ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags22f04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY233283.1| Hepatitis B virus isolate 4038 complete genome 42 2.3
2emb|AL356772.14| Human DNA sequence from clone RP11-47B24 on chr... 42 2.3
3emb|AL136119.16| Human DNA sequence from clone RP11-113F5 on chr... 42 2.3
4gb|DQ013311.1| Oligocottus maculosus heat shock protein 90 (Hsp9... 42 2.3
5gb|AC140306.3| Mus musculus BAC clone RP23-386L13 from 8, comple... 42 2.3
6gb|AC169128.2| Mus musculus BAC clone RP23-306C13 from chromosom... 40 9.2
7gb|AY395632.1| Dicentrarchus labrax HSP-90 mRNA, complete cds 40 9.2
8gb|AC007578.6| Drosophila melanogaster clone BACR09A11, complete... 40 9.2
9gb|AC133092.4| Mus musculus BAC clone RP23-404G6 from chromosome... 40 9.2
10gb|AE006376.1| Lactococcus lactis subsp. lactis IL1403 section 1... 40 9.2
11gb|AC126408.6| Mus musculus chromosome 13, clone RP23-216P14, co... 40 9.2
12ref|XM_001000956.1| PREDICTED: Mus musculus DEAD (Asp-Glu-Ala-As... 40 9.2
13gb|AC133205.3| Mus musculus BAC clone RP23-108P11 from chromosom... 40 9.2
14gb|AE014075.1| Escherichia coli CFT073, complete genome 40 9.2
15gb|CP000243.1| Escherichia coli UTI89, complete genome 40 9.2
16gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ... 40 9.2
17gb|AC158926.4| Mus musculus chromosome 3, clone RP24-93J4, compl... 40 9.2
18emb|BX640421.1| Bordetella pertussis strain Tohama I, complete g... 40 9.2
19gb|AE010060.1| Streptococcus pyogenes strain MGAS8232, section 1... 40 9.2
20gb|AC155936.7| Mus musculus 10 BAC RP24-397C20 (Roswell Park Can... 40 9.2
21gb|AC007473.10|AC007473 Drosophila melanogaster, chromosome 2R, ... 40 9.2
22gb|AE003825.3| Drosophila melanogaster chromosome 2R, section 25... 40 9.2

>gb|AY233283.1| Hepatitis B virus isolate 4038 complete genome
          Length = 3221

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 5    atatattgttgatttagaaag 25
            |||||||||||||||||||||
Sbjct: 1136 atatattgttgatttagaaag 1116



to top

>emb|AL356772.14| Human DNA sequence from clone RP11-47B24 on chromosome 10, complete
              sequence
          Length = 163861

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 537    aaggttttatggccaggactg 557
              |||||||||||||||||||||
Sbjct: 163092 aaggttttatggccaggactg 163112



to top

>emb|AL136119.16| Human DNA sequence from clone RP11-113F5 on chromosome 10, complete
            sequence
          Length = 91580

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 537  aaggttttatggccaggactg 557
            |||||||||||||||||||||
Sbjct: 1231 aaggttttatggccaggactg 1251



to top

>gb|DQ013311.1| Oligocottus maculosus heat shock protein 90 (Hsp90) mRNA, partial
           cds
          Length = 811

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 244 ctctggcagctccagaccctc 264
           |||||||||||||||||||||
Sbjct: 568 ctctggcagctccagaccctc 548



to top

>gb|AC140306.3| Mus musculus BAC clone RP23-386L13 from 8, complete sequence
          Length = 220059

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 75     gaagatacaaaacagtcttgg 95
              |||||||||||||||||||||
Sbjct: 143655 gaagatacaaaacagtcttgg 143675



to top

>gb|AC169128.2| Mus musculus BAC clone RP23-306C13 from chromosome 13, complete
             sequence
          Length = 185965

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 452   ttagatgtggatgccgttgccatttcgc 479
             ||||||||||||||  ||||||||||||
Sbjct: 73343 ttagatgtggatgcatttgccatttcgc 73316



to top

>gb|AY395632.1| Dicentrarchus labrax HSP-90 mRNA, complete cds
          Length = 2265

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 245  tctggcagctccagaccctc 264
            ||||||||||||||||||||
Sbjct: 1713 tctggcagctccagaccctc 1694



to top

>gb|AC007578.6| Drosophila melanogaster clone BACR09A11, complete sequence
          Length = 170684

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 348  gcagttccaaatccaaaacc 367
            ||||||||||||||||||||
Sbjct: 9221 gcagttccaaatccaaaacc 9240



to top

>gb|AC133092.4| Mus musculus BAC clone RP23-404G6 from chromosome 3, complete sequence
          Length = 190089

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 14     tgatttagaaagatactaactatt 37
              |||||||||||||||||| |||||
Sbjct: 163180 tgatttagaaagatactatctatt 163157



to top

>gb|AE006376.1| Lactococcus lactis subsp. lactis IL1403 section 138 of 218 of the
           complete genome
          Length = 10658

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 171 cgaaaaaatatcagaaacgc 190
           ||||||||||||||||||||
Sbjct: 224 cgaaaaaatatcagaaacgc 243



to top

>gb|AC126408.6| Mus musculus chromosome 13, clone RP23-216P14, complete sequence
          Length = 238967

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 3      gtatatattgttgatttaga 22
              ||||||||||||||||||||
Sbjct: 182992 gtatatattgttgatttaga 183011



to top

>ref|XM_001000956.1| PREDICTED: Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 46
            (Ddx46), mRNA
          Length = 5370

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 3    gtatatattgttgatttaga 22
            ||||||||||||||||||||
Sbjct: 4552 gtatatattgttgatttaga 4571



to top

>gb|AC133205.3| Mus musculus BAC clone RP23-108P11 from chromosome 13, complete sequence
          Length = 205640

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 3      gtatatattgttgatttaga 22
              ||||||||||||||||||||
Sbjct: 106835 gtatatattgttgatttaga 106854



to top

>gb|AE014075.1| Escherichia coli CFT073, complete genome
          Length = 5231428

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 422     ggaatgttgcgtgatgctgc 441
               ||||||||||||||||||||
Sbjct: 5212275 ggaatgttgcgtgatgctgc 5212294



to top

>gb|CP000243.1| Escherichia coli UTI89, complete genome
          Length = 5065741

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 422     ggaatgttgcgtgatgctgc 441
               ||||||||||||||||||||
Sbjct: 5046588 ggaatgttgcgtgatgctgc 5046607



to top

>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence
          Length = 3806533

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 184    gaaacgcgtgttgccggctg 203
              ||||||||||||||||||||
Sbjct: 254796 gaaacgcgtgttgccggctg 254777



to top

>gb|AC158926.4| Mus musculus chromosome 3, clone RP24-93J4, complete sequence
          Length = 185247

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 14     tgatttagaaagatactaactatt 37
              |||||||||||||||||| |||||
Sbjct: 157809 tgatttagaaagatactatctatt 157832



to top

>emb|BX640421.1| Bordetella pertussis strain Tohama I, complete genome; segment 11/12
          Length = 349726

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 620    gcgctggagcagcaggtcta 639
              ||||||||||||||||||||
Sbjct: 116572 gcgctggagcagcaggtcta 116553



to top

>gb|AE010060.1| Streptococcus pyogenes strain MGAS8232, section 108 of 173 of the
            complete genome
          Length = 10844

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 20   agaaagatactaactatttgacca 43
            ||||||||||||||||||| ||||
Sbjct: 7255 agaaagatactaactatttaacca 7232



to top

>gb|AC155936.7| Mus musculus 10 BAC RP24-397C20 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 177791

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 354   ccaaatccaaaaccaaagaaatcc 377
             ||||| ||||||||||||||||||
Sbjct: 63283 ccaaaaccaaaaccaaagaaatcc 63306



to top

>gb|AC007473.10|AC007473 Drosophila melanogaster, chromosome 2R, region 48A-48B, BAC clone
            BACR38D12, complete sequence
          Length = 171831

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 348  gcagttccaaatccaaaacc 367
            ||||||||||||||||||||
Sbjct: 8728 gcagttccaaatccaaaacc 8709



to top

>gb|AE003825.3| Drosophila melanogaster chromosome 2R, section 25 of 73 of the complete
             sequence
          Length = 261690

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 348   gcagttccaaatccaaaacc 367
             ||||||||||||||||||||
Sbjct: 86901 gcagttccaaatccaaaacc 86882


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,396,364
Number of Sequences: 3902068
Number of extensions: 5396364
Number of successful extensions: 100751
Number of sequences better than 10.0: 22
Number of HSP's better than 10.0 without gapping: 22
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 100685
Number of HSP's gapped (non-prelim): 66
length of query: 670
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 647
effective length of database: 17,143,297,704
effective search space: 11091713614488
effective search space used: 11091713614488
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top