
Query: 444   gcaggcccagcgtccctgaccatt 467
             || || ||| ||||| ||||||||
Sbjct: 44298 gctgg-ccaacgtccttgaccatt 44320



to top

>gb|DQ235197.1| Solanum tuberosum clone 168G07 ribosomal protein PETRP-like mRNA,
           complete cds
          Length = 774

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 136/168 (80%)
 Strand = Plus / Minus

                                                                       
Query: 232 ctcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgat 291
           |||||||||||| || || |||| |||||| ||||| ||||  ||||| |||||||| ||
Sbjct: 503 ctcttccttctcggataaaatcaactcaatatggcaggggtgagacatataggggttaat 444

                                                                       
Query: 292 gcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtg 351
            | ||| || ||||||||||| |  |||| ||| || || || |  ||||||||||||||
Sbjct: 443 tcttccgtgtgcacggtaggtacgacgcctctgtttttgagcttcattcacttggatgtg 384

                                                           
Query: 352 cgaaatgtagagagcatccacatcaagacctttcacctcagcattgct 399
            || || || || | ||||||||| | |||||||||||||||||||||
Sbjct: 383 agatatataaagtgaatccacatccaaacctttcacctcagcattgct 336



to top

>gb|AY853172.1| Pectinaria gouldii ribosomal protein L17 mRNA, complete cds
          Length = 666

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 253 cagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggt 312
           ||||||||||||||||||| ||  |||||||||||||||||| |||||||| | ||||||
Sbjct: 472 cagctcaatgtggcatgggctgctcatgtaggggttgatgcgaccatgagccctgtaggt 413

              
Query: 313 cct 315
           |||
Sbjct: 412 cct 410



to top

>gb|AC004557.2|AC004557 Genomic sequence for Arabidopsis thaliana BAC F17L21 from chromosome I,
             complete sequence
          Length = 99690

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 60/67 (89%)
 Strand = Plus / Minus

                                                                         
Query: 216   cctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatgggttgg 275
             |||| |||||||| |||||||| ||||| ||||| |||| |||||||||||||||||| |
Sbjct: 60465 cctctttcttcacaggctcttctttctctgacaaaatcaactcaatgtggcatgggtttg 60406

                    
Query: 276   acatgta 282
             |||||||
Sbjct: 60405 acatgta 60399



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 56/65 (86%), Gaps = 1/65 (1%)
 Strand = Plus / Minus

                                                                         
Query: 386   acctcagcattgctcttctgcgttctttagaagatccagaacgaacttagcagacttggc 445
             ||||||||||||||| || || ||||| |||||||| |||||||| | |||||| || ||
Sbjct: 60121 acctcagcattgctc-tcagcattcttgagaagatcaagaacgaattgagcagatttagc 60063

                  
Query: 446   aggcc 450
             |||||
Sbjct: 60062 aggcc 60058



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                    
Query: 335   tggttcacttggatgtgcgaaatgtagagagcatccacatcaagacctttcacct 389
             ||||||||||||||||| |||||| | || ||||| ||||| | |||||| ||||
Sbjct: 60256 tggttcacttggatgtgagaaatgaaaagggcatcgacatccaaacctttgacct 60202



to top

>ref|XM_747718.1| Aspergillus fumigatus Af293 60s ribosomal protein yL17-b
           (Afu1g14410) partial mRNA
          Length = 585

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 254 agctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggt 312
           ||||| |||||||| ||||||| ||||||||||||||| || || ||||||||||||||
Sbjct: 464 agctcgatgtggcaggggttggtcatgtaggggttgatacgaccgtgagcacggtaggt 406



to top

>dbj|AB226154.1| Aspergillus oryzae cDNA, contig sequence: AoEST3012
          Length = 1075

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 254 agctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggt 312
           ||||| |||||||| ||||||| ||||||||||||||| || || ||||||||||||||
Sbjct: 501 agctcgatgtggcaagggttggtcatgtaggggttgatacgaccgtgagcacggtaggt 443



to top

>gb|AY389972.1| Xenopus laevis ribosomal protein L17 mRNA, partial cds
          Length = 472

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 67/78 (85%)
 Strand = Plus / Minus

                                                                       
Query: 235 ttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcg 294
           |||||||||||  | |||||  || ||||||||||||  |  ||||||||||||||||||
Sbjct: 436 ttccttctcagtaaggatcatttcgatgtggcatggggagctcatgtaggggttgatgcg 377

                             
Query: 295 tccatgagcacggtaggt 312
            |||||||||||||||||
Sbjct: 376 accatgagcacggtaggt 359



to top

>gb|BC043971.1| Xenopus laevis similar to ribosomal protein L17, mRNA (cDNA clone
           IMAGE:5571114), partial cds
          Length = 627

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 67/78 (85%)
 Strand = Plus / Minus

                                                                       
Query: 235 ttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcg 294
           |||||||||||  | |||||  || ||||||||||||  |  ||||||||||||||||||
Sbjct: 473 ttccttctcagtaaggatcatttcgatgtggcatggggagctcatgtaggggttgatgcg 414

                             
Query: 295 tccatgagcacggtaggt 312
            |||||||||||||||||
Sbjct: 413 accatgagcacggtaggt 396



to top

>gb|AF401571.1| Ictalurus punctatus ribosomal protein L17 mRNA, complete cds
          Length = 600

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 67/78 (85%)
 Strand = Plus / Minus

                                                                       
Query: 235 ttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcg 294
           |||||||||||  | ||||| |||||||||||| |||  |  ||||||||||||||||||
Sbjct: 478 ttccttctcagtgaggatcatctcaatgtggcagggggagctcatgtaggggttgatgcg 419

                             
Query: 295 tccatgagcacggtaggt 312
           ||| || |||||||||||
Sbjct: 418 tccgtgggcacggtaggt 401



to top

>gb|BC053781.1| Xenopus laevis cDNA clone IMAGE:6876276, containing frame-shift
           errors
          Length = 651

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 260 atgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggt 312
           ||||||||||||  |  |||||||||||||||||| |||||||||||||||||
Sbjct: 467 atgtggcatggggagctcatgtaggggttgatgcgaccatgagcacggtaggt 415



to top

>gb|BC055097.1| Danio rerio zgc:65996, mRNA (cDNA clone MGC:65996 IMAGE:6792826),
           complete cds
          Length = 636

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 277 catgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctg 336
           ||||||||||||||||||||| ||||| |||||||| |  ||||||  |||  |||||| 
Sbjct: 428 catgtaggggttgatgcgtccgtgagcgcggtaggtacgtcgccgcatctttggggcctt 369

                           
Query: 337 gttcacttggatgtgc 352
           |||||| |||||||||
Sbjct: 368 gttcacctggatgtgc 353



to top

>ref|XM_653288.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN0776.2), mRNA
          Length = 555

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                       
Query: 241 ctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatg 300
           ||||| || ||| ||||| |||||||| ||||||| |||||| |||||||| || || ||
Sbjct: 456 ctcagtcaggatgagctcgatgtggcaggggttggtcatgtaagggttgatacgaccgtg 397

                       
Query: 301 agcacggtaggt 312
           ||||||||||||
Sbjct: 396 agcacggtaggt 385



to top

>ref|NM_212760.1| Danio rerio zgc:65996 (zgc:65996), mRNA
          Length = 636

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 277 catgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctg 336
           ||||||||||||||||||||| ||||| |||||||| |  ||||||  |||  |||||| 
Sbjct: 428 catgtaggggttgatgcgtccgtgagcgcggtaggtacgtcgccgcatctttggggcctt 369

                           
Query: 337 gttcacttggatgtgc 352
           |||||| |||||||||
Sbjct: 368 gttcacctggatgtgc 353



to top

>ref|XM_866977.1| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI),
           transcript variant 3 (LOC534195), mRNA
          Length = 643

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                       
Query: 250 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 309
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 482 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 423

                                                      
Query: 310 ggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
            ||||||||||||  |||  |||| | ||||||||||||||||
Sbjct: 422 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 380



to top

>ref|XM_613874.2| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI),
           transcript variant 1 (LOC534195), mRNA
          Length = 548

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                       
Query: 250 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 309
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 404 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 345

                                                      
Query: 310 ggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
            ||||||||||||  |||  |||| | ||||||||||||||||
Sbjct: 344 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 302



to top

>ref|XM_879331.1| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI),
           transcript variant 4 (LOC534195), mRNA
          Length = 515

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                       
Query: 250 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 309
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 371 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 312

                                                      
Query: 310 ggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
            ||||||||||||  |||  |||| | ||||||||||||||||
Sbjct: 311 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 269



to top

>gb|BC102600.1| Bos taurus similar to 60S ribosomal protein L17 (L23) (Amino acid
           starvation-induced protein) (ASI), mRNA (cDNA clone
           MGC:128012 IMAGE:30957113), complete cds
          Length = 642

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                       
Query: 250 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 309
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 488 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 429

                                                      
Query: 310 ggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
            ||||||||||||  |||  |||| | ||||||||||||||||
Sbjct: 428 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 386



to top

>dbj|AB099057.1| Bos taurus mRNA for similar to ribosomal protein L17, partial cds,
           clone: ORCS13090
          Length = 608

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                       
Query: 250 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 309
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 470 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 411

                                                      
Query: 310 ggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
            ||||||||||||  |||  |||| | ||||||||||||||||
Sbjct: 410 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 368



to top

>dbj|AB099047.1| Bos taurus mRNA for similar to ribosomal protein L17, partial cds,
           clone: ORCS12904
          Length = 615

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                       
Query: 250 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 309
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 469 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 410

                                                      
Query: 310 ggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
            ||||||||||||  |||  |||| | ||||||||||||||||
Sbjct: 409 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 367



to top

>dbj|AB099021.1| Bos taurus mRNA for similar to ribosomal protein L17, partial cds,
           clone: ORCS12459
          Length = 509

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                       
Query: 250 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 309
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 383 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 324

                                                      
Query: 310 ggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
            ||||||||||||  |||  |||| | ||||||||||||||||
Sbjct: 323 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 281



to top

>dbj|AB098996.1| Bos taurus mRNA for similar to ribosomal protein L17, partial cds,
           clone: ORCS11762
          Length = 586

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                       
Query: 250 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 309
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 474 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 415

                                                      
Query: 310 ggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
            ||||||||||||  |||  |||| | ||||||||||||||||
Sbjct: 414 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 372



to top

>dbj|AB098987.1| Bos taurus mRNA for similar to ribosomal protein L17, partial cds,
           clone: ORCS11689
          Length = 567

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                       
Query: 250 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 309
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 454 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 395

                                                      
Query: 310 ggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
            ||||||||||||  |||  |||| | ||||||||||||||||
Sbjct: 394 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 352



to top

>dbj|AB098888.1| Bos taurus mRNA for similar to ribosomal protein L17, partial cds,
           clone: ORCS10039
          Length = 589

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                       
Query: 250 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 309
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 466 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 407

                                                      
Query: 310 ggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
            ||||||||||||  |||  |||| | ||||||||||||||||
Sbjct: 406 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 364



to top

>ref|NM_001034459.1| Bos taurus similar to 60S ribosomal protein L17 (L23) (Amino acid
           starvation-induced protein) (ASI) (MGC128012), mRNA
          Length = 642

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                       
Query: 250 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 309
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 488 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 429

                                                      
Query: 310 ggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
            ||||||||||||  |||  |||| | ||||||||||||||||
Sbjct: 428 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 386



to top

>gb|AF443188.1| Paracoccidioides brasiliensis sorbitol dehydrogenase (SOR1) gene;
            hydroxyacid dehydrogenase protein Ynl274c (YNL274c) gene;
            and 60S ribosomal protein Rpl17A (RPL17A) gene, partial
            cds
          Length = 6361

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                  
Query: 254  agctcaatgtggcatgggttggacatgtaggggttgat 291
            ||||| |||||||||||| |||||||||||||||||||
Sbjct: 6360 agctcgatgtggcatgggctggacatgtaggggttgat 6323



to top

>emb|AL451014.1|NCB9B15 Neurospora crassa DNA linkage group V BAC clone B9B15
          Length = 81650

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                   
Query: 254   agctcaatgtggcatgggttggacatgtaggggttgat 291
             ||||| |||||||| |||||||||||||||||||||||
Sbjct: 76796 agctcgatgtggcaggggttggacatgtaggggttgat 76759



to top

>gb|DQ066273.1| Ixodes scapularis isolate is-all-clu554 ribosomal protein L17 mRNA,
           complete cds
          Length = 558

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 84/102 (82%)
 Strand = Plus / Minus

                                                                       
Query: 250 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 309
           ||||| |||||||||||| ||| ||  |||||| |||||||||||||| || || |||||
Sbjct: 447 gatcacctcaatgtggcacgggctgctcatgtacgggttgatgcgtccgtgggcgcggta 388

                                                     
Query: 310 ggtcctgcgccgctgcttctgggcctggttcacttggatgtg 351
           |||||| |  |||  |||  ||||| |||| |||||||||||
Sbjct: 387 ggtcctcctgcgcatcttgggggcccggttgacttggatgtg 346



to top

>gb|BC077192.1| Xenopus laevis MGC78885 protein, mRNA (cDNA clone MGC:78885
           IMAGE:4174034), complete cds
          Length = 678

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 277 catgtaggggttgatgcgtccatgagcacggtaggt 312
           |||||||||||||||||| |||||||| ||||||||
Sbjct: 443 catgtaggggttgatgcgaccatgagcgcggtaggt 408



to top

>gb|BC049299.1| Danio rerio cDNA clone IMAGE:5914772, **** WARNING: chimeric clone
            ****
          Length = 1854

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                
Query: 277  catgtaggggttgatgcgtccatgagcacggtaggt 312
            ||||||||||||||||||||| ||||| ||||||||
Sbjct: 1672 catgtaggggttgatgcgtccgtgagcgcggtaggt 1637



to top

>ref|XM_680042.1| PREDICTED: Danio rerio similar to Ribosomal protein L17
           (LOC572750), mRNA
          Length = 631

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 277 catgtaggggttgatgcgtccatgagcacggtaggt 312
           ||||||||||||||||||||| ||||| ||||||||
Sbjct: 462 catgtaggggttgatgcgtccgtgagcgcggtaggt 427



to top

>emb|BX000991.8| Zebrafish DNA sequence from clone CH211-203L7 in linkage group 6,
              complete sequence
          Length = 170966

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                  
Query: 277    catgtaggggttgatgcgtccatgagcacggtaggt 312
              ||||||||||||||||||||| ||||| ||||||||
Sbjct: 121973 catgtaggggttgatgcgtccgtgagcgcggtaggt 122008



to top

>emb|BX005111.4| Zebrafish DNA sequence from clone CH211-273E17 in linkage group 21,
            complete sequence
          Length = 169747

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                
Query: 277  catgtaggggttgatgcgtccatgagcacggtaggt 312
            ||||||||||||||||||||| ||||| ||||||||
Sbjct: 5500 catgtaggggttgatgcgtccgtgagcgcggtaggt 5535



to top

>gb|AY769286.1| Bombyx mori ribosomal protein L17 (RpL17) mRNA, complete cds
          Length = 620

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 275 gacatgtaggggttgatgcgtccatgagcacggta 309
           |||||||||||||||||||| || |||||||||||
Sbjct: 437 gacatgtaggggttgatgcgaccgtgagcacggta 403



to top

>ref|XM_599030.2| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23)
           (LOC520780), mRNA
          Length = 500

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 84/103 (81%)
 Strand = Plus / Minus

                                                                       
Query: 250 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 309
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 354 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 295

                                                      
Query: 310 ggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
            ||||||||||||  | |  |||| | ||||||||||||||||
Sbjct: 294 agtcctgcgccgcatcctgggggctttgttcacttggatgtgc 252



to top

>ref|XM_869475.1| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI)
           (LOC617250), mRNA
          Length = 483

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 84/103 (81%)
 Strand = Plus / Minus

                                                                       
Query: 250 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 309
           ||||| |||||||||||| |||  |  |||||||||| |||| || || ||||| | |||
Sbjct: 339 gatcatctcaatgtggcagggggagctcatgtaggggctgatccgaccgtgagctctgta 280

                                                      
Query: 310 ggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
            ||||||||||||  |||  |||| | ||||||||||||||||
Sbjct: 279 agtcctgcgccgcgtcttgggggctttgttcacttggatgtgc 237



to top

>emb|BX649607.1| Aspergillus fumigatus BAC pilot project supercontig; segment 3/3
          Length = 227448

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                    
Query: 254    agctcaatgtggcatgggttggacatgtaggggttgat 291
              ||||| |||||||| ||||||| |||||||||||||||
Sbjct: 202049 agctcgatgtggcaggggttggtcatgtaggggttgat 202012



to top

>dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011
          Length = 2505489

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                    
Query: 254    agctcaatgtggcatgggttggacatgtaggggttgat 291
              ||||| |||||||| ||||||| |||||||||||||||
Sbjct: 944438 agctcgatgtggcaagggttggtcatgtaggggttgat 944475



to top

>emb|AL115613.1|CNS01CJP Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 247 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 306
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 474 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 415

                                                         
Query: 307 gtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 414 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 369



to top

>emb|AL114989.1|CNS01C2D Botrytis cinerea strain T4 cDNA library
          Length = 420

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 247 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 306
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 198 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 139

                                                         
Query: 307 gtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 138 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 93



to top

>emb|AL114758.1|CNS01BVY Botrytis cinerea strain T4 cDNA library
          Length = 840

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 247 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 306
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 460 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 401

                                                         
Query: 307 gtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 400 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 355



to top

>emb|AL114552.1|CNS01BQ8 Botrytis cinerea strain T4 cDNA library
          Length = 456

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 247 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 306
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 200 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 141

                                                         
Query: 307 gtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 140 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 95



to top

>emb|AL113871.1|CNS01B7B Botrytis cinerea strain T4 cDNA library
          Length = 600

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 247 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 306
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 371 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 312

                                                         
Query: 307 gtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 311 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 266



to top

>emb|AL113217.1|CNS01AP5 Botrytis cinerea strain T4 cDNA library
          Length = 516

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 247 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 306
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 286 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 227

                                                         
Query: 307 gtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 226 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 181



to top

>emb|AL113064.1|CNS01AKW Botrytis cinerea strain T4 cDNA library
          Length = 636

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 247 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 306
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 454 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 395

                                                         
Query: 307 gtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 394 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 349



to top

>emb|AL112375.1|CNS01A1R Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 247 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 306
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 480 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 421

                                                         
Query: 307 gtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 420 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 375



to top

>emb|AL112009.1|CNS019RL Botrytis cinerea strain T4 cDNA library
          Length = 636

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 247 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 306
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 501 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 442

                                                         
Query: 307 gtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 441 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 396



to top

>emb|AL111981.1|CNS019QT Botrytis cinerea strain T4 cDNA library
          Length = 636

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 247 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 306
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 372 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 313

                                                         
Query: 307 gtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 312 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 267



to top

>emb|AL111483.1|CNS019CZ Botrytis cinerea strain T4 cDNA library
          Length = 696

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 247 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 306
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 461 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 402

                                                         
Query: 307 gtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 401 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 356



to top

>emb|AL111750.1|CNS019KE Botrytis cinerea strain T4 cDNA library
          Length = 636

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 247 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 306
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 480 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 421

                                                         
Query: 307 gtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 420 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 375



to top

>emb|AL111381.1|CNS019A5 Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 247 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 306
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 466 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 407

                                                         
Query: 307 gtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 406 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 361



to top

>emb|AL110722.1|CNS018RV Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 247 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 306
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 469 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 410

                                                         
Query: 307 gtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 409 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 364



to top

>emb|AL110976.1|CNS018YX Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 247 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 306
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 463 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 404

                                                         
Query: 307 gtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgc 352
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 403 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 358



to top

>ref|XM_865349.1| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI)
           (LOC614032), mRNA
          Length = 442

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 61/73 (83%)
 Strand = Plus / Minus

                                                                       
Query: 280 gtaggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggtt 339
           |||||||||||| || || ||||| | ||| ||||||||||||  |||  |||| | |||
Sbjct: 267 gtaggggttgatccgaccgtgagctctgtaagtcctgcgccgcatcttgggggctttgtt 208

                        
Query: 340 cacttggatgtgc 352
           |||||||||||||
Sbjct: 207 cacttggatgtgc 195



to top

>gb|AY389929.1| Latimeria chalumnae ribosomal protein L17 mRNA, partial cds
          Length = 472

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                       
Query: 236 tccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgt 295
           ||||||||||  | |||||  ||||||||||| |||  |  |||||| ||||||||||| 
Sbjct: 435 tccttctcagttaggatcatttcaatgtggcaaggggagctcatgtaagggttgatgcgg 376

                            
Query: 296 ccatgagcacggtaggt 312
           || ||||||||||||||
Sbjct: 375 ccgtgagcacggtaggt 359



to top

>ref|XM_871477.1| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI)
           (LOC619156), mRNA
          Length = 627

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 60/72 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 taggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttc 340
           ||||||||||| || |||||||| | ||| |||| |||||||  |||  |||| | ||||
Sbjct: 445 taggggttgatacgaccatgagctctgtaagtcccgcgccgcatcttgggggctttgttc 386

                       
Query: 341 acttggatgtgc 352
           ||||||||||||
Sbjct: 385 acttggatgtgc 374



to top

>ref|XM_868142.1| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI)
           (LOC616175), mRNA
          Length = 398

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                       
Query: 277 catgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctg 336
           ||||||||||||||| || |  ||||| | ||| ||||||||||||  |||  |||| | 
Sbjct: 219 catgtaggggttgatccgactgtgagctctgtaagtcctgcgccgcatcttgggggcttt 160

                           
Query: 337 gttcacttggatgtgc 352
           ||||||||||||||||
Sbjct: 159 gttcacttggatgtgc 144



to top

>ref|XM_869796.1| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI)
           (LOC617520), mRNA
          Length = 570

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                       
Query: 277 catgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctg 336
           ||||||||||||||| || || ||||| | ||| ||||||||||||  | |  |||| | 
Sbjct: 327 catgtaggggttgatccgaccgtgagctctgtaagtcctgcgccgcatcgtgggggcttt 268

                           
Query: 337 gttcacttggatgtgc 352
           ||||||||||||||||
Sbjct: 267 gttcacttggatgtgc 252



to top

>ref|XM_584664.2| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI)
           (LOC507961), mRNA
          Length = 590

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                       
Query: 277 catgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctg 336
           ||||||||||||||| || || ||||| | ||| ||||||||||||  |||  |||| | 
Sbjct: 436 catgtaggggttgatccgaccgtgagctctgtaagtcctgcgccgcatcttgggggcttt 377

                           
Query: 337 gttcacttggatgtgc 352
           |||||| |||||||||
Sbjct: 376 gttcacctggatgtgc 361



to top

>gb|AY310814.1| Nicotiana benthamiana clone 12-173 unknown mRNA
          Length = 202

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                       
Query: 338 ttcacttggatgtgcgaaatgtagagagcatccacatcaagacctttcacctcagcattg 397
           |||||||||||||| || ||| | || | ||||||||| |  ||||| ||||||||||||
Sbjct: 154 ttcacttggatgtgagatatgaaaagtgaatccacatccaagcctttaacctcagcattg 95

               
Query: 398 ctct 401
           ||||
Sbjct: 94  ctct 91



to top

>gb|DQ223555.1| Ovis aries clone TO-DOWN-E18-5 ribosomal protein L17 mRNA, partial
           cds
          Length = 538

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                       
Query: 277 catgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcctg 336
           ||||||||||||||| || || ||||| | ||| |||||||| |||  |||  |||| | 
Sbjct: 349 catgtaggggttgatccgaccgtgagctctgtaagtcctgcgtcgcatcttgggggcttt 290

                           
Query: 337 gttcacttggatgtgc 352
           ||||||||||||||||
Sbjct: 289 gttcacttggatgtgc 274



to top

>emb|X71382.1|PCRPL17 P.carnea mRNA for 60S ribosomal protein L17
          Length = 577

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 260 atgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 306
           |||||||||||  | |||||||| || |||||||| |||||||||||
Sbjct: 447 atgtggcatggactcgacatgtatggattgatgcgaccatgagcacg 401



to top

>gb|AC023722.4| Drosophila melanogaster X BAC RP98-48O24 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 191590

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 275   gacatgtaggggttgatgcgtccatgagcacggta 309
             ||||||||||| |||||||| ||||| ||||||||
Sbjct: 56271 gacatgtagggattgatgcgaccatgggcacggta 56305



to top

>gb|AC023699.4| Drosophila melanogaster X BAC RP98-11K20 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 177941

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                 
Query: 275    gacatgtaggggttgatgcgtccatgagcacggta 309
              ||||||||||| |||||||| ||||| ||||||||
Sbjct: 160375 gacatgtagggattgatgcgaccatgggcacggta 160409



to top

>ref|NM_167089.1| Drosophila melanogaster Ribosomal protein L17 CG3203-RC, transcript
           variant C (RpL17), mRNA
          Length = 919

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 275 gacatgtaggggttgatgcgtccatgagcacggta 309
           ||||||||||| |||||||| ||||| ||||||||
Sbjct: 540 gacatgtagggattgatgcgaccatgggcacggta 506



to top

>ref|NM_167088.1| Drosophila melanogaster Ribosomal protein L17 CG3203-RB, transcript
           variant B (RpL17), mRNA
          Length = 873

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 275 gacatgtaggggttgatgcgtccatgagcacggta 309
           ||||||||||| |||||||| ||||| ||||||||
Sbjct: 494 gacatgtagggattgatgcgaccatgggcacggta 460



to top

>ref|NM_167087.1| Drosophila melanogaster Ribosomal protein L17 CG3203-RA, transcript
           variant A (RpL17), mRNA
          Length = 837

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 275 gacatgtaggggttgatgcgtccatgagcacggta 309
           ||||||||||| |||||||| ||||| ||||||||
Sbjct: 458 gacatgtagggattgatgcgaccatgggcacggta 424



to top

>ref|NM_132118.2| Drosophila melanogaster Ribosomal protein L17 CG3203-RD, transcript
           variant D (RpL17), mRNA
          Length = 1065

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 275 gacatgtaggggttgatgcgtccatgagcacggta 309
           ||||||||||| |||||||| ||||| ||||||||
Sbjct: 686 gacatgtagggattgatgcgaccatgggcacggta 652



to top

>gb|AY060845.1| Drosophila melanogaster GM02242 full length cDNA
          Length = 885

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 275 gacatgtaggggttgatgcgtccatgagcacggta 309
           ||||||||||| |||||||| ||||| ||||||||
Sbjct: 686 gacatgtagggattgatgcgaccatgggcacggta 652



to top

>emb|AL111872.1|CNS019NS Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 247 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 306
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 461 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 402

              
Query: 307 gta 309
           |||
Sbjct: 401 gta 399



to top

>gb|AE003438.3| Drosophila melanogaster chromosome X, section 22 of 74 of the complete
              sequence
          Length = 299943

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                 
Query: 275    gacatgtaggggttgatgcgtccatgagcacggta 309
              ||||||||||| |||||||| ||||| ||||||||
Sbjct: 202262 gacatgtagggattgatgcgaccatgggcacggta 202296



to top

>gb|BC077000.1| Xenopus tropicalis MGC89639 protein, mRNA (cDNA clone MGC:89639
           IMAGE:7025713), complete cds
          Length = 653

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 64/78 (82%)
 Strand = Plus / Minus

                                                                       
Query: 235 ttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcg 294
           |||||||||||  | |||||  || ||||||||||||  |  ||| ||||| ||||| ||
Sbjct: 499 ttccttctcagtaaggatcaattcgatgtggcatggggagctcatatagggattgatacg 440

                             
Query: 295 tccatgagcacggtaggt 312
            |||||||||||||||||
Sbjct: 439 accatgagcacggtaggt 422



to top

>emb|CT025372.2| Xenopus tropicalis finished cDNA, clone TNeu098j06
          Length = 658

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 64/78 (82%)
 Strand = Plus / Minus

                                                                       
Query: 235 ttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcg 294
           |||||||||||  | |||||  || ||||||||||||  |  ||| ||||| ||||| ||
Sbjct: 476 ttccttctcagtaaggatcaattcgatgtggcatggggagctcatatagggattgatacg 417

                             
Query: 295 tccatgagcacggtaggt 312
            |||||||||||||||||
Sbjct: 416 accatgagcacggtaggt 399



to top

>emb|Z83836.2|HS111J24 Human DNA sequence from clone RP1-111J24 on chromosome 22 Contains
             GSSs, complete sequence
          Length = 119008

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 318   gccgctgcttctgggcctggtt 339
             ||||||||||||||||||||||
Sbjct: 44838 gccgctgcttctgggcctggtt 44859



to top

>ref|NM_171832.2| Caenorhabditis elegans Ribosomal Protein, Large subunit family
           member (rpl-17) (rpl-17) mRNA, complete cds
          Length = 543

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 tccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgt 295
           |||||||| | |||||| | ||| ||||||||||||   |||||||| |||||||| | |
Sbjct: 403 tccttctcggccaagatgacctcgatgtggcatggggaagacatgtatgggttgattctt 344

                         
Query: 296 ccatgagcacggta 309
           || || ||||||||
Sbjct: 343 ccgtgggcacggta 330



to top

>ref|NM_170799.2| Caenorhabditis elegans Ribosomal Protein, Large subunit family
           member (rpl-17) (rpl-17) mRNA, complete cds
          Length = 621

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                       
Query: 236 tccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgt 295
           |||||||| | |||||| | ||| ||||||||||||   |||||||| |||||||| | |
Sbjct: 487 tccttctcggccaagatgacctcgatgtggcatggggaagacatgtatgggttgattctt 428

                         
Query: 296 ccatgagcacggta 309
           || || ||||||||
Sbjct: 427 ccgtgggcacggta 414



to top

>ref|NM_001005078.1| Xenopus tropicalis MGC89639 protein (MGC89639), mRNA
          Length = 653

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 64/78 (82%)
 Strand = Plus / Minus

                                                                       
Query: 235 ttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcg 294
           |||||||||||  | |||||  || ||||||||||||  |  ||| ||||| ||||| ||
Sbjct: 499 ttccttctcagtaaggatcaattcgatgtggcatggggagctcatatagggattgatacg 440

                             
Query: 295 tccatgagcacggtaggt 312
            |||||||||||||||||
Sbjct: 439 accatgagcacggtaggt 422



to top

>dbj|AK110522.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-167-H04, full
           insert sequence
          Length = 944

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 64/78 (82%)
 Strand = Plus / Minus

                                                                       
Query: 275 gacatgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgctgcttctgggcc 334
           ||||||||||||||||| || || || |||||||| ||||  |  ||||||||  | |||
Sbjct: 480 gacatgtaggggttgatacgaccgtgggcacggtacgtccgcctgcgctgcttgggagcc 421

                             
Query: 335 tggttcacttggatgtgc 352
           ||||| || |||||||||
Sbjct: 420 tggttgacctggatgtgc 403



to top

>ref|XM_758557.1| Theileria parva strain Muguga chromosome 4 hypothetical protein
            (TP04_0015) partial mRNA
          Length = 1527

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 3    ataagatacgatgaaaaatat 23
            |||||||||||||||||||||
Sbjct: 1472 ataagatacgatgaaaaatat 1452



to top

>emb|AL392172.9| Human DNA sequence from clone RP11-452F19 on chromosome 1 Contains the 5'
              end of the gene for a novel protein (FLJ12806), the gene
              for a novel protein (FLJ32421), two novel genes, the 5' end
              of two variants of the DISP1 gene for dispatched homolog 1
              (Drosophila) and a CpG island, complete sequence
          Length = 195849

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 369    ccacatcaagacctttcacct 389
              |||||||||||||||||||||
Sbjct: 167508 ccacatcaagacctttcacct 167528



to top

>ref|XM_786536.1| PREDICTED: Strongylocentrotus purpuratus similar to 60S ribosomal
           protein L17 (L23) (Amino acid starvation-induced
           protein) (ASI) (LOC586769), mRNA
          Length = 631

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 250 gatcagctcaatgtggcatgg 270
           |||||||||||||||||||||
Sbjct: 457 gatcagctcaatgtggcatgg 437



to top

>dbj|AK171782.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
            library, clone:F830010M10 product:unclassifiable, full
            insert sequence
          Length = 6121

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 407  gttctttagaagatccagaac 427
            |||||||||||||||||||||
Sbjct: 5302 gttctttagaagatccagaac 5282



to top

>gb|AC092155.3| Homo sapiens BAC clone RP11-312H10 from 2, complete sequence
          Length = 153304

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 620   ttagtgttcttgaaatgaaca 640
             |||||||||||||||||||||
Sbjct: 20751 ttagtgttcttgaaatgaaca 20731



to top

>gb|AY130351.1| Scyliorhinus canicula ribosomal protein L17 mRNA, partial cds
          Length = 472

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 63/77 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 tccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgt 295
           ||||||||||  | ||||| ||| |||||||||||   |  |||||| |||||||| || 
Sbjct: 435 tccttctcagtgaggatcatctctatgtggcatggtgagctcatgtatgggttgatacgg 376

                            
Query: 296 ccatgagcacggtaggt 312
           ||||| |||||||||||
Sbjct: 375 ccatgggcacggtaggt 359



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 43/49 (87%), Gaps = 1/49 (2%)
 Strand = Plus / Minus

                                                            
Query: 367 atccacatcaagacctttcacctcagcattgctcttctgcgttctttag 415
           ||||||||| ||||| || |  ||||||||||| |||||||||||||||
Sbjct: 304 atccacatccagacccttgagttcagcattgct-ttctgcgttctttag 257



to top

>gb|AY909403.1| Siniperca chuatsi clone C176 ribosomal protein L17 mRNA, partial
           cds
          Length = 441

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 63/77 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 tccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgt 295
           |||||||| | || ||||| ||| |||||||| |||  |  |||||||||||||||||| 
Sbjct: 322 tccttctcggtcaggatcatctcgatgtggcagggggagctcatgtaggggttgatgcgg 263

                            
Query: 296 ccatgagcacggtaggt 312
           || || || ||||||||
Sbjct: 262 ccgtgggcgcggtaggt 246



to top

>emb|AL603829.5| Mouse DNA sequence from clone RP23-416G21 on chromosome 11, complete
             sequence
          Length = 226220

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 407   gttctttagaagatccagaac 427
             |||||||||||||||||||||
Sbjct: 23800 gttctttagaagatccagaac 23820



to top

>gb|AC152753.1| Mus musculus chromosome 17 clone RP23-65L9, complete sequence
          Length = 211853

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 15    gaaaaatattccaaaacaca 34
             ||||||||||||||||||||
Sbjct: 70352 gaaaaatattccaaaacaca 70333



to top

>gb|AF064857.1| Homo sapiens BAC derived from chromosome 21q22.3, complete sequence,
             containing PEP19 (PCP4) gene
          Length = 199665

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 618   ccttagtgttcttgaaatga 637
             ||||||||||||||||||||
Sbjct: 98927 ccttagtgttcttgaaatga 98946



to top

>gb|AC103376.7| Mus musculus chromosome 8, clone RP24-226P5, complete sequence
          Length = 165714

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 240   tctcagacaagatcagctca 259
             ||||||||||||||||||||
Sbjct: 93352 tctcagacaagatcagctca 93333



to top

>ref|XM_424454.1| PREDICTED: Gallus gallus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI)
           (LOC426845), mRNA
          Length = 726

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 362 agagcatccacatcaagacctttcacctcagcattgctct 401
           |||| ||||||||| ||||| || | ||||||||||||||
Sbjct: 456 agagaatccacatcgagacccttgagctcagcattgctct 417



to top

>ref|XM_427732.1| PREDICTED: Gallus gallus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI)
           (LOC430175), partial mRNA
          Length = 530

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 362 agagcatccacatcaagacctttcacctcagcattgctct 401
           |||| ||||||||| ||||| || | ||||||||||||||
Sbjct: 119 agagaatccacatcgagacccttaagctcagcattgctct 80



to top

>gb|AY389962.1| Gallus gallus ribosomal protein L17 mRNA, partial cds
          Length = 472

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 362 agagcatccacatcaagacctttcacctcagcattgctct 401
           |||| ||||||||| ||||| || | ||||||||||||||
Sbjct: 309 agagaatccacatcgagacccttgagctcagcattgctct 270



to top

>ref|NM_205014.1| Gallus gallus T-cell leukemia homeobox 3 (TLX3), mRNA
          Length = 1603

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                    
Query: 362  agagcatccacatcaagacctttcacctcagcattgctct 401
            |||| ||||||||| ||||| || | ||||||||||||||
Sbjct: 1319 agagaatccacatcgagacccttgagctcagcattgctct 1280



to top

>gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome
          Length = 5650368

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 219     ccttcttcaccggctcttcc 238
               ||||||||||||||||||||
Sbjct: 2470354 ccttcttcaccggctcttcc 2470335



to top

>gb|AC025794.9| Mus musculus chromosome 19, clone RP23-62O7, complete sequence
          Length = 242418

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 112    aattccactcagccaaacca 131
              ||||||||||||||||||||
Sbjct: 205775 aattccactcagccaaacca 205756



to top

>gb|AY382669.1| Cryptosporidium hominis isolate A13 60kDa glycoprotein (GP60) gene,
           GP60-Id allele, partial cds
          Length = 523

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 553 acatccttcaaggtacctcttagc 576
           |||||||||||||| |||||||||
Sbjct: 41  acatccttcaaggtgcctcttagc 18



to top

>gb|AC126244.3| Mus musculus BAC clone RP24-319A6 from chromosome 12, complete sequence
          Length = 175549

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 189   aggccttcctggcaatctgg 208
             ||||||||||||||||||||
Sbjct: 98933 aggccttcctggcaatctgg 98914



to top

>gb|AC114824.5| Mus musculus BAC clone RP23-342J11 from chromosome 17, complete sequence
          Length = 216044

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 15     gaaaaatattccaaaacaca 34
              ||||||||||||||||||||
Sbjct: 204762 gaaaaatattccaaaacaca 204743



to top

>gb|AC123063.4| Mus musculus BAC clone RP23-219I20 from 5, complete sequence
          Length = 204795

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 205   ctgggactcagcctccttcttcac 228
             |||| |||||||||||||||||||
Sbjct: 51513 ctggcactcagcctccttcttcac 51490



to top

>emb|AL163281.2|HS21C081 Homo sapiens chromosome 21 segment HS21C081
          Length = 340000

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 618   ccttagtgttcttgaaatga 637
             ||||||||||||||||||||
Sbjct: 46628 ccttagtgttcttgaaatga 46647



to top

>gb|AE016795.2| Vibrio vulnificus CMCP6 chromosome I complete sequence
          Length = 3281944

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 113     attccactcagccaaaccagatgc 136
               ||||||||||||||||||| ||||
Sbjct: 1353301 attccactcagccaaaccatatgc 1353278



to top

>gb|AC129292.4| Mus musculus chromosome 5 clone RP24-507A8, complete sequence
          Length = 186200

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 205    ctgggactcagcctccttcttcac 228
              |||| |||||||||||||||||||
Sbjct: 126406 ctggcactcagcctccttcttcac 126383



to top

>gb|AC067931.16| Homo sapiens chromosome 8, clone RP11-642A1, complete sequence
          Length = 206466

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 16     aaaaatattccaaaacacaa 35
              ||||||||||||||||||||
Sbjct: 165912 aaaaatattccaaaacacaa 165931



to top

>gb|AC108751.10| Homo sapiens 3 BAC RP11-278L15 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 131894

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 210   actcagcctccttcttcacc 229
             ||||||||||||||||||||
Sbjct: 88424 actcagcctccttcttcacc 88405



to top

>ref|NM_001003629.1| Danio rerio zgc:100933 (zgc:100933), mRNA
          Length = 1675

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 251  atcagctcaatgtggcatgg 270
            ||||||||||||||||||||
Sbjct: 1034 atcagctcaatgtggcatgg 1015



to top

>dbj|BA000037.2| Vibrio vulnificus YJ016 DNA, chromosome I, complete sequence
          Length = 3354505

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 113     attccactcagccaaaccagatgc 136
               ||||||||||||||||||| ||||
Sbjct: 3079457 attccactcagccaaaccatatgc 3079480



to top

>gb|AC098685.7| Mus musculus clone ct7-393l21, complete sequence
          Length = 73632

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 620   ttagtgttcttgaaatgaac 639
             ||||||||||||||||||||
Sbjct: 35517 ttagtgttcttgaaatgaac 35536



to top

>dbj|AK135445.1| Mus musculus 12 days embryo female mullerian duct includes
            surrounding region cDNA, RIKEN full-length enriched
            library, clone:6820422B21 product:syntaxin 5A, full
            insert sequence
          Length = 2722

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 112  aattccactcagccaaacca 131
            ||||||||||||||||||||
Sbjct: 1200 aattccactcagccaaacca 1181



to top

>gb|AC108089.2| Homo sapiens chromosome 5 clone CTD-2313B8, complete sequence
          Length = 133225

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 128    accagatgctacaaagtgct 147
              ||||||||||||||||||||
Sbjct: 127666 accagatgctacaaagtgct 127685



to top

>gb|AC022139.5| Homo sapiens chromosome 5 clone CTD-2255L15, complete sequence
          Length = 112978

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 128   accagatgctacaaagtgct 147
             ||||||||||||||||||||
Sbjct: 26901 accagatgctacaaagtgct 26920



to top

>dbj|AK170893.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
            full-length enriched library, clone:F630208A14
            product:syntaxin 5A, full insert sequence
          Length = 3017

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 112  aattccactcagccaaacca 131
            ||||||||||||||||||||
Sbjct: 1495 aattccactcagccaaacca 1476



to top

>gb|AC157822.2| Mus musculus BAC clone RP23-392J15 from chromosome 12, complete
             sequence
          Length = 185536

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 189   aggccttcctggcaatctgg 208
             ||||||||||||||||||||
Sbjct: 79561 aggccttcctggcaatctgg 79542



to top

>emb|CR352619.1| Gallus gallus finished cDNA, clone ChEST14e6
          Length = 715

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 362 agagcatccacatcaagacctttcacctcagcattgctct 401
           |||| ||||||||| ||||| || | ||||||||||||||
Sbjct: 452 agagaatccacatcgagacccttaagctcagcattgctct 413



to top

>dbj|BS000162.1| Pan troglodytes chromosome 22 clone:PTB-060F12, map 22, complete
              sequences
          Length = 156288

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 618    ccttagtgttcttgaaatga 637
              ||||||||||||||||||||
Sbjct: 111540 ccttagtgttcttgaaatga 111559



to top

>gb|BC078194.1| Danio rerio zgc:100933, mRNA (cDNA clone MGC:100933 IMAGE:7145844),
            complete cds
          Length = 1675

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 251  atcagctcaatgtggcatgg 270
            ||||||||||||||||||||
Sbjct: 1034 atcagctcaatgtggcatgg 1015



to top

>emb|AL954228.1|CH179K04 Pan troglodytes chromosome 22 BAC CH251-179K04, complete sequence
          Length = 182532

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 618    ccttagtgttcttgaaatga 637
              ||||||||||||||||||||
Sbjct: 129464 ccttagtgttcttgaaatga 129483



to top

>dbj|AP000852.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-851M3, complete
              sequence
          Length = 166277

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 241    ctcagacaagatcagctcaa 260
              ||||||||||||||||||||
Sbjct: 153596 ctcagacaagatcagctcaa 153615



to top

>gb|AF071875.1|AF071875 Gallus gallus homeodomain protein (Tlx-3) mRNA, complete cds
          Length = 1603

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                    
Query: 362  agagcatccacatcaagacctttcacctcagcattgctct 401
            |||| ||||||||| ||||| || | ||||||||||||||
Sbjct: 1319 agagaatccacatcgagacccttgagctcagcattgctct 1280



to top

>emb|AL954380.9| Mouse DNA sequence from clone RP23-156O9 on chromosome 2, complete
             sequence
          Length = 105996

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 160   tggacagatgatgtagagct 179
             ||||||||||||||||||||
Sbjct: 43551 tggacagatgatgtagagct 43570



to top

>emb|AL844180.6| Mouse DNA sequence from clone RP23-403A4 on chromosome 4, complete
              sequence
          Length = 213870

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 620    ttagtgttcttgaaatgaac 639
              ||||||||||||||||||||
Sbjct: 148376 ttagtgttcttgaaatgaac 148395


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,653,783
Number of Sequences: 3902068
Number of extensions: 5653783
Number of successful extensions: 97839
Number of sequences better than 10.0: 160
Number of HSP's better than 10.0 without gapping: 160
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 97349
Number of HSP's gapped (non-prelim): 408
length of query: 643
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 620
effective length of database: 17,143,297,704
effective search space: 10628844576480
effective search space used: 10628844576480
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top