| Clone Name | rbaal0g10 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_640592.1| Dictyostelium discoideum hypothetical protein (DDB0202825), partial mRNA Length = 4386 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttcatca 288 ||||||||||||||||||||||||| Sbjct: 2637 ctcttcttcttcctcctcttcatca 2613
>ref|XM_851542.1| PREDICTED: Canis familiaris similar to pericentriolar material 1, transcript variant 10 (LOC475618), mRNA Length = 6906 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 263 gctcttcttcttcctcctcttcatc 287 ||||||||||||||||||||||||| Sbjct: 3160 gctcttcttcttcctcctcttcatc 3136
>ref|XM_851501.1| PREDICTED: Canis familiaris similar to pericentriolar material 1, transcript variant 9 (LOC475618), mRNA Length = 6726 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 263 gctcttcttcttcctcctcttcatc 287 ||||||||||||||||||||||||| Sbjct: 3145 gctcttcttcttcctcctcttcatc 3121
>ref|XM_851464.1| PREDICTED: Canis familiaris similar to pericentriolar material 1, transcript variant 8 (LOC475618), mRNA Length = 6960 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 263 gctcttcttcttcctcctcttcatc 287 ||||||||||||||||||||||||| Sbjct: 3145 gctcttcttcttcctcctcttcatc 3121
>ref|XM_851418.1| PREDICTED: Canis familiaris similar to pericentriolar material 1, transcript variant 7 (LOC475618), mRNA Length = 7018 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 263 gctcttcttcttcctcctcttcatc 287 ||||||||||||||||||||||||| Sbjct: 3260 gctcttcttcttcctcctcttcatc 3236
>ref|XM_851378.1| PREDICTED: Canis familiaris similar to pericentriolar material 1, transcript variant 6 (LOC475618), mRNA Length = 6712 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 263 gctcttcttcttcctcctcttcatc 287 ||||||||||||||||||||||||| Sbjct: 2954 gctcttcttcttcctcctcttcatc 2930
>ref|XM_843474.1| PREDICTED: Canis familiaris similar to pericentriolar material 1, transcript variant 2 (LOC475618), mRNA Length = 6783 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 263 gctcttcttcttcctcctcttcatc 287 ||||||||||||||||||||||||| Sbjct: 3043 gctcttcttcttcctcctcttcatc 3019
>ref|XM_851292.1| PREDICTED: Canis familiaris similar to pericentriolar material 1, transcript variant 5 (LOC475618), mRNA Length = 7021 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 263 gctcttcttcttcctcctcttcatc 287 ||||||||||||||||||||||||| Sbjct: 3275 gctcttcttcttcctcctcttcatc 3251
>ref|XM_851252.1| PREDICTED: Canis familiaris similar to pericentriolar material 1, transcript variant 4 (LOC475618), mRNA Length = 7108 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 263 gctcttcttcttcctcctcttcatc 287 ||||||||||||||||||||||||| Sbjct: 3269 gctcttcttcttcctcctcttcatc 3245
>ref|XM_851211.1| PREDICTED: Canis familiaris similar to pericentriolar material 1, transcript variant 3 (LOC475618), mRNA Length = 7135 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 263 gctcttcttcttcctcctcttcatc 287 ||||||||||||||||||||||||| Sbjct: 3377 gctcttcttcttcctcctcttcatc 3353
>ref|XM_532832.2| PREDICTED: Canis familiaris similar to pericentriolar material 1, transcript variant 1 (LOC475618), mRNA Length = 7136 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 263 gctcttcttcttcctcctcttcatc 287 ||||||||||||||||||||||||| Sbjct: 3145 gctcttcttcttcctcctcttcatc 3121
>ref|XM_633332.1| Dictyostelium discoideum hypothetical protein (DDB0186212), partial mRNA Length = 1641 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttcatca 288 |||||||||||||||||||||||| Sbjct: 443 tcttcttcttcctcctcttcatca 420
>ref|XM_629259.1| Dictyostelium discoideum hypothetical protein (DDB0220643), partial mRNA Length = 9216 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttcatc 287 |||||||||||||||||||||||| Sbjct: 657 ctcttcttcttcctcctcttcatc 634
>ref|XM_707954.1| Candida albicans SC5314 hypothetical protein (CaO19.8737), mRNA Length = 3960 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttcatca 288 |||||||||||||||||||||||| Sbjct: 1832 tcttcttcttcctcctcttcatca 1809
>ref|XM_707920.1| Candida albicans SC5314 hypothetical protein (CaO19.1144), mRNA Length = 3366 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttcatca 288 |||||||||||||||||||||||| Sbjct: 1238 tcttcttcttcctcctcttcatca 1215
>emb|CR450831.4| Zebrafish DNA sequence from clone CH211-79O8 in linkage group 11, complete sequence Length = 190163 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttcatc 287 |||||||||||||||||||||||| Sbjct: 158566 ctcttcttcttcctcctcttcatc 158589
>ref|XM_735147.1| Plasmodium chabaudi chabaudi helicase (PC000662.03.0) partial mRNA Length = 1665 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttcatc 287 |||||||||||||||||||||||| Sbjct: 1062 ctcttcttcttcctcctcttcatc 1039
>ref|XM_947409.1| Theileria annulata strain Ankara hypothetical protein (TA11950) partial mRNA Length = 3879 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttcatc 287 |||||||||||||||||||||||| Sbjct: 1113 ctcttcttcttcctcctcttcatc 1090
>ref|XM_674554.1| Plasmodium berghei strain ANKA NAD(P)H-dependent glutamate synthase (PB000874.03.0) partial mRNA Length = 8607 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttcatc 287 |||||||||||||||||||||||| Sbjct: 4809 ctcttcttcttcctcctcttcatc 4786
>ref|XM_779868.1| PREDICTED: Strongylocentrotus purpuratus similar to arginine-glutamic acid dipeptide (RE) repeats (LOC579772), mRNA Length = 4002 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttcatc 287 |||||||||||||||||||||||| Sbjct: 1788 ctcttcttcttcctcctcttcatc 1765
>ref|XM_625389.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd2_200), partial mRNA Length = 972 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttcatca 288 |||||||||||||||||||||||| Sbjct: 659 tcttcttcttcctcctcttcatca 636
>emb|BX004838.8| Zebrafish DNA sequence from clone DKEY-29N1 in linkage group 7, complete sequence Length = 226160 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Plus Query: 261 cggctcttcttcttcctcctcttc 284 |||||||||||||||||||||||| Sbjct: 9704 cggctcttcttcttcctcctcttc 9727
>emb|BX571796.10| Zebrafish DNA sequence from clone DKEY-180P18 in linkage group 4, complete sequence Length = 130699 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttcatc 287 |||||||||||||||||||||||| Sbjct: 116941 ctcttcttcttcctcctcttcatc 116918
>emb|AL837509.11| Mouse DNA sequence from clone RP23-44L6 on chromosome 2, complete sequence Length = 156698 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttcatc 287 |||||||||||||||||||||||| Sbjct: 70225 ctcttcttcttcctcctcttcatc 70248
>gb|AC170804.2| Mus musculus BAC clone RP24-435B12 from chromosome 6, complete sequence Length = 143675 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttcat 286 ||||||||||||||||||||||| Sbjct: 71439 ctcttcttcttcctcctcttcat 71461
>ref|XM_642573.1| Dictyostelium discoideum adenylyl cyclase (DDB0191294), partial mRNA Length = 6372 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 262 ggctcttcttcttcctcctcttc 284 ||||||||||||||||||||||| Sbjct: 80 ggctcttcttcttcctcctcttc 58
>ref|XM_635214.1| Dictyostelium discoideum actin binding protein (DDB0231188), partial mRNA Length = 3645 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttcatc 287 ||||||||||||||||||||||| Sbjct: 3593 tcttcttcttcctcctcttcatc 3571
>gb|AC102825.6| Mus musculus chromosome 15, clone RP24-227B12, complete sequence Length = 153145 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 260 ccggctcttcttcttcctcctct 282 ||||||||||||||||||||||| Sbjct: 121420 ccggctcttcttcttcctcctct 121398
>gb|AC132595.3| Mus musculus BAC clone RP24-229G7 from chromosome 7, complete sequence Length = 155547 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 266 cttcttcttcctcctcttcatcagcag 292 ||||||||||||||||||| ||||||| Sbjct: 129257 cttcttcttcctcctcttcctcagcag 129231
>emb|CR391911.15| Zebrafish DNA sequence from clone DKEYP-26A9 in linkage group 1, complete sequence Length = 194115 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttcatcagc 290 ||||||||||||||||||||| ||||| Sbjct: 84381 ctcttcttcttcctcctcttcctcagc 84407
>emb|CR769781.9| Zebrafish DNA sequence from clone DKEY-215B13 in linkage group 1, complete sequence Length = 180227 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttcatcagc 290 ||||||||||||||||||||| ||||| Sbjct: 128197 ctcttcttcttcctcctcttcctcagc 128223
>ref|XM_661101.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.60491) partial mRNA Length = 4317 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 265 tcttcttcttcctcctcttcatc 287 ||||||||||||||||||||||| Sbjct: 2818 tcttcttcttcctcctcttcatc 2840
>gb|AC165968.3| Mus musculus BAC clone RP23-181K4 from chromosome 7, complete sequence Length = 190840 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 266 cttcttcttcctcctcttcatcagcag 292 ||||||||||||||||||| ||||||| Sbjct: 98407 cttcttcttcctcctcttcctcagcag 98381
>ref|XM_795323.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein LOC586871 (LOC586871), mRNA Length = 3324 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttcatc 287 ||||||||||||||||||||||| Sbjct: 155 tcttcttcttcctcctcttcatc 133
>emb|AL929353.1|PFA929353 Plasmodium falciparum strain 3D7, chromosome 5, segment 3/4 Length = 343050 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 263 gctcttcttcttcctcctcttca 285 ||||||||||||||||||||||| Sbjct: 162848 gctcttcttcttcctcctcttca 162870
>emb|AJ812734.1| Dictyostelium discoideum mRNA for diaphanous-related formin dDia4 (drf4 gene) Length = 3645 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttcatc 287 ||||||||||||||||||||||| Sbjct: 3593 tcttcttcttcctcctcttcatc 3571
>gb|AC159907.3| Pan troglodytes BAC clone CH251-286G18 from chromosome unknown, complete sequence Length = 156488 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttcatcagc 290 ||||||||||||||||||||| ||||| Sbjct: 145153 ctcttcttcttcctcctcttcctcagc 145127
>gb|AC025905.3| Oryza sativa (japonica cultivar-group) chromosome 10 clone nbxb0018F16, complete sequence Length = 179157 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttcat 286 ||||||||||||||||||||||| Sbjct: 19231 ctcttcttcttcctcctcttcat 19209
>gb|AC160022.2| Pan troglodytes BAC clone CH251-424F19 from chromosome unknown, complete sequence Length = 197895 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttcatcagc 290 ||||||||||||||||||||| ||||| Sbjct: 194800 ctcttcttcttcctcctcttcctcagc 194774
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttcat 286 ||||||||||||||||||||||| Sbjct: 16140342 ctcttcttcttcctcctcttcat 16140320 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 18230597 ctcttcttcttcctcctcttc 18230577 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 265 tcttcttcttcctcctcttc 284 |||||||||||||||||||| Sbjct: 7363314 tcttcttcttcctcctcttc 7363333 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttc 284 |||||||||||||||||||| Sbjct: 2011345 tcttcttcttcctcctcttc 2011326
>gb|AF153362.1|AF153362 Dictyostelium discoideum adenylyl cyclase (acrA) gene, complete cds Length = 7921 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 262 ggctcttcttcttcctcctcttc 284 ||||||||||||||||||||||| Sbjct: 701 ggctcttcttcttcctcctcttc 679
>dbj|AK072120.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013127E14, full insert sequence Length = 2780 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttcat 286 ||||||||||||||||||||||| Sbjct: 798 ctcttcttcttcctcctcttcat 776
>emb|BX322587.10| Zebrafish DNA sequence from clone RP71-36A1 in linkage group 22, complete sequence Length = 104515 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 267 ttcttcttcctcctcttcatcag 289 ||||||||||||||||||||||| Sbjct: 60362 ttcttcttcctcctcttcatcag 60384
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttcat 286 ||||||||||||||||||||||| Sbjct: 16148583 ctcttcttcttcctcctcttcat 16148561 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 18239850 ctcttcttcttcctcctcttc 18239830 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 265 tcttcttcttcctcctcttc 284 |||||||||||||||||||| Sbjct: 7366613 tcttcttcttcctcctcttc 7366632 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttc 284 |||||||||||||||||||| Sbjct: 2011296 tcttcttcttcctcctcttc 2011277
>emb|CR388402.15| Zebrafish DNA sequence from clone DKEY-97I21 in linkage group 1, complete sequence Length = 155300 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttcatcagc 290 ||||||||||||||||||||| ||||| Sbjct: 11920 ctcttcttcttcctcctcttcctcagc 11946
>ref|NM_117871.3| Arabidopsis thaliana unknown protein AT4G17620 transcript variant AT4G17620.1 mRNA, complete cds Length = 1873 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttcat 286 |||||||||||||||||||||| Sbjct: 420 tcttcttcttcctcctcttcat 399
>ref|NM_001036577.1| Arabidopsis thaliana unknown protein AT4G17620 transcript variant AT4G17620.2 mRNA, complete cds Length = 1873 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttcat 286 |||||||||||||||||||||| Sbjct: 420 tcttcttcttcctcctcttcat 399
>ref|NM_116309.2| Arabidopsis thaliana RNA binding / nucleic acid binding AT4G00830 transcript variant AT4G00830.1 mRNA, complete cds Length = 2267 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttcat 286 |||||||||||||||||||||| Sbjct: 265 tcttcttcttcctcctcttcat 244
>ref|NM_001036489.1| Arabidopsis thaliana RNA binding / nucleic acid binding AT4G00830 transcript variant AT4G00830.2 mRNA, complete cds Length = 2455 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttcat 286 |||||||||||||||||||||| Sbjct: 453 tcttcttcttcctcctcttcat 432
>ref|XM_632761.1| Dictyostelium discoideum hypothetical protein (DDB0218807), partial mRNA Length = 1290 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttcat 286 |||||||||||||||||||||| Sbjct: 710 tcttcttcttcctcctcttcat 689
>gb|AE017349.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 9, complete sequence Length = 1178688 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 263 gctcttcttcttcctcctcttc 284 |||||||||||||||||||||| Sbjct: 557073 gctcttcttcttcctcctcttc 557094
>gb|AC007865.8| Trypanosoma brucei chromosome 2 clone RPCI93-30M24, complete sequence Length = 148533 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttcatcag 289 ||||||||||||||||||||| |||| Sbjct: 106686 ctcttcttcttcctcctcttcctcag 106661
>gb|AE017150.2| Trypanosoma brucei chromosome 2, complete sequence Length = 1193948 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttcatcag 289 ||||||||||||||||||||| |||| Sbjct: 804556 ctcttcttcttcctcctcttcctcag 804581
>gb|AY703828.1| Scleronephthya gracillimum beta-tubulin mRNA, complete cds Length = 1541 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttca 285 |||||||||||||||||||||| Sbjct: 1399 ctcttcttcttcctcctcttca 1378
>gb|AC167711.1| Medicago truncatula chromosome 7 BAC clone mth2-167p21, complete sequence Length = 132340 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 267 ttcttcttcctcctcttcatca 288 |||||||||||||||||||||| Sbjct: 16606 ttcttcttcctcctcttcatca 16627
>gb|BC045402.1| Danio rerio novel nuclear protein 1, mRNA (cDNA clone IMAGE:2644274), partial cds Length = 2358 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 268 tcttcttcctcctcttcatcag 289 |||||||||||||||||||||| Sbjct: 1429 tcttcttcctcctcttcatcag 1408 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttc 284 |||||||||||||||||||| Sbjct: 1162 tcttcttcttcctcctcttc 1143
>ref|XM_946549.1| Trypanosoma brucei TREU927 hypothetical protein (Tb927.2.4520) partial mRNA Length = 3765 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttcatcag 289 ||||||||||||||||||||| |||| Sbjct: 702 ctcttcttcttcctcctcttcctcag 677
>ref|XM_572659.1| Cryptococcus neoformans var. neoformans JEC21 chaperone (CNI02020) partial mRNA Length = 1371 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 263 gctcttcttcttcctcctcttc 284 |||||||||||||||||||||| Sbjct: 560 gctcttcttcttcctcctcttc 581
>emb|BX936288.8| Platypus DNA sequence from clone XX-534O22, complete sequence Length = 153564 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 263 gctcttcttcttcctcctcttc 284 |||||||||||||||||||||| Sbjct: 76857 gctcttcttcttcctcctcttc 76878
>gb|AC159149.10| Mus musculus 10 BAC RP23-56F17 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 219585 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttca 285 |||||||||||||||||||||| Sbjct: 174355 ctcttcttcttcctcctcttca 174334
>gb|AC146790.16| Medicago truncatula clone mth2-123b21, complete sequence Length = 114449 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttca 285 |||||||||||||||||||||| Sbjct: 80505 ctcttcttcttcctcctcttca 80484 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttca 285 ||||||||||||||||||||| Sbjct: 84010 tcttcttcttcctcctcttca 83990 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttc 284 |||||||||||||||||||| Sbjct: 84052 tcttcttcttcctcctcttc 84033 Score = 40.1 bits (20), Expect = 6.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttcatcagcag 292 |||||||| |||||||||||| |||||| Sbjct: 83974 tcttcttcatcctcctcttcagcagcag 83947
>emb|Z97343.1|ATFCA8 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 8 Length = 207674 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttcat 286 |||||||||||||||||||||| Sbjct: 187105 tcttcttcttcctcctcttcat 187084
>gb|AY133815.1| Arabidopsis thaliana clone U18774 unknown protein (At4g17620) mRNA, complete cds Length = 1666 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttcat 286 |||||||||||||||||||||| Sbjct: 329 tcttcttcttcctcctcttcat 308
>gb|AY074548.1| Arabidopsis thaliana unknown protein (At4g17620) mRNA, complete cds Length = 1782 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttcat 286 |||||||||||||||||||||| Sbjct: 365 tcttcttcttcctcctcttcat 344
>emb|AL929355.1|PFA929355 Plasmodium falciparum strain 3D7, chromosome 9; segment 1/5 Length = 330050 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 265 tcttcttcttcctcctcttcat 286 |||||||||||||||||||||| Sbjct: 240452 tcttcttcttcctcctcttcat 240473
>emb|AL161546.2|ATCHRIV46 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 46 Length = 198788 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttcat 286 |||||||||||||||||||||| Sbjct: 176470 tcttcttcttcctcctcttcat 176449
>emb|AL161472.2|ATCHRIV2 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 2 Length = 197975 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttcat 286 |||||||||||||||||||||| Sbjct: 159588 tcttcttcttcctcctcttcat 159567
>gb|AY113171.1| Arabidopsis thaliana AT4g00830/A_TM018A10_14 mRNA, complete cds Length = 1488 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttcat 286 |||||||||||||||||||||| Sbjct: 119 tcttcttcttcctcctcttcat 98
>gb|AF367357.1| Arabidopsis thaliana AT4g00830/A_TM018A10_14 mRNA, complete cds Length = 1838 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttcat 286 |||||||||||||||||||||| Sbjct: 264 tcttcttcttcctcctcttcat 243
>emb|BX005309.14| Zebrafish DNA sequence from clone CH211-265M20 in linkage group 10, complete sequence Length = 179240 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 263 gctcttcttcttcctcctcttc 284 |||||||||||||||||||||| Sbjct: 64605 gctcttcttcttcctcctcttc 64584
>emb|BX841533.1|CNS09YG2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS41ZB05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 910 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttcat 286 |||||||||||||||||||||| Sbjct: 210 tcttcttcttcctcctcttcat 189
>gb|AC155938.6| Mus musculus 10 BAC RP24-421D7 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 157047 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttca 285 |||||||||||||||||||||| Sbjct: 87094 ctcttcttcttcctcctcttca 87115
>emb|Y08571.1|NVY08571 N.vacuolatum gvpA, gvpC, gvpN, gvpO, gvpF, gvpG and gvpH genes Length = 5110 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttcatcag 289 |||||| ||||||||||||||||||| Sbjct: 1810 ctcttcatcttcctcctcttcatcag 1785
>emb|BX088560.7| Zebrafish DNA sequence from clone DKEY-237O15 in linkage group 10, complete sequence Length = 156486 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 263 gctcttcttcttcctcctcttc 284 |||||||||||||||||||||| Sbjct: 87797 gctcttcttcttcctcctcttc 87776
>gb|AY104489.1| Zea mays PCO108349 mRNA sequence Length = 553 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Minus Query: 217 gccttccttctgcgcttcttccctgt 242 |||||||||||||||||||| ||||| Sbjct: 195 gccttccttctgcgcttctttcctgt 170
>gb|AE000782.1| Archaeoglobus fulgidus DSM 4304, complete genome Length = 2178400 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttca 285 |||||||||||||||||||||| Sbjct: 1349620 ctcttcttcttcctcctcttca 1349599
>emb|AL935333.9| Zebrafish DNA sequence from clone CH211-198I18 in linkage group 5, complete sequence Length = 199019 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttcat 286 |||||||||||||||||||||| Sbjct: 972 tcttcttcttcctcctcttcat 951
>gb|AF013294.1|TM018A10 Arabidopsis thaliana BAC TM018A10 Length = 106184 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 265 tcttcttcttcctcctcttcat 286 |||||||||||||||||||||| Sbjct: 74977 tcttcttcttcctcctcttcat 74998
>gb|AC110244.10| Mus musculus chromosome 5, clone RP23-247E10, complete sequence Length = 214638 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 23620 ctcttcttcttcctcctcttc 23600
>gb|AC132899.11| Mus musculus chromosome 15, clone RP24-367P22, complete sequence Length = 152183 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 57676 ctcttcttcttcctcctcttc 57656 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttc 284 |||||||||||||||||||| Sbjct: 57705 tcttcttcttcctcctcttc 57686
>ref|NM_181505.1| Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 1B (dopamine and cAMP regulated phosphoprotein, DARPP-32) (PPP1R1B), transcript variant 2, mRNA Length = 1529 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttcatca 288 ||||||||||||||| ||||||||| Sbjct: 532 ctcttcttcttcctcttcttcatca 508
>ref|NM_032192.2| Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 1B (dopamine and cAMP regulated phosphoprotein, DARPP-32) (PPP1R1B), transcript variant 1, mRNA Length = 1841 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttcatca 288 ||||||||||||||| ||||||||| Sbjct: 872 ctcttcttcttcctcttcttcatca 848
>gb|BC050418.1| Homo sapiens polymerase (RNA) III (DNA directed) polypeptide G (32kD) like, mRNA (cDNA clone IMAGE:5588819) Length = 1674 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 824 ctcttcttcttcctcctcttc 804
>gb|AC163280.2| Mus musculus BAC clone RP23-478G5 from chromosome 14, complete sequence Length = 202761 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 197188 ctcttcttcttcctcctcttc 197168
>gb|AC154102.15| Mus musculus chromosome 8, clone RP24-186O14, complete sequence Length = 171510 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 138859 ctcttcttcttcctcctcttc 138839
>gb|AC164597.11| Mus musculus chromosome 15, clone RP23-108H23, complete sequence Length = 190235 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 104602 ctcttcttcttcctcctcttc 104622
>gb|AC107774.8| Mus musculus chromosome 5, clone RP23-99A9, complete sequence Length = 227044 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 96524 ctcttcttcttcctcctcttc 96504
>gb|AC116386.9| Mus musculus chromosome 15, clone RP23-37B16, complete sequence Length = 185556 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 178947 ctcttcttcttcctcctcttc 178967
>ref|XM_632824.1| Dictyostelium discoideum hypothetical protein (DDB0186792), partial mRNA Length = 1464 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttca 285 ||||||||||||||||||||| Sbjct: 473 tcttcttcttcctcctcttca 453
>gb|BC085378.1| Danio rerio zgc:101592, mRNA (cDNA clone MGC:101592 IMAGE:7223768), complete cds Length = 2597 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 792 ctcttcttcttcctcctcttc 772
>gb|AC115691.8| Mus musculus chromosome 18, clone RP24-286B14, complete sequence Length = 175016 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 74932 ctcttcttcttcctcctcttc 74952
>ref|XM_639839.1| Dictyostelium discoideum hypothetical protein (DDB0217078), partial mRNA Length = 3345 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 897 ctcttcttcttcctcctcttc 877
>ref|XM_638718.1| Dictyostelium discoideum hypothetical protein (DDB0167422), partial mRNA Length = 1920 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 102 ctcttcttcttcctcctcttc 82 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 263 gctcttcttcttcctcctct 282 |||||||||||||||||||| Sbjct: 76 gctcttcttcttcctcctct 57
>ref|XM_636881.1| Dictyostelium discoideum hypothetical protein (DDB0206201), partial mRNA Length = 1491 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 1153 ctcttcttcttcctcctcttc 1133
>ref|XM_635799.1| Dictyostelium discoideum TATA box-binding protein-associated factor, RNA polymerase III, subunit 2 (DDB0231089), partial mRNA Length = 2121 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 268 tcttcttcctcctcttcatca 288 ||||||||||||||||||||| Sbjct: 1136 tcttcttcctcctcttcatca 1116
>ref|XM_635579.1| Dictyostelium discoideum AAA ATPase domain-containing protein (DDB0220704), partial mRNA Length = 5403 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 1188 ctcttcttcttcctcctcttc 1168
>ref|XM_634046.1| Dictyostelium discoideum hypothetical protein (DDB0191409), partial mRNA Length = 2592 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 666 ctcttcttcttcctcctcttc 686
>ref|XM_631434.1| Dictyostelium discoideum hypothetical protein (DDB0188114), partial mRNA Length = 1683 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 210 ctcttcttcttcctcctcttc 190
>ref|XM_629896.1| Dictyostelium discoideum hypothetical protein (DDB0184122), partial mRNA Length = 1503 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttca 285 ||||||||||||||||||||| Sbjct: 191 tcttcttcttcctcctcttca 171
>gb|AC154737.3| Mus musculus BAC clone RP24-390A6 from chromosome 9, complete sequence Length = 113204 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 9458 ctcttcttcttcctcctcttc 9478
>ref|XM_465614.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2555 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 6 ctcttcttcttcctcctcttc 26
>ref|NM_197144.1| Oryza sativa (japonica cultivar-group) hypothetical protein (OSJNBa0041P03.19), mRNA Length = 492 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 215 ctcttcttcttcctcctcttc 195
>gb|AC159407.1| Trypanosoma brucei chromosome 8 clone RPCI93-12O16, complete sequence Length = 161249 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 93713 ctcttcttcttcctcctcttc 93733
>ref|NM_193485.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 891 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 268 tcttcttcctcctcttcatcagcag 292 ||||||||||||||||| ||||||| Sbjct: 797 tcttcttcctcctcttcgtcagcag 773
>ref|XM_514421.1| PREDICTED: Pan troglodytes LOC457985 (LOC457985), mRNA Length = 691 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 580 ctcttcttcttcctcctcttc 560
>gb|AC121510.10| Mus musculus chromosome 19, clone RP24-371N19, complete sequence Length = 168677 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 44637 ctcttcttcttcctcctcttc 44657
>gb|AC109149.15| Mus musculus chromosome 19, clone RP24-178F17, complete sequence Length = 176668 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 26916 ctcttcttcttcctcctcttc 26936
>gb|AC138334.11| Mus musculus chromosome 7, clone RP23-306H5, complete sequence Length = 177803 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 33395 ctcttcttcttcctcctcttc 33415
>gb|AE014843.1| Plasmodium falciparum 3D7 chromosome 11 section 8 of 8 of the complete sequence Length = 271546 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 25691 ctcttcttcttcctcctcttc 25711 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 265 tcttcttcttcctcctcttc 284 |||||||||||||||||||| Sbjct: 25677 tcttcttcttcctcctcttc 25696
>gb|DP000013.1| Otolemur garnettii target 1 genomic scaffold Length = 1743090 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 826907 ctcttcttcttcctcctcttc 826887
>gb|AC102923.10| Mus musculus chromosome 1, clone RP24-262J2, complete sequence Length = 159541 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 31283 ctcttcttcttcctcctcttc 31263 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttc 284 |||||||||||||||||||| Sbjct: 31375 tcttcttcttcctcctcttc 31356
>ref|NM_053888.1| Rattus norvegicus myelin transcription factor 1-like (Myt1l), mRNA Length = 4491 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 268 tcttcttcctcctcttcatca 288 ||||||||||||||||||||| Sbjct: 1277 tcttcttcctcctcttcatca 1257
>gb|AC157991.5| Mus musculus chromosome 18, clone RP23-335B10, complete sequence Length = 198636 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 26162 ctcttcttcttcctcctcttc 26142 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttc 284 |||||||||||||||||||| Sbjct: 26518 tcttcttcttcctcctcttc 26499 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttc 284 |||||||||||||||||||| Sbjct: 26332 tcttcttcttcctcctcttc 26313 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttc 284 |||||||||||||||||||| Sbjct: 26251 tcttcttcttcctcctcttc 26232
>gb|AF147806.2| Gallid herpesvirus 2, complete genome Length = 174077 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttcatca 288 |||||| |||||||||||||||||| Sbjct: 167509 ctcttcatcttcctcctcttcatca 167533 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttcatca 288 |||||| |||||||||||||||||| Sbjct: 145244 ctcttcatcttcctcctcttcatca 145220
>gb|AE000665.1|MMAE000665 Mus musculus TCR beta locus from bases 501860 to 700960 (section 3 of 3) of the complete sequence Length = 199101 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 130235 ctcttcttcttcctcctcttc 130215
>gb|AY023485.1| Oryza sativa microsatellite MRG5810 containing (TCT)X8, genomic sequence Length = 224 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 268 tcttcttcctcctcttcatca 288 ||||||||||||||||||||| Sbjct: 182 tcttcttcctcctcttcatca 202
>gb|CP000071.1| Trypanosoma brucei chromosome 8, complete sequence Length = 2481190 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 232433 ctcttcttcttcctcctcttc 232453
>gb|AC123662.13| Mus musculus chromosome 5, clone RP23-213N8, complete sequence Length = 223267 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 125031 ctcttcttcttcctcctcttc 125051
>gb|AC115932.11| Mus musculus chromosome 1, clone RP24-538F21, complete sequence Length = 205378 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 90096 ctcttcttcttcctcctcttc 90116
>gb|AC102124.16| Mus musculus chromosome 18, clone RP23-188D1, complete sequence Length = 222450 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 196166 ctcttcttcttcctcctcttc 196146 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttc 284 |||||||||||||||||||| Sbjct: 196522 tcttcttcttcctcctcttc 196503 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttc 284 |||||||||||||||||||| Sbjct: 196336 tcttcttcttcctcctcttc 196317 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttc 284 |||||||||||||||||||| Sbjct: 196255 tcttcttcttcctcctcttc 196236
>gb|AC097087.13| Rattus norvegicus BAC CH230-140P4 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence Length = 166595 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 38565 ctcttcttcttcctcctcttc 38545
>gb|AC165357.4| Mus musculus BAC clone RP23-114G24 from chromosome 10, complete sequence Length = 216816 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 41224 ctcttcttcttcctcctcttc 41244
>gb|AC159810.2| Mus musculus BAC clone RP24-94A19 from chromosome 9, complete sequence Length = 168537 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 55574 ctcttcttcttcctcctcttc 55594
>gb|AC164117.5| Mus musculus BAC clone RP24-249P3 from chromosome 13, complete sequence Length = 171066 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 94789 ctcttcttcttcctcctcttc 94809
>gb|AC154760.2| Mus musculus BAC clone RP24-414E6 from chromosome 14, complete sequence Length = 163089 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 88450 ctcttcttcttcctcctcttc 88470
>ref|NM_001013986.2| Rattus norvegicus similar to hypothetical protein MGC29875; novel putative protein similar to YIL091C yeast hypothetical 84 kD protein from SGA1-KTR7 (LOC305076), mRNA Length = 2668 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 375 ctcttcttcttcctcctcttc 355
>gb|AC149071.3| Xenopus tropicalis BAC clone ISB10250N9 containing the Irx4 gene, complete cds, complete sequence Length = 84437 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttcatca 288 |||||||||||| |||||||||||| Sbjct: 29767 ctcttcttcttcttcctcttcatca 29743
>gb|AC121291.18| Mus musculus chromosome 5, clone RP23-170M15, complete sequence Length = 192717 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 30887 ctcttcttcttcctcctcttc 30907
>gb|AC167724.6| Mus musculus 10 BAC RP23-331P17 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 230186 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 166398 ctcttcttcttcctcctcttc 166378
>gb|AC118628.11| Mus musculus chromosome 19, clone RP24-92P15, complete sequence Length = 202071 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 11199 ctcttcttcttcctcctcttc 11219
>gb|AC112898.5| Rattus norvegicus 2 BAC CH230-157M2 (Children's Hospital Oakland Research Institute) complete sequence Length = 213379 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 140558 ctcttcttcttcctcctcttc 140538 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 140543 ctcttcttcttcctcctcttc 140523 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 140495 ctcttcttcttcctcctcttc 140475 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 140450 ctcttcttcttcctcctcttc 140430 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttc 284 |||||||||||||||||||| Sbjct: 140401 tcttcttcttcctcctcttc 140382
>gb|AC112739.5| Rattus norvegicus 7 BAC CH230-108A12 (Children's Hospital Oakland Research Institute) complete sequence Length = 234420 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 175716 ctcttcttcttcctcctcttc 175696
>gb|AC115878.12| Mus musculus chromosome 15, clone RP24-358G9, complete sequence Length = 173049 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 1078 ctcttcttcttcctcctcttc 1058
>gb|BC073489.1| Xenopus laevis hypothetical protein LOC443651, mRNA (cDNA clone IMAGE:5570720), partial cds Length = 1328 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 1257 ctcttcttcttcctcctcttc 1237
>gb|AC141583.3| Rattus norvegicus 9 BAC CH230-486H15 (Children's Hospital Oakland Research Institute) complete sequence Length = 132946 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 37247 ctcttcttcttcctcctcttc 37267
>ref|XM_591851.2| PREDICTED: Bos taurus similar to HLA-B associated transcript 8 isoform a, transcript variant 1 (LOC514062), mRNA Length = 3890 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 946 ctcttcttcttcctcctcttc 926
>ref|XM_882445.1| PREDICTED: Bos taurus similar to HLA-B associated transcript 8 isoform a, transcript variant 7 (LOC514062), mRNA Length = 3941 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 943 ctcttcttcttcctcctcttc 923
>ref|XM_882432.1| PREDICTED: Bos taurus similar to HLA-B associated transcript 8 isoform a, transcript variant 6 (LOC514062), mRNA Length = 3920 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 943 ctcttcttcttcctcctcttc 923
>ref|XM_882425.1| PREDICTED: Bos taurus similar to HLA-B associated transcript 8 isoform a, transcript variant 5 (LOC514062), mRNA Length = 3869 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 943 ctcttcttcttcctcctcttc 923
>ref|XM_882418.1| PREDICTED: Bos taurus similar to HLA-B associated transcript 8 isoform a, transcript variant 4 (LOC514062), mRNA Length = 3124 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 943 ctcttcttcttcctcctcttc 923
>ref|XM_869170.1| PREDICTED: Bos taurus similar to HLA-B associated transcript 8 isoform a, transcript variant 2 (LOC514062), mRNA Length = 3992 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 946 ctcttcttcttcctcctcttc 926
>gb|AC182436.1| Mus musculus chromosome 5, clone wi1-1982K15, complete sequence Length = 43869 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 29918 ctcttcttcttcctcctcttc 29898
>gb|BC077588.1| Xenopus laevis Swift, mRNA (cDNA clone MGC:83895 IMAGE:6859117), complete cds Length = 4612 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 699 ctcttcttcttcctcctcttc 679
>ref|XM_586145.2| PREDICTED: Bos taurus similar to chromodomain helicase DNA binding protein 9 (LOC539275), mRNA Length = 9909 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 263 gctcttcttcttcctcctctt 283 ||||||||||||||||||||| Sbjct: 5386 gctcttcttcttcctcctctt 5406
>gb|BC058412.1| Mus musculus serine/threonine kinase 32B, mRNA (cDNA clone MGC:67312 IMAGE:5715729), complete cds Length = 3367 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 2704 ctcttcttcttcctcctcttc 2724
>gb|BC067684.1| Danio rerio zgc:85905, mRNA (cDNA clone MGC:85905 IMAGE:6972219), complete cds Length = 1803 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttcatca 288 ||||||||| ||||||||||||||| Sbjct: 113 ctcttcttcctcctcctcttcatca 89
>gb|BC056396.1| Mus musculus serine/threonine kinase 32B, mRNA (cDNA clone MGC:65645 IMAGE:6841272), complete cds Length = 3449 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 2780 ctcttcttcttcctcctcttc 2800
>gb|BC052404.1| Mus musculus serine/threonine kinase 32B, mRNA (cDNA clone MGC:63434 IMAGE:5715729), complete cds Length = 3367 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 2704 ctcttcttcttcctcctcttc 2724
>ref|XM_957161.1| Neurospora crassa OR74A hypothetical protein (NCU06547.1) partial mRNA Length = 1875 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 271 tcttcctcctcttcatcagca 291 ||||||||||||||||||||| Sbjct: 880 tcttcctcctcttcatcagca 900
>ref|XM_958814.1| Neurospora crassa OR74A hypothetical protein (NCU07456.1) partial mRNA Length = 768 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 102 ctcttcttcttcctcctcttc 122
>ref|XM_958982.1| Neurospora crassa OR74A hypothetical protein (NCU02793.1) partial mRNA Length = 32463 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 28815 ctcttcttcttcctcctcttc 28795
>gb|AC113957.8| Mus musculus chromosome 15, clone RP23-452M1, complete sequence Length = 168824 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 156967 ctcttcttcttcctcctcttc 156947
>gb|AF131866.2| Mus musculus chromosome X clone CT7-271B7 map qA7.1, complete sequence Length = 110310 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 40081 ctcttcttcttcctcctcttc 40061
>ref|XM_326401.1| Neurospora crassa OR74A hypothetical protein (NCU06547.1) partial mRNA Length = 1875 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 271 tcttcctcctcttcatcagca 291 ||||||||||||||||||||| Sbjct: 880 tcttcctcctcttcatcagca 900
>ref|XM_327741.1| Neurospora crassa OR74A hypothetical protein (NCU07456.1) partial mRNA Length = 768 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 102 ctcttcttcttcctcctcttc 122
>gb|AC123507.4| Rattus norvegicus 11 BAC CH230-18C5 (Children's Hospital Oakland Research Institute) complete sequence Length = 166073 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 80073 ctcttcttcttcctcctcttc 80053
>ref|XM_329980.1| Neurospora crassa OR74A hypothetical protein (NCU02793.1) partial mRNA Length = 32463 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 28815 ctcttcttcttcctcctcttc 28795
>ref|XM_583813.2| PREDICTED: Bos taurus similar to PRP38 pre-mRNA processing factor 38 (yeast) domain containing A isoform 2, transcript variant 1 (LOC507240), mRNA Length = 1268 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttca 285 ||||||||||||||||||||| Sbjct: 665 tcttcttcttcctcctcttca 645
>ref|XM_583773.2| PREDICTED: Bos taurus similar to acidic (leucine-rich) nuclear phosphoprotein 32 family, member E (predicted) (LOC507203), mRNA Length = 1172 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 845 ctcttcttcttcctcctcttc 825
>ref|NM_001007257.1| Homo sapiens PR domain containing 2, with ZNF domain (PRDM2), transcript variant 3, mRNA Length = 6207 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 267 ttcttcttcctcctcttcatc 287 ||||||||||||||||||||| Sbjct: 2749 ttcttcttcctcctcttcatc 2769
>ref|NM_012231.3| Homo sapiens PR domain containing 2, with ZNF domain (PRDM2), transcript variant 1, mRNA Length = 7958 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 267 ttcttcttcctcctcttcatc 287 ||||||||||||||||||||| Sbjct: 4009 ttcttcttcctcctcttcatc 4029
>ref|NM_015866.3| Homo sapiens PR domain containing 2, with ZNF domain (PRDM2), transcript variant 2, mRNA Length = 7466 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 267 ttcttcttcctcctcttcatc 287 ||||||||||||||||||||| Sbjct: 4009 ttcttcttcctcctcttcatc 4029
>ref|NM_001033194.1| Mus musculus general transcription factor IIIC, polypeptide 3 (Gtf3c3), mRNA Length = 3006 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 268 tcttcttcctcctcttcatca 288 ||||||||||||||||||||| Sbjct: 363 tcttcttcctcctcttcatca 343
>ref|XM_714241.1| Candida albicans SC5314 putative histone acetyltransferase SAGA complex component (CaO19_7572), mRNA Length = 3924 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttcatca 288 |||||||||||| |||||||||||| Sbjct: 1836 ctcttcttcttcttcctcttcatca 1812
>gb|AC125192.3| Mus musculus BAC clone RP23-266B4 from chromosome 8, complete sequence Length = 199459 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 188182 ctcttcttcttcctcctcttc 188162
>gb|AC127339.3| Mus musculus BAC clone RP23-180G16 from chromosome 5, complete sequence Length = 225376 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 156150 ctcttcttcttcctcctcttc 156130
>gb|AC140387.2| Mus musculus BAC clone RP24-185D21 from chromosome 9, complete sequence Length = 158741 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 118709 ctcttcttcttcctcctcttc 118729
>gb|AC141880.3| Mus musculus BAC clone RP24-220N1 from chromosome 15, complete sequence Length = 185646 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 146773 ctcttcttcttcctcctcttc 146753
>ref|NM_022416.1| Mus musculus serine/threonine kinase 32B (Stk32b), mRNA Length = 3367 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 2704 ctcttcttcttcctcctcttc 2724
>ref|XM_451299.1| Kluyveromyces lactis NRRL Y-1140, KLLA0A06710g predicted mRNA Length = 1272 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttcatcag 289 |||||||||||||| |||||||||| Sbjct: 461 tcttcttcttcctcttcttcatcag 437
>ref|XM_453587.1| Kluyveromyces lactis NRRL Y-1140, KLLA0D11792g predicted mRNA Length = 2058 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttcatcag 289 |||||||||||||| |||||||||| Sbjct: 707 tcttcttcttcctcatcttcatcag 683
>gb|AC135104.22| Mus musculus strain C57BL/6J clone rp23-206l6, complete sequence Length = 198294 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 137169 ctcttcttcttcctcctcttc 137149
>gb|AC158915.4| Mus musculus chromosome 8, clone RP23-146N20, complete sequence Length = 207367 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 103118 ctcttcttcttcctcctcttc 103098
>gb|AC158582.2| Mus musculus chromosome 7, clone RP24-173K12, complete sequence Length = 169636 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 50407 ctcttcttcttcctcctcttc 50387
>ref|NM_032305.1| Homo sapiens polymerase (RNA) III (DNA directed) polypeptide G (32kD) like (POLR3GL), mRNA Length = 1191 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 653 ctcttcttcttcctcctcttc 633
>gb|AC091324.10| Mus musculus chromosome 7, clone RP23-7G1, complete sequence Length = 225556 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 130892 ctcttcttcttcctcctcttc 130912
>gb|AC114411.24| Mus musculus chromosome 5, clone RP23-162F3, complete sequence Length = 208432 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 195303 ctcttcttcttcctcctcttc 195323
>gb|AC109151.9| Mus musculus chromosome 1, clone RP24-530O9, complete sequence Length = 130025 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 105719 ctcttcttcttcctcctcttc 105739
>gb|AC158983.2| Mus musculus BAC clone RP23-264L8 from chromosome 14, complete sequence Length = 218519 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 62552 ctcttcttcttcctcctcttc 62572
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 464 tttctgcagtcttcgcctccgattt 488 |||||||||||||| |||||||||| Sbjct: 4053225 tttctgcagtcttcccctccgattt 4053201 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttc 284 |||||||||||||||||||| Sbjct: 35066319 tcttcttcttcctcctcttc 35066300 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttc 284 |||||||||||||||||||| Sbjct: 20669173 tcttcttcttcctcctcttc 20669154 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 265 tcttcttcttcctcctcttc 284 |||||||||||||||||||| Sbjct: 16286262 tcttcttcttcctcctcttc 16286281 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 263 gctcttcttcttcctcctct 282 |||||||||||||||||||| Sbjct: 6093453 gctcttcttcttcctcctct 6093472
>gb|AC161930.7| Mus musculus chromosome 7, clone RP23-157P17, complete sequence Length = 212109 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 45786 ctcttcttcttcctcctcttc 45766 Score = 40.1 bits (20), Expect = 6.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttcatcagca 291 |||||||||||||||||| || |||||| Sbjct: 66179 ctcttcttcttcctcctcgtcctcagca 66206
>gb|AC165154.2| Mus musculus BAC clone RP23-302C3 from chromosome 14, complete sequence Length = 225721 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 44421 ctcttcttcttcctcctcttc 44401
>gb|AC166178.10| Mus musculus 6 BAC RP24-414G20 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 173015 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 116281 ctcttcttcttcctcctcttc 116301
>gb|AC134459.4| Mus musculus BAC clone RP23-360L15 from chromosome 8, complete sequence Length = 211773 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 56857 ctcttcttcttcctcctcttc 56877
>gb|AC167222.4| Mus musculus 10 BAC RP23-261G3 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 198762 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 11415 ctcttcttcttcctcctcttc 11435 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 265 tcttcttcttcctcctcttc 284 |||||||||||||||||||| Sbjct: 11401 tcttcttcttcctcctcttc 11420
>gb|AC164701.4| Mus musculus BAC clone RP24-108J12 from chromosome 17, complete sequence Length = 184296 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 141886 ctcttcttcttcctcctcttc 141866
>gb|AC115904.13| Mus musculus chromosome 16, clone RP24-472P22, complete sequence Length = 167938 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 87901 ctcttcttcttcctcctcttc 87921
>gb|AC126937.3| Mus musculus BAC clone RP24-250G8 from chromosome 17, complete sequence Length = 150579 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 114190 ctcttcttcttcctcctcttc 114210
>ref|XM_846664.1| PREDICTED: Canis familiaris similar to translocation protein 1 (LOC609416), mRNA Length = 2854 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttca 285 ||||||||||||||||||||| Sbjct: 1379 tcttcttcttcctcctcttca 1359
>gb|AC124721.4| Mus musculus chromosome 10 clone RP23-387G19, complete sequence Length = 216612 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 136449 ctcttcttcttcctcctcttc 136429
>gb|AC125194.4| Mus musculus BAC clone RP23-275K6 from chromosome 18, complete sequence Length = 155706 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 50490 ctcttcttcttcctcctcttc 50470 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttc 284 |||||||||||||||||||| Sbjct: 50432 tcttcttcttcctcctcttc 50413
>gb|AC115843.10| Mus musculus chromosome 9, clone RP24-239P6, complete sequence Length = 215265 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 86160 ctcttcttcttcctcctcttc 86180
>gb|AC004593.1| Homo sapiens PAC clone RP5-964C11 from 7, complete sequence Length = 150221 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 118186 ctcttcttcttcctcctcttc 118206
>gb|AC117678.16| Mus musculus chromosome 6, clone RP23-421M9, complete sequence Length = 204437 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 32308 ctcttcttcttcctcctcttc 32288
>gb|AC107179.5| Rattus norvegicus 9 BAC CH230-155P21 (Children's Hospital Oakland Research Institute) complete sequence Length = 204235 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 163915 ctcttcttcttcctcctcttc 163935
>gb|AC117098.6| Rattus norvegicus 2 BAC CH230-271M7 (Children's Hospital Oakland Research Institute) complete sequence Length = 174234 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 85373 ctcttcttcttcctcctcttc 85393
>ref|XM_844267.1| PREDICTED: Canis familiaris similar to SRp25 nuclear protein isoform 4, transcript variant 1 (LOC608170), mRNA Length = 1057 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 472 ctcttcttcttcctcctcttc 452
>ref|XM_853414.1| PREDICTED: Canis familiaris similar to SRp25 nuclear protein isoform 4, transcript variant 4 (LOC608170), mRNA Length = 993 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 408 ctcttcttcttcctcctcttc 388
>ref|XM_853379.1| PREDICTED: Canis familiaris similar to SRp25 nuclear protein isoform 4, transcript variant 3 (LOC608170), mRNA Length = 1215 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 696 ctcttcttcttcctcctcttc 676
>ref|XM_853344.1| PREDICTED: Canis familiaris similar to SRp25 nuclear protein isoform 4, transcript variant 2 (LOC608170), mRNA Length = 1281 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 696 ctcttcttcttcctcctcttc 676
>gb|AC122903.4| Mus musculus BAC clone RP23-44N5 from chromosome 1, complete sequence Length = 169832 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 267 ttcttcttcctcctcttcatc 287 ||||||||||||||||||||| Sbjct: 145347 ttcttcttcctcctcttcatc 145327
>gb|DQ484031.1| Gymnogyps californianus clone 197G microsatellite sequence Length = 1223 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 1029 ctcttcttcttcctcctcttc 1009
>ref|XM_853376.1| PREDICTED: Canis familiaris similar to translocation protein 1, transcript variant 2 (LOC485507), mRNA Length = 1404 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttca 285 ||||||||||||||||||||| Sbjct: 1176 tcttcttcttcctcctcttca 1156
>ref|XM_844216.1| PREDICTED: Canis familiaris similar to translocation protein 1, transcript variant 1 (LOC485507), mRNA Length = 1348 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttca 285 ||||||||||||||||||||| Sbjct: 1176 tcttcttcttcctcctcttca 1156
>emb|CT025652.7| Mouse DNA sequence from clone RP24-68J3 on chromosome 17, complete sequence Length = 226856 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 156366 ctcttcttcttcctcctcttc 156346
>ref|XM_818496.1| Trypanosoma brucei TREU927 clone RPCI93-12O16 hypothetical protein (Tb927.8.810) partial mRNA Length = 1002 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 477 ctcttcttcttcctcctcttc 457
>emb|CT025292.2| Xenopus tropicalis finished cDNA, clone TNeu144j16 Length = 2279 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttcatca 288 |||||||||||| |||||||||||| Sbjct: 908 ctcttcttcttcttcctcttcatca 884
>ref|XM_539928.2| PREDICTED: Canis familiaris similar to PAX interacting (with transcription-activation domain) protein 1 (LOC482813), mRNA Length = 3597 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 930 ctcttcttcttcctcctcttc 910
>emb|CR628387.12| Zebrafish DNA sequence from clone DKEY-59J17 in linkage group 17, complete sequence Length = 220664 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 263 gctcttcttcttcctcctctt 283 ||||||||||||||||||||| Sbjct: 36714 gctcttcttcttcctcctctt 36734
>ref|XM_747293.1| Aspergillus fumigatus Af293 cell cycle control protein Cwf4 (Afu1g10200) partial mRNA Length = 2031 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 1689 ctcttcttcttcctcctcttc 1669
>ref|XM_747906.1| Aspergillus fumigatus Af293 hypothetical protein (Afu1g16330) partial mRNA Length = 2367 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 2331 ctcttcttcttcctcctcttc 2311
>ref|XM_388974.1| Gibberella zeae PH-1 chromosome 2 hypothetical protein (FG08798.1) partial mRNA Length = 2469 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 260 ccggctcttcttcttcctcctcttcatca 288 |||| |||||||||||||| ||||||||| Sbjct: 2391 ccggttcttcttcttcctcatcttcatca 2363
>emb|CT010587.5| Mouse DNA sequence from clone RP23-307A6 on chromosome 17, complete sequence Length = 173949 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 35735 ctcttcttcttcctcctcttc 35715
>gb|AC146905.1| Human Herpesvirus 5 Toledo-BAC isolate, complete sequence Length = 226889 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 104431 ctcttcttcttcctcctcttc 104411
>gb|AC127690.4| Mus musculus BAC clone RP24-215A3 from chromosome 17, complete sequence Length = 187751 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 143832 ctcttcttcttcctcctcttc 143852 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 265 tcttcttcttcctcctcttc 284 |||||||||||||||||||| Sbjct: 143781 tcttcttcttcctcctcttc 143800
>gb|AC129079.5| Mus musculus BAC clone RP24-126J17 from chromosome 7, complete sequence Length = 180663 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 24495 ctcttcttcttcctcctcttc 24515
>gb|AC123817.4| Mus musculus BAC clone RP24-255D13 from chromosome 9, complete sequence Length = 169614 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 63011 ctcttcttcttcctcctcttc 62991
>gb|BC101890.1| Rattus norvegicus proline, glutamic acid and leucine rich protein 1, mRNA (cDNA clone MGC:124791 IMAGE:7930679), complete cds Length = 3530 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttcatca 288 ||||||||| ||||||||||||||| Sbjct: 2714 ctcttcttcctcctcctcttcatca 2690
>gb|AC129311.6| Mus musculus BAC clone RP24-404P10 from chromosome 3, complete sequence Length = 160537 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 20362 ctcttcttcttcctcctcttc 20382
>gb|AC129304.6| Mus musculus BAC clone RP24-462H23 from chromosome 10, complete sequence Length = 153772 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 60207 ctcttcttcttcctcctcttc 60227
>gb|AC127681.4| Mus musculus BAC clone RP24-164P24 from chromosome 3, complete sequence Length = 175131 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 21395 ctcttcttcttcctcctcttc 21415
>gb|AC130711.3| Mus musculus BAC clone RP23-22M24 from chromosome 17, complete sequence Length = 226651 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 182204 ctcttcttcttcctcctcttc 182224 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 160565 ctcttcttcttcctcctcttc 160585
>gb|AC129609.3| Mus musculus BAC clone RP23-194H4 from chromosome 7, complete sequence Length = 225829 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 1883 ctcttcttcttcctcctcttc 1863
>gb|AC129020.4| Mus musculus BAC clone RP23-234A5 from chromosome 16, complete sequence Length = 192668 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 148925 ctcttcttcttcctcctcttc 148945
>gb|AC122342.4| Mus musculus BAC clone RP23-357O17 from chromosome 8, complete sequence Length = 199412 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 152306 ctcttcttcttcctcctcttc 152286
>gb|AC122863.4| Mus musculus BAC clone RP23-142A14 from chromosome 7, complete sequence Length = 226601 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 15494 ctcttcttcttcctcctcttc 15514
>gb|AC125065.3| Mus musculus BAC clone RP23-430G6 from chromosome 5, complete sequence Length = 205734 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 30542 ctcttcttcttcctcctcttc 30522 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 265 tcttcttcttcctcctcttc 284 |||||||||||||||||||| Sbjct: 117089 tcttcttcttcctcctcttc 117070
>gb|AC124581.4| Mus musculus BAC clone RP23-116E3 from chromosome 13, complete sequence Length = 205173 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 189829 ctcttcttcttcctcctcttc 189849
>gb|AC133204.3| Mus musculus BAC clone RP23-106N3 from chromosome 5, complete sequence Length = 224181 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 199734 ctcttcttcttcctcctcttc 199754
>gb|AC007950.7| Homo sapiens chromosome 15, clone RP11-44M14, complete sequence Length = 170979 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 113013 ctcttcttcttcctcctcttc 113033
>gb|BC032768.1| Homo sapiens PR domain containing 2, with ZNF domain, mRNA (cDNA clone IMAGE:3872694), containing frame-shift errors Length = 3938 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 267 ttcttcttcctcctcttcatc 287 ||||||||||||||||||||| Sbjct: 480 ttcttcttcctcctcttcatc 500
>emb|Z79755.1|CEF43G9 Caenorhabditis elegans Cosmid F43G9, complete sequence Length = 38166 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 265 tcttcttcttcctcctcttca 285 ||||||||||||||||||||| Sbjct: 34403 tcttcttcttcctcctcttca 34423
>gb|AC110212.12| Mus musculus chromosome 19, clone RP23-183H23, complete sequence Length = 212687 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 63553 ctcttcttcttcctcctcttc 63533
>gb|AC124447.3| Mus musculus BAC clone RP24-209M20 from chromosome 1, complete sequence Length = 167053 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 6329 ctcttcttcttcctcctcttc 6349
>gb|AC122445.3| Mus musculus BAC clone RP24-233P3 from chromosome 17, complete sequence Length = 173130 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 168871 ctcttcttcttcctcctcttc 168851
>gb|AC124681.3| Mus musculus BAC clone RP24-261H7 from chromosome 16, complete sequence Length = 173837 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 82916 ctcttcttcttcctcctcttc 82896
>ref|XM_810992.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053509099.160) partial mRNA Length = 3378 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 564 ctcttcttcttcctcctcttc 544
>gb|AC125157.4| Mus musculus BAC clone RP24-390G17 from chromosome 18, complete sequence Length = 207265 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 127800 ctcttcttcttcctcctcttc 127820
>gb|AC122540.4| Mus musculus BAC clone RP24-555K13 from chromosome 17, complete sequence Length = 149770 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 93011 ctcttcttcttcctcctcttc 93031
>gb|AC121804.3| Mus musculus BAC clone RP23-442I5 from chromosome 12, complete sequence Length = 199938 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 32875 ctcttcttcttcctcctcttc 32895
>gb|AC125077.4| Mus musculus BAC clone RP23-473K6 from chromosome 6, complete sequence Length = 184783 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 179266 ctcttcttcttcctcctcttc 179246
>ref|XM_813963.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053508879.210) partial mRNA Length = 1698 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 84 ctcttcttcttcctcctcttc 64
>gb|AC124538.4| Mus musculus BAC clone RP23-338P10 from chromosome 1, complete sequence Length = 181512 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 268 tcttcttcctcctcttcatca 288 ||||||||||||||||||||| Sbjct: 100763 tcttcttcctcctcttcatca 100783
>gb|AC123844.4| Mus musculus BAC clone RP23-416P14 from chromosome 7, complete sequence Length = 198721 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 24752 ctcttcttcttcctcctcttc 24732
>gb|AC122420.4| Mus musculus BAC clone RP24-167C5 from chromosome 8, complete sequence Length = 179058 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 39603 ctcttcttcttcctcctcttc 39583 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 39522 ctcttcttcttcctcctcttc 39502
>gb|AC123069.4| Mus musculus BAC clone RP23-23B21 from 9, complete sequence Length = 162961 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 120793 ctcttcttcttcctcctcttc 120813
>gb|AC126686.3| Mus musculus BAC clone RP23-148C24 from 18, complete sequence Length = 232817 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 178982 ctcttcttcttcctcctcttc 179002 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 80660 ctcttcttcttcctcctcttc 80680
>emb|CR381607.8| Zebrafish DNA sequence from clone CH211-125I6 in linkage group 7, complete sequence Length = 94930 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 263 gctcttcttcttcctcctcttcatc 287 |||| |||||||||||||||||||| Sbjct: 56798 gctcctcttcttcctcctcttcatc 56822
>gb|AC124177.2| Mus musculus BAC clone RP23-193C10 from 3, complete sequence Length = 217266 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 161415 ctcttcttcttcctcctcttc 161435
>gb|AC122295.4| Mus musculus BAC clone RP23-263E3 from 13, complete sequence Length = 200289 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 264 ctcttcttcttcctcctcttc 284 ||||||||||||||||||||| Sbjct: 58466 ctcttcttcttcctcctcttc 58486 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,806,288 Number of Sequences: 3902068 Number of extensions: 5806288 Number of successful extensions: 193102 Number of sequences better than 10.0: 1710 Number of HSP's better than 10.0 without gapping: 1755 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 180607 Number of HSP's gapped (non-prelim): 12177 length of query: 502 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 480 effective length of database: 17,147,199,772 effective search space: 8230655890560 effective search space used: 8230655890560 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)