Clone Name	rbags22k10
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|AK121580.1| Oryza sativa (japonica cultivar-group) cDNA clon...	454	e-124
2	gb|BT019314.1| Zea mays clone Contig987.F mRNA sequence	430	e-117
3	gb|AY106208.1| Zea mays PCO085865 mRNA sequence	422	e-115
4	ref|XM_479492.1| Oryza sativa (japonica cultivar-group), mRNA	323	4e-85
5	dbj|AK066329.1| Oryza sativa (japonica cultivar-group) cDNA clon...	323	4e-85
6	dbj|AK061929.1| Oryza sativa (japonica cultivar-group) cDNA clon...	299	6e-78
7	dbj|AK120877.1| Oryza sativa (japonica cultivar-group) cDNA clon...	299	6e-78
8	ref|NM_185271.1| Oryza sativa (japonica cultivar-group), predic...	297	2e-77
9	dbj|AK102810.1| Oryza sativa (japonica cultivar-group) cDNA clon...	283	4e-73
10	gb|BT017364.1| Zea mays clone EL01N0324F01.c mRNA sequence	280	6e-72
11	gb|AY104839.1| Zea mays PCO137857 mRNA sequence	280	6e-72
12	gb|DQ363992.1| Saccharum hybrid cultivar putative 60S ribosomal ...	244	3e-61
13	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	204	3e-49
14	dbj|AP006268.4| Oryza sativa (japonica cultivar-group) genomic D...	204	3e-49
15	dbj|AP004343.2| Oryza sativa (japonica cultivar-group) genomic D...	204	3e-49
16	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	172	9e-40
17	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	172	9e-40
18	gb|AC121491.2| Oryza sativa (japonica cultivar-group) chromosome...	172	9e-40
19	gb|AY846824.1| Triticum aestivum ribosomal protein L18 mRNA, com...	159	1e-35
20	gb|AC087551.3| Oryza sativa (japonica cultivar-group) chromosome...	121	3e-24
21	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	121	3e-24
22	gb|DQ428164.1| Sorghum propinquum locus PRC0147 genomic sequence	103	7e-19
23	gb|DQ428163.1| Sorghum bicolor voucher PI585454 locus PRC0147 ge...	103	7e-19
24	gb|DQ428162.1| Sorghum bicolor voucher PI267539 locus PRC0147 ge...	103	7e-19
25	gb|DQ428161.1| Sorghum bicolor voucher PI267408 locus PRC0147 ge...	103	7e-19
26	gb|DQ428160.1| Sorghum bicolor voucher PI221607 locus PRC0147 ge...	103	7e-19
27	gb|DQ428159.1| Sorghum bicolor voucher PI152702 locus PRC0147 ge...	103	7e-19
28	gb|DQ428158.1| Sorghum bicolor voucher NSL92371 locus PRC0147 ge...	103	7e-19
29	gb|DQ428157.1| Sorghum bicolor voucher NSL87902 locus PRC0147 ge...	103	7e-19
30	gb|DQ428156.1| Sorghum bicolor voucher NSL87666 locus PRC0147 ge...	103	7e-19
31	gb|DQ428155.1| Sorghum bicolor voucher NSL77217 locus PRC0147 ge...	103	7e-19
32	gb|DQ428154.1| Sorghum bicolor voucher NSL77034 locus PRC0147 ge...	103	7e-19
33	gb|DQ428153.1| Sorghum bicolor voucher NSL56174 locus PRC0147 ge...	103	7e-19
34	gb|DQ428152.1| Sorghum bicolor voucher NSL56003 locus PRC0147 ge...	103	7e-19
35	gb|DQ428151.1| Sorghum bicolor voucher NSL55243 locus PRC0147 ge...	103	7e-19
36	gb|DQ428150.1| Sorghum bicolor voucher NSL51365 locus PRC0147 ge...	103	7e-19
37	gb|DQ428149.1| Sorghum bicolor voucher NSL51030 locus PRC0147 ge...	103	7e-19
38	gb|DQ428148.1| Sorghum bicolor voucher NSL50875 locus PRC0147 ge...	103	7e-19
39	gb|DQ428147.1| Sorghum bicolor voucher BTx623 locus PRC0147 geno...	103	7e-19
40	ref|NM_111432.2| Arabidopsis thaliana RPL18 (RIBOSOMAL PROTEIN L...	84	7e-13
41	gb|AC011620.8|ATAC011620 Arabidopsis thaliana chromosome III BAC...	84	7e-13
42	gb|AY037224.1| Arabidopsis thaliana AT3g05590/F18C1_14 mRNA, com...	84	7e-13
43	emb|BX823193.1|CNS0A5VT Arabidopsis thaliana Full-length cDNA Co...	84	7e-13
44	emb|BX822829.1|CNS0A4S7 Arabidopsis thaliana Full-length cDNA Co...	84	7e-13
45	gb|U15741.1|ATU15741 Arabidopsis thaliana cytoplasmic ribosomal ...	84	7e-13
46	gb|AY060533.1| Arabidopsis thaliana AT3g05590/F18C1_14 mRNA, com...	82	3e-12
47	gb|BT013100.1| Lycopersicon esculentum clone 114386R, mRNA sequence	78	4e-11
48	emb|CR734138.2|CNS0GT8P Tetraodon nigroviridis full-length cDNA	78	4e-11
49	emb|CR712214.2|CNS0GCHU Tetraodon nigroviridis full-length cDNA	78	4e-11
50	emb|CR727240.2|CNS0GO32 Tetraodon nigroviridis full-length cDNA	78	4e-11
51	emb|CR722346.2|CNS0GKB4 Tetraodon nigroviridis full-length cDNA	78	4e-11
52	emb|CR722203.2|CNS0GK75 Tetraodon nigroviridis full-length cDNA	78	4e-11
53	emb|CR720412.2|CNS0GITE Tetraodon nigroviridis full-length cDNA	78	4e-11
54	emb|CR718786.2|CNS0GHK8 Tetraodon nigroviridis full-length cDNA	78	4e-11
55	emb|CR718640.2|CNS0GHG6 Tetraodon nigroviridis full-length cDNA	78	4e-11
56	emb|CR718477.2|CNS0GHBN Tetraodon nigroviridis full-length cDNA	78	4e-11
57	emb|CR718216.2|CNS0GH4E Tetraodon nigroviridis full-length cDNA	78	4e-11
58	emb|CR716822.2|CNS0GG1R Tetraodon nigroviridis full-length cDNA	78	4e-11
59	emb|CR716557.2|CNS0GFUE Tetraodon nigroviridis full-length cDNA	78	4e-11
60	emb|CR716126.2|CNS0GFII Tetraodon nigroviridis full-length cDNA	78	4e-11
61	emb|CR715708.2|CNS0GF6W Tetraodon nigroviridis full-length cDNA	78	4e-11
62	emb|CR713867.2|CNS0GDRR Tetraodon nigroviridis full-length cDNA	78	4e-11
63	emb|CR713475.2|CNS0GDGV Tetraodon nigroviridis full-length cDNA	78	4e-11
64	emb|CR713262.2|CNS0GDAY Tetraodon nigroviridis full-length cDNA	78	4e-11
65	emb|CR710045.2|CNS0GATL Tetraodon nigroviridis full-length cDNA	78	4e-11
66	emb|CR709916.2|CNS0GAQ0 Tetraodon nigroviridis full-length cDNA	78	4e-11
67	emb|CR707932.2|CNS0G96W Tetraodon nigroviridis full-length cDNA	78	4e-11
68	emb|CR707373.2|CNS0G8RD Tetraodon nigroviridis full-length cDNA	78	4e-11
69	emb|CR707090.2|CNS0G8JI Tetraodon nigroviridis full-length cDNA	78	4e-11
70	emb|CR706834.2|CNS0G8CE Tetraodon nigroviridis full-length cDNA	78	4e-11
71	emb|CR706311.2|CNS0G7XV Tetraodon nigroviridis full-length cDNA	78	4e-11
72	emb|CR705355.2|CNS0G77B Tetraodon nigroviridis full-length cDNA	78	4e-11
73	emb|CR705285.2|CNS0G75D Tetraodon nigroviridis full-length cDNA	78	4e-11
74	emb|CR705192.2|CNS0G72S Tetraodon nigroviridis full-length cDNA	78	4e-11
75	emb|CR704641.2|CNS0G6NH Tetraodon nigroviridis full-length cDNA	78	4e-11
76	emb|CR701253.2|CNS0G41D Tetraodon nigroviridis full-length cDNA	78	4e-11
77	emb|CR696223.2|CNS0G05N Tetraodon nigroviridis full-length cDNA	78	4e-11
78	emb|CR695482.2|CNS0FZL2 Tetraodon nigroviridis full-length cDNA	78	4e-11
79	emb|CR694940.2|CNS0FZ60 Tetraodon nigroviridis full-length cDNA	78	4e-11
80	emb|CR694036.2|CNS0FYGW Tetraodon nigroviridis full-length cDNA	78	4e-11
81	emb|CR692628.2|CNS0FXDS Tetraodon nigroviridis full-length cDNA	78	4e-11
82	emb|CR690516.2|CNS0FVR4 Tetraodon nigroviridis full-length cDNA	78	4e-11
83	emb|CR688214.2|CNS0FTZ6 Tetraodon nigroviridis full-length cDNA	78	4e-11
84	emb|CR687256.2|CNS0FT8K Tetraodon nigroviridis full-length cDNA	78	4e-11
85	emb|CR686542.2|CNS0FSOQ Tetraodon nigroviridis full-length cDNA	78	4e-11
86	emb|CR679416.2|CNS0FN6S Tetraodon nigroviridis full-length cDNA	78	4e-11
87	emb|CR677668.2|CNS0FLUL Tetraodon nigroviridis full-length cDNA	78	4e-11
88	emb|CR676604.2|CNS0FL14 Tetraodon nigroviridis full-length cDNA	78	4e-11
89	emb|CR674481.2|CNS0FJEF Tetraodon nigroviridis full-length cDNA	78	4e-11
90	emb|CR672907.2|CNS0FI6P Tetraodon nigroviridis full-length cDNA	78	4e-11
91	emb|CR668215.2|CNS0FEKD Tetraodon nigroviridis full-length cDNA	78	4e-11
92	emb|CR667583.2|CNS0FE2T Tetraodon nigroviridis full-length cDNA	78	4e-11
93	emb|CR666251.2|CNS0FD1T Tetraodon nigroviridis full-length cDNA	78	4e-11
94	emb|CR665491.2|CNS0FCGP Tetraodon nigroviridis full-length cDNA	78	4e-11
95	emb|CR663494.2|CNS0FAX8 Tetraodon nigroviridis full-length cDNA	78	4e-11
96	emb|CR662279.2|CNS0F9ZH Tetraodon nigroviridis full-length cDNA	78	4e-11
97	emb|CR661654.2|CNS0F9I4 Tetraodon nigroviridis full-length cDNA	78	4e-11
98	emb|CR660863.2|CNS0F8W5 Tetraodon nigroviridis full-length cDNA	78	4e-11
99	emb|CR660093.2|CNS0F8AR Tetraodon nigroviridis full-length cDNA	78	4e-11
100	emb|CR650864.2|CNS0F16E Tetraodon nigroviridis full-length cDNA	78	4e-11
101	emb|CR650032.2|CNS0F0JA Tetraodon nigroviridis full-length cDNA	78	4e-11
102	emb|CR650013.2|CNS0F0IR Tetraodon nigroviridis full-length cDNA	78	4e-11
103	emb|CR647600.2|CNS0EYNQ Tetraodon nigroviridis full-length cDNA	78	4e-11
104	emb|CR646130.2|CNS0EXIW Tetraodon nigroviridis full-length cDNA	78	4e-11
105	emb|CR642444.2|CNS0EUOI Tetraodon nigroviridis full-length cDNA	78	4e-11
106	emb|CR642257.2|CNS0EUJB Tetraodon nigroviridis full-length cDNA	78	4e-11
107	emb|CR640900.2|CNS0ETHM Tetraodon nigroviridis full-length cDNA	78	4e-11
108	emb|CR635790.2|CNS0EPJO Tetraodon nigroviridis full-length cDNA	78	4e-11
109	gb|AF240375.1|AF240375 Oreochromis niloticus clone tiL18b riboso...	78	4e-11
110	gb|AF240374.1|AF240374 Oreochromis niloticus clone tiL18a riboso...	78	4e-11
111	emb|CR734840.2|CNS0GTS7 Tetraodon nigroviridis full-length cDNA	74	6e-10
112	emb|CR734324.2|CNS0GTDV Tetraodon nigroviridis full-length cDNA	74	6e-10
113	emb|CR710888.2|CNS0GBH0 Tetraodon nigroviridis full-length cDNA	74	6e-10
114	emb|CR700146.2|CNS0G36M Tetraodon nigroviridis full-length cDNA	74	6e-10
115	emb|CR672842.2|CNS0FI4W Tetraodon nigroviridis full-length cDNA	74	6e-10
116	gb|BC084727.1| Rattus norvegicus ribosomal protein L18, mRNA (cD...	70	1e-08
117	emb|CR722630.2|CNS0GKJ0 Tetraodon nigroviridis full-length cDNA	70	1e-08
118	emb|CR710189.2|CNS0GAXL Tetraodon nigroviridis full-length cDNA	70	1e-08
119	emb|CR707928.2|CNS0G96S Tetraodon nigroviridis full-length cDNA	70	1e-08
120	emb|CR704690.2|CNS0G6OU Tetraodon nigroviridis full-length cDNA	70	1e-08
121	emb|CR659514.2|CNS0F7UO Tetraodon nigroviridis full-length cDNA	70	1e-08
122	emb|CR634249.2|CNS0EOCV Tetraodon nigroviridis full-length cDNA	70	1e-08
123	ref|NM_031102.1| Rattus norvegicus ribosomal protein L18 (Rpl18)...	70	1e-08
124	gb|M20156.1|RATRPL18A Rat ribosomal protein L18 mRNA, complete cds	70	1e-08
125	gb|BC076332.1| Danio rerio zgc:92872, mRNA (cDNA clone MGC:92872...	68	4e-08
126	ref|NM_001003432.1| Danio rerio zgc:92872 (zgc:92872), mRNA	68	4e-08
127	emb|BX822675.1|CNS0A7MK Arabidopsis thaliana Full-length cDNA Co...	68	4e-08
128	gb|AY190744.1| Pagrus major ribosomal protein L18 mRNA, partial cds	66	2e-07
129	emb|CR643404.2|CNS0EVF6 Tetraodon nigroviridis full-length cDNA	66	2e-07
130	emb|AJ004961.1|CAA004961 Cicer arietinum mRNA for cytoplasmic ri...	66	2e-07
131	ref|XM_512797.1| PREDICTED: Pan troglodytes similar to ribosomal...	64	6e-07
132	emb|AJ306691.1|SSA306691 Salmo salar partial mRNA for L18 riboso...	64	6e-07
133	ref|XM_527867.1| PREDICTED: Pan troglodytes similar to ribosomal...	62	2e-06
134	gb|AC074085.7| Homo sapiens BAC clone RP11-3L10 from 7, complete...	62	2e-06
135	ref|XM_374646.3| PREDICTED: Homo sapiens similar to ribosomal pr...	62	2e-06
136	ref|XM_937605.1| PREDICTED: Homo sapiens similar to ribosomal pr...	62	2e-06
137	ref|XM_069734.4| PREDICTED: Homo sapiens similar to ribosomal pr...	62	2e-06
138	dbj|AB169565.1| Macaca fascicularis brain cDNA, clone: QflA-1395...	62	2e-06
139	dbj|AK174004.1| Ciona intestinalis cDNA, clone:ciad012g12, full ...	62	2e-06
140	dbj|AK110540.1| Oryza sativa (japonica cultivar-group) cDNA clon...	62	2e-06
141	ref|NM_000979.2| Homo sapiens ribosomal protein L18 (RPL18), mRNA	56	2e-04
142	gb|AY389963.1| Gallus gallus ribosomal protein L18 mRNA, partial...	56	2e-04
143	gb|BC000374.2| Homo sapiens ribosomal protein L18, mRNA (cDNA cl...	56	2e-04
144	gb|DQ489378.1| Homo sapiens heat shock 70kDa protein 2 (HSPA2) g...	56	2e-04
145	gb|BC051359.1| Homo sapiens cDNA clone IMAGE:6646239, **** WARNI...	56	2e-04
146	gb|BC021743.2| Homo sapiens ribosomal protein L18, mRNA (cDNA cl...	56	2e-04
147	emb|CR626510.1| full-length cDNA clone CS0DK008YC06 of HeLa cell...	56	2e-04
148	emb|CR623252.1| full-length cDNA clone CS0DI028YB06 of Placenta ...	56	2e-04
149	emb|CR622915.1| full-length cDNA clone CS0DI003YD02 of Placenta ...	56	2e-04
150	emb|CR614681.1| full-length cDNA clone CS0DD008YG13 of Neuroblas...	56	2e-04
151	emb|CR609223.1| full-length cDNA clone CS0DM004YL12 of Fetal liv...	56	2e-04
152	emb|CR608718.1| full-length cDNA clone CS0DM014YN06 of Fetal liv...	56	2e-04
153	emb|CR602585.1| full-length cDNA clone CS0DD002YH22 of Neuroblas...	56	2e-04
154	emb|CR601070.1| full-length cDNA clone CS0DC010YK01 of Neuroblas...	56	2e-04
155	emb|CR600364.1| full-length cDNA clone CS0DI084YG06 of Placenta ...	56	2e-04
156	emb|CR600341.1| full-length cDNA clone CS0DJ007YF01 of T cells (...	56	2e-04
157	emb|CR598496.1| full-length cDNA clone CS0DF016YB08 of Fetal bra...	56	2e-04
158	emb|CR597869.1| full-length cDNA clone CS0DI006YF05 of Placenta ...	56	2e-04
159	emb|CR591878.1| full-length cDNA clone CS0DB002YN19 of Neuroblas...	56	2e-04
160	emb|CR591552.1| full-length cDNA clone CS0DL006YH09 of B cells (...	56	2e-04
161	emb|CR590122.1| full-length cDNA clone CS0DI081YM04 of Placenta ...	56	2e-04
162	emb|BX933065.2| Gallus gallus finished cDNA, clone ChEST914g7	56	2e-04
163	emb|BX932992.2| Gallus gallus finished cDNA, clone ChEST1005i18	56	2e-04
164	dbj|AK026558.1| Homo sapiens cDNA: FLJ22905 fis, clone KAT05654,...	56	2e-04
165	gb|BC009708.2| Homo sapiens ribosomal protein L18, mRNA (cDNA cl...	56	2e-04
166	emb|AL049869.6|CNS0000P Human chromosome 14 DNA sequence BAC R-9...	56	2e-04
167	gb|AY610456.1| Sus scrofa clone rmed27c_g16.y1.abd, mRNA sequence	56	2e-04
168	gb|L11566.1|HUMRPL18A Homo sapiens ribosomal protein L18 (RPL18)...	56	2e-04
169	ref|NM_130325.1| Arabidopsis thaliana structural constituent of ...	54	6e-04
170	gb|AC009517.6| Homo sapiens chromosome 7 clone RP11-181K7, compl...	54	6e-04
171	emb|AL591143.11| Mouse DNA sequence from clone RP23-210L24 on ch...	54	6e-04
172	gb|AY389931.1| Latimeria chalumnae ribosomal protein L18-like mR...	52	0.002
173	emb|AJ563457.1|CGI563457 Crassostrea gigas partial mRNA for ribo...	52	0.002
174	gb|AC124505.4| Mus musculus BAC clone RP23-421P23 from 7, comple...	52	0.002
175	gb|AY486772.1| Hevea brasiliensis clone gHbCIRT2617 microsatelli...	50	0.009
176	gb|AC128270.3| Rattus norvegicus 12 BAC CH230-48A22 (Children's ...	50	0.009
177	gb|AC116573.7| Mus musculus BAC clone RP23-114E15 from chromosom...	50	0.009
178	gb|BC072558.1| Mus musculus ribosomal protein L18, mRNA (cDNA cl...	50	0.009
179	ref|NM_009077.2| Mus musculus ribosomal protein L18 (Rpl18), mRNA	50	0.009
180	ref|NM_001015556.2| Bos taurus ribosomal protein L18 (RPL18), mRNA	50	0.009
181	ref|XM_001002512.1| PREDICTED: Mus musculus similar to 60S ribos...	50	0.009
182	dbj|AK149813.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	50	0.009
183	dbj|AK151667.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	50	0.009
184	gb|BC104507.1| Bos taurus ribosomal protein L18, mRNA (cDNA clon...	50	0.009
185	dbj|AK145649.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f...	50	0.009
186	dbj|AK166803.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f...	50	0.009
187	dbj|AK153172.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	50	0.009
188	dbj|AK169659.1| Mus musculus 2 days neonate thymus thymic cells ...	50	0.009
189	dbj|AK168288.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length...	50	0.009
190	dbj|AK010510.1| Mus musculus ES cells cDNA, RIKEN full-length en...	50	0.009
191	dbj|AK009044.1| Mus musculus adult male tongue cDNA, RIKEN full-...	50	0.009
192	dbj|AK012580.1| Mus musculus 11 days embryo whole body cDNA, RIK...	50	0.009
193	dbj|AK007263.1| Mus musculus adult male testis cDNA, RIKEN full-...	50	0.009
194	gb|BC090154.1| Xenopus laevis cDNA clone MGC:98504 IMAGE:7198701...	50	0.009
195	gb|BC090155.1| Xenopus laevis cDNA clone MGC:98507 IMAGE:7198715...	50	0.009
196	gb|BC091732.1| Mus musculus ribosomal protein L18, mRNA (cDNA cl...	50	0.009
197	emb|AL732452.5| Mouse DNA sequence from clone RP23-177C20 on chr...	50	0.009
198	gb|BT021047.1| Bos taurus ribosomal protein L18 (RPL18), mRNA, c...	50	0.009
199	gb|BC082290.1| Mus musculus ribosomal protein L18, mRNA (cDNA cl...	50	0.009
200	gb|BC081468.1| Mus musculus ribosomal protein L18, mRNA (cDNA cl...	50	0.009
201	ref|NG_005371.1| Mus musculus ribosomal protein L18 pseudogene (...	50	0.009
202	gb|DQ160027.1| Taraxacum officinale TO23-2rc (To23-2rc) mRNA, pa...	48	0.037
203	gb|AF240376.1|AF240376 Tilapia mossambica ribosomal protein L18 ...	48	0.037
204	gb|AC010528.8|AC010528 Homo sapiens chromosome 16 clone RP11-150...	48	0.037
205	ref|NM_070254.2| Caenorhabditis elegans Ribosomal Protein, Large...	48	0.037
206	gb|AC011194.15|AC011194 Mus musculus chromosome 11, clone RP23-1...	48	0.037
207	gb|AY205233.1| Medicago sativa 60S ribosomal protein mRNA, parti...	48	0.037
208	gb|AC009046.4|AC009046 Homo sapiens chromosome 16 clone RP11-200...	48	0.037
209	emb|AL021492.1|CEY45F10D Caenorhabditis elegans YAC Y45F10D, com...	48	0.037
210	emb|AL645478.15| Mouse DNA sequence from clone RP23-85A17 on chr...	48	0.037
211	gb|DQ213610.1| Taeniopygia guttata clone 0058P0027B10 ribosomal ...	46	0.14
212	ref|XM_537965.2| PREDICTED: Canis familiaris similar to ribosoma...	46	0.14
213	gb|AF481060.1| Aplysia californica 60S ribosomal protein L18 mRN...	46	0.14
214	ref|XM_541138.2| PREDICTED: Canis familiaris similar to ribosoma...	46	0.14
215	gb|AF159901.1|AF159901 Lapemis hardwickii ribosomal protein L14 ...	46	0.14
216	dbj|AK221052.1| Arabidopsis thaliana mRNA for hypothetical prote...	46	0.14
217	gb|AC007207.22| Homo sapiens 12 BAC RP11-320N7 (Roswell Park Can...	46	0.14
218	ref|NM_122667.2| Arabidopsis thaliana structural constituent of ...	44	0.57
219	ref|XM_533629.2| PREDICTED: Canis familiaris similar to ribosoma...	44	0.57
220	gb|BT000711.1| Arabidopsis thaliana clone RAFL09-17-C05 (R09425)...	44	0.57
221	gb|AY122996.1| Arabidopsis thaliana putative 60S ribosomal prote...	44	0.57
222	gb|AY056141.1| Arabidopsis thaliana putative 60S ribosomal prote...	44	0.57
223	gb|AC022748.10| Homo sapiens chromosome 15, clone RP11-160C18, c...	44	0.57
224	gb|AC136191.5| Rattus norvegicus BAC CH230-52I17 (Children's Ho...	44	0.57
225	gb|DQ066324.1| Ixodes scapularis isolate IS-6-12L-136 ribosomal ...	44	0.57
226	emb|BX832577.1|CNS0A1WZ Arabidopsis thaliana Full-length cDNA Co...	44	0.57
227	gb|AC067863.19| Homo sapiens chromosome 15, clone RP11-335K5, co...	44	0.57
228	gb|AC007399.1|AC007399 Arabidopsis thaliana BAC F14I23 from chro...	44	0.57
229	gb|AC166939.2| Mus musculus BAC clone RP23-72K19 from chromosome...	42	2.3
230	emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ...	42	2.3
231	gb|AC122890.4| Mus musculus BAC clone RP23-63O14 from 8, complet...	42	2.3
232	emb|AL162382.13| Human DNA sequence from clone RP11-248J2 on chr...	42	2.3
233	ref|XM_787988.1| PREDICTED: Strongylocentrotus purpuratus simila...	42	2.3
234	gb|AE011634.1| Xanthomonas axonopodis pv. citri str. 306, secti...	42	2.3
235	gb|AC023781.5| Homo sapiens chromosome 8, clone RP11-149P24, com...	42	2.3
236	dbj|AB180448.1| Plutella xylostella mRNA for Ribosomal protein L...	42	2.3
237	gb|L41708.1|PS300427E Eucalyptus globulus bicostata symbiont (F0...	42	2.3
238	ref|XM_367270.1| Magnaporthe grisea 70-15 hypothetical protein (...	40	8.9
239	gb|BC037592.1| Mus musculus sphingosine-1-phosphate phosphatase ...	40	8.9
240	gb|AC184800.2| Pan troglodytes chromosome X clone PTB-18K16 map ...	40	8.9
241	ref|NM_030750.2| Mus musculus sphingosine-1-phosphate phosphatas...	40	8.9
242	ref|XM_452443.1| Kluyveromyces lactis NRRL Y-1140, KLLA0C05478g ...	40	8.9
243	gb|AC163608.2| Mus musculus chromosome 1, clone RP24-185M14, com...	40	8.9
244	emb|BX927325.15| Zebrafish DNA sequence from clone DKEYP-47G1 in...	40	8.9
245	ref|XM_818117.1| Trypanosoma brucei TREU927 60S ribosomal protei...	40	8.9
246	ref|XM_742113.1| Aspergillus fumigatus Af293 U5 snRNP component ...	40	8.9
247	ref|XM_800023.1| Trypanosoma cruzi strain CL Brener 60S ribosoma...	40	8.9
248	ref|XM_808753.1| Trypanosoma cruzi strain CL Brener 60S ribosoma...	40	8.9
249	gb|AC124363.3| Mus musculus BAC clone RP24-531A9 from chromosome...	40	8.9
250	gb|AC122033.5| Mus musculus BAC clone RP24-403A7 from chromosome...	40	8.9
251	ref|XM_814733.1| Trypanosoma cruzi strain CL Brener 60S ribosoma...	40	8.9
252	gb|AC101994.3| Mus musculus chromosome 1, clone RP24-406F14, com...	40	8.9
253	emb|AL360011.19| Human DNA sequence from clone RP11-103A2 on chr...	40	8.9
254	emb|AL022578.1|HS393P12 Human DNA sequence from clone RP3-393P12...	40	8.9
255	emb|CR382123.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso...	40	8.9
256	emb|AL645799.5| Mouse DNA sequence from clone RP23-459O24 on chr...	40	8.9
257	gb|AC159897.2| Mus musculus BAC clone RP23-191E14 from chromosom...	40	8.9
258	emb|X84413.1|DYAN3B12 D.yakuba anon-3B1.2 gene	40	8.9
259	gb|AC010115.6| Drosophila melanogaster 3L BAC RP98-16I16 (Roswel...	40	8.9
260	gb|AY113554.1| Drosophila melanogaster RH01814 full insert cDNA	40	8.9
261	ref|NM_139834.2| Drosophila melanogaster Ribosomal protein L18 C...	40	8.9
262	dbj|AK149860.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	40	8.9
263	gb|DQ376040.1| Podarcis sicula cryptochrome 1 (CRY1) mRNA, compl...	40	8.9
264	gb|AC111120.12| Mus musculus chromosome 7, clone RP23-225M4, com...	40	8.9
265	gb|AF415215.1|AF415215 Mus musculus sphingosine-1-phosphate phos...	40	8.9
266	emb|BX530057.5| Zebrafish DNA sequence from clone DKEY-48O24 in ...	40	8.9
267	gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete g...	40	8.9
268	dbj|AK043586.1| Mus musculus 10 days neonate cortex cDNA, RIKEN ...	40	8.9
269	gb|AC116984.2| Dictyostelium discoideum chromosome 2 map 2567470...	40	8.9
270	gb|AY130355.1| Myxine glutinosa ribosomal protein L18 mRNA, part...	40	8.9
271	gb|AF401572.1| Ictalurus punctatus ribosomal protein L18 mRNA, c...	40	8.9
272	ref|XM_578444.1| PREDICTED: Rattus norvegicus similar to Ab2-162...	40	8.9
273	gb|AC131206.2| Homo sapiens 12 BAC RP11-157G21 (Roswell Park Can...	40	8.9
274	gb|AF247177.1|AF247177 Mus musculus sphingosine-1-phosphate phos...	40	8.9
275	emb|BX294656.8| Zebrafish DNA sequence from clone CH211-238M13, ...	40	8.9
276	gb|AC115850.11| Mus musculus chromosome 7, clone RP24-252O10, co...	40	8.9
277	emb|BX323595.8| Zebrafish DNA sequence from clone CH211-155O21 i...	40	8.9
278	gb|AE003559.3| Drosophila melanogaster chromosome 3L, section 26...	40	8.9
279	gb|BC026814.1| Mus musculus cDNA clone IMAGE:4458667, containing...	40	8.9
280	emb|CT009609.1| Desulfococcus multivorans vrl island	40	8.9
281	gb|AC004107.1|AC004107 Human Cosmid g1248a010 from 7q31.3, compl...	40	8.9
282	emb|AJ509090.1|HSA509090 Homo sapiens WASF4 gene for Wiskott-Ald...	40	8.9

---

>dbj|AK121580.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033037B18, full
           insert sequence
          Length = 769

 Score =  454 bits (229), Expect = e-124
 Identities = 413/473 (87%), Gaps = 1/473 (0%)
 Strand = Plus / Minus

                                                                       
Query: 181 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 240
           |||| |||||||||||  ||||||||||||||||||| |||||||| || ||||| ||||
Sbjct: 608 cttagaccttgaagcctttgctgttcctccttcctctcgccttctcaaacttccttccct 549

                                                                       
Query: 241 tggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcc 300
           | ||||| || || |||||||||| ||||||||||||||| |||||    ||||||||| 
Sbjct: 548 ttgagcgcacgtaaggcttggtgttgctgtgtggcactccaggagcaggaccaaagtgct 489

                                                                       
Query: 301 taacagcttccctggcgttcttgggacccctcaggagaagcgtgttctgtccaagcggag 360
           | || ||||||||||||||||| |||||||||||||||| ||||||||| || || ||||
Sbjct: 488 tcactgcttccctggcgttcttaggacccctcaggagaaccgtgttctggcccagaggag 429

                                                                       
Query: 361 cacggagggcgagctggtcaaaggtaaggcactcgccaccagcgttgacaatcctggccc 420
           | ||||| || ||||| || |||||||||||||| |||||||  || ||||| |  ||||
Sbjct: 428 cgcggagcgccagctgatcgaaggtaaggcactctccaccagtattcacaatgcgagccc 369

                                                                       
Query: 421 tcgccgtctcggtgaacctgagcgcggccaccttcattgccggtatctcgtagaccctct 480
           |||| |||||||||||||||||||||||||||||||| ||||| | ||||||||||||||
Sbjct: 368 tcgcggtctcggtgaacctgagcgcggccaccttcatcgccggcacctcgtagaccctct 309

                                                                       
Query: 481 ggtcatcggtgatggtgcccacgatcacagcgatcttgtccgccttcccatccatgaacc 540
            ||| ||||| | ||||||||||||||| ||||||| || | |||| || |||| |||||
Sbjct: 308 tgtcgtcggtaacggtgcccacgatcacggcgatctggttctccttgccctccacgaacc 249

                                                                       
Query: 541 tgacgaggcggcgcatcgagagcggcggccggtttgtcttgctcatgaagagccgcttca 600
           ||||||||||||| | |||||||||||| ||||| ||||||||||||||||||||| |||
Sbjct: 248 tgacgaggcggcggagcgagagcggcgggcggttggtcttgctcatgaagagccgcctca 189

                                                                
Query: 601 ggatcaccggcgttgaactggctcttggtcctccgcaccaggaagcggtagag 653
           |||||| ||||||||||  ||||||||||||||||||||||||||||||||||
Sbjct: 188 ggatca-cggcgttgaaggggctcttggtcctccgcaccaggaagcggtagag 137

---

>gb|BT019314.1| Zea mays clone Contig987.F mRNA sequence
          Length = 786

 Score =  430 bits (217), Expect = e-117
 Identities = 410/473 (86%), Gaps = 1/473 (0%)
 Strand = Plus / Plus

                                                                       
Query: 181 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 240
           |||| |||||||||||||||||||||||||||||||| |||||||| || ||||| ||||
Sbjct: 185 cttagaccttgaagcccctgctgttcctccttcctctcgccttctcaaacttcctaccct 244

                                                                       
Query: 241 tggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcc 300
           | ||||| ||||| ||||||||||||||||| ||||||||||| ||    || |||||||
Sbjct: 245 tcgagcgaacataaggcttggtgtggctgtgaggcactcctggtgcaggcccgaagtgcc 304

                                                                       
Query: 301 taacagcttccctggcgttcttgggacccctcaggagaagcgtgttctgtccaagcggag 360
           | ||||||||||| |||||||| ||||||||||| |||| |||||| || |||||||| |
Sbjct: 305 tgacagcttccctagcgttcttaggacccctcagcagaaccgtgttttgcccaagcgggg 364

                                                                       
Query: 361 cacggagggcgagctggtcaaaggtaaggcactcgccaccagcgttgacaatcctggccc 420
           ||||||| ||||||||||| ||||| |||||||| || ||||| ||||  ||||||||||
Sbjct: 365 cacggagcgcgagctggtcgaaggtgaggcactctccgccagcattgatgatcctggccc 424

                                                                       
Query: 421 tcgccgtctcggtgaacctgagcgcggccaccttcattgccggtatctcgtagaccctct 480
           |||| ||||| |||||||||||||||   |||||||| ||||| | ||||  || |||||
Sbjct: 425 tcgctgtctcagtgaacctgagcgcgcagaccttcatcgccggcacctcgctgatcctct 484

                                                                       
Query: 481 ggtcatcggtgatggtgcccacgatcacagcgatcttgtccgccttcccatccatgaacc 540
            ||| ||||| | ||||||||| ||||| |||||||  ||  ||||||| ||||||||||
Sbjct: 485 tgtcgtcggtcacggtgcccacaatcacggcgatctgatcacccttcccctccatgaacc 544

                                                                       
Query: 541 tgacgaggcggcgcatcgagagcggcggccggtttgtcttgctcatgaagagccgcttca 600
           |||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||| |
Sbjct: 545 tgacgaggcggcgcatcgagagcggcgggcggttggtcttgctcatgaagaggcgcttga 604

                                                                
Query: 601 ggatcaccggcgttgaactggctcttggtcctccgcaccaggaagcggtagag 653
           |||||| |||||||||| | |||||| ||||| ||||| ||||||||||||||
Sbjct: 605 ggatca-cggcgttgaagttgctctttgtcctgcgcacaaggaagcggtagag 656

---

>gb|AY106208.1| Zea mays PCO085865 mRNA sequence
          Length = 1008

 Score =  422 bits (213), Expect = e-115
 Identities = 409/473 (86%), Gaps = 1/473 (0%)
 Strand = Plus / Minus

                                                                       
Query: 181 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 240
           |||| |||||||||||||||||||||||||||||||| |||||||| || ||||| ||||
Sbjct: 613 cttagaccttgaagcccctgctgttcctccttcctctcgccttctcaaacttcctaccct 554

                                                                       
Query: 241 tggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcc 300
           | ||||| ||||| ||||||||||||||||| ||||||||||| ||    || |||||||
Sbjct: 553 tcgagcgaacataaggcttggtgtggctgtgaggcactcctggtgcaggcccgaagtgcc 494

                                                                       
Query: 301 taacagcttccctggcgttcttgggacccctcaggagaagcgtgttctgtccaagcggag 360
           | ||||||||||| |||||||| ||||||||||| |||| |||||| || ||||| || |
Sbjct: 493 tgacagcttccctagcgttcttaggacccctcagcagaaccgtgttttgcccaagtgggg 434

                                                                       
Query: 361 cacggagggcgagctggtcaaaggtaaggcactcgccaccagcgttgacaatcctggccc 420
           ||||||| ||||||||||| ||||| |||||||| || ||||| ||||  ||||||||||
Sbjct: 433 cacggagcgcgagctggtcgaaggtgaggcactctccgccagcattgatgatcctggccc 374

                                                                       
Query: 421 tcgccgtctcggtgaacctgagcgcggccaccttcattgccggtatctcgtagaccctct 480
           |||| ||||| |||||||||||||||   |||||||| ||||| | ||||  || |||||
Sbjct: 373 tcgctgtctcagtgaacctgagcgcgcagaccttcatcgccggcacctcgctgatcctct 314

                                                                       
Query: 481 ggtcatcggtgatggtgcccacgatcacagcgatcttgtccgccttcccatccatgaacc 540
            ||| ||||| | ||||||||| ||||| |||||||  ||  ||||||| ||||||||||
Sbjct: 313 tgtcgtcggtcacggtgcccacaatcacggcgatctgatcacccttcccctccatgaacc 254

                                                                       
Query: 541 tgacgaggcggcgcatcgagagcggcggccggtttgtcttgctcatgaagagccgcttca 600
           |||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||| |
Sbjct: 253 tgacgaggcggcgcatcgagagcggcgggcggttggtcttgctcatgaagaggcgcttga 194

                                                                
Query: 601 ggatcaccggcgttgaactggctcttggtcctccgcaccaggaagcggtagag 653
           |||||| |||||||||| | |||||| ||||| ||||| ||||||||||||||
Sbjct: 193 ggatca-cggcgttgaagttgctctttgtcctgcgcacaaggaagcggtagag 142

---

>ref|XM_479492.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 850

 Score =  323 bits (163), Expect = 4e-85
 Identities = 301/347 (86%)
 Strand = Plus / Minus

                                                                       
Query: 175 ccacagcttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcc 234
           ||||| |||| |||||||||||| |||||||||| ||||||||||||||||| |||||||
Sbjct: 626 ccacaacttataccttgaagcccttgctgttccttcttcctcttgccttctcaaatttcc 567

                                                                       
Query: 235 tgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaa 294
           | ||||| ||||| ||||||||||| |||| |||||| || |||||||||||   |||||
Sbjct: 566 ttccctttgagcgaacatatggcttagtgttgctgtggggaactcctggagcagggccaa 507

                                                                       
Query: 295 agtgcctaacagcttccctggcgttcttgggacccctcaggagaagcgtgttctgtccaa 354
           ||||| ||||||||||||| ||||||||||||||||||||||| | ||||||||| ||||
Sbjct: 506 agtgcttaacagcttccctagcgttcttgggacccctcaggaggaccgtgttctggccaa 447

                                                                       
Query: 355 gcggagcacggagggcgagctggtcaaaggtaaggcactcgccaccagcgttgacaatcc 414
           |||| || ||||| ||||||||||| || || |||||||||||||| || ||||  ||||
Sbjct: 446 gcggggcgcggagagcgagctggtcgaacgtgaggcactcgccaccggcattgatgatcc 387

                                                                       
Query: 415 tggccctcgccgtctcggtgaacctgagcgcggccaccttcattgccggtatctcgtaga 474
             || ||||| ||||||||||||||||| || ||||||||||| ||||| | ||| ||||
Sbjct: 386 gtgctctcgcggtctcggtgaacctgagagcagccaccttcatcgccggcacctcataga 327

                                                          
Query: 475 ccctctggtcatcggtgatggtgcccacgatcacagcgatcttgtcc 521
            ||||| |||||| |||| ||||||||||||||| ||||||| ||||
Sbjct: 326 tcctcttgtcatctgtgacggtgcccacgatcacggcgatctggtcc 280



 Score =  204 bits (103), Expect = 3e-49
 Identities = 125/131 (95%), Gaps = 1/131 (0%)
 Strand = Plus / Minus

                                                                       
Query: 523 ccttcccatccatgaacctgacgaggcggcgcatcgagagcggcggccggtttgtcttgc 582
           ||||||| ||||||||||||||||| |||||||||||||||||||| ||||| |||||||
Sbjct: 254 ccttcccctccatgaacctgacgagacggcgcatcgagagcggcgggcggttggtcttgc 195

                                                                       
Query: 583 tcatgaagagccgcttcaggatcaccggcgttgaactggctcttggtcctccgcaccagg 642
           |||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 194 tcatgaagagccgcttcaggatca-cggcgttgaagtggctcttggtcctccgcaccagg 136

                      
Query: 643 aagcggtagag 653
           |||||||||||
Sbjct: 135 aagcggtagag 125

---

>dbj|AK066329.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013060D13, full
           insert sequence
          Length = 850

 Score =  323 bits (163), Expect = 4e-85
 Identities = 301/347 (86%)
 Strand = Plus / Minus

                                                                       
Query: 175 ccacagcttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcc 234
           ||||| |||| |||||||||||| |||||||||| ||||||||||||||||| |||||||
Sbjct: 626 ccacaacttataccttgaagcccttgctgttccttcttcctcttgccttctcaaatttcc 567

                                                                       
Query: 235 tgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaa 294
           | ||||| ||||| ||||||||||| |||| |||||| || |||||||||||   |||||
Sbjct: 566 ttccctttgagcgaacatatggcttagtgttgctgtggggaactcctggagcagggccaa 507

                                                                       
Query: 295 agtgcctaacagcttccctggcgttcttgggacccctcaggagaagcgtgttctgtccaa 354
           ||||| ||||||||||||| ||||||||||||||||||||||| | ||||||||| ||||
Sbjct: 506 agtgcttaacagcttccctagcgttcttgggacccctcaggaggaccgtgttctggccaa 447

                                                                       
Query: 355 gcggagcacggagggcgagctggtcaaaggtaaggcactcgccaccagcgttgacaatcc 414
           |||| || ||||| ||||||||||| || || |||||||||||||| || ||||  ||||
Sbjct: 446 gcggggcgcggagagcgagctggtcgaacgtgaggcactcgccaccggcattgatgatcc 387

                                                                       
Query: 415 tggccctcgccgtctcggtgaacctgagcgcggccaccttcattgccggtatctcgtaga 474
             || ||||| ||||||||||||||||| || ||||||||||| ||||| | ||| ||||
Sbjct: 386 gtgctctcgcggtctcggtgaacctgagagcagccaccttcatcgccggcacctcataga 327

                                                          
Query: 475 ccctctggtcatcggtgatggtgcccacgatcacagcgatcttgtcc 521
            ||||| |||||| |||| ||||||||||||||| ||||||| ||||
Sbjct: 326 tcctcttgtcatctgtgacggtgcccacgatcacggcgatctggtcc 280



 Score =  204 bits (103), Expect = 3e-49
 Identities = 125/131 (95%), Gaps = 1/131 (0%)
 Strand = Plus / Minus

                                                                       
Query: 523 ccttcccatccatgaacctgacgaggcggcgcatcgagagcggcggccggtttgtcttgc 582
           ||||||| ||||||||||||||||| |||||||||||||||||||| ||||| |||||||
Sbjct: 254 ccttcccctccatgaacctgacgagacggcgcatcgagagcggcgggcggttggtcttgc 195

                                                                       
Query: 583 tcatgaagagccgcttcaggatcaccggcgttgaactggctcttggtcctccgcaccagg 642
           |||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 194 tcatgaagagccgcttcaggatca-cggcgttgaagtggctcttggtcctccgcaccagg 136

                      
Query: 643 aagcggtagag 653
           |||||||||||
Sbjct: 135 aagcggtagag 125

---

>dbj|AK061929.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-C09, full
           insert sequence
          Length = 839

 Score =  299 bits (151), Expect = 6e-78
 Identities = 394/473 (83%), Gaps = 4/473 (0%)
 Strand = Plus / Minus

                                                                       
Query: 181 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 240
           |||| |||||||| || | |||||||||||| || |  ||||||||||| ||||| ||||
Sbjct: 631 cttagaccttgaatccacggctgttcctcctgccacgggccttctcgaacttccttccct 572

                                                                       
Query: 241 tggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcc 300
           ||||||| ||||||||||| ||||||||||| ||||| || ||||| || ||||||||||
Sbjct: 571 tggagcgcacatatggcttcgtgtggctgtgcggcacaccaggagccttaccaaagtgcc 512

                                                                       
Query: 301 taacagcttccctggcgttcttgggacccctcaggagaagcgtgttctgtccaagcggag 360
           | || || || | ||| |||||||||||||||| ||| | ||||||||  ||||||||||
Sbjct: 511 tgacggcctcacgggcattcttgggacccctcaagaggaccgtgttctccccaagcggag 452

                                                                       
Query: 361 cacggagggcgagctggtcaaaggtaaggcactcgccaccagcgttgacaatcctggccc 420
           ||||||| || |||||||| ||||| ||||||||||| ||||| ||||||||||| ||||
Sbjct: 451 cacggagagcaagctggtcgaaggtgaggcactcgccgccagcattgacaatccttgccc 392

                                                                       
Query: 421 tcgccgtctcggtgaacctgagcgcggccaccttcattgccggtatctcgtagaccctct 480
           | |||||||| |||||||| || || |  |||||||||  ||| ||||| | || |||||
Sbjct: 391 tagccgtctccgtgaacctcagggcagtaaccttcattttcggaatctcttggatcctct 332

                                                                       
Query: 481 ggtcatcggtgatggtgcccacgatcacagcgatcttg---tccgccttcccatccatga 537
            |||||| ||||  || || || |||||||| || |||   ||| |||| || |||||||
Sbjct: 331 tgtcatcagtgactgtaccaacaatcacagcaatgttgttctcctccttgccttccatga 272

                                                                       
Query: 538 acctgacgaggcggcgcatcgagagcggcggccggtttgtcttgctcatgaagagccgct 597
           || || ||||||||||||  ||||||||||| ||||| ||||||||||||||||||| ||
Sbjct: 271 acttggcgaggcggcgcagggagagcggcgggcggttggtcttgctcatgaagagcctct 212

                                                                
Query: 598 tcaggatcaccggcgttgaactggctcttggtcctccgcaccaggaagcggta 650
           | ||||||| |||| ||||| |  |||||||| |||| ||||||||| |||||
Sbjct: 211 tgaggatca-cggcattgaagttactcttggttctcctcaccaggaaacggta 160

---

>dbj|AK120877.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023027I12, full
           insert sequence
          Length = 997

 Score =  299 bits (151), Expect = 6e-78
 Identities = 394/473 (83%), Gaps = 4/473 (0%)
 Strand = Plus / Minus

                                                                       
Query: 181 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 240
           |||| |||||||| || | |||||||||||| || |  ||||||||||| ||||| ||||
Sbjct: 632 cttagaccttgaatccacggctgttcctcctgccacgggccttctcgaacttccttccct 573

                                                                       
Query: 241 tggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcc 300
           ||||||| ||||||||||| ||||||||||| ||||| || ||||| || ||||||||||
Sbjct: 572 tggagcgcacatatggcttcgtgtggctgtgcggcacaccaggagccttaccaaagtgcc 513

                                                                       
Query: 301 taacagcttccctggcgttcttgggacccctcaggagaagcgtgttctgtccaagcggag 360
           | || || || | ||| |||||||||||||||| ||| | ||||||||  ||||||||||
Sbjct: 512 tgacggcctcacgggcattcttgggacccctcaagaggaccgtgttctccccaagcggag 453

                                                                       
Query: 361 cacggagggcgagctggtcaaaggtaaggcactcgccaccagcgttgacaatcctggccc 420
           ||||||| || |||||||| ||||| ||||||||||| ||||| ||||||||||| ||||
Sbjct: 452 cacggagagcaagctggtcgaaggtgaggcactcgccgccagcattgacaatccttgccc 393

                                                                       
Query: 421 tcgccgtctcggtgaacctgagcgcggccaccttcattgccggtatctcgtagaccctct 480
           | |||||||| |||||||| || || |  |||||||||  ||| ||||| | || |||||
Sbjct: 392 tagccgtctccgtgaacctcagggcagtaaccttcattttcggaatctcttggatcctct 333

                                                                       
Query: 481 ggtcatcggtgatggtgcccacgatcacagcgatcttg---tccgccttcccatccatga 537
            |||||| ||||  || || || |||||||| || |||   ||| |||| || |||||||
Sbjct: 332 tgtcatcagtgactgtaccaacaatcacagcaatgttgttctcctccttgccttccatga 273

                                                                       
Query: 538 acctgacgaggcggcgcatcgagagcggcggccggtttgtcttgctcatgaagagccgct 597
           || || ||||||||||||  ||||||||||| ||||| ||||||||||||||||||| ||
Sbjct: 272 acttggcgaggcggcgcagggagagcggcgggcggttggtcttgctcatgaagagcctct 213

                                                                
Query: 598 tcaggatcaccggcgttgaactggctcttggtcctccgcaccaggaagcggta 650
           | ||||||| |||| ||||| |  |||||||| |||| ||||||||| |||||
Sbjct: 212 tgaggatca-cggcattgaagttactcttggttctcctcaccaggaaacggta 161

---

>ref|NM_185271.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 567

 Score =  297 bits (150), Expect = 2e-77
 Identities = 390/468 (83%), Gaps = 4/468 (0%)
 Strand = Plus / Minus

                                                                       
Query: 186 accttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgcccttggag 245
           |||||||| || | |||||||||||| || |  ||||||||||| ||||| |||||||||
Sbjct: 563 accttgaatccacggctgttcctcctgccacgggccttctcgaacttccttcccttggag 504

                                                                       
Query: 246 cggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcctaaca 305
           || ||||||||||| ||||||||||| ||||| || ||||| || ||||||||||| || 
Sbjct: 503 cgcacatatggcttcgtgtggctgtgcggcacaccaggagccttaccaaagtgcctgacg 444

                                                                       
Query: 306 gcttccctggcgttcttgggacccctcaggagaagcgtgttctgtccaagcggagcacgg 365
           || || | ||| |||||||||||||||| ||| | ||||||||  |||||||||||||||
Sbjct: 443 gcctcacgggcattcttgggacccctcaagaggaccgtgttctccccaagcggagcacgg 384

                                                                       
Query: 366 agggcgagctggtcaaaggtaaggcactcgccaccagcgttgacaatcctggccctcgcc 425
           || || |||||||| ||||| ||||||||||| ||||| ||||||||||| ||||| |||
Sbjct: 383 agagcaagctggtcgaaggtgaggcactcgccgccagcattgacaatccttgccctagcc 324

                                                                       
Query: 426 gtctcggtgaacctgagcgcggccaccttcattgccggtatctcgtagaccctctggtca 485
           ||||| |||||||| || || |  |||||||||  ||| ||||| | || ||||| ||||
Sbjct: 323 gtctccgtgaacctcagggcagtaaccttcattttcggaatctcttggatcctcttgtca 264

                                                                       
Query: 486 tcggtgatggtgcccacgatcacagcgatcttg---tccgccttcccatccatgaacctg 542
           || ||||  || || || |||||||| || |||   ||| |||| || ||||||||| ||
Sbjct: 263 tcagtgactgtaccaacaatcacagcaatgttgttctcctccttgccttccatgaacttg 204

                                                                       
Query: 543 acgaggcggcgcatcgagagcggcggccggtttgtcttgctcatgaagagccgcttcagg 602
            ||||||||||||  ||||||||||| ||||| ||||||||||||||||||| ||| |||
Sbjct: 203 gcgaggcggcgcagggagagcggcgggcggttggtcttgctcatgaagagcctcttgagg 144

                                                           
Query: 603 atcaccggcgttgaactggctcttggtcctccgcaccaggaagcggta 650
           |||| |||| ||||| |  |||||||| |||| ||||||||| |||||
Sbjct: 143 atca-cggcattgaagttactcttggttctcctcaccaggaaacggta 97

---

>dbj|AK102810.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033108L02, full
           insert sequence
          Length = 824

 Score =  283 bits (143), Expect = 4e-73
 Identities = 392/473 (82%), Gaps = 4/473 (0%)
 Strand = Plus / Minus

                                                                       
Query: 181 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 240
           |||| |||||||| || | |||||||||||| || |  ||||||||||| ||||| ||||
Sbjct: 632 cttagaccttgaatccacggctgttcctcctgccacgggccttctcgaacttccttccct 573

                                                                       
Query: 241 tggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcc 300
           ||||||| ||||||||||| ||||||||||| ||||| || ||||| || ||||||||||
Sbjct: 572 tggagcgcacatatggcttcgtgtggctgtgcggcacaccaggagccttaccaaagtgcc 513

                                                                       
Query: 301 taacagcttccctggcgttcttgggacccctcaggagaagcgtgttctgtccaagcggag 360
           | || || || | ||| ||||||||||||| || ||| | ||||||||  ||||||||||
Sbjct: 512 tgacggcctcacgggcattcttgggaccccccaagaggaccgtgttctccccaagcggag 453

                                                                       
Query: 361 cacggagggcgagctggtcaaaggtaaggcactcgccaccagcgttgacaatcctggccc 420
           ||| ||| || |||||||| ||||| ||||||||||| ||||| ||||||||||| ||||
Sbjct: 452 cactgagagcaagctggtcgaaggtgaggcactcgccgccagcattgacaatccttgccc 393

                                                                       
Query: 421 tcgccgtctcggtgaacctgagcgcggccaccttcattgccggtatctcgtagaccctct 480
           | |||||||| |||||||| || || |  |||||||||  ||| ||||| | || |||||
Sbjct: 392 tagccgtctccgtgaacctcagggcagtaaccttcattttcggaatctcttggatcctct 333

                                                                       
Query: 481 ggtcatcggtgatggtgcccacgatcacagcgatcttg---tccgccttcccatccatga 537
            |||||| ||||  || || || |||||||| || |||   ||| |||| || |||||||
Sbjct: 332 tgtcatcagtgactgtaccaacaatcacagcaatgttgttctcctccttgccttccatga 273

                                                                       
Query: 538 acctgacgaggcggcgcatcgagagcggcggccggtttgtcttgctcatgaagagccgct 597
           || || ||||||||||||  ||||||||||| ||||| ||||||||||||||||||| ||
Sbjct: 272 acttggcgaggcggcgcagggagagcggcgggcggttggtcttgctcatgaagagcctct 213

                                                                
Query: 598 tcaggatcaccggcgttgaactggctcttggtcctccgcaccaggaagcggta 650
           | ||||||| |||| ||||| |  |||||||| |||| ||||||||| |||||
Sbjct: 212 tgaggatca-cggcattgaagttactcttggttctcctcaccaggaaacggta 161

---

>gb|BT017364.1| Zea mays clone EL01N0324F01.c mRNA sequence
          Length = 772

 Score =  280 bits (141), Expect = 6e-72
 Identities = 391/473 (82%), Gaps = 1/473 (0%)
 Strand = Plus / Minus

                                                                       
Query: 181 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 240
           ||||||||||||| || | |||||||||||| || |  ||||||||||| ||||| ||||
Sbjct: 608 cttaaaccttgaacccacggctgttcctcctgccacgagccttctcgaacttccttccct 549

                                                                       
Query: 241 tggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcc 300
           ||||||| ||||||||||||||||||||||| |||||||| ||||| ||||| |||||||
Sbjct: 548 tggagcgcacatatggcttggtgtggctgtgcggcactccaggagccttgccgaagtgcc 489

                                                                       
Query: 301 taacagcttccctggcgttcttgggacccctcaggagaagcgtgttctgtccaagcggag 360
           | || || || | ||| |||||||| ||||||| ||| |  |||||||  ||||| ||||
Sbjct: 488 tcaccgcctcacgggcattcttggggcccctcaagaggactgtgttctcgccaagtggag 429

                                                                       
Query: 361 cacggagggcgagctggtcaaaggtaaggcactcgccaccagcgttgacaatcctggccc 420
           ||||||| || ||||||||||| || |||||||| |||||||| ||||||||||||||||
Sbjct: 428 cacggagagcaagctggtcaaatgtgaggcactccccaccagcattgacaatcctggccc 369

                                                                       
Query: 421 tcgccgtctcggtgaacctgagcgcggccaccttcattgccggtatctcgtagaccctct 480
           | ||||||||||||||||| || || |  ||||||||||| || | ||| | || |||||
Sbjct: 368 ttgccgtctcggtgaacctcagggcagtaaccttcattgctggaacctcttggatcctct 309

                                                                       
Query: 481 ggtcatcggtgatggtgcccacgatcacagcgatcttgtccgccttcccatccatgaacc 540
            |||||| ||||  ||||| || |||||||| || || | | |||| || ||||||||| 
Sbjct: 308 tgtcatctgtgactgtgccaacaatcacagcaatgttcttctcctttccttccatgaact 249

                                                                       
Query: 541 tgacgaggcggcgcatcgagagcggcggccggtttgtcttgctcatgaagagccgcttca 600
           |||| ||||||||||| ||||  || || || || || |||||||||||||||| ||| |
Sbjct: 248 tgacaaggcggcgcatggagattggtgggcgattggttttgctcatgaagagcctcttga 189

                                                                
Query: 601 ggatcaccggcgttgaactggctcttggtcctccgcaccaggaagcggtagag 653
           | || | | || ||||| | ||||||||||||||  |||| ||| ||||||||
Sbjct: 188 gaatga-cagcattgaagttgctcttggtcctcctgaccaagaaacggtagag 137

---

>gb|AY104839.1| Zea mays PCO137857 mRNA sequence
          Length = 1127

 Score =  280 bits (141), Expect = 6e-72
 Identities = 391/473 (82%), Gaps = 1/473 (0%)
 Strand = Plus / Minus

                                                                       
Query: 181 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 240
           ||||||||||||| || | |||||||||||| || |  ||||||||||| ||||| ||||
Sbjct: 833 cttaaaccttgaacccacggctgttcctcctgccacgagccttctcgaacttccttccct 774

                                                                       
Query: 241 tggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcc 300
           ||||||| ||||||||||||||||||||||| |||||||| ||||| ||||| |||||||
Sbjct: 773 tggagcgcacatatggcttggtgtggctgtgcggcactccaggagccttgccgaagtgcc 714

                                                                       
Query: 301 taacagcttccctggcgttcttgggacccctcaggagaagcgtgttctgtccaagcggag 360
           | || || || | ||| |||||||| ||||||| ||| |  |||||||  ||||| ||||
Sbjct: 713 tcaccgcctcacgggcattcttggggcccctcaagaggactgtgttctcgccaagtggag 654

                                                                       
Query: 361 cacggagggcgagctggtcaaaggtaaggcactcgccaccagcgttgacaatcctggccc 420
           ||||||| || ||||||||||| || |||||||| |||||||| ||||||||||||||||
Sbjct: 653 cacggagagcaagctggtcaaatgtgaggcactccccaccagcattgacaatcctggccc 594

                                                                       
Query: 421 tcgccgtctcggtgaacctgagcgcggccaccttcattgccggtatctcgtagaccctct 480
           | ||||||||||||||||| || || |  ||||||||||| || | ||| | || |||||
Sbjct: 593 ttgccgtctcggtgaacctcagggcagtaaccttcattgctggaacctcttggatcctct 534

                                                                       
Query: 481 ggtcatcggtgatggtgcccacgatcacagcgatcttgtccgccttcccatccatgaacc 540
            |||||| ||||  ||||| || |||||||| || || | | |||| || ||||||||| 
Sbjct: 533 tgtcatctgtgactgtgccaacaatcacagcaatgttcttctcctttccttccatgaact 474

                                                                       
Query: 541 tgacgaggcggcgcatcgagagcggcggccggtttgtcttgctcatgaagagccgcttca 600
           |||| ||||||||||| ||||  || || || || || |||||||||||||||| ||| |
Sbjct: 473 tgacaaggcggcgcatggagattggtgggcgattggttttgctcatgaagagcctcttga 414

                                                                
Query: 601 ggatcaccggcgttgaactggctcttggtcctccgcaccaggaagcggtagag 653
           | || | | || ||||| | ||||||||||||||  |||| ||| ||||||||
Sbjct: 413 gaatga-cagcattgaagttgctcttggtcctcctgaccaagaaacggtagag 362

---

>gb|DQ363992.1| Saccharum hybrid cultivar putative 60S ribosomal protein L18 mRNA,
           partial cds
          Length = 527

 Score =  244 bits (123), Expect = 3e-61
 Identities = 240/279 (86%)
 Strand = Plus / Minus

                                                                       
Query: 182 ttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccctt 241
           |||||||||||| || | |||||||||||| || |  ||||||||||| ||||| |||||
Sbjct: 318 ttaaaccttgaatccacggctgttcctcctgccacgagccttctcgaacttccttccctt 259

                                                                       
Query: 242 ggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcct 301
           |||||| ||||||||||||||||||||||||||||| || ||||| ||||||||||||||
Sbjct: 258 ggagcgcacatatggcttggtgtggctgtgtggcacgccaggagccttgccaaagtgcct 199

                                                                       
Query: 302 aacagcttccctggcgttcttgggacccctcaggagaagcgtgttctgtccaagcggagc 361
            || || || | ||| |||||||| ||||||| ||| | ||||||||  ||||| |||||
Sbjct: 198 caccgcctcacgggcattcttggggcccctcaagaggaccgtgttctcgccaagtggagc 139

                                                                       
Query: 362 acggagggcgagctggtcaaaggtaaggcactcgccaccagcgttgacaatcctggccct 421
           |||||| || ||||||||||| || |||||||| |||||||| |||||||||||||||||
Sbjct: 138 acggagagcaagctggtcaaatgtgaggcactccccaccagcattgacaatcctggccct 79

                                                  
Query: 422 cgccgtctcggtgaacctgagcgcggccaccttcattgc 460
            || |||||||||||||| || || |  |||||||||||
Sbjct: 78  tgctgtctcggtgaacctcagggcagtaaccttcattgc 40

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  204 bits (103), Expect = 3e-49
 Identities = 125/131 (95%), Gaps = 1/131 (0%)
 Strand = Plus / Minus

                                                                            
Query: 523      ccttcccatccatgaacctgacgaggcggcgcatcgagagcggcggccggtttgtcttgc 582
                ||||||| ||||||||||||||||| |||||||||||||||||||| ||||| |||||||
Sbjct: 28484468 ccttcccctccatgaacctgacgagacggcgcatcgagagcggcgggcggttggtcttgc 28484409

                                                                            
Query: 583      tcatgaagagccgcttcaggatcaccggcgttgaactggctcttggtcctccgcaccagg 642
                |||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 28484408 tcatgaagagccgcttcaggatca-cggcgttgaagtggctcttggtcctccgcaccagg 28484350

                           
Query: 643      aagcggtagag 653
                |||||||||||
Sbjct: 28484349 aagcggtagag 28484339



 Score =  188 bits (95), Expect = 2e-44
 Identities = 146/163 (89%)
 Strand = Plus / Minus

                                                                            
Query: 175      ccacagcttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcc 234
                ||||| |||| |||||||||||| |||||||||| ||||||||||||||||| |||||||
Sbjct: 28486302 ccacaacttataccttgaagcccttgctgttccttcttcctcttgccttctcaaatttcc 28486243

                                                                            
Query: 235      tgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaa 294
                | ||||| ||||| ||||||||||| |||| |||||| || |||||||||||   |||||
Sbjct: 28486242 ttccctttgagcgaacatatggcttagtgttgctgtggggaactcctggagcagggccaa 28486183

                                                           
Query: 295      agtgcctaacagcttccctggcgttcttgggacccctcaggag 337
                ||||| ||||||||||||| |||||||||||||||||||||||
Sbjct: 28486182 agtgcttaacagcttccctagcgttcttgggacccctcaggag 28486140



 Score =  145 bits (73), Expect = 2e-31
 Identities = 154/181 (85%)
 Strand = Plus / Minus

                                                                            
Query: 341      cgtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacc 400
                ||||||||| |||||||| || ||||| ||||||||||| || || ||||||||||||||
Sbjct: 28484757 cgtgttctggccaagcggggcgcggagagcgagctggtcgaacgtgaggcactcgccacc 28484698

                                                                            
Query: 401      agcgttgacaatcctggccctcgccgtctcggtgaacctgagcgcggccaccttcattgc 460
                 || ||||  ||||  || ||||| ||||||||||||||||| || ||||||||||| ||
Sbjct: 28484697 ggcattgatgatccgtgctctcgcggtctcggtgaacctgagagcagccaccttcatcgc 28484638

                                                                            
Query: 461      cggtatctcgtagaccctctggtcatcggtgatggtgcccacgatcacagcgatcttgtc 520
                ||| | ||| |||| ||||| |||||| |||| ||||||||||||||| ||||||| |||
Sbjct: 28484637 cggcacctcatagatcctcttgtcatctgtgacggtgcccacgatcacggcgatctggtc 28484578

                 
Query: 521      c 521
                |
Sbjct: 28484577 c 28484577

---

>dbj|AP006268.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0037D09
          Length = 140470

 Score =  204 bits (103), Expect = 3e-49
 Identities = 125/131 (95%), Gaps = 1/131 (0%)
 Strand = Plus / Minus

                                                                         
Query: 523   ccttcccatccatgaacctgacgaggcggcgcatcgagagcggcggccggtttgtcttgc 582
             ||||||| ||||||||||||||||| |||||||||||||||||||| ||||| |||||||
Sbjct: 50220 ccttcccctccatgaacctgacgagacggcgcatcgagagcggcgggcggttggtcttgc 50161

                                                                         
Query: 583   tcatgaagagccgcttcaggatcaccggcgttgaactggctcttggtcctccgcaccagg 642
             |||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 50160 tcatgaagagccgcttcaggatca-cggcgttgaagtggctcttggtcctccgcaccagg 50102

                        
Query: 643   aagcggtagag 653
             |||||||||||
Sbjct: 50101 aagcggtagag 50091



 Score =  188 bits (95), Expect = 2e-44
 Identities = 146/163 (89%)
 Strand = Plus / Minus

                                                                         
Query: 175   ccacagcttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcc 234
             ||||| |||| |||||||||||| |||||||||| ||||||||||||||||| |||||||
Sbjct: 52054 ccacaacttataccttgaagcccttgctgttccttcttcctcttgccttctcaaatttcc 51995

                                                                         
Query: 235   tgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaa 294
             | ||||| ||||| ||||||||||| |||| |||||| || |||||||||||   |||||
Sbjct: 51994 ttccctttgagcgaacatatggcttagtgttgctgtggggaactcctggagcagggccaa 51935

                                                        
Query: 295   agtgcctaacagcttccctggcgttcttgggacccctcaggag 337
             ||||| ||||||||||||| |||||||||||||||||||||||
Sbjct: 51934 agtgcttaacagcttccctagcgttcttgggacccctcaggag 51892



 Score =  145 bits (73), Expect = 2e-31
 Identities = 154/181 (85%)
 Strand = Plus / Minus

                                                                         
Query: 341   cgtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacc 400
             ||||||||| |||||||| || ||||| ||||||||||| || || ||||||||||||||
Sbjct: 50509 cgtgttctggccaagcggggcgcggagagcgagctggtcgaacgtgaggcactcgccacc 50450

                                                                         
Query: 401   agcgttgacaatcctggccctcgccgtctcggtgaacctgagcgcggccaccttcattgc 460
              || ||||  ||||  || ||||| ||||||||||||||||| || ||||||||||| ||
Sbjct: 50449 ggcattgatgatccgtgctctcgcggtctcggtgaacctgagagcagccaccttcatcgc 50390

                                                                         
Query: 461   cggtatctcgtagaccctctggtcatcggtgatggtgcccacgatcacagcgatcttgtc 520
             ||| | ||| |||| ||||| |||||| |||| ||||||||||||||| ||||||| |||
Sbjct: 50389 cggcacctcatagatcctcttgtcatctgtgacggtgcccacgatcacggcgatctggtc 50330

              
Query: 521   c 521
             |
Sbjct: 50329 c 50329

---

>dbj|AP004343.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0618H09
          Length = 142306

 Score =  204 bits (103), Expect = 3e-49
 Identities = 125/131 (95%), Gaps = 1/131 (0%)
 Strand = Plus / Minus

                                                                         
Query: 523   ccttcccatccatgaacctgacgaggcggcgcatcgagagcggcggccggtttgtcttgc 582
             ||||||| ||||||||||||||||| |||||||||||||||||||| ||||| |||||||
Sbjct: 42009 ccttcccctccatgaacctgacgagacggcgcatcgagagcggcgggcggttggtcttgc 41950

                                                                         
Query: 583   tcatgaagagccgcttcaggatcaccggcgttgaactggctcttggtcctccgcaccagg 642
             |||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 41949 tcatgaagagccgcttcaggatca-cggcgttgaagtggctcttggtcctccgcaccagg 41891

                        
Query: 643   aagcggtagag 653
             |||||||||||
Sbjct: 41890 aagcggtagag 41880



 Score =  188 bits (95), Expect = 2e-44
 Identities = 146/163 (89%)
 Strand = Plus / Minus

                                                                         
Query: 175   ccacagcttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcc 234
             ||||| |||| |||||||||||| |||||||||| ||||||||||||||||| |||||||
Sbjct: 43843 ccacaacttataccttgaagcccttgctgttccttcttcctcttgccttctcaaatttcc 43784

                                                                         
Query: 235   tgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaa 294
             | ||||| ||||| ||||||||||| |||| |||||| || |||||||||||   |||||
Sbjct: 43783 ttccctttgagcgaacatatggcttagtgttgctgtggggaactcctggagcagggccaa 43724

                                                        
Query: 295   agtgcctaacagcttccctggcgttcttgggacccctcaggag 337
             ||||| ||||||||||||| |||||||||||||||||||||||
Sbjct: 43723 agtgcttaacagcttccctagcgttcttgggacccctcaggag 43681



 Score =  145 bits (73), Expect = 2e-31
 Identities = 154/181 (85%)
 Strand = Plus / Minus

                                                                         
Query: 341   cgtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacc 400
             ||||||||| |||||||| || ||||| ||||||||||| || || ||||||||||||||
Sbjct: 42298 cgtgttctggccaagcggggcgcggagagcgagctggtcgaacgtgaggcactcgccacc 42239

                                                                         
Query: 401   agcgttgacaatcctggccctcgccgtctcggtgaacctgagcgcggccaccttcattgc 460
              || ||||  ||||  || ||||| ||||||||||||||||| || ||||||||||| ||
Sbjct: 42238 ggcattgatgatccgtgctctcgcggtctcggtgaacctgagagcagccaccttcatcgc 42179

                                                                         
Query: 461   cggtatctcgtagaccctctggtcatcggtgatggtgcccacgatcacagcgatcttgtc 520
             ||| | ||| |||| ||||| |||||| |||| ||||||||||||||| ||||||| |||
Sbjct: 42178 cggcacctcatagatcctcttgtcatctgtgacggtgcccacgatcacggcgatctggtc 42119

              
Query: 521   c 521
             |
Sbjct: 42118 c 42118

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  172 bits (87), Expect = 9e-40
 Identities = 115/123 (93%), Gaps = 1/123 (0%)
 Strand = Plus / Plus

                                                                            
Query: 531      tccatgaacctgacgaggcggcgcatcgagagcggcggccggtttgtcttgctcatgaag 590
                ||||||||||||||||||||||| | |||||||||||| ||||| |||||||||||||||
Sbjct: 12692404 tccatgaacctgacgaggcggcggagcgagagcggcgggcggttggtcttgctcatgaag 12692463

                                                                            
Query: 591      agccgcttcaggatcaccggcgttgaactggctcttggtcctccgcaccaggaagcggta 650
                |||||| ||||||||| ||||||||||  |||||||||||||||||||||||||||||||
Sbjct: 12692464 agccgcctcaggatca-cggcgttgaaggggctcttggtcctccgcaccaggaagcggta 12692522

                   
Query: 651      gag 653
                |||
Sbjct: 12692523 gag 12692525



 Score =  159 bits (80), Expect = 1e-35
 Identities = 152/176 (86%)
 Strand = Plus / Plus

                                                                            
Query: 341      cgtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacc 400
                ||||||||| || || ||||| ||||| || ||||| || |||||||||||||| |||||
Sbjct: 12692122 cgtgttctggcccagaggagcgcggagcgccagctgatcgaaggtaaggcactctccacc 12692181

                                                                            
Query: 401      agcgttgacaatcctggccctcgccgtctcggtgaacctgagcgcggccaccttcattgc 460
                ||  || ||||| |  |||||||| |||||||||||||||||||||||||||||||| ||
Sbjct: 12692182 agtattcacaatgcgagccctcgcggtctcggtgaacctgagcgcggccaccttcatcgc 12692241

                                                                        
Query: 461      cggtatctcgtagaccctctggtcatcggtgatggtgcccacgatcacagcgatct 516
                ||| | |||||||||||||| ||| ||||| | ||||||||||||||| |||||||
Sbjct: 12692242 cggcacctcgtagaccctcttgtcgtcggtaacggtgcccacgatcacggcgatct 12692297



 Score =  149 bits (75), Expect = 1e-32
 Identities = 138/159 (86%)
 Strand = Plus / Plus

                                                                            
Query: 181      cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 240
                |||| |||||||||||  ||||||||||||||||||| |||||||| || ||||| ||||
Sbjct: 12690609 cttagaccttgaagcctttgctgttcctccttcctctcgccttctcaaacttccttccct 12690668

                                                                            
Query: 241      tggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcc 300
                | ||||| || || |||||||||| ||||||||||||||| |||||    ||||||||| 
Sbjct: 12690669 ttgagcgcacgtaaggcttggtgttgctgtgtggcactccaggagcaggaccaaagtgct 12690728

                                                       
Query: 301      taacagcttccctggcgttcttgggacccctcaggagaa 339
                | || ||||||||||||||||| ||||||||||||||||
Sbjct: 12690729 tcactgcttccctggcgttcttaggacccctcaggagaa 12690767

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  172 bits (87), Expect = 9e-40
 Identities = 115/123 (93%), Gaps = 1/123 (0%)
 Strand = Plus / Plus

                                                                            
Query: 531      tccatgaacctgacgaggcggcgcatcgagagcggcggccggtttgtcttgctcatgaag 590
                ||||||||||||||||||||||| | |||||||||||| ||||| |||||||||||||||
Sbjct: 12689167 tccatgaacctgacgaggcggcggagcgagagcggcgggcggttggtcttgctcatgaag 12689226

                                                                            
Query: 591      agccgcttcaggatcaccggcgttgaactggctcttggtcctccgcaccaggaagcggta 650
                |||||| ||||||||| ||||||||||  |||||||||||||||||||||||||||||||
Sbjct: 12689227 agccgcctcaggatca-cggcgttgaaggggctcttggtcctccgcaccaggaagcggta 12689285

                   
Query: 651      gag 653
                |||
Sbjct: 12689286 gag 12689288



 Score =  159 bits (80), Expect = 1e-35
 Identities = 152/176 (86%)
 Strand = Plus / Plus

                                                                            
Query: 341      cgtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacc 400
                ||||||||| || || ||||| ||||| || ||||| || |||||||||||||| |||||
Sbjct: 12688885 cgtgttctggcccagaggagcgcggagcgccagctgatcgaaggtaaggcactctccacc 12688944

                                                                            
Query: 401      agcgttgacaatcctggccctcgccgtctcggtgaacctgagcgcggccaccttcattgc 460
                ||  || ||||| |  |||||||| |||||||||||||||||||||||||||||||| ||
Sbjct: 12688945 agtattcacaatgcgagccctcgcggtctcggtgaacctgagcgcggccaccttcatcgc 12689004

                                                                        
Query: 461      cggtatctcgtagaccctctggtcatcggtgatggtgcccacgatcacagcgatct 516
                ||| | |||||||||||||| ||| ||||| | ||||||||||||||| |||||||
Sbjct: 12689005 cggcacctcgtagaccctcttgtcgtcggtaacggtgcccacgatcacggcgatct 12689060



 Score =  149 bits (75), Expect = 1e-32
 Identities = 138/159 (86%)
 Strand = Plus / Plus

                                                                            
Query: 181      cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 240
                |||| |||||||||||  ||||||||||||||||||| |||||||| || ||||| ||||
Sbjct: 12687372 cttagaccttgaagcctttgctgttcctccttcctctcgccttctcaaacttccttccct 12687431

                                                                            
Query: 241      tggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcc 300
                | ||||| || || |||||||||| ||||||||||||||| |||||    ||||||||| 
Sbjct: 12687432 ttgagcgcacgtaaggcttggtgttgctgtgtggcactccaggagcaggaccaaagtgct 12687491

                                                       
Query: 301      taacagcttccctggcgttcttgggacccctcaggagaa 339
                | || ||||||||||||||||| ||||||||||||||||
Sbjct: 12687492 tcactgcttccctggcgttcttaggacccctcaggagaa 12687530

---

>gb|AC121491.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBb0050D18, complete sequence
          Length = 126350

 Score =  172 bits (87), Expect = 9e-40
 Identities = 115/123 (93%), Gaps = 1/123 (0%)
 Strand = Plus / Plus

                                                                         
Query: 531   tccatgaacctgacgaggcggcgcatcgagagcggcggccggtttgtcttgctcatgaag 590
             ||||||||||||||||||||||| | |||||||||||| ||||| |||||||||||||||
Sbjct: 46857 tccatgaacctgacgaggcggcggagcgagagcggcgggcggttggtcttgctcatgaag 46916

                                                                         
Query: 591   agccgcttcaggatcaccggcgttgaactggctcttggtcctccgcaccaggaagcggta 650
             |||||| ||||||||| ||||||||||  |||||||||||||||||||||||||||||||
Sbjct: 46917 agccgcctcaggatca-cggcgttgaaggggctcttggtcctccgcaccaggaagcggta 46975

                
Query: 651   gag 653
             |||
Sbjct: 46976 gag 46978



 Score =  159 bits (80), Expect = 1e-35
 Identities = 152/176 (86%)
 Strand = Plus / Plus

                                                                         
Query: 341   cgtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacc 400
             ||||||||| || || ||||| ||||| || ||||| || |||||||||||||| |||||
Sbjct: 46575 cgtgttctggcccagaggagcgcggagcgccagctgatcgaaggtaaggcactctccacc 46634

                                                                         
Query: 401   agcgttgacaatcctggccctcgccgtctcggtgaacctgagcgcggccaccttcattgc 460
             ||  || ||||| |  |||||||| |||||||||||||||||||||||||||||||| ||
Sbjct: 46635 agtattcacaatgcgagccctcgcggtctcggtgaacctgagcgcggccaccttcatcgc 46694

                                                                     
Query: 461   cggtatctcgtagaccctctggtcatcggtgatggtgcccacgatcacagcgatct 516
             ||| | |||||||||||||| ||| ||||| | ||||||||||||||| |||||||
Sbjct: 46695 cggcacctcgtagaccctcttgtcgtcggtaacggtgcccacgatcacggcgatct 46750



 Score =  149 bits (75), Expect = 1e-32
 Identities = 138/159 (86%)
 Strand = Plus / Plus

                                                                         
Query: 181   cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 240
             |||| |||||||||||  ||||||||||||||||||| |||||||| || ||||| ||||
Sbjct: 45062 cttagaccttgaagcctttgctgttcctccttcctctcgccttctcaaacttccttccct 45121

                                                                         
Query: 241   tggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcc 300
             | ||||| || || |||||||||| ||||||||||||||| |||||    ||||||||| 
Sbjct: 45122 ttgagcgcacgtaaggcttggtgttgctgtgtggcactccaggagcaggaccaaagtgct 45181

                                                    
Query: 301   taacagcttccctggcgttcttgggacccctcaggagaa 339
             | || ||||||||||||||||| ||||||||||||||||
Sbjct: 45182 tcactgcttccctggcgttcttaggacccctcaggagaa 45220

---

>gb|AY846824.1| Triticum aestivum ribosomal protein L18 mRNA, complete cds
          Length = 793

 Score =  159 bits (80), Expect = 1e-35
 Identities = 230/280 (82%)
 Strand = Plus / Minus

                                                                       
Query: 181 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 240
           |||||||||||||||| | |||||||||||| || |   ||||||| || ||||| ||||
Sbjct: 591 cttaaaccttgaagccacggctgttcctcctaccacgaaccttctcaaacttcctaccct 532

                                                                       
Query: 241 tggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcc 300
           ||||||| ||||| ||||||||||||||||| ||||| || || || ||||| |||||||
Sbjct: 531 tggagcgcacatagggcttggtgtggctgtgcggcacaccaggcgccttgccgaagtgcc 472

                                                                       
Query: 301 taacagcttccctggcgttcttgggacccctcaggagaagcgtgttctgtccaagcggag 360
           | || || || |  || |||||||| |||||||  || | ||||||||  |||   ||||
Sbjct: 471 tcaccgcctcacgcgcattcttgggtcccctcaacaggatcgtgttctccccagttggag 412

                                                                       
Query: 361 cacggagggcgagctggtcaaaggtaaggcactcgccaccagcgttgacaatcctggccc 420
           ||||||| || ||||||||||| || |||||||| |||||||| |||| |||||| ||||
Sbjct: 411 cacggagagcaagctggtcaaaagtgaggcactccccaccagcattgataatccttgccc 352

                                                   
Query: 421 tcgccgtctcggtgaacctgagcgcggccaccttcattgc 460
           |||| ||||| |||||||| || || |  |||||||||||
Sbjct: 351 tcgctgtctctgtgaacctcagagcagtaaccttcattgc 312



 Score =  129 bits (65), Expect = 1e-26
 Identities = 99/109 (90%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 545 gaggcggcgcatcgagagcggcggccggtttgtcttgctcatgaagagccgcttcaggat 604
           |||||||||||| ||||||||||| ||||| ||||||||||||||||||| ||| |||||
Sbjct: 224 gaggcggcgcatggagagcggcgggcggttagtcttgctcatgaagagcctcttgaggat 165

                                                            
Query: 605 caccggcgttgaactggctcttggtcctccgcaccaggaagcggtagag 653
            | |||||||||||| |||||||||||||| ||||||||| ||||||||
Sbjct: 164 ga-cggcgttgaacttgctcttggtcctcctcaccaggaaacggtagag 117

---

>gb|AC087551.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0431G05,
             complete sequence
          Length = 145044

 Score =  121 bits (61), Expect = 3e-24
 Identities = 130/153 (84%)
 Strand = Plus / Minus

                                                                         
Query: 181   cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 240
             |||| |||||||| || | |||||||||||| || |  ||||||||||| ||||| ||||
Sbjct: 49877 cttagaccttgaatccacggctgttcctcctgccacgggccttctcgaacttccttccct 49818

                                                                         
Query: 241   tggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcc 300
             ||||||| ||||||||||| ||||||||||| ||||| || ||||| || ||||||||||
Sbjct: 49817 tggagcgcacatatggcttcgtgtggctgtgcggcacaccaggagccttaccaaagtgcc 49758

                                              
Query: 301   taacagcttccctggcgttcttgggacccctca 333
             | || || || | ||| ||||||||||||||||
Sbjct: 49757 tgacggcctcacgggcattcttgggacccctca 49725



 Score =  111 bits (56), Expect = 3e-21
 Identities = 128/152 (84%)
 Strand = Plus / Minus

                                                                         
Query: 341   cgtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacc 400
             ||||||||  ||||||||||||||||| || |||||||| ||||| ||||||||||| ||
Sbjct: 48716 cgtgttctccccaagcggagcacggagagcaagctggtcgaaggtgaggcactcgccgcc 48657

                                                                         
Query: 401   agcgttgacaatcctggccctcgccgtctcggtgaacctgagcgcggccaccttcattgc 460
             ||| ||||||||||| ||||| |||||||| |||||||| || || |  |||||||||  
Sbjct: 48656 agcattgacaatccttgccctagccgtctccgtgaacctcagggcagtaaccttcatttt 48597

                                             
Query: 461   cggtatctcgtagaccctctggtcatcggtga 492
             ||| ||||| | || ||||| |||||| ||||
Sbjct: 48596 cggaatctcttggatcctcttgtcatcagtga 48565



 Score =  103 bits (52), Expect = 7e-19
 Identities = 104/120 (86%), Gaps = 1/120 (0%)
 Strand = Plus / Minus

                                                                         
Query: 531   tccatgaacctgacgaggcggcgcatcgagagcggcggccggtttgtcttgctcatgaag 590
             ||||||||| || ||||||||||||  ||||||||||| ||||| |||||||||||||||
Sbjct: 48394 tccatgaacttggcgaggcggcgcagggagagcggcgggcggttggtcttgctcatgaag 48335

                                                                         
Query: 591   agccgcttcaggatcaccggcgttgaactggctcttggtcctccgcaccaggaagcggta 650
             |||| ||| ||||||| |||| ||||| |  |||||||| |||| ||||||||| |||||
Sbjct: 48334 agcctcttgaggatca-cggcattgaagttactcttggttctcctcaccaggaaacggta 48276

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score =  121 bits (61), Expect = 3e-24
 Identities = 130/153 (84%)
 Strand = Plus / Minus

                                                                           
Query: 181     cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 240
               |||| |||||||| || | |||||||||||| || |  ||||||||||| ||||| ||||
Sbjct: 3172160 cttagaccttgaatccacggctgttcctcctgccacgggccttctcgaacttccttccct 3172101

                                                                           
Query: 241     tggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcc 300
               ||||||| ||||||||||| ||||||||||| ||||| || ||||| || ||||||||||
Sbjct: 3172100 tggagcgcacatatggcttcgtgtggctgtgcggcacaccaggagccttaccaaagtgcc 3172041

                                                
Query: 301     taacagcttccctggcgttcttgggacccctca 333
               | || || || | ||| ||||||||||||||||
Sbjct: 3172040 tgacggcctcacgggcattcttgggacccctca 3172008



 Score =  111 bits (56), Expect = 3e-21
 Identities = 128/152 (84%)
 Strand = Plus / Minus

                                                                           
Query: 341     cgtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacc 400
               ||||||||  ||||||||||||||||| || |||||||| ||||| ||||||||||| ||
Sbjct: 3170999 cgtgttctccccaagcggagcacggagagcaagctggtcgaaggtgaggcactcgccgcc 3170940

                                                                           
Query: 401     agcgttgacaatcctggccctcgccgtctcggtgaacctgagcgcggccaccttcattgc 460
               ||| ||||||||||| ||||| |||||||| |||||||| || || |  |||||||||  
Sbjct: 3170939 agcattgacaatccttgccctagccgtctccgtgaacctcagggcagtaaccttcatttt 3170880

                                               
Query: 461     cggtatctcgtagaccctctggtcatcggtga 492
               ||| ||||| | || ||||| |||||| ||||
Sbjct: 3170879 cggaatctcttggatcctcttgtcatcagtga 3170848



 Score =  103 bits (52), Expect = 7e-19
 Identities = 104/120 (86%), Gaps = 1/120 (0%)
 Strand = Plus / Minus

                                                                           
Query: 531     tccatgaacctgacgaggcggcgcatcgagagcggcggccggtttgtcttgctcatgaag 590
               ||||||||| || ||||||||||||  ||||||||||| ||||| |||||||||||||||
Sbjct: 3170677 tccatgaacttggcgaggcggcgcagggagagcggcgggcggttggtcttgctcatgaag 3170618

                                                                           
Query: 591     agccgcttcaggatcaccggcgttgaactggctcttggtcctccgcaccaggaagcggta 650
               |||| ||| ||||||| |||| ||||| |  |||||||| |||| ||||||||| |||||
Sbjct: 3170617 agcctcttgaggatca-cggcattgaagttactcttggttctcctcaccaggaaacggta 3170559

---

>gb|DQ428164.1| Sorghum propinquum locus PRC0147 genomic sequence
          Length = 707

 Score =  103 bits (52), Expect = 7e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 cgtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacc 400
           ||||||||  ||||| ||||||||||| || ||||||||||| || |||||||| |||||
Sbjct: 493 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 434

                                                                       
Query: 401 agcgttgacaatcctggccctcgccgtctcggtgaacctgagcgcggccaccttcattgc 460
           ||| ||||||||||||||||| || ||||| |||||||| || || |  |||||||||||
Sbjct: 433 agcattgacaatcctggcccttgctgtctctgtgaacctcagggcagtaaccttcattgc 374



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 53/64 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 tccatgaacctgacgaggcggcgcatcgagagcggcggccggtttgtcttgctcatgaag 590
           ||||||||| |||| ||||||||||  || |  || || ||||| || ||||||||||||
Sbjct: 71  tccatgaacttgacaaggcggcgcagggaaattggtgggcggttggttttgctcatgaag 12

               
Query: 591 agcc 594
           ||||
Sbjct: 11  agcc 8

---

>gb|DQ428163.1| Sorghum bicolor voucher PI585454 locus PRC0147 genomic sequence
          Length = 682

 Score =  103 bits (52), Expect = 7e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 cgtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacc 400
           ||||||||  ||||| ||||||||||| || ||||||||||| || |||||||| |||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 401 agcgttgacaatcctggccctcgccgtctcggtgaacctgagcgcggccaccttcattgc 460
           ||| |||||||||||||| || || |||||||||||||| || || |  |||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 53/64 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 tccatgaacctgacgaggcggcgcatcgagagcggcggccggtttgtcttgctcatgaag 590
           ||||||||| |||| ||||||||||  || |  || || ||||| || ||||||||||||
Sbjct: 71  tccatgaacttgacaaggcggcgcagggaaattggtgggcggttggttttgctcatgaag 12

               
Query: 591 agcc 594
           ||||
Sbjct: 11  agcc 8

---

>gb|DQ428162.1| Sorghum bicolor voucher PI267539 locus PRC0147 genomic sequence
          Length = 682

 Score =  103 bits (52), Expect = 7e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 cgtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacc 400
           ||||||||  ||||| ||||||||||| || ||||||||||| || |||||||| |||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 401 agcgttgacaatcctggccctcgccgtctcggtgaacctgagcgcggccaccttcattgc 460
           ||| |||||||||||||| || || |||||||||||||| || || |  |||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383

---

>gb|DQ428161.1| Sorghum bicolor voucher PI267408 locus PRC0147 genomic sequence
          Length = 682

 Score =  103 bits (52), Expect = 7e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 cgtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacc 400
           ||||||||  ||||| ||||||||||| || ||||||||||| || |||||||| |||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 401 agcgttgacaatcctggccctcgccgtctcggtgaacctgagcgcggccaccttcattgc 460
           ||| |||||||||||||| || || |||||||||||||| || || |  |||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 53/64 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 tccatgaacctgacgaggcggcgcatcgagagcggcggccggtttgtcttgctcatgaag 590
           ||||||||| |||| ||||||||||  || |  || || ||||| || ||||||||||||
Sbjct: 71  tccatgaacttgacaaggcggcgcagggaaattggtgggcggttggttttgctcatgaag 12

               
Query: 591 agcc 594
           ||||
Sbjct: 11  agcc 8

---

>gb|DQ428160.1| Sorghum bicolor voucher PI221607 locus PRC0147 genomic sequence
          Length = 682

 Score =  103 bits (52), Expect = 7e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 cgtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacc 400
           ||||||||  ||||| ||||||||||| || ||||||||||| || |||||||| |||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 401 agcgttgacaatcctggccctcgccgtctcggtgaacctgagcgcggccaccttcattgc 460
           ||| |||||||||||||| || || |||||||||||||| || || |  |||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 53/64 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 tccatgaacctgacgaggcggcgcatcgagagcggcggccggtttgtcttgctcatgaag 590
           ||||||||| |||| ||||||||||  || |  || || ||||| || ||||||||||||
Sbjct: 71  tccatgaacttgacaaggcggcgcagggaaattggtgggcggttggttttgctcatgaag 12

               
Query: 591 agcc 594
           ||||
Sbjct: 11  agcc 8

---

>gb|DQ428159.1| Sorghum bicolor voucher PI152702 locus PRC0147 genomic sequence
          Length = 682

 Score =  103 bits (52), Expect = 7e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 cgtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacc 400
           ||||||||  ||||| ||||||||||| || ||||||||||| || |||||||| |||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 401 agcgttgacaatcctggccctcgccgtctcggtgaacctgagcgcggccaccttcattgc 460
           ||| |||||||||||||| || || |||||||||||||| || || |  |||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 53/64 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 tccatgaacctgacgaggcggcgcatcgagagcggcggccggtttgtcttgctcatgaag 590
           ||||||||| |||| ||||||||||  || |  || || ||||| || ||||||||||||
Sbjct: 71  tccatgaacttgacaaggcggcgcagggaaattggtgggcggttggttttgctcatgaag 12

               
Query: 591 agcc 594
           ||||
Sbjct: 11  agcc 8

---

>gb|DQ428158.1| Sorghum bicolor voucher NSL92371 locus PRC0147 genomic sequence
          Length = 682

 Score =  103 bits (52), Expect = 7e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 cgtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacc 400
           ||||||||  ||||| ||||||||||| || ||||||||||| || |||||||| |||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 401 agcgttgacaatcctggccctcgccgtctcggtgaacctgagcgcggccaccttcattgc 460
           ||| |||||||||||||| || || |||||||||||||| || || |  |||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383

---

>gb|DQ428157.1| Sorghum bicolor voucher NSL87902 locus PRC0147 genomic sequence
          Length = 682

 Score =  103 bits (52), Expect = 7e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 cgtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacc 400
           ||||||||  ||||| ||||||||||| || ||||||||||| || |||||||| |||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 401 agcgttgacaatcctggccctcgccgtctcggtgaacctgagcgcggccaccttcattgc 460
           ||| |||||||||||||| || || |||||||||||||| || || |  |||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 53/64 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 tccatgaacctgacgaggcggcgcatcgagagcggcggccggtttgtcttgctcatgaag 590
           ||||||||| |||| ||||||||||  || |  || || ||||| || ||||||||||||
Sbjct: 71  tccatgaacttgacaaggcggcgcagggaaattggtgggcggttggttttgctcatgaag 12

               
Query: 591 agcc 594
           ||||
Sbjct: 11  agcc 8

---

>gb|DQ428156.1| Sorghum bicolor voucher NSL87666 locus PRC0147 genomic sequence
          Length = 682

 Score =  103 bits (52), Expect = 7e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 cgtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacc 400
           ||||||||  ||||| ||||||||||| || ||||||||||| || |||||||| |||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 401 agcgttgacaatcctggccctcgccgtctcggtgaacctgagcgcggccaccttcattgc 460
           ||| |||||||||||||| || || |||||||||||||| || || |  |||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 53/64 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 tccatgaacctgacgaggcggcgcatcgagagcggcggccggtttgtcttgctcatgaag 590
           ||||||||| |||| ||||||||||  || |  || || ||||| || ||||||||||||
Sbjct: 71  tccatgaacttgacaaggcggcgcagggaaattggtgggcggttggttttgctcatgaag 12

               
Query: 591 agcc 594
           ||||
Sbjct: 11  agcc 8

---

>gb|DQ428155.1| Sorghum bicolor voucher NSL77217 locus PRC0147 genomic sequence
          Length = 682

 Score =  103 bits (52), Expect = 7e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 cgtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacc 400
           ||||||||  ||||| ||||||||||| || ||||||||||| || |||||||| |||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 401 agcgttgacaatcctggccctcgccgtctcggtgaacctgagcgcggccaccttcattgc 460
           ||| |||||||||||||| || || |||||||||||||| || || |  |||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 53/64 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 tccatgaacctgacgaggcggcgcatcgagagcggcggccggtttgtcttgctcatgaag 590
           ||||||||| |||| ||||||||||  || |  || || ||||| || ||||||||||||
Sbjct: 71  tccatgaacttgacaaggcggcgcagggaaattggtgggcggttggttttgctcatgaag 12

               
Query: 591 agcc 594
           ||||
Sbjct: 11  agcc 8

---

>gb|DQ428154.1| Sorghum bicolor voucher NSL77034 locus PRC0147 genomic sequence
          Length = 682

 Score =  103 bits (52), Expect = 7e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 cgtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacc 400
           ||||||||  ||||| ||||||||||| || ||||||||||| || |||||||| |||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 401 agcgttgacaatcctggccctcgccgtctcggtgaacctgagcgcggccaccttcattgc 460
           ||| |||||||||||||| || || |||||||||||||| || || |  |||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 53/64 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 tccatgaacctgacgaggcggcgcatcgagagcggcggccggtttgtcttgctcatgaag 590
           ||||||||| |||| ||||||||||  || |  || || ||||| || ||||||||||||
Sbjct: 71  tccatgaacttgacaaggcggcgcagggaaattggtgggcggttggttttgctcatgaag 12

               
Query: 591 agcc 594
           ||||
Sbjct: 11  agcc 8

---

>gb|DQ428153.1| Sorghum bicolor voucher NSL56174 locus PRC0147 genomic sequence
          Length = 682

 Score =  103 bits (52), Expect = 7e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 cgtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacc 400
           ||||||||  ||||| ||||||||||| || ||||||||||| || |||||||| |||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 401 agcgttgacaatcctggccctcgccgtctcggtgaacctgagcgcggccaccttcattgc 460
           ||| |||||||||||||| || || |||||||||||||| || || |  |||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 53/64 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 tccatgaacctgacgaggcggcgcatcgagagcggcggccggtttgtcttgctcatgaag 590
           ||||||||| |||| ||||||||||  || |  || || ||||| || ||||||||||||
Sbjct: 71  tccatgaacttgacaaggcggcgcagggaaattggtgggcggttggttttgctcatgaag 12

               
Query: 591 agcc 594
           ||||
Sbjct: 11  agcc 8

---

>gb|DQ428152.1| Sorghum bicolor voucher NSL56003 locus PRC0147 genomic sequence
          Length = 682

 Score =  103 bits (52), Expect = 7e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 cgtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacc 400
           ||||||||  ||||| ||||||||||| || ||||||||||| || |||||||| |||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 401 agcgttgacaatcctggccctcgccgtctcggtgaacctgagcgcggccaccttcattgc 460
           ||| |||||||||||||| || || |||||||||||||| || || |  |||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383

---

>gb|DQ428151.1| Sorghum bicolor voucher NSL55243 locus PRC0147 genomic sequence
          Length = 682

 Score =  103 bits (52), Expect = 7e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 cgtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacc 400
           ||||||||  ||||| ||||||||||| || ||||||||||| || |||||||| |||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 401 agcgttgacaatcctggccctcgccgtctcggtgaacctgagcgcggccaccttcattgc 460
           ||| |||||||||||||| || || |||||||||||||| || || |  |||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383

---

>gb|DQ428150.1| Sorghum bicolor voucher NSL51365 locus PRC0147 genomic sequence
          Length = 682

 Score =  103 bits (52), Expect = 7e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 cgtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacc 400
           ||||||||  ||||| ||||||||||| || ||||||||||| || |||||||| |||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 401 agcgttgacaatcctggccctcgccgtctcggtgaacctgagcgcggccaccttcattgc 460
           ||| |||||||||||||| || || |||||||||||||| || || |  |||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383

---

>gb|DQ428149.1| Sorghum bicolor voucher NSL51030 locus PRC0147 genomic sequence
          Length = 682

 Score =  103 bits (52), Expect = 7e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 cgtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacc 400
           ||||||||  ||||| ||||||||||| || ||||||||||| || |||||||| |||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 401 agcgttgacaatcctggccctcgccgtctcggtgaacctgagcgcggccaccttcattgc 460
           ||| |||||||||||||| || || |||||||||||||| || || |  |||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 53/64 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 tccatgaacctgacgaggcggcgcatcgagagcggcggccggtttgtcttgctcatgaag 590
           ||||||||| |||| ||||||||||  || |  || || ||||| || ||||||||||||
Sbjct: 71  tccatgaacttgacaaggcggcgcagggaaattggtgggcggttggttttgctcatgaag 12

               
Query: 591 agcc 594
           ||||
Sbjct: 11  agcc 8

---

>gb|DQ428148.1| Sorghum bicolor voucher NSL50875 locus PRC0147 genomic sequence
          Length = 682

 Score =  103 bits (52), Expect = 7e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 cgtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacc 400
           ||||||||  ||||| ||||||||||| || ||||||||||| || |||||||| |||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 401 agcgttgacaatcctggccctcgccgtctcggtgaacctgagcgcggccaccttcattgc 460
           ||| |||||||||||||| || || |||||||||||||| || || |  |||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383

---

>gb|DQ428147.1| Sorghum bicolor voucher BTx623 locus PRC0147 genomic sequence
          Length = 682

 Score =  103 bits (52), Expect = 7e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 341 cgtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacc 400
           ||||||||  ||||| ||||||||||| || ||||||||||| || |||||||| |||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 401 agcgttgacaatcctggccctcgccgtctcggtgaacctgagcgcggccaccttcattgc 460
           ||| |||||||||||||| || || |||||||||||||| || || |  |||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 53/64 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 tccatgaacctgacgaggcggcgcatcgagagcggcggccggtttgtcttgctcatgaag 590
           ||||||||| |||| ||||||||||  || |  || || ||||| || ||||||||||||
Sbjct: 71  tccatgaacttgacaaggcggcgcagggaaattggtgggcggttggttttgctcatgaag 12

               
Query: 591 agcc 594
           ||||
Sbjct: 11  agcc 8

---

>ref|NM_111432.2| Arabidopsis thaliana RPL18 (RIBOSOMAL PROTEIN L18); structural
           constituent of ribosome AT3G05590 (RPL18) mRNA, complete
           cds
          Length = 834

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 90/106 (84%)
 Strand = Plus / Minus

                                                                       
Query: 181 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 240
           ||||||||||||| || |  || |||||| ||||||| ||||||||||| ||||| ||||
Sbjct: 596 cttaaaccttgaatccacgactcttcctctttcctctggccttctcgaacttccttccct 537

                                                         
Query: 241 tggagcggacatatggcttggtgtggctgtgtggcactcctggagc 286
           |||  || ||||||||||||| ||| ||||||||||| || |||||
Sbjct: 536 tggcccgaacatatggcttggagtgactgtgtggcacaccaggagc 491

---

>gb|AC011620.8|ATAC011620 Arabidopsis thaliana chromosome III BAC F18C1 genomic sequence,
             complete sequence
          Length = 100887

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 90/106 (84%)
 Strand = Plus / Plus

                                                                         
Query: 181   cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 240
             ||||||||||||| || |  || |||||| ||||||| ||||||||||| ||||| ||||
Sbjct: 84357 cttaaaccttgaatccacgactcttcctctttcctctggccttctcgaacttccttccct 84416

                                                           
Query: 241   tggagcggacatatggcttggtgtggctgtgtggcactcctggagc 286
             |||  || ||||||||||||| ||| ||||||||||| || |||||
Sbjct: 84417 tggcccgaacatatggcttggagtgactgtgtggcacaccaggagc 84462

---

>gb|AY037224.1| Arabidopsis thaliana AT3g05590/F18C1_14 mRNA, complete cds
          Length = 794

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 90/106 (84%)
 Strand = Plus / Minus

                                                                       
Query: 181 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 240
           ||||||||||||| || |  || |||||| ||||||| ||||||||||| ||||| ||||
Sbjct: 596 cttaaaccttgaatccacgactcttcctctttcctctggccttctcgaacttccttccct 537

                                                         
Query: 241 tggagcggacatatggcttggtgtggctgtgtggcactcctggagc 286
           |||  || ||||||||||||| ||| ||||||||||| || |||||
Sbjct: 536 tggcccgaacatatggcttggagtgactgtgtggcacaccaggagc 491

---

>emb|BX823193.1|CNS0A5VT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB9ZC10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 575

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 90/106 (84%)
 Strand = Plus / Minus

                                                                       
Query: 181 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 240
           ||||||||||||| || |  || |||||| ||||||| ||||||||||| ||||| ||||
Sbjct: 345 cttaaaccttgaatccacgactcttcctctttcctctggccttctcgaacttccttccct 286

                                                         
Query: 241 tggagcggacatatggcttggtgtggctgtgtggcactcctggagc 286
           |||  || ||||||||||||| ||| ||||||||||| || |||||
Sbjct: 285 tggcccgaacatatggcttggagtgactgtgtggcacaccaggagc 240

---

>emb|BX822829.1|CNS0A4S7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB67ZC09 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 714

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 90/106 (84%)
 Strand = Plus / Minus

                                                                       
Query: 181 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 240
           ||||||||||||| || |  || |||||| ||||||| ||||||||||| ||||| ||||
Sbjct: 587 cttaaaccttgaatccacgactcttcctctttcctctggccttctcgaacttccttccct 528

                                                         
Query: 241 tggagcggacatatggcttggtgtggctgtgtggcactcctggagc 286
           |||  || ||||||||||||| ||| ||||||||||| || |||||
Sbjct: 527 tggcccgaacatatggcttggagtgactgtgtggcacaccaggagc 482

---

>gb|U15741.1|ATU15741 Arabidopsis thaliana cytoplasmic ribosomal protein L18 mRNA,
           complete cds
          Length = 778

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 90/106 (84%)
 Strand = Plus / Minus

                                                                       
Query: 181 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 240
           ||||||||||||| || |  || |||||| ||||||| ||||||||||| ||||| ||||
Sbjct: 591 cttaaaccttgaatccacgactcttcctctttcctctggccttctcgaacttccttccct 532

                                                         
Query: 241 tggagcggacatatggcttggtgtggctgtgtggcactcctggagc 286
           |||  || ||||||||||||| ||| ||||||||||| || |||||
Sbjct: 531 tggcccgaacatatggcttggagtgactgtgtggcacaccaggagc 486

---

>gb|AY060533.1| Arabidopsis thaliana AT3g05590/F18C1_14 mRNA, complete cds
          Length = 564

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 89/105 (84%)
 Strand = Plus / Minus

                                                                       
Query: 182 ttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccctt 241
           |||||||||||| || |  || |||||| ||||||| ||||||||||| ||||| |||||
Sbjct: 564 ttaaaccttgaatccacgactcttcctctttcctctggccttctcgaacttccttccctt 505

                                                        
Query: 242 ggagcggacatatggcttggtgtggctgtgtggcactcctggagc 286
           ||  || ||||||||||||| ||| ||||||||||| || |||||
Sbjct: 504 ggcccgaacatatggcttggagtgactgtgtggcacaccaggagc 460

---

>gb|BT013100.1| Lycopersicon esculentum clone 114386R, mRNA sequence
          Length = 839

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 159/199 (79%)
 Strand = Plus / Minus

                                                                       
Query: 187 ccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgcccttggagc 246
           ||||| |||| ||||| || ||| ||||||||||   ||| || ||||| ||||| | ||
Sbjct: 616 ccttgtagcctctgctatttctctttcctcttgctcgctcaaacttccttccctttgcgc 557

                                                                       
Query: 247 ggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcctaacag 306
           | ||||| ||||| |||||||||||||| || || || ||||| ||||||||| |||| |
Sbjct: 556 gaacataaggctttgtgtggctgtgtgggacaccaggtgctttaccaaagtgcttaacgg 497

                                                                       
Query: 307 cttccctggcgttcttgggacccctcaggagaagcgtgttctgtccaagcggagcacgga 366
           | ||||| | |||||| |||||||| || | ||  |||||||| ||||| || || | ||
Sbjct: 496 cctcccttgagttctttggacccctaagcaaaacagtgttctgcccaagaggggctctga 437

                              
Query: 367 gggcgagctggtcaaaggt 385
           | || ||||| ||||||||
Sbjct: 436 gagcaagctgatcaaaggt 418

---

>emb|CR734138.2|CNS0GT8P Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 540 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 481

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 480 ccaaagtgcct 470

---

>emb|CR712214.2|CNS0GCHU Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 539 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 480

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 479 ccaaagtgcct 469

---

>emb|CR727240.2|CNS0GO32 Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   |||||| ||||| 
Sbjct: 540 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttcctggggctttt 481

                      
Query: 291 ccaaagtgcct 301
           || ||||||||
Sbjct: 480 ccgaagtgcct 470

---

>emb|CR722346.2|CNS0GKB4 Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 539 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 480

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 479 ccaaagtgcct 469

---

>emb|CR722203.2|CNS0GK75 Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 539 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 480

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 479 ccaaagtgcct 469

---

>emb|CR720412.2|CNS0GITE Tetraodon nigroviridis full-length cDNA
          Length = 604

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 503 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 444

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 443 ccaaagtgcct 433

---

>emb|CR718786.2|CNS0GHK8 Tetraodon nigroviridis full-length cDNA
          Length = 654

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 540 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 481

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 480 ccaaagtgcct 470

---

>emb|CR718640.2|CNS0GHG6 Tetraodon nigroviridis full-length cDNA
          Length = 646

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 545 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 486

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 485 ccaaagtgcct 475

---

>emb|CR718477.2|CNS0GHBN Tetraodon nigroviridis full-length cDNA
          Length = 639

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 538 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 479

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 478 ccaaagtgcct 468

---

>emb|CR718216.2|CNS0GH4E Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 539 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 480

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 479 ccaaagtgcct 469

---

>emb|CR716822.2|CNS0GG1R Tetraodon nigroviridis full-length cDNA
          Length = 638

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 537 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 478

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 477 ccaaagtgcct 467

---

>emb|CR716557.2|CNS0GFUE Tetraodon nigroviridis full-length cDNA
          Length = 646

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 545 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 486

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 485 ccaaagtgcct 475

---

>emb|CR716126.2|CNS0GFII Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 540 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 481

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 480 ccaaagtgcct 470

---

>emb|CR715708.2|CNS0GF6W Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 540 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 481

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 480 ccaaagtgcct 470

---

>emb|CR713867.2|CNS0GDRR Tetraodon nigroviridis full-length cDNA
          Length = 617

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 516 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 457

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 456 ccaaagtgcct 446

---

>emb|CR713475.2|CNS0GDGV Tetraodon nigroviridis full-length cDNA
          Length = 638

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 537 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 478

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 477 ccaaagtgcct 467

---

>emb|CR713262.2|CNS0GDAY Tetraodon nigroviridis full-length cDNA
          Length = 649

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 548 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 489

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 488 ccaaagtgcct 478

---

>emb|CR710045.2|CNS0GATL Tetraodon nigroviridis full-length cDNA
          Length = 639

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 538 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 479

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 478 ccaaagtgcct 468

---

>emb|CR709916.2|CNS0GAQ0 Tetraodon nigroviridis full-length cDNA
          Length = 649

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 548 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 489

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 488 ccaaagtgcct 478

---

>emb|CR707932.2|CNS0G96W Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 540 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 481

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 480 ccaaagtgcct 470

---

>emb|CR707373.2|CNS0G8RD Tetraodon nigroviridis full-length cDNA
          Length = 616

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 515 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 456

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 455 ccaaagtgcct 445

---

>emb|CR707090.2|CNS0G8JI Tetraodon nigroviridis full-length cDNA
          Length = 617

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 516 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 457

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 456 ccaaagtgcct 446

---

>emb|CR706834.2|CNS0G8CE Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 540 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 481

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 480 ccaaagtgcct 470

---

>emb|CR706311.2|CNS0G7XV Tetraodon nigroviridis full-length cDNA
          Length = 649

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 548 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 489

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 488 ccaaagtgcct 478

---

>emb|CR705355.2|CNS0G77B Tetraodon nigroviridis full-length cDNA
          Length = 644

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 543 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 484

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 483 ccaaagtgcct 473

---

>emb|CR705285.2|CNS0G75D Tetraodon nigroviridis full-length cDNA
          Length = 639

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 538 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 479

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 478 ccaaagtgcct 468

---

>emb|CR705192.2|CNS0G72S Tetraodon nigroviridis full-length cDNA
          Length = 642

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 541 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 482

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 481 ccaaagtgcct 471

---

>emb|CR704641.2|CNS0G6NH Tetraodon nigroviridis full-length cDNA
          Length = 639

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 538 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 479

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 478 ccaaagtgcct 468

---

>emb|CR701253.2|CNS0G41D Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 539 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 480

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 479 ccaaagtgcct 469

---

>emb|CR696223.2|CNS0G05N Tetraodon nigroviridis full-length cDNA
          Length = 644

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 543 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 484

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 483 ccaaagtgcct 473

---

>emb|CR695482.2|CNS0FZL2 Tetraodon nigroviridis full-length cDNA
          Length = 477

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 376 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 317

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 316 ccaaagtgcct 306

---

>emb|CR694940.2|CNS0FZ60 Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 539 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 480

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 479 ccaaagtgcct 469

---

>emb|CR694036.2|CNS0FYGW Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   |||||| ||||| 
Sbjct: 540 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttcctggggctttt 481

                      
Query: 291 ccaaagtgcct 301
           || ||||||||
Sbjct: 480 ccgaagtgcct 470

---

>emb|CR692628.2|CNS0FXDS Tetraodon nigroviridis full-length cDNA
          Length = 617

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 516 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 457

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 456 ccaaagtgcct 446

---

>emb|CR690516.2|CNS0FVR4 Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 539 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 480

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 479 ccaaagtgcct 469

---

>emb|CR688214.2|CNS0FTZ6 Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 539 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 480

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 479 ccaaagtgcct 469

---

>emb|CR687256.2|CNS0FT8K Tetraodon nigroviridis full-length cDNA
          Length = 642

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 541 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 482

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 481 ccaaagtgcct 471

---

>emb|CR686542.2|CNS0FSOQ Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   |||||| ||||| 
Sbjct: 540 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttcctggggctttt 481

                      
Query: 291 ccaaagtgcct 301
           || ||||||||
Sbjct: 480 ccgaagtgcct 470

---

>emb|CR679416.2|CNS0FN6S Tetraodon nigroviridis full-length cDNA
          Length = 639

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 538 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 479

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 478 ccaaagtgcct 468

---

>emb|CR677668.2|CNS0FLUL Tetraodon nigroviridis full-length cDNA
          Length = 617

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 516 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 457

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 456 ccaaagtgcct 446

---

>emb|CR676604.2|CNS0FL14 Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 540 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 481

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 480 ccaaagtgcct 470

---

>emb|CR674481.2|CNS0FJEF Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   |||||| ||||| 
Sbjct: 539 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttcctggggctttt 480

                      
Query: 291 ccaaagtgcct 301
           || ||||||||
Sbjct: 479 ccgaagtgcct 469

---

>emb|CR672907.2|CNS0FI6P Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 540 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 481

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 480 ccaaagtgcct 470

---

>emb|CR668215.2|CNS0FEKD Tetraodon nigroviridis full-length cDNA
          Length = 617

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   |||||| ||||| 
Sbjct: 516 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttcctggggctttt 457

                      
Query: 291 ccaaagtgcct 301
           || ||||||||
Sbjct: 456 ccgaagtgcct 446

---

>emb|CR667583.2|CNS0FE2T Tetraodon nigroviridis full-length cDNA
          Length = 646

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 545 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 486

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 485 ccaaagtgcct 475

---

>emb|CR666251.2|CNS0FD1T Tetraodon nigroviridis full-length cDNA
          Length = 659

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   |||||| ||||| 
Sbjct: 558 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttcctggggctttt 499

                      
Query: 291 ccaaagtgcct 301
           || ||||||||
Sbjct: 498 ccgaagtgcct 488

---

>emb|CR665491.2|CNS0FCGP Tetraodon nigroviridis full-length cDNA
          Length = 645

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 545 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 486

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 485 ccaaagtgcct 475

---

>emb|CR663494.2|CNS0FAX8 Tetraodon nigroviridis full-length cDNA
          Length = 646

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 545 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 486

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 485 ccaaagtgcct 475

---

>emb|CR662279.2|CNS0F9ZH Tetraodon nigroviridis full-length cDNA
          Length = 618

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 517 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 458

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 457 ccaaagtgcct 447

---

>emb|CR661654.2|CNS0F9I4 Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   |||||| ||||| 
Sbjct: 539 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttcctggggctttt 480

                      
Query: 291 ccaaagtgcct 301
           || ||||||||
Sbjct: 479 ccgaagtgcct 469

---

>emb|CR660863.2|CNS0F8W5 Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 539 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 480

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 479 ccaaagtgcct 469

---

>emb|CR660093.2|CNS0F8AR Tetraodon nigroviridis full-length cDNA
          Length = 639

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 538 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 479

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 478 ccaaagtgcct 468

---

>emb|CR650864.2|CNS0F16E Tetraodon nigroviridis full-length cDNA
          Length = 645

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   |||||| ||||| 
Sbjct: 544 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttcctggggctttt 485

                      
Query: 291 ccaaagtgcct 301
           || ||||||||
Sbjct: 484 ccgaagtgcct 474

---

>emb|CR650032.2|CNS0F0JA Tetraodon nigroviridis full-length cDNA
          Length = 646

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 545 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 486

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 485 ccaaagtgcct 475

---

>emb|CR650013.2|CNS0F0IR Tetraodon nigroviridis full-length cDNA
          Length = 639

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   |||||| ||||| 
Sbjct: 538 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttcctggggctttt 479

                      
Query: 291 ccaaagtgcct 301
           || ||||||||
Sbjct: 478 ccgaagtgcct 468

---

>emb|CR647600.2|CNS0EYNQ Tetraodon nigroviridis full-length cDNA
          Length = 638

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   |||||| ||||| 
Sbjct: 537 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttcctggggctttt 478

                      
Query: 291 ccaaagtgcct 301
           || ||||||||
Sbjct: 477 ccgaagtgcct 467

---

>emb|CR646130.2|CNS0EXIW Tetraodon nigroviridis full-length cDNA
          Length = 639

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 538 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 479

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 478 ccaaagtgcct 468

---

>emb|CR642444.2|CNS0EUOI Tetraodon nigroviridis full-length cDNA
          Length = 645

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 544 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 485

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 484 ccaaagtgcct 474

---

>emb|CR642257.2|CNS0EUJB Tetraodon nigroviridis full-length cDNA
          Length = 645

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 544 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 485

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 484 ccaaagtgcct 474

---

>emb|CR640900.2|CNS0ETHM Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   |||||| ||||| 
Sbjct: 539 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttcctggggctttt 480

                      
Query: 291 ccaaagtgcct 301
           || ||||||||
Sbjct: 479 ccgaagtgcct 469

---

>emb|CR635790.2|CNS0EPJO Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||||||| ||   |||||| ||||| 
Sbjct: 540 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttcctggggctttt 481

                      
Query: 291 ccaaagtgcct 301
           || ||||||||
Sbjct: 480 ccgaagtgcct 470

---

>gb|AF240375.1|AF240375 Oreochromis niloticus clone tiL18b ribosomal protein L18 mRNA,
           complete cds
          Length = 649

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 69/79 (87%)
 Strand = Plus / Minus

                                                                       
Query: 223 tctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctg 282
           ||||||| |||||||||||||||||||| || ||||||||||||||||| ||   ||| |
Sbjct: 549 tctcgaacttcctgcccttggagcggacgtagggcttggtgtggctgtgaggggttccag 490

                              
Query: 283 gagctttgccaaagtgcct 301
           |||| || |||||||||||
Sbjct: 489 gagcctttccaaagtgcct 471

---

>gb|AF240374.1|AF240374 Oreochromis niloticus clone tiL18a ribosomal protein L18 mRNA,
           complete cds
          Length = 649

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 69/79 (87%)
 Strand = Plus / Minus

                                                                       
Query: 223 tctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctg 282
           ||||||| |||||||||||||||||||| || ||||||||||||||||| ||   ||| |
Sbjct: 549 tctcgaacttcctgcccttggagcggacgtagggcttggtgtggctgtgaggggttccag 490

                              
Query: 283 gagctttgccaaagtgcct 301
           |||| || |||||||||||
Sbjct: 489 gagcctttccaaagtgcct 471

---

>emb|CR734840.2|CNS0GTS7 Tetraodon nigroviridis full-length cDNA
          Length = 523

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 40/41 (97%)
 Strand = Plus / Minus

                                                    
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 422 ttcctgcccttggagcggacatagggcttggtgtggctgtg 382

---

>emb|CR734324.2|CNS0GTDV Tetraodon nigroviridis full-length cDNA
          Length = 614

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 40/41 (97%)
 Strand = Plus / Minus

                                                    
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 514 ttcctgcccttggagcggacatagggcttggtgtggctgtg 474

---

>emb|CR710888.2|CNS0GBH0 Tetraodon nigroviridis full-length cDNA
          Length = 638

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 40/41 (97%)
 Strand = Plus / Minus

                                                    
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 537 ttcctgcccttggagcggacatagggcttggtgtggctgtg 497

---

>emb|CR700146.2|CNS0G36M Tetraodon nigroviridis full-length cDNA
          Length = 645

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 40/41 (97%)
 Strand = Plus / Minus

                                                    
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 544 ttcctgcccttggagcggacatagggcttggtgtggctgtg 504

---

>emb|CR672842.2|CNS0FI4W Tetraodon nigroviridis full-length cDNA
          Length = 617

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 40/41 (97%)
 Strand = Plus / Minus

                                                    
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 516 ttcctgcccttggagcggacatagggcttggtgtggctgtg 476

---

>gb|BC084727.1| Rattus norvegicus ribosomal protein L18, mRNA (cDNA clone
           MGC:105408 IMAGE:7308070), complete cds
          Length = 640

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 65/75 (86%)
 Strand = Plus / Minus

                                                                       
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctgg 283
           |||||| |||| ||||||||| |||||||| || |||||||||||||||||   ||||||
Sbjct: 532 ctcgaacttccggcccttggaacggacatagggtttggtgtggctgtgtggagttcctgg 473

                          
Query: 284 agctttgccaaagtg 298
            || |||||||||||
Sbjct: 472 ggccttgccaaagtg 458

---

>emb|CR722630.2|CNS0GKJ0 Tetraodon nigroviridis full-length cDNA
          Length = 622

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||| ||||| ||||||||||||||||| ||   |||||| ||||| 
Sbjct: 516 ttcctgcccttggagcgcacatagggcttggtgtggctgtgaggagttcctggggctttt 457

                      
Query: 291 ccaaagtgcct 301
           || ||||||||
Sbjct: 456 ccgaagtgcct 446

---

>emb|CR710189.2|CNS0GAXL Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| |||||| |||||||||| ||   ||| || ||||| 
Sbjct: 539 ttcctgcccttggagcggacatagggcttgatgtggctgtgaggagttccaggggctttt 480

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 479 ccaaagtgcct 469

---

>emb|CR707928.2|CNS0G96S Tetraodon nigroviridis full-length cDNA
          Length = 617

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| |||| |||||||||||| ||   ||| || ||||| 
Sbjct: 516 ttcctgcccttggagcggacatagggctcggtgtggctgtgaggagttccaggggctttt 457

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 456 ccaaagtgcct 446

---

>emb|CR704690.2|CNS0G6OU Tetraodon nigroviridis full-length cDNA
          Length = 617

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| ||||||||||||| ||| ||   ||| || ||||| 
Sbjct: 516 ttcctgcccttggagcggacatagggcttggtgtggccgtgaggagttccaggggctttt 457

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 456 ccaaagtgcct 446

---

>emb|CR659514.2|CNS0F7UO Tetraodon nigroviridis full-length cDNA
          Length = 646

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||||||||||||||||| || |||||||||||||| ||   ||| || ||||| 
Sbjct: 545 ttcctgcccttggagcggacatagggtttggtgtggctgtgaggagttccaggggctttt 486

                      
Query: 291 ccaaagtgcct 301
           |||||||||||
Sbjct: 485 ccaaagtgcct 475

---

>emb|CR634249.2|CNS0EOCV Tetraodon nigroviridis full-length cDNA
          Length = 639

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           ||||||||| ||||||||||||| ||||||||||||||||| ||   |||||| ||||| 
Sbjct: 538 ttcctgcccctggagcggacatagggcttggtgtggctgtgaggagttcctggggctttt 479

                      
Query: 291 ccaaagtgcct 301
           || ||||||||
Sbjct: 478 ccgaagtgcct 468

---

>ref|NM_031102.1| Rattus norvegicus ribosomal protein L18 (Rpl18), mRNA
          Length = 607

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 65/75 (86%)
 Strand = Plus / Minus

                                                                       
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctgg 283
           |||||| |||| ||||||||| |||||||| || |||||||||||||||||   ||||||
Sbjct: 526 ctcgaacttccggcccttggaacggacatagggtttggtgtggctgtgtggagttcctgg 467

                          
Query: 284 agctttgccaaagtg 298
            || |||||||||||
Sbjct: 466 ggccttgccaaagtg 452

---

>gb|M20156.1|RATRPL18A Rat ribosomal protein L18 mRNA, complete cds
          Length = 607

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 65/75 (86%)
 Strand = Plus / Minus

                                                                       
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctgg 283
           |||||| |||| ||||||||| |||||||| || |||||||||||||||||   ||||||
Sbjct: 526 ctcgaacttccggcccttggaacggacatagggtttggtgtggctgtgtggagttcctgg 467

                          
Query: 284 agctttgccaaagtg 298
            || |||||||||||
Sbjct: 466 ggccttgccaaagtg 452

---

>gb|BC076332.1| Danio rerio zgc:92872, mRNA (cDNA clone MGC:92872 IMAGE:7117835),
           complete cds
          Length = 655

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 67/78 (85%)
 Strand = Plus / Minus

                                                                       
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctgg 283
           |||||| |||||||| |||||||| ||||| ||||||||||||||||| ||   ||| ||
Sbjct: 556 ctcgaacttcctgcctttggagcgcacatagggcttggtgtggctgtgaggggttccagg 497

                             
Query: 284 agctttgccaaagtgcct 301
           |||||| ||||| |||||
Sbjct: 496 agctttcccaaaatgcct 479

---

>ref|NM_001003432.1| Danio rerio zgc:92872 (zgc:92872), mRNA
          Length = 655

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 67/78 (85%)
 Strand = Plus / Minus

                                                                       
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctgg 283
           |||||| |||||||| |||||||| ||||| ||||||||||||||||| ||   ||| ||
Sbjct: 556 ctcgaacttcctgcctttggagcgcacatagggcttggtgtggctgtgaggggttccagg 497

                             
Query: 284 agctttgccaaagtgcct 301
           |||||| ||||| |||||
Sbjct: 496 agctttcccaaaatgcct 479

---

>emb|BX822675.1|CNS0A7MK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB57ZH02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 722

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 88/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 181 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 240
           ||||||||||||| || |  || |||||| ||||||| ||||||||||| ||||| ||||
Sbjct: 563 cttaaaccttgaatccacgactcttcctctttcctctggccttctcgaacttccttccct 504

                                                         
Query: 241 tggagcggacatatggcttggtgtggctgtgtggcactcctggagc 286
           |||  || ||||||||||||| ||  |||| |||||| || |||||
Sbjct: 503 tggcccgaacatatggcttggagttactgtatggcacaccaggagc 458

---

>gb|AY190744.1| Pagrus major ribosomal protein L18 mRNA, partial cds
          Length = 674

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 223 tctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           ||||||| |||||||||||||||||||  || |||||||||||||||||
Sbjct: 527 tctcgaacttcctgcccttggagcggatgtagggcttggtgtggctgtg 479

---

>emb|CR643404.2|CNS0EVF6 Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 36/37 (97%)
 Strand = Plus / Minus

                                                
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggc 267
           ||||||||||||||||||||||| |||||||||||||
Sbjct: 539 ttcctgcccttggagcggacatagggcttggtgtggc 503

---

>emb|AJ004961.1|CAA004961 Cicer arietinum mRNA for cytoplasmic ribosomal protein L18
          Length = 714

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 75/89 (84%)
 Strand = Plus / Minus

                                                                       
Query: 198 ctgctgttcctccttcctcttgccttctcgaatttcctgcccttggagcggacatatggc 257
           ||||| || ||||| ||||| |||||||| |||||||| ||||| || |  ||||| |||
Sbjct: 537 ctgctctttctcctccctctagccttctcaaatttccttccctttgacctaacataaggc 478

                                        
Query: 258 ttggtgtggctgtgtggcactcctggagc 286
           ||||| |||||||||||||| || |||||
Sbjct: 477 ttggtatggctgtgtggcacaccaggagc 449

---

>ref|XM_512797.1| PREDICTED: Pan troglodytes similar to ribosomal protein L18; 60S
           ribosomal protein L18 (LOC456183), mRNA
          Length = 665

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           |||||| |||| |||||||||||||||||| || ||||||||||||||
Sbjct: 562 ctcgaacttccggcccttggagcggacatagggtttggtgtggctgtg 515

---

>emb|AJ306691.1|SSA306691 Salmo salar partial mRNA for L18 ribosomal protein (l18 gene)
          Length = 541

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtgg 274
           ||||||||||||||||| || || ||||||||||||||||||||
Sbjct: 497 ttcctgcccttggagcgaacgtagggcttggtgtggctgtgtgg 454

---

>ref|XM_527867.1| PREDICTED: Pan troglodytes similar to ribosomal protein L18; 60S
           ribosomal protein L18 (LOC472492), mRNA
          Length = 789

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgtgg 274
           |||||| |||| ||||||||||||||| || || |||||||||||||||||
Sbjct: 747 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtgtgg 697

---

>gb|AC074085.7| Homo sapiens BAC clone RP11-3L10 from 7, complete sequence
          Length = 155260

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                                
Query: 224   ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgtgg 274
             |||||| |||| ||||||||||||||| || || |||||||||||||||||
Sbjct: 43627 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtgtgg 43677

---

>ref|XM_374646.3| PREDICTED: Homo sapiens similar to ribosomal protein L18
           (LOC392979), mRNA
          Length = 501

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgtgg 274
           |||||| |||| ||||||||||||||| || || |||||||||||||||||
Sbjct: 459 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtgtgg 409

---

>ref|XM_937605.1| PREDICTED: Homo sapiens similar to ribosomal protein L18
           (LOC392979), mRNA
          Length = 501

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgtgg 274
           |||||| |||| ||||||||||||||| || || |||||||||||||||||
Sbjct: 459 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtgtgg 409

---

>ref|XM_069734.4| PREDICTED: Homo sapiens similar to ribosomal protein L18
           (LOC136143), mRNA
          Length = 480

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgtgg 274
           |||||| |||| ||||||||||||||| || || |||||||||||||||||
Sbjct: 438 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtgtgg 388

---

>dbj|AB169565.1| Macaca fascicularis brain cDNA, clone: QflA-13958, similar to human
           ribosomal protein L18 (RPL18), mRNA, RefSeq: NM_000979.2
          Length = 664

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgtgg 274
           |||||| |||| ||||||||||||||| || || |||||||||||||||||
Sbjct: 563 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtgtgg 513

---

>dbj|AK174004.1| Ciona intestinalis cDNA, clone:ciad012g12, full insert sequence
          Length = 630

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 249 acatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgc 299
           |||||||| |||||||| || |||||||| |||||||||||||| ||||||
Sbjct: 494 acatatggtttggtgtgactatgtggcacgcctggagctttgccgaagtgc 444

---

>dbj|AK110540.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-168-B02, full
           insert sequence
          Length = 1006

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 366 agggcgagctggtcaaaggtaaggcactcgccaccagcgttgacaat 412
           ||||| |||||||||||||| |||||||| |||||||| ||||||||
Sbjct: 425 agggccagctggtcaaaggtgaggcactcaccaccagccttgacaat 379

---

>ref|NM_000979.2| Homo sapiens ribosomal protein L18 (RPL18), mRNA
          Length = 648

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 558 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 511

---

>gb|AY389963.1| Gallus gallus ribosomal protein L18 mRNA, partial cds
          Length = 499

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           |||||| |||| |||||||||||| || || |||||||||||||||||
Sbjct: 487 ctcgaacttccggcccttggagcgcacgtagggcttggtgtggctgtg 440



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 581 gctcatgaagagccgcttcag 601
           |||||||||||||||||||||
Sbjct: 124 gctcatgaagagccgcttcag 104

---

>gb|BC000374.2| Homo sapiens ribosomal protein L18, mRNA (cDNA clone MGC:8373
           IMAGE:2820119), complete cds
          Length = 648

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 532 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 485

---

>gb|DQ489378.1| Homo sapiens heat shock 70kDa protein 2 (HSPA2) gene, complete cds
          Length = 11093

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                            
Query: 224  ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
            |||||| |||| ||||||||||| |||||| || ||||||||||||||
Sbjct: 1542 ctcgaacttccagcccttggagcagacatagggtttggtgtggctgtg 1589

---

>gb|BC051359.1| Homo sapiens cDNA clone IMAGE:6646239, **** WARNING: chimeric clone
            ****
          Length = 1234

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 224  ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
            |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 1134 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 1087

---

>gb|BC021743.2| Homo sapiens ribosomal protein L18, mRNA (cDNA clone MGC:33859
           IMAGE:5261251), complete cds
          Length = 665

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 558 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 511

---

>emb|CR626510.1| full-length cDNA clone CS0DK008YC06 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 639

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 556 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 509

---

>emb|CR623252.1| full-length cDNA clone CS0DI028YB06 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 611

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 528 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 481

---

>emb|CR622915.1| full-length cDNA clone CS0DI003YD02 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1606

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 224  ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
            |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 1559 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 1512

---

>emb|CR614681.1| full-length cDNA clone CS0DD008YG13 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 604

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 523 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 476

---

>emb|CR609223.1| full-length cDNA clone CS0DM004YL12 of Fetal liver of Homo sapiens
           (human)
          Length = 611

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 528 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 481

---

>emb|CR608718.1| full-length cDNA clone CS0DM014YN06 of Fetal liver of Homo sapiens
           (human)
          Length = 606

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 528 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 481

---

>emb|CR602585.1| full-length cDNA clone CS0DD002YH22 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 611

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 528 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 481

---

>emb|CR601070.1| full-length cDNA clone CS0DC010YK01 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 628

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 545 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 498

---

>emb|CR600364.1| full-length cDNA clone CS0DI084YG06 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 612

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 529 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 482

---

>emb|CR600341.1| full-length cDNA clone CS0DJ007YF01 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 628

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 545 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 498

---

>emb|CR598496.1| full-length cDNA clone CS0DF016YB08 of Fetal brain of Homo sapiens
           (human)
          Length = 687

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 556 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 509

---

>emb|CR597869.1| full-length cDNA clone CS0DI006YF05 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 628

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 545 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 498

---

>emb|CR591878.1| full-length cDNA clone CS0DB002YN19 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 631

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 545 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 498

---

>emb|CR591552.1| full-length cDNA clone CS0DL006YH09 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 639

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 556 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 509

---

>emb|CR590122.1| full-length cDNA clone CS0DI081YM04 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 637

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 556 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 509

---

>emb|BX933065.2| Gallus gallus finished cDNA, clone ChEST914g7
          Length = 665

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           |||||| |||| |||||||||||| || || |||||||||||||||||
Sbjct: 532 ctcgaacttccggcccttggagcgcacgtagggcttggtgtggctgtg 485



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 581 gctcatgaagagccgcttcag 601
           |||||||||||||||||||||
Sbjct: 172 gctcatgaagagccgcttcag 152

---

>emb|BX932992.2| Gallus gallus finished cDNA, clone ChEST1005i18
          Length = 755

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           |||||| |||| |||||||||||| || || |||||||||||||||||
Sbjct: 621 ctcgaacttccggcccttggagcgcacgtagggcttggtgtggctgtg 574



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 581 gctcatgaagagccgcttcag 601
           |||||||||||||||||||||
Sbjct: 258 gctcatgaagagccgcttcag 238

---

>dbj|AK026558.1| Homo sapiens cDNA: FLJ22905 fis, clone KAT05654, highly similar to
           HUMRPL18A Homo sapiens ribosomal protein L18 (RPL18)
           mRNA
          Length = 656

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 558 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 511

---

>gb|BC009708.2| Homo sapiens ribosomal protein L18, mRNA (cDNA clone MGC:9403
           IMAGE:3878799), complete cds
          Length = 648

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 546 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 499

---

>emb|AL049869.6|CNS0000P Human chromosome 14 DNA sequence BAC R-973N13 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 195840

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                              
Query: 224    ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
              |||||| |||| ||||||||||| |||||| || ||||||||||||||
Sbjct: 144142 ctcgaacttccagcccttggagcagacatagggtttggtgtggctgtg 144095

---

>gb|AY610456.1| Sus scrofa clone rmed27c_g16.y1.abd, mRNA sequence
          Length = 599

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           |||||| |||| |||||||||||| ||||| || ||||||||||||||
Sbjct: 554 ctcgaacttccggcccttggagcgaacatagggtttggtgtggctgtg 507

---

>gb|L11566.1|HUMRPL18A Homo sapiens ribosomal protein L18 (RPL18) mRNA, complete cds
          Length = 630

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 540 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 493

---

>ref|NM_130325.1| Arabidopsis thaliana structural constituent of ribosome AT2G47570
           mRNA, complete cds
          Length = 408

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 127/158 (80%), Gaps = 3/158 (1%)
 Strand = Plus / Minus

                                                                       
Query: 249 acatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcctaacagct 308
           ||||| || |||||||||||||| ||||| || ||||||   ||||||||| | || |||
Sbjct: 341 acatacggtttggtgtggctgtgaggcacaccaggagctggtccaaagtgcttcactgct 282

                                                                       
Query: 309 tccctggcgttcttgggacccctcaggagaagcgtgt--tctgtccaagcggagcacgg- 365
           || |  | |||||| ||||| || || |||| |||||  |||| ||||| || |||||| 
Sbjct: 281 tcacgtgtgttcttaggacctctaagcagaaccgtgttctctgaccaagtggggcacgga 222

                                                 
Query: 366 agggcgagctggtcaaaggtaaggcactcgccaccagc 403
           || |||||||| ||||| || |||||||| ||||||||
Sbjct: 221 agagcgagctgatcaaaagtgaggcactctccaccagc 184

---

>gb|AC009517.6| Homo sapiens chromosome 7 clone RP11-181K7, complete sequence
          Length = 141395

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                            
Query: 224   ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgt 270
             |||||| |||| ||||||||||||||  ||||| |||||||||||||
Sbjct: 78821 ctcgaacttccggcccttggagcggatgtatggtttggtgtggctgt 78775

---

>emb|AL591143.11| Mouse DNA sequence from clone RP23-210L24 on chromosome 11 Contains the
             5' end of the Abr gene for active BCR-related protein, a
             ribosomal protein L18 (Rpl18) pseudogene, a ribosomal
             protein L36 (Rpl36) pseudogene and four CpG islands,
             complete sequence
          Length = 212940

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                         
Query: 231   ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
             |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 70361 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 70302

                        
Query: 291   ccaaagtgcct 301
             ||||| |||||
Sbjct: 70301 ccaaaatgcct 70291

---

>gb|AY389931.1| Latimeria chalumnae ribosomal protein L18-like mRNA, partial
           sequence
          Length = 497

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 237 cccttggagcggacatatggcttggtgtggctgtgtgg 274
           ||||||||||| ||||| |||||||| |||||||||||
Sbjct: 480 cccttggagcgcacatagggcttggtatggctgtgtgg 443

---

>emb|AJ563457.1|CGI563457 Crassostrea gigas partial mRNA for ribosomal protein L18 (rpl18
           gene)
          Length = 573

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 207 ctccttcctcttgccttctcgaatttcctgcccttggagcggacatatgg 256
           |||||||||||| ||||||| || ||||| ||||||||||| || |||||
Sbjct: 548 ctccttcctcttcccttctcaaacttccttcccttggagcgcacgtatgg 499

---

>gb|AC124505.4| Mus musculus BAC clone RP23-421P23 from 7, complete sequence
          Length = 222439

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                         
Query: 231   ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
             |||| ||||||||| |||||||| || |||| |||||||||||    ||||||||| |||
Sbjct: 90635 ttccggcccttggaccggacatagggtttggggtggctgtgtgtggttcctggagccttg 90576

                       
Query: 291   ccaaagtgcc 300
             ||||| ||||
Sbjct: 90575 ccaaaatgcc 90566

---

>gb|AY486772.1| Hevea brasiliensis clone gHbCIRT2617 microsatellite sequence
          Length = 591

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 577 tcttgctcatgaagagccgcttcaggatcaccg 609
           |||||||||||||||| |||||||| |||||||
Sbjct: 520 tcttgctcatgaagagtcgcttcagaatcaccg 552

---

>gb|AC128270.3| Rattus norvegicus 12 BAC CH230-48A22 (Children's Hospital Oakland
             Research Institute Rat (BN/SsNHsd/MCW) BAC library)
             complete sequence
          Length = 236843

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                              
Query: 224   ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgt 272
             |||||| |||| ||||||||| | |||||| || |||||||||||||||
Sbjct: 42386 ctcgaacttccggcccttggaacagacatagggtttggtgtggctgtgt 42338

---

>gb|AC116573.7| Mus musculus BAC clone RP23-114E15 from chromosome 6, complete sequence
          Length = 211910

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                         
Query: 231   ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
             |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 94871 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 94812

                  
Query: 291   ccaaa 295
             |||||
Sbjct: 94811 ccaaa 94807

---

>gb|BC072558.1| Mus musculus ribosomal protein L18, mRNA (cDNA clone IMAGE:5685697),
            partial cds
          Length = 3034

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                        
Query: 231  ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
            |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 2893 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 2834

                 
Query: 291  ccaaa 295
            |||||
Sbjct: 2833 ccaaa 2829

---

>ref|NM_009077.2| Mus musculus ribosomal protein L18 (Rpl18), mRNA
          Length = 708

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 584 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 525

                
Query: 291 ccaaa 295
           |||||
Sbjct: 524 ccaaa 520

---

>ref|NM_001015556.2| Bos taurus ribosomal protein L18 (RPL18), mRNA
          Length = 773

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggct 268
           |||||| |||| ||||||||||||||| || || |||||||||||
Sbjct: 548 ctcgaacttccggcccttggagcggacgtagggtttggtgtggct 504

---

>ref|XM_001002512.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L18
           (LOC672898), mRNA
          Length = 945

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 854 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 795

                
Query: 291 ccaaa 295
           |||||
Sbjct: 794 ccaaa 790

---

>dbj|AK149813.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:G530019P09 product:procollagen-lysine,
            2-oxoglutarate 5-dioxygenase 1, full insert sequence
          Length = 3565

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                        
Query: 231  ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
            |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 3478 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 3419

                 
Query: 291  ccaaa 295
            |||||
Sbjct: 3418 ccaaa 3414

---

>dbj|AK151667.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830033B22 product:ribosomal
           protein L18, full insert sequence
          Length = 641

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 554 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 495

                
Query: 291 ccaaa 295
           |||||
Sbjct: 494 ccaaa 490

---

>gb|BC104507.1| Bos taurus ribosomal protein L18, mRNA (cDNA clone MGC:129138
           IMAGE:8122333), complete cds
          Length = 773

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggct 268
           |||||| |||| ||||||||||||||| || || |||||||||||
Sbjct: 548 ctcgaacttccggcccttggagcggacgtagggtttggtgtggct 504

---

>dbj|AK145649.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0026A12 product:ribosomal protein L18,
           full insert sequence
          Length = 675

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 585 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 526

                
Query: 291 ccaaa 295
           |||||
Sbjct: 525 ccaaa 521

---

>dbj|AK166803.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0014M02 product:ribosomal protein L18,
           full insert sequence
          Length = 638

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 554 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 495

                
Query: 291 ccaaa 295
           |||||
Sbjct: 494 ccaaa 490

---

>dbj|AK153172.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830126C06 product:ribosomal
           protein L18, full insert sequence
          Length = 636

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 552 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 493

                
Query: 291 ccaaa 295
           |||||
Sbjct: 492 ccaaa 488

---

>dbj|AK169659.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430004N22
           product:ribosomal protein L18, full insert sequence
          Length = 640

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 552 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 493

                
Query: 291 ccaaa 295
           |||||
Sbjct: 492 ccaaa 488

---

>dbj|AK168288.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730080N03 product:ribosomal protein L18, full
           insert sequence
          Length = 642

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 552 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 493

                
Query: 291 ccaaa 295
           |||||
Sbjct: 492 ccaaa 488

---

>dbj|AK010510.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2410015P13 product:ribosomal protein L18, full
           insert sequence
          Length = 642

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 552 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 493

                
Query: 291 ccaaa 295
           |||||
Sbjct: 492 ccaaa 488

---

>dbj|AK009044.1| Mus musculus adult male tongue cDNA, RIKEN full-length enriched
           library, clone:2300008F05 product:ribosomal protein L18,
           full insert sequence
          Length = 642

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 555 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 496

                
Query: 291 ccaaa 295
           |||||
Sbjct: 495 ccaaa 491

---

>dbj|AK012580.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2700088D17 product:ribosomal
           protein L18, full insert sequence
          Length = 636

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 552 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 493

                
Query: 291 ccaaa 295
           |||||
Sbjct: 492 ccaaa 488

---

>dbj|AK007263.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:1700124C09 product:ribosomal protein L18,
           full insert sequence
          Length = 638

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 554 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 495

                
Query: 291 ccaaa 295
           |||||
Sbjct: 494 ccaaa 490

---

>gb|BC090154.1| Xenopus laevis cDNA clone MGC:98504 IMAGE:7198701, complete cds
          Length = 750

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 539 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 480

                
Query: 291 ccaaa 295
           |||||
Sbjct: 479 ccaaa 475

---

>gb|BC090155.1| Xenopus laevis cDNA clone MGC:98507 IMAGE:7198715, complete cds
          Length = 644

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 539 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 480

                
Query: 291 ccaaa 295
           |||||
Sbjct: 479 ccaaa 475

---

>gb|BC091732.1| Mus musculus ribosomal protein L18, mRNA (cDNA clone MGC:102603
           IMAGE:2655484), complete cds
          Length = 638

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 530 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 471

                
Query: 291 ccaaa 295
           |||||
Sbjct: 470 ccaaa 466

---

>emb|AL732452.5| Mouse DNA sequence from clone RP23-177C20 on chromosome 2, complete
             sequence
          Length = 190165

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                         
Query: 231   ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
             |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 90401 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 90460

                  
Query: 291   ccaaa 295
             |||||
Sbjct: 90461 ccaaa 90465

---

>gb|BT021047.1| Bos taurus ribosomal protein L18 (RPL18), mRNA, complete cds
          Length = 629

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggct 268
           |||||| |||| ||||||||||||||| || || |||||||||||
Sbjct: 547 ctcgaacttccggcccttggagcggacgtagggtttggtgtggct 503

---

>gb|BC082290.1| Mus musculus ribosomal protein L18, mRNA (cDNA clone MGC:102572
           IMAGE:6485569), complete cds
          Length = 643

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 538 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 479

                
Query: 291 ccaaa 295
           |||||
Sbjct: 478 ccaaa 474

---

>gb|BC081468.1| Mus musculus ribosomal protein L18, mRNA (cDNA clone MGC:102181
           IMAGE:6823249), complete cds
          Length = 666

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 542 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 483

                
Query: 291 ccaaa 295
           |||||
Sbjct: 482 ccaaa 478

---

>ref|NG_005371.1| Mus musculus ribosomal protein L18 pseudogene (LOC652986) on
           chromosome 6
          Length = 809

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 639 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 580

                
Query: 291 ccaaa 295
           |||||
Sbjct: 579 ccaaa 575

---

>gb|DQ160027.1| Taraxacum officinale TO23-2rc (To23-2rc) mRNA, partial cds
          Length = 306

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 396 ccaccagcgttgacaatcctggccctcgccgtctcggtgaacct 439
           |||||||| ||  ||||||||||||| || ||||||||||||||
Sbjct: 273 ccaccagccttttcaatcctggccctggcagtctcggtgaacct 230



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 579 ttgctcatgaagagccgcttcaggatcac 607
           |||||||||||||||| |||||| |||||
Sbjct: 90  ttgctcatgaagagcctcttcagtatcac 62

---

>gb|AF240376.1|AF240376 Tilapia mossambica ribosomal protein L18 (L18) gene, complete cds
          Length = 5828

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 223  tctcgaatttcctgcccttggagcggac 250
            ||||||| ||||||||||||||||||||
Sbjct: 5408 tctcgaacttcctgcccttggagcggac 5381

---

>gb|AC010528.8|AC010528 Homo sapiens chromosome 16 clone RP11-150D5, complete sequence
          Length = 168172

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                              
Query: 224    ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
              |||||| |||| |||||||||| |||| || || ||||||||||||||
Sbjct: 154945 ctcgaacttccggcccttggagtggacgtagggtttggtgtggctgtg 154898

---

>ref|NM_070254.2| Caenorhabditis elegans Ribosomal Protein, Large subunit family
           member (rpl-18) (rpl-18) mRNA, complete cds
          Length = 666

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 252 tatggcttggtgtggctgtgtggcactcctggagct 287
           |||||||||||||||  |||||| ||||||||||||
Sbjct: 530 tatggcttggtgtgggagtgtgggactcctggagct 495

---

>gb|AC011194.15|AC011194 Mus musculus chromosome 11, clone RP23-196F5, complete sequence
          Length = 181320

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                         
Query: 231   ttcctgcccttggagcggacatatggcttggtgtggctgtgtgg 274
             |||| ||||||||| |||||||| || ||||| |||||||||||
Sbjct: 44918 ttccagcccttggaacggacatagggtttggtatggctgtgtgg 44875

---

>gb|AY205233.1| Medicago sativa 60S ribosomal protein mRNA, partial cds
          Length = 544

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                       
Query: 372 agctggtcaaaggtaaggcactcgccaccagcgttgacaatcctggccctcgccgtctcg 431
           ||||| |||||||| |||||||| |||||||| ||  |||| || ||||| ||| | |||
Sbjct: 425 agctgatcaaaggtgaggcactccccaccagccttctcaattctagccctggccttttcg 366

                   
Query: 432 gtgaacct 439
           ||||||||
Sbjct: 365 gtgaacct 358

---

>gb|AC009046.4|AC009046 Homo sapiens chromosome 16 clone RP11-200H5, complete sequence
          Length = 153562

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                             
Query: 224   ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 271
             |||||| |||| |||||||||| |||| || || ||||||||||||||
Sbjct: 50820 ctcgaacttccggcccttggagtggacgtagggtttggtgtggctgtg 50867

---

>emb|AL021492.1|CEY45F10D Caenorhabditis elegans YAC Y45F10D, complete sequence
          Length = 59573

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                 
Query: 252   tatggcttggtgtggctgtgtggcactcctggagct 287
             |||||||||||||||  |||||| ||||||||||||
Sbjct: 18922 tatggcttggtgtgggagtgtgggactcctggagct 18887

---

>emb|AL645478.15| Mouse DNA sequence from clone RP23-85A17 on chromosome 11, complete
             sequence
          Length = 121560

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                         
Query: 231   ttcctgcccttggagcggacatatggcttggtgtggctgtgtgg 274
             |||| ||||||||| |||||||| || ||||| |||||||||||
Sbjct: 63740 ttccagcccttggaacggacatagggtttggtatggctgtgtgg 63697

---

>gb|DQ213610.1| Taeniopygia guttata clone 0058P0027B10 ribosomal protein L18-like
           mRNA, complete sequence
          Length = 804

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 237 cccttggagcggacatatggcttggtgtggctgtg 271
           ||||||||||| || || |||||||||||||||||
Sbjct: 677 cccttggagcgcacgtagggcttggtgtggctgtg 643

---

>ref|XM_537965.2| PREDICTED: Canis familiaris similar to ribosomal protein L18
           (LOC480848), mRNA
          Length = 659

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 62/75 (82%)
 Strand = Plus / Minus

                                                                       
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctgg 283
           |||||| |||| ||||||||| |  || || || |||||||||||||||||   ||||||
Sbjct: 566 ctcgaacttccggcccttggatctcacgtagggtttggtgtggctgtgtggggttcctgg 507

                          
Query: 284 agctttgccaaagtg 298
            || |||||||||||
Sbjct: 506 ggccttgccaaagtg 492

---

>gb|AF481060.1| Aplysia californica 60S ribosomal protein L18 mRNA, complete cds
          Length = 363

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 357 ggagcacggagggcgagctggtcaaaggtaa 387
           ||||||||||| || ||||||||||||||||
Sbjct: 188 ggagcacggagagcaagctggtcaaaggtaa 158

---

>ref|XM_541138.2| PREDICTED: Canis familiaris similar to ribosomal protein L18
           (LOC484021), mRNA
          Length = 647

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 62/75 (82%)
 Strand = Plus / Minus

                                                                       
Query: 224 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctgg 283
           |||||| |||| ||||||||| |  || || || |||||||||||||||||   ||||||
Sbjct: 551 ctcgaacttccggcccttggatctcacgtagggtttggtgtggctgtgtggggttcctgg 492

                          
Query: 284 agctttgccaaagtg 298
            || |||||||||||
Sbjct: 491 ggccttgccaaagtg 477

---

>gb|AF159901.1|AF159901 Lapemis hardwickii ribosomal protein L14 mRNA, partial cds
          Length = 494

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 237 cccttggagcggacatatggcttggtgtggctgtg 271
           |||||||| |||||||||||||| ||||| |||||
Sbjct: 352 cccttggatcggacatatggcttagtgtgactgtg 318

---

>dbj|AK221052.1| Arabidopsis thaliana mRNA for hypothetical protein, partial cds,
           clone: RAFL22-76-K07
          Length = 204

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 181 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcct 235
           ||||||||||||| || |  || |||||| ||||||| ||||||||||| |||||
Sbjct: 56  cttaaaccttgaatccacgactcttcctctttcctctggccttctcgaacttcct 2

---

>gb|AC007207.22| Homo sapiens 12 BAC RP11-320N7 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 191877

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                    
Query: 236   gcccttggagcggacatatggcttggtgtggctgtgtgg 274
             |||||||| | ||||||| || |||||||||||||||||
Sbjct: 91314 gcccttggggtggacatagggtttggtgtggctgtgtgg 91352

---

>ref|NM_122667.2| Arabidopsis thaliana structural constituent of ribosome AT5G27850
           mRNA, complete cds
          Length = 878

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 342 gtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacca 401
           ||||||||||| |  ||||| | ||| || |||||||||||||| | |||||| ||||||
Sbjct: 417 gtgttctgtcccaatggagctctgagagcaagctggtcaaaggttaagcactctccacca 358

             
Query: 402 gc 403
           ||
Sbjct: 357 gc 356

---

>ref|XM_533629.2| PREDICTED: Canis familiaris similar to ribosomal protein L18
           (LOC476422), mRNA
          Length = 531

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 257 cttggtgtggctgtgtggcactcctggagctttgccaaagtg 298
           ||||||||||||||||||   |||||| || |||||||||||
Sbjct: 528 cttggtgtggctgtgtggggttcctggggccttgccaaagtg 487

---

>gb|BT000711.1| Arabidopsis thaliana clone RAFL09-17-C05 (R09425) putative 60S
           ribosomal protein (At5g27850) mRNA, complete cds
          Length = 775

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 342 gtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacca 401
           ||||||||||| |  ||||| | ||| || |||||||||||||| | |||||| ||||||
Sbjct: 416 gtgttctgtcccaatggagctctgagagcaagctggtcaaaggttaagcactctccacca 357

             
Query: 402 gc 403
           ||
Sbjct: 356 gc 355

---

>gb|AY122996.1| Arabidopsis thaliana putative 60S ribosomal protein (At5g27850)
           mRNA, complete cds
          Length = 595

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 342 gtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacca 401
           ||||||||||| |  ||||| | ||| || |||||||||||||| | |||||| ||||||
Sbjct: 404 gtgttctgtcccaatggagctctgagagcaagctggtcaaaggttaagcactctccacca 345

             
Query: 402 gc 403
           ||
Sbjct: 344 gc 343

---

>gb|AY056141.1| Arabidopsis thaliana putative 60S ribosomal protein (At5g27850)
           mRNA, complete cds
          Length = 893

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 342 gtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacca 401
           ||||||||||| |  ||||| | ||| || |||||||||||||| | |||||| ||||||
Sbjct: 416 gtgttctgtcccaatggagctctgagagcaagctggtcaaaggttaagcactctccacca 357

             
Query: 402 gc 403
           ||
Sbjct: 356 gc 355

---

>gb|AC022748.10| Homo sapiens chromosome 15, clone RP11-160C18, complete sequence
          Length = 163642

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                          
Query: 231    ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
              |||| ||||||||||||||| || |  |||||||||||||| |||  |||||| || |||
Sbjct: 155692 ttccggcccttggagcggacgtaggctttggtgtggctgtgcggcgttcctggggccttg 155633

                
Query: 291    cc 292
              ||
Sbjct: 155632 cc 155631

---

>gb|AC136191.5| Rattus norvegicus  BAC CH230-52I17 (Children's Hospital Oakland
             Research Institute Rat (BN/SsNHsd/MCW) BAC library)
             complete sequence
          Length = 221923

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                       
Query: 257   cttggtgtggctgtgtggcactcctggagctttgccaaagtg 298
             ||||||||||||||||||   |||||| || |||||||||||
Sbjct: 14896 cttggtgtggctgtgtggagttcctggggccttgccaaagtg 14937

---

>gb|DQ066324.1| Ixodes scapularis isolate IS-6-12L-136 ribosomal protein L18 mRNA,
           complete cds
          Length = 567

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 237 cccttggagcggacatatggcttggtgtggctgtgtgg 274
           |||||||| || || || ||||||||||||||||||||
Sbjct: 512 cccttggaccgcacgtacggcttggtgtggctgtgtgg 475

---

>emb|BX832577.1|CNS0A1WZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH81ZE08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 644

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 342 gtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacca 401
           ||||||||||| |  ||||| | ||| || |||||||||||||| | |||||| ||||||
Sbjct: 253 gtgttctgtcccaatggagctctgagagcaagctggtcaaaggttaagcactctccacca 194

             
Query: 402 gc 403
           ||
Sbjct: 193 gc 192

---

>gb|AC067863.19| Homo sapiens chromosome 15, clone RP11-335K5, complete sequence
          Length = 111700

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                          
Query: 231    ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 290
              |||| ||||||||||||||| || |  |||||||||||||| |||  |||||| || |||
Sbjct: 102278 ttccggcccttggagcggacgtaggctttggtgtggctgtgcggcgttcctggggccttg 102337

                
Query: 291    cc 292
              ||
Sbjct: 102338 cc 102339

---

>gb|AC007399.1|AC007399 Arabidopsis thaliana BAC F14I23 from chromosome V near 69 cM,
            complete sequence
          Length = 105223

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                        
Query: 342  gtgttctgtccaagcggagcacggagggcgagctggtcaaaggtaaggcactcgccacca 401
            ||||||||||| |  ||||| | ||| || |||||||||||||| | |||||| ||||||
Sbjct: 3583 gtgttctgtcccaatggagctctgagagcaagctggtcaaaggttaagcactctccacca 3524

              
Query: 402  gc 403
            ||
Sbjct: 3523 gc 3522

---

>gb|AC166939.2| Mus musculus BAC clone RP23-72K19 from chromosome 8, complete sequence
          Length = 236510

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 626    tggtcctccgcaccaggaagc 646
              |||||||||||||||||||||
Sbjct: 147821 tggtcctccgcaccaggaagc 147841

---

>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome
          Length = 5178466

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 442   gcgcggccaccttcattgccg 462
             |||||||||||||||||||||
Sbjct: 94266 gcgcggccaccttcattgccg 94286

---

>gb|AC122890.4| Mus musculus BAC clone RP23-63O14 from 8, complete sequence
          Length = 209359

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 626   tggtcctccgcaccaggaagc 646
             |||||||||||||||||||||
Sbjct: 10214 tggtcctccgcaccaggaagc 10234

---

>emb|AL162382.13| Human DNA sequence from clone RP11-248J2 on chromosome 6, complete
             sequence
          Length = 55594

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 61    tgagaactcattgacacagga 81
             |||||||||||||||||||||
Sbjct: 24838 tgagaactcattgacacagga 24858

---

>ref|XM_787988.1| PREDICTED: Strongylocentrotus purpuratus similar to CG10185-PA
            (LOC588296), partial mRNA
          Length = 4296

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 231  ttcctgcccttggagcggaca 251
            |||||||||||||||||||||
Sbjct: 1094 ttcctgcccttggagcggaca 1114

---

>gb|AE011634.1| Xanthomonas axonopodis pv. citri str. 306,  section 12 of 469 of the
            complete genome
          Length = 13286

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 442  gcgcggccaccttcattgccg 462
            |||||||||||||||||||||
Sbjct: 1954 gcgcggccaccttcattgccg 1974

---

>gb|AC023781.5| Homo sapiens chromosome 8, clone RP11-149P24, complete sequence
          Length = 147607

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 115   caaaaaggtgatgataataaa 135
             |||||||||||||||||||||
Sbjct: 52509 caaaaaggtgatgataataaa 52529

---

>dbj|AB180448.1| Plutella xylostella mRNA for Ribosomal protein L18, complete cds
          Length = 564

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 237 cccttggagcggacatatggcttggtgtg 265
           |||||||||||||| || |||||||||||
Sbjct: 513 cccttggagcggacgtagggcttggtgtg 485

---

>gb|L41708.1|PS300427E Eucalyptus globulus bicostata symbiont (F00073) mRNA, ESTun427
          Length = 246

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 179 agcttaaaccttgaagcccctgctgttcctcct 211
           |||| ||||| |||| |||||||||||||||||
Sbjct: 34  agctcaaaccctgaatcccctgctgttcctcct 2

---

>ref|XM_367270.1| Magnaporthe grisea 70-15 hypothetical protein (MG07195.4) partial
           mRNA
          Length = 1371

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 406 tgacaatcctggccctcgcc 425
           ||||||||||||||||||||
Sbjct: 278 tgacaatcctggccctcgcc 297

---

>gb|BC037592.1| Mus musculus sphingosine-1-phosphate phosphatase 1, mRNA (cDNA
           clone MGC:46758 IMAGE:5004335), complete cds
          Length = 3274

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 364 ggagggcgagctggtcaaag 383
           ||||||||||||||||||||
Sbjct: 434 ggagggcgagctggtcaaag 453

---

>gb|AC184800.2| Pan troglodytes chromosome X clone PTB-18K16 map human ortholog p11.23,
              complete sequence
          Length = 142154

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 201    ctgttcctccttcctcttgc 220
              ||||||||||||||||||||
Sbjct: 131062 ctgttcctccttcctcttgc 131043

---

>ref|NM_030750.2| Mus musculus sphingosine-1-phosphate phosphatase 1 (Sgpp1), mRNA
          Length = 3274

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 364 ggagggcgagctggtcaaag 383
           ||||||||||||||||||||
Sbjct: 434 ggagggcgagctggtcaaag 453

---

>ref|XM_452443.1| Kluyveromyces lactis NRRL Y-1140, KLLA0C05478g predicted mRNA
          Length = 408

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 584 catgaagagccgcttcagga 603
           ||||||||||||||||||||
Sbjct: 166 catgaagagccgcttcagga 147

---

>gb|AC163608.2| Mus musculus chromosome 1, clone RP24-185M14, complete sequence
          Length = 161555

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 317   gttcttgggacccctcagga 336
             ||||||||||||||||||||
Sbjct: 80263 gttcttgggacccctcagga 80244

---

>emb|BX927325.15| Zebrafish DNA sequence from clone DKEYP-47G1 in linkage group 7, complete
              sequence
          Length = 208845

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 114    ccaaaaaggtgatgataata 133
              ||||||||||||||||||||
Sbjct: 142376 ccaaaaaggtgatgataata 142395

---

>ref|XM_818117.1| Trypanosoma brucei TREU927 60S ribosomal protein L18
           (Tb10.6k15.0410) partial mRNA
          Length = 582

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 372 agctggtcaaaggtaaggcactcgccaccagc 403
           ||||| |||||||| | |||||||||||||||
Sbjct: 398 agctgatcaaaggttaagcactcgccaccagc 367

---

>ref|XM_742113.1| Aspergillus fumigatus Af293 U5 snRNP component (Afu8g03990) partial
           mRNA
          Length = 3015

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 200 gctgttcctccttcctcttgccttctcg 227
           ||||||||||||||| ||||||| ||||
Sbjct: 586 gctgttcctccttccgcttgcctactcg 559

---

>ref|XM_800023.1| Trypanosoma cruzi strain CL Brener 60S ribosomal protein L18
           (Tc00.1047053503395.40) partial mRNA
          Length = 972

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 369 gcgagctggtcaaaggtaaggcactcgccacc 400
           |||||||||||||| || |||||||| |||||
Sbjct: 791 gcgagctggtcaaacgtcaggcactcaccacc 760

---

>ref|XM_808753.1| Trypanosoma cruzi strain CL Brener 60S ribosomal protein L18
           (Tc00.1047053506181.50) partial mRNA
          Length = 897

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 369 gcgagctggtcaaaggtaaggcactcgccacc 400
           |||||||||||||| || |||||||| |||||
Sbjct: 716 gcgagctggtcaaacgtcaggcactcaccacc 685

---

>gb|AC124363.3| Mus musculus BAC clone RP24-531A9 from chromosome 12, complete sequence
          Length = 134858

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 364   ggagggcgagctggtcaaag 383
             ||||||||||||||||||||
Sbjct: 99218 ggagggcgagctggtcaaag 99237

---

>gb|AC122033.5| Mus musculus BAC clone RP24-403A7 from chromosome 17, complete sequence
          Length = 119877

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                             
Query: 236   gcccttggagcggacatatggcttggtgtggctgtgtggcactcctgg 283
             |||||||||| ||||||| |  ||||| ||||||||||| | ||||||
Sbjct: 80444 gcccttggagtggacataggatttggtatggctgtgtgggattcctgg 80397


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,626,356
Number of Sequences: 3902068
Number of extensions: 4626356
Number of successful extensions: 91795
Number of sequences better than 10.0: 282
Number of HSP's better than 10.0 without gapping: 282
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 91070
Number of HSP's gapped (non-prelim): 699
length of query: 653
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 630
effective length of database: 17,143,297,704
effective search space: 10800277553520
effective search space used: 10800277553520
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---