ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags22f03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|D13147.1|WHTNANBU Triticum aestivum mRNA for elongation fact... 470 e-129
2ref|NM_186038.2| Oryza sativa (japonica cultivar-group), mRNA 165 2e-37
3ref|XM_506540.1| PREDICTED Oryza sativa (japonica cultivar-group... 165 2e-37
4dbj|AK121942.1| Oryza sativa (japonica cultivar-group) cDNA clon... 165 2e-37
5dbj|AK098892.1| Oryza sativa (japonica cultivar-group) cDNA clon... 165 2e-37
6dbj|AK061761.1| Oryza sativa (japonica cultivar-group) cDNA clon... 165 2e-37
7dbj|D12821.1|RICEF1B Oryza sativa (japonica cultivar-group) mRNA... 165 2e-37
8gb|BT016181.1| Zea mays clone Contig14 mRNA sequence 121 2e-24
9dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 117 3e-23
10dbj|AP005452.5| Oryza sativa (japonica cultivar-group) genomic D... 117 3e-23
11gb|BT017490.1| Zea mays clone EL01N0413C10.c mRNA sequence 105 1e-19
12emb|AJ277799.1|HVU277799 Hordeum vulgare mRNA for putative elong... 105 1e-19
13gb|BT016185.1| Zea mays clone Contig18 mRNA sequence 82 2e-12
14gb|BT016424.1| Zea mays clone Contig257 mRNA sequence 78 3e-11
15gb|AY103717.1| Zea mays PCO098989 mRNA sequence 72 2e-09
16emb|CR954185.2| Medicago truncatula chromosome 5 clone mth4-20m5... 62 2e-06
17gb|AY111648.1| Zea mays CL2935_1 mRNA sequence 60 6e-06
18gb|DQ226877.1| Boechera divaricarpa isolate SLW-C-G10 mRNA sequence 58 3e-05
19gb|AY909456.1| Siniperca chuatsi clone C279 translation elongati... 58 3e-05
20ref|NM_127367.1| Arabidopsis thaliana translation elongation fac... 56 1e-04
21emb|BX071583.1|CNS09REB Single read from an extremity of a full-... 56 1e-04
22emb|BX071358.1|CNS09R82 Single read from an extremity of a full-... 56 1e-04
23emb|BX071357.1|CNS09R81 Single read from an extremity of a full-... 56 1e-04
24emb|BX068711.1|CNS09P6J Single read from an extremity of a full-... 56 1e-04
25emb|BX068710.1|CNS09P6I Single read from an extremity of a full-... 56 1e-04
26emb|BX065206.1|CNS09MH6 Single read from an extremity of a full-... 56 1e-04
27emb|BX063619.1|CNS09L93 Single read from an extremity of a full-... 56 1e-04
28emb|BX063618.1|CNS09L92 Single read from an extremity of a full-... 56 1e-04
29emb|BX063276.1|CNS09KZK Single read from an extremity of a full-... 56 1e-04
30emb|BX063275.1|CNS09KZJ Single read from an extremity of a full-... 56 1e-04
31emb|BX053674.1|CNS09DKU Single read from an extremity of a full-... 56 1e-04
32emb|BX053673.1|CNS09DKT Single read from an extremity of a full-... 56 1e-04
33emb|BX052417.1|CNS09CLX Single read from an extremity of a full-... 56 1e-04
34emb|BX052416.1|CNS09CLW Single read from an extremity of a full-... 56 1e-04
35emb|BX052150.1|CNS09CEI Single read from an extremity of a full-... 56 1e-04
36emb|BX052149.1|CNS09CEH Single read from an extremity of a full-... 56 1e-04
37emb|BX052078.1|CNS09CCI Single read from an extremity of a full-... 56 1e-04
38emb|BX052058.1|CNS09CBY Single read from an extremity of a full-... 56 1e-04
39emb|BX047220.1|CNS098LK Single read from an extremity of a full-... 56 1e-04
40emb|BX047219.1|CNS098LJ Single read from an extremity of a full-... 56 1e-04
41emb|BX046233.1|CNS097U5 Single read from an extremity of a full-... 56 1e-04
42emb|BX046232.1|CNS097U4 Single read from an extremity of a full-... 56 1e-04
43emb|BX042348.1|CNS094U8 Single read from an extremity of a full-... 56 1e-04
44emb|BX042347.1|CNS094U7 Single read from an extremity of a full-... 56 1e-04
45emb|BX041605.1|CNS0949L Single read from an extremity of a full-... 56 1e-04
46emb|BX041604.1|CNS0949K Single read from an extremity of a full-... 56 1e-04
47emb|BX041307.1|CNS0941B Single read from an extremity of a full-... 56 1e-04
48emb|BX039708.1|CNS092SW Single read from an extremity of a full-... 56 1e-04
49emb|BX039707.1|CNS092SV Single read from an extremity of a full-... 56 1e-04
50emb|BX037290.1|CNS090XQ Single read from an extremity of a full-... 56 1e-04
51emb|BX036523.1|CNS090CF Single read from an extremity of a full-... 56 1e-04
52emb|BX036522.1|CNS090CE Single read from an extremity of a full-... 56 1e-04
53emb|BX035983.1|CNS08ZXF Single read from an extremity of a full-... 56 1e-04
54emb|BX035891.1|CNS08ZUV Single read from an extremity of a full-... 56 1e-04
55emb|BX035890.1|CNS08ZUU Single read from an extremity of a full-... 56 1e-04
56emb|BX035827.1|CNS08ZT3 Single read from an extremity of a full-... 56 1e-04
57emb|BX035826.1|CNS08ZT2 Single read from an extremity of a full-... 56 1e-04
58emb|BX035202.1|CNS08ZBQ Single read from an extremity of a full-... 56 1e-04
59emb|BX034842.1|CNS08Z1Q Single read from an extremity of a full-... 56 1e-04
60emb|BX034841.1|CNS08Z1P Single read from an extremity of a full-... 56 1e-04
61emb|BX034961.1|CNS08Z51 Single read from an extremity of a full-... 56 1e-04
62emb|BX032179.1|CNS08WZR Single read from an extremity of a full-... 56 1e-04
63emb|BX032178.1|CNS08WZQ Single read from an extremity of a full-... 56 1e-04
64emb|BX032163.1|CNS08WZB Single read from an extremity of a full-... 56 1e-04
65emb|BX029545.1|CNS08UYL Single read from an extremity of a full-... 56 1e-04
66emb|BX029544.1|CNS08UYK Single read from an extremity of a full-... 56 1e-04
67emb|BX022261.1|CNS08PC9 Single read from an extremity of a full-... 56 1e-04
68emb|BX022260.1|CNS08PC8 Single read from an extremity of a full-... 56 1e-04
69emb|BX027369.1|CNS08TA5 Single read from an extremity of a full-... 56 1e-04
70emb|BX027135.1|CNS08T3N Single read from an extremity of a full-... 56 1e-04
71emb|BX027134.1|CNS08T3M Single read from an extremity of a full-... 56 1e-04
72emb|BX026630.1|CNS08SPM Single read from an extremity of a full-... 56 1e-04
73emb|BX026629.1|CNS08SPL Single read from an extremity of a full-... 56 1e-04
74emb|BX026387.1|CNS08SIV Single read from an extremity of a full-... 56 1e-04
75emb|BX026386.1|CNS08SIU Single read from an extremity of a full-... 56 1e-04
76emb|BX025444.1|CNS08RSO Single read from an extremity of a full-... 56 1e-04
77emb|BX025443.1|CNS08RSN Single read from an extremity of a full-... 56 1e-04
78emb|BX024844.1|CNS08RC0 Single read from an extremity of a full-... 56 1e-04
79emb|BX024401.1|CNS08QZP Single read from an extremity of a full-... 56 1e-04
80emb|BX024400.1|CNS08QZO Single read from an extremity of a full-... 56 1e-04
81emb|BX023680.1|CNS08QFO Single read from an extremity of a full-... 56 1e-04
82emb|BX023679.1|CNS08QFN Single read from an extremity of a full-... 56 1e-04
83emb|BX019648.1|CNS08NBO Single read from an extremity of a full-... 56 1e-04
84emb|BX019647.1|CNS08NBN Single read from an extremity of a full-... 56 1e-04
85emb|BX019885.1|CNS08NI9 Single read from an extremity of a full-... 56 1e-04
86emb|BX019884.1|CNS08NI8 Single read from an extremity of a full-... 56 1e-04
87emb|BX018057.1|CNS08M3H Single read from an extremity of a full-... 56 1e-04
88emb|BX018056.1|CNS08M3G Single read from an extremity of a full-... 56 1e-04
89emb|BX016732.1|CNS08L2O Single read from an extremity of a full-... 56 1e-04
90emb|BX016731.1|CNS08L2N Single read from an extremity of a full-... 56 1e-04
91emb|BX016339.1|CNS08KRR Single read from an extremity of a full-... 56 1e-04
92emb|BX016338.1|CNS08KRQ Single read from an extremity of a full-... 56 1e-04
93emb|BX015846.1|CNS08KE2 Single read from an extremity of a full-... 56 1e-04
94emb|BX015845.1|CNS08KE1 Single read from an extremity of a full-... 56 1e-04
95emb|BX015954.1|CNS08KH2 Single read from an extremity of a full-... 56 1e-04
96emb|BX015953.1|CNS08KH1 Single read from an extremity of a full-... 56 1e-04
97emb|BX015235.1|CNS08JX3 Single read from an extremity of a full-... 56 1e-04
98emb|BX015234.1|CNS08JX2 Single read from an extremity of a full-... 56 1e-04
99emb|BX012178.1|CNS08HK6 Single read from an extremity of a full-... 56 1e-04
100emb|BX012177.1|CNS08HK5 Single read from an extremity of a full-... 56 1e-04
101emb|BX010493.1|CNS08G9D Single read from an extremity of a full-... 56 1e-04
102emb|BX010492.1|CNS08G9C Single read from an extremity of a full-... 56 1e-04
103emb|BX010211.1|CNS08G1J Single read from an extremity of a full-... 56 1e-04
104emb|BX010113.1|CNS08FYT Single read from an extremity of a full-... 56 1e-04
105emb|BX010112.1|CNS08FYS Single read from an extremity of a full-... 56 1e-04
106emb|BX009646.1|CNS08FLU Single read from an extremity of a full-... 56 1e-04
107emb|BX008302.1|CNS08EKI Single read from an extremity of a full-... 56 1e-04
108emb|BX008301.1|CNS08EKH Single read from an extremity of a full-... 56 1e-04
109gb|AC007212.7| Arabidopsis thaliana chromosome 2 clone F8D23 map... 56 1e-04
110gb|AC006201.4| Arabidopsis thaliana chromosome 2 clone T27K22 ma... 56 1e-04
111gb|AY081568.1| Arabidopsis thaliana putative elongation factor 1... 56 1e-04
112gb|AY065159.1| Arabidopsis thaliana putative elongation factor 1... 56 1e-04
113emb|BX820727.1|CNS0A8QL Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
114emb|BX820611.1|CNS0A8PL Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
115emb|BX842001.1|CNS09Y84 Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
116gb|AY087429.1| Arabidopsis thaliana clone 35337 mRNA, complete s... 56 1e-04
117ref|XM_313149.2| Anopheles gambiae str. PEST ENSANGP00000013448 ... 56 1e-04
118emb|BX037291.1|CNS090XR Single read from an extremity of a full-... 54 4e-04
119emb|X74734.1|ATHEFBI Arabidopsis thaliana gene for elongation fa... 54 4e-04
120ref|NM_102762.2| Arabidopsis thaliana translation elongation fac... 52 0.002
121ref|XM_479153.1| Oryza sativa (japonica cultivar-group), mRNA 52 0.002
122ref|XM_506463.1| PREDICTED Oryza sativa (japonica cultivar-group... 52 0.002
123gb|DQ207867.1| Solanum tuberosum clone 085E09 putative elongatio... 52 0.002
124gb|AC136471.1| Solanum demissum chromosome 11 BAC PGEC561 genomi... 52 0.002
125gb|DQ191626.1| Solanum tuberosum unknown mRNA 52 0.002
126gb|AY480020.1| Capsicum annuum putative elongation factor 1B alp... 52 0.002
127emb|BX816984.1|CNS0AE2C Arabidopsis thaliana Full-length cDNA Co... 52 0.002
128emb|BX817009.1|CNS0ABWL Arabidopsis thaliana Full-length cDNA Co... 52 0.002
129emb|BX817138.1|CNS0ABNH Arabidopsis thaliana Full-length cDNA Co... 52 0.002
130gb|AC073506.11|AC073506 Arabidopsis thaliana chromosome 1 BAC F1... 52 0.002
131dbj|AP005198.3| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
132dbj|AB180443.1| Plutella xylostella eEF-1 beta' mRNA for elongat... 52 0.002
133dbj|AK071736.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
134dbj|AK061069.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
135dbj|AK059384.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
136dbj|D23674.1|RICEF1BRB Oryza sativa (japonica cultivar-group) mR... 52 0.002
137ref|NM_121956.2| Arabidopsis thaliana translation elongation fac... 50 0.006
138ref|XM_520696.1| PREDICTED: Pan troglodytes similar to bA526D8.4... 50 0.006
139ref|NM_001010925.1| Homo sapiens ankyrin repeat domain 19 (ANKRD... 50 0.006
140emb|AJ249597.1|ATH249597 Arabidopsis thaliana mRNA for elongatio... 50 0.006
141emb|AL136981.22| Human DNA sequence from clone RP11-526D8 on chr... 50 0.006
142gb|AY056354.1| Arabidopsis thaliana putative elongation factor 1... 50 0.006
143gb|AF360304.1| Arabidopsis thaliana putative elongation factor 1... 50 0.006
144gb|BC028712.1| Homo sapiens ankyrin repeat domain 19, mRNA (cDNA... 50 0.006
145dbj|AK093497.1| Homo sapiens cDNA FLJ36178 fis, clone TESTI2026534 50 0.006
146emb|AL116697.1|CNS01DDT Botrytis cinerea strain T4 cDNA library 50 0.006
147emb|AL116510.1|CNS01D8M Botrytis cinerea strain T4 cDNA library 50 0.006
148emb|AL116208.1|CNS01D08 Botrytis cinerea strain T4 cDNA library 50 0.006
149emb|AL115318.1|CNS01CBI Botrytis cinerea strain T4 cDNA library 50 0.006
150emb|AL114622.1|CNS01BS6 Botrytis cinerea strain T4 cDNA library 50 0.006
151emb|AL114417.1|CNS01BMH Botrytis cinerea strain T4 cDNA library 50 0.006
152emb|AL112302.1|CNS019ZQ Botrytis cinerea strain T4 cDNA library 50 0.006
153emb|AL111685.1|CNS019IL Botrytis cinerea strain T4 cDNA library 50 0.006
154emb|BX830320.1|CNS0A1AJ Arabidopsis thaliana Full-length cDNA Co... 50 0.006
155emb|BX830295.1|CNS0A1LL Arabidopsis thaliana Full-length cDNA Co... 50 0.006
156emb|BX832129.1|CNS0A0XD Arabidopsis thaliana Full-length cDNA Co... 50 0.006
157emb|BX831615.1|CNS0A14O Arabidopsis thaliana Full-length cDNA Co... 50 0.006
158emb|BX830589.1|CNS0A17N Arabidopsis thaliana Full-length cDNA Co... 50 0.006
159gb|AY089071.1| Arabidopsis thaliana clone 26936 mRNA, complete s... 50 0.006
160gb|AF296830.1|T20D1 Arabidopsis thaliana BAC T20D1 50 0.006
161gb|BC038951.1| Homo sapiens ankyrin repeat domain 19, mRNA (cDNA... 50 0.006
162ref|XM_752243.1| Ustilago maydis 521 hypothetical protein (UM011... 48 0.025
163emb|BX046091.1|CNS097Q7 Single read from an extremity of a full-... 48 0.025
164emb|BX046090.1|CNS097Q6 Single read from an extremity of a full-... 48 0.025
165emb|Z97067.1|BVEF1BETA Beta vulgaris mRNA for elongation factor ... 48 0.025
166emb|X74733.1|ATL1BETA A.thaliana mRNA for elongation factor 1 beta 48 0.025
167gb|AC090680.11| Homo sapiens 12 BAC RP11-87P13 (Roswell Park Can... 48 0.025
168emb|BX820768.1|CNS0A8OK Arabidopsis thaliana Full-length cDNA Co... 48 0.025
169gb|DQ235167.1| Solanum tuberosum clone 154B05 ripening regulated... 46 0.097
170gb|AY398339.1| Danio rerio clone RK121A4C07 eukaryotic translati... 46 0.097
171gb|BC046042.1| Danio rerio eukaryotic translation elongation fac... 46 0.097
172gb|AC129594.3| Mus musculus BAC clone RP24-319J19 from chromosom... 46 0.097
173gb|AC140925.4| Mus musculus BAC clone RP24-140B17 from chromosom... 46 0.097
174gb|AC145266.3| Mus musculus BAC clone RP24-174A3 from chromosome... 46 0.097
175emb|CT009620.9| Zebrafish DNA sequence from clone CH73-187F10 in... 46 0.097
176gb|AY444796.1| Pisum sativum translational elongation factor 1 s... 46 0.097
177emb|BX029538.1|CNS08UYE Single read from an extremity of a full-... 46 0.097
178emb|AJ237772.1|OLA237772 Oryzias latipes mRNA for elongation fac... 46 0.097
179ref|NM_199949.2| Danio rerio eukaryotic translation elongation f... 46 0.097
180gb|AC149597.4| Mus musculus BAC clone RP24-90B12 from Y, complet... 46 0.097
181gb|BC071464.1| Danio rerio eukaryotic translation elongation fac... 46 0.097
182gb|BC055643.1| Danio rerio cDNA clone IMAGE:5915478, **** WARNIN... 44 0.38
183emb|AL353136.21| Human DNA sequence from clone RP11-133K18 on ch... 44 0.38
184gb|AY321330.1| Rattus norvegicus Ac2-067 mRNA, complete cds 44 0.38
185emb|AJ291984.1|PFL291984 Platichthys flesus partial mRNA for tra... 44 0.38
186emb|AL645962.22| Mouse DNA sequence from clone RP23-217L7 on chr... 44 0.38
187dbj|AB254814.1| Cryptomeria japonica mRNA for putative elongatio... 44 0.38
188ref|XM_703998.1| PREDICTED: Danio rerio similar to Elongation fa... 44 0.38
189ref|XM_683289.1| PREDICTED: Danio rerio similar to Elongation fa... 44 0.38
190emb|CR387695.1| Gallus gallus finished cDNA, clone ChEST70j23 44 0.38
191gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 44 0.38
192emb|BX933683.2| Gallus gallus finished cDNA, clone ChEST942d7 44 0.38
193emb|AL116212.1|CNS01D0C Botrytis cinerea strain T4 cDNA library 44 0.38
194emb|BX813340.1|CNS0AC3L Arabidopsis thaliana Full-length cDNA Co... 44 0.38
195emb|BX818274.1|CNS0AB2B Arabidopsis thaliana Full-length cDNA Co... 44 0.38
196emb|BX841878.1|CNS09Y45 Arabidopsis thaliana Full-length cDNA Co... 44 0.38
197emb|BX841873.1|CNS09Y2H Arabidopsis thaliana Full-length cDNA Co... 44 0.38
198emb|BX935015.1| Gallus gallus finished cDNA, clone ChEST301p14 44 0.38
199ref|XM_342043.2| PREDICTED: Rattus norvegicus similar to eukaryo... 44 0.38
200ref|NM_210904.1| Eremothecium gossypii AFR003Cp (AFR003C), mRNA 44 0.38
201gb|BC096865.1| Danio rerio cold inducible RNA binding protein, m... 44 0.38
202gb|AC170424.1| Rhesus Macaque BAC CH250-53N5 (Children's Hospit... 42 1.5
203ref|XM_524853.1| PREDICTED: Pan troglodytes similar to Elongatio... 42 1.5
204ref|XM_414267.1| PREDICTED: Gallus gallus similar to ring finger... 42 1.5
205gb|DQ440296.1| Aedes aegypti clone AET-374 elongation factor 1 b... 42 1.5
206gb|DQ191662.1| Solanum tuberosum elongation factor-like protein ... 42 1.5
207gb|BC021729.1| Homo sapiens similar to hypothetical protein FLJ2... 42 1.5
208gb|AC144711.2| Danio rerio clone CH211-218M15, complete sequence 42 1.5
209gb|AC004682.1|HUAC004682 Homo sapiens Chromosome 16 BAC clone CI... 42 1.5
210emb|CR733792.2|CNS0GSZ3 Tetraodon nigroviridis full-length cDNA 42 1.5
211emb|CR728524.2|CNS0GP2Q Tetraodon nigroviridis full-length cDNA 42 1.5
212emb|CR720100.2|CNS0GIKQ Tetraodon nigroviridis full-length cDNA 42 1.5
213emb|CR722642.2|CNS0GKJC Tetraodon nigroviridis full-length cDNA 42 1.5
214emb|CR719902.2|CNS0GIF8 Tetraodon nigroviridis full-length cDNA 42 1.5
215emb|CR703454.2|CNS0G5QI Tetraodon nigroviridis full-length cDNA 42 1.5
216emb|CR701463.2|CNS0G477 Tetraodon nigroviridis full-length cDNA 42 1.5
217emb|CR698877.2|CNS0G27D Tetraodon nigroviridis full-length cDNA 42 1.5
218emb|CR691105.2|CNS0FW7H Tetraodon nigroviridis full-length cDNA 42 1.5
219emb|CR688433.2|CNS0FU59 Tetraodon nigroviridis full-length cDNA 42 1.5
220emb|CR687149.2|CNS0FT5L Tetraodon nigroviridis full-length cDNA 42 1.5
221emb|CR687009.2|CNS0FT1P Tetraodon nigroviridis full-length cDNA 42 1.5
222emb|CR686677.2|CNS0FSSH Tetraodon nigroviridis full-length cDNA 42 1.5
223emb|CR685114.3|CNS0FRL2 Tetraodon nigroviridis full-length cDNA 42 1.5
224emb|CR683419.2|CNS0FQ9Z Tetraodon nigroviridis full-length cDNA 42 1.5
225emb|CR681006.2|CNS0FOEY Tetraodon nigroviridis full-length cDNA 42 1.5
226emb|CR680575.2|CNS0FO2Z Tetraodon nigroviridis full-length cDNA 42 1.5
227emb|CR680242.2|CNS0FNTQ Tetraodon nigroviridis full-length cDNA 42 1.5
228emb|CR679939.2|CNS0FNLB Tetraodon nigroviridis full-length cDNA 42 1.5
229emb|CR677929.1|CNS0FM1T Tetraodon nigroviridis full-length cDNA 42 1.5
230emb|CR677980.2|CNS0FM38 Tetraodon nigroviridis full-length cDNA 42 1.5
231emb|CR677281.2|CNS0FLJX Tetraodon nigroviridis full-length cDNA 42 1.5
232emb|CR677181.2|CNS0FLH5 Tetraodon nigroviridis full-length cDNA 42 1.5
233emb|CR676468.2|CNS0FKXC Tetraodon nigroviridis full-length cDNA 42 1.5
234emb|CR676870.2|CNS0FL8I Tetraodon nigroviridis full-length cDNA 42 1.5
235emb|CR674225.2|CNS0FJ7B Tetraodon nigroviridis full-length cDNA 42 1.5
236emb|CR673965.2|CNS0FJ03 Tetraodon nigroviridis full-length cDNA 42 1.5
237emb|CR673115.2|CNS0FICH Tetraodon nigroviridis full-length cDNA 42 1.5
238emb|CR672809.2|CNS0FI3Z Tetraodon nigroviridis full-length cDNA 42 1.5
239emb|CR672714.2|CNS0FI1C Tetraodon nigroviridis full-length cDNA 42 1.5
240emb|CR672557.2|CNS0FHWZ Tetraodon nigroviridis full-length cDNA 42 1.5
241emb|CR672233.2|CNS0FHNZ Tetraodon nigroviridis full-length cDNA 42 1.5
242emb|CR671039.2|CNS0FGQT Tetraodon nigroviridis full-length cDNA 42 1.5
243emb|CR671013.2|CNS0FGQ3 Tetraodon nigroviridis full-length cDNA 42 1.5
244emb|CR671520.2|CNS0FH46 Tetraodon nigroviridis full-length cDNA 42 1.5
245emb|CR670534.2|CNS0FGCS Tetraodon nigroviridis full-length cDNA 42 1.5
246emb|CR668627.2|CNS0FEVT Tetraodon nigroviridis full-length cDNA 42 1.5
247emb|CR668461.2|CNS0FER7 Tetraodon nigroviridis full-length cDNA 42 1.5
248emb|CR668249.2|CNS0FELB Tetraodon nigroviridis full-length cDNA 42 1.5
249emb|CR667660.2|CNS0FE4Y Tetraodon nigroviridis full-length cDNA 42 1.5
250emb|CR666943.2|CNS0FDL1 Tetraodon nigroviridis full-length cDNA 42 1.5
251emb|CR666424.2|CNS0FD6M Tetraodon nigroviridis full-length cDNA 42 1.5
252emb|CR666052.2|CNS0FCWA Tetraodon nigroviridis full-length cDNA 42 1.5
253emb|CR665436.2|CNS0FCF6 Tetraodon nigroviridis full-length cDNA 42 1.5
254emb|CR664496.2|CNS0FBP2 Tetraodon nigroviridis full-length cDNA 42 1.5
255emb|CR664813.2|CNS0FBXV Tetraodon nigroviridis full-length cDNA 42 1.5
256emb|CR664774.2|CNS0FBWS Tetraodon nigroviridis full-length cDNA 42 1.5
257emb|CR663967.2|CNS0FBAD Tetraodon nigroviridis full-length cDNA 42 1.5
258emb|CR663903.2|CNS0FB8L Tetraodon nigroviridis full-length cDNA 42 1.5
259emb|CR663679.2|CNS0FB2D Tetraodon nigroviridis full-length cDNA 42 1.5
260emb|CR663217.2|CNS0FAPJ Tetraodon nigroviridis full-length cDNA 42 1.5
261emb|CR662504.2|CNS0FA5Q Tetraodon nigroviridis full-length cDNA 42 1.5
262emb|CR662807.2|CNS0FAE5 Tetraodon nigroviridis full-length cDNA 42 1.5
263emb|CR661271.2|CNS0F97H Tetraodon nigroviridis full-length cDNA 42 1.5
264emb|CR658047.2|CNS0F6PX Tetraodon nigroviridis full-length cDNA 42 1.5
265emb|CR659461.2|CNS0F7T7 Tetraodon nigroviridis full-length cDNA 42 1.5
266emb|CR659404.2|CNS0F7RM Tetraodon nigroviridis full-length cDNA 42 1.5
267emb|CR658737.2|CNS0F793 Tetraodon nigroviridis full-length cDNA 42 1.5
268emb|CR658693.2|CNS0F77V Tetraodon nigroviridis full-length cDNA 42 1.5
269emb|CR657178.2|CNS0F61S Tetraodon nigroviridis full-length cDNA 42 1.5
270emb|CR657080.2|CNS0F5Z2 Tetraodon nigroviridis full-length cDNA 42 1.5
271emb|CR657622.2|CNS0F6E4 Tetraodon nigroviridis full-length cDNA 42 1.5
272emb|CR657582.2|CNS0F6D0 Tetraodon nigroviridis full-length cDNA 42 1.5
273emb|CR657548.2|CNS0F6C2 Tetraodon nigroviridis full-length cDNA 42 1.5
274emb|CR655077.2|CNS0F4FF Tetraodon nigroviridis full-length cDNA 42 1.5
275emb|CR652367.2|CNS0F2C5 Tetraodon nigroviridis full-length cDNA 42 1.5
276emb|CR652169.2|CNS0F26N Tetraodon nigroviridis full-length cDNA 42 1.5
277emb|CR649960.2|CNS0F0HA Tetraodon nigroviridis full-length cDNA 42 1.5
278emb|CR649944.2|CNS0F0GU Tetraodon nigroviridis full-length cDNA 42 1.5
279emb|CR648239.2|CNS0EZ5H Tetraodon nigroviridis full-length cDNA 42 1.5
280emb|CR645624.2|CNS0EX4U Tetraodon nigroviridis full-length cDNA 42 1.5
281emb|CR642727.2|CNS0EUWD Tetraodon nigroviridis full-length cDNA 42 1.5
282emb|CR642517.2|CNS0EUQJ Tetraodon nigroviridis full-length cDNA 42 1.5
283emb|CR642045.2|CNS0EUDF Tetraodon nigroviridis full-length cDNA 42 1.5
284emb|CR641777.2|CNS0EU5Z Tetraodon nigroviridis full-length cDNA 42 1.5
285emb|CR637840.2|CNS0ER4M Tetraodon nigroviridis full-length cDNA 42 1.5
286emb|CR636750.2|CNS0EQAC Tetraodon nigroviridis full-length cDNA 42 1.5
287emb|CR635662.2|CNS0EPG4 Tetraodon nigroviridis full-length cDNA 42 1.5
288emb|CR634289.2|CNS0EODZ Tetraodon nigroviridis full-length cDNA 42 1.5
289emb|CR634173.2|CNS0EOAR Tetraodon nigroviridis full-length cDNA 42 1.5
290emb|AL731568.7| Human DNA sequence from clone RP11-367B6 on chro... 42 1.5
291emb|AL590229.3| Human DNA sequence from clone RP11-192B18 on chr... 42 1.5
292emb|AL512627.6| Human DNA sequence from clone RP11-21A16 on chro... 42 1.5
293emb|AL359205.15| Human DNA sequence from clone RP11-345N16 on ch... 42 1.5
294emb|AL833768.1|HSM805081 Homo sapiens mRNA; cDNA DKFZp666K117 (f... 42 1.5
295gb|AC022098.9| Homo sapiens chromosome 19 clone CTB-55O6, comple... 42 1.5
296gb|AC099507.3| Homo sapiens chromosome 5 clone RP11-24H18, compl... 42 1.5
297gb|AC087490.6| Homo sapiens chromosome 15, clone RP11-810H22, co... 42 1.5
298gb|AC103750.2| Homo sapiens chromosome 15, clone RP11-494F2, com... 42 1.5
299gb|AC010362.6| Homo sapiens chromosome 5 clone CTD-2037I18, comp... 42 1.5
300gb|AC098976.2| Homo sapiens BAC clone RP11-751L19 from 4, comple... 42 1.5
301ref|XM_944722.1| PREDICTED: Homo sapiens similar to Elongation f... 42 1.5
302ref|XM_944719.1| PREDICTED: Homo sapiens similar to Elongation f... 42 1.5
303ref|XM_944718.1| PREDICTED: Homo sapiens similar to Elongation f... 42 1.5
304ref|XM_940654.1| PREDICTED: Homo sapiens similar to Elongation f... 42 1.5
305ref|XM_934766.1| PREDICTED: Homo sapiens similar to Elongation f... 42 1.5
306ref|XM_934764.1| PREDICTED: Homo sapiens similar to Elongation f... 42 1.5
307ref|XM_934762.1| PREDICTED: Homo sapiens similar to Elongation f... 42 1.5
308ref|XM_058967.12| PREDICTED: Homo sapiens similar to Elongation ... 42 1.5
309gb|AC009075.7| Homo sapiens chromosome 16 clone RP11-328J14, com... 42 1.5
310dbj|AB169168.1| Macaca fascicularis testis cDNA, clone: QtsA-177... 42 1.5
311dbj|AB179332.1| Macaca fascicularis testis cDNA clone: QtsA-1773... 42 1.5
312gb|AC010429.6|AC010429 Homo sapiens chromosome 5 clone CTD-2199L... 42 1.5
313gb|AC008220.5|AC008220 Drosophila melanogaster, chromosome 3R, r... 42 1.5
314gb|AC007975.7|AC007975 Drosophila melanogaster, chromosome 3R, r... 42 1.5
315ref|NM_145293.2| Homo sapiens similar to hypothetical protein FL... 42 1.5
316dbj|BS000210.2| Pan troglodytes chromosome 22 clone:RP43-018H16,... 42 1.5
317emb|AL590078.2|HS381K22 Homo sapiens chromosome 9 BAC RP11-381K2... 42 1.5
318emb|CR848705.13| Zebrafish DNA sequence from clone DKEY-8O15 in ... 42 1.5
319gb|AE003776.2| Drosophila melanogaster chromosome 3R, section 11... 42 1.5
320dbj|AP001011.6| Homo sapiens genomic DNA, chromosome 18 clone:RP... 42 1.5
321gb|AC002525.1|AC002525 Human PAC clone 257C22A from 13q12-q13, c... 42 1.5
322ref|NM_121249.2| Arabidopsis thaliana translation elongation fac... 40 6.0
323gb|AC102320.6| Mus musculus chromosome 1, clone RP24-459A11, com... 40 6.0
324gb|AC152821.5| Mus musculus BAC clone RP24-366H21 from chromosom... 40 6.0
325gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 6.0
326gb|BC097116.1| Danio rerio zgc:114052, mRNA (cDNA clone MGC:1140... 40 6.0
327gb|AC119971.8| Mus musculus chromosome 16, clone RP24-480D8, com... 40 6.0
328gb|AC140680.4| Mus musculus BAC clone RP24-548A12 from chromosom... 40 6.0
329gb|AC141874.4| Mus musculus BAC clone RP24-327L10 from chromosom... 40 6.0
330gb|AC145586.4| Mus musculus BAC clone RP24-167J1 from chromosome... 40 6.0
331gb|AC145267.5| Mus musculus BAC clone RP24-161F7 from chromosome... 40 6.0
332gb|AC129209.4| Mus musculus BAC clone RP24-318B5 from chromosome... 40 6.0
333gb|L25599.1| Caenorhabditis elegans cosmid F54H12, complete sequ... 40 6.0
334gb|AC145346.3| Mus musculus BAC clone RP24-76G8 from chromosome ... 40 6.0
335gb|AC140401.4| Mus musculus BAC clone RP24-89O8 from chromosome ... 40 6.0
336gb|AC147259.3| Mus musculus BAC clone RP24-178N16 from chromosom... 40 6.0
337gb|AC145742.3| Mus musculus BAC clone RP24-225F21 from chromosom... 40 6.0
338gb|AC142265.4| Mus musculus BAC clone RP24-360F24 from chromosom... 40 6.0
339gb|AC184101.1| Mus musculus BAC clone RP24-534I7 from chromosome... 40 6.0
340gb|AC102333.10| Mus musculus chromosome 18, clone RP24-542P12, c... 40 6.0
341emb|AJ249596.1|ATH249596 Arabidopsis thaliana mRNA for elongatio... 40 6.0
342ref|NM_001030147.1| Danio rerio zgc:114052 (zgc:114052), mRNA 40 6.0
343gb|AC116503.17| Mus musculus chromosome 9, clone RP24-302M3, com... 40 6.0
344gb|AC147126.2| Mus musculus BAC clone RP24-561J22 from chromosom... 40 6.0
345gb|AC141875.4| Mus musculus BAC clone RP24-316O22 from chromosom... 40 6.0
346gb|AC144582.3| Mus musculus BAC clone RP24-323J22 from chromosom... 40 6.0
347gb|AC140678.2| Mus musculus BAC clone RP24-553I16 from chromosom... 40 6.0
348gb|AC142412.3| Mus musculus BAC clone RP24-75E18 from chromosome... 40 6.0
349gb|AC130834.4| Mus musculus BAC clone RP24-119M1 from chromosome... 40 6.0
350gb|AC140439.3| Mus musculus BAC clone RP24-172C23 from chromosom... 40 6.0
351gb|AC140427.3| Mus musculus BAC clone RP24-173G7 from chromosome... 40 6.0
352gb|AC144855.3| Mus musculus BAC clone RP24-179H2 from chromosome... 40 6.0
353gb|AC140394.3| Mus musculus BAC clone RP24-181E19 from chromosom... 40 6.0
354gb|AC147159.2| Mus musculus BAC clone RP24-259B7 from chromosome... 40 6.0
355gb|AC144552.3| Mus musculus BAC clone RP24-271M6 from chromosome... 40 6.0
356gb|AC145564.4| Mus musculus BAC clone RP24-482K19 from chromosom... 40 6.0
357gb|AC140474.3| Mus musculus BAC clone RP24-406O7 from chromosome... 40 6.0
358gb|AC144409.3| Mus musculus BAC clone RP24-302I24 from chromosom... 40 6.0
359gb|AC135808.4| Mus musculus BAC clone RP24-316N5 from chromosome... 40 6.0
360gb|AC141470.4| Mus musculus BAC clone RP24-566E24 from chromosom... 40 6.0
361ref|XM_381184.1| Gibberella zeae PH-1 chromosome 1 hypothetical ... 40 6.0
362ref|XM_532345.2| PREDICTED: Canis familiaris similar to eukaryot... 40 6.0
363ref|XM_851661.1| PREDICTED: Canis familiaris similar to eukaryot... 40 6.0
364ref|XM_851616.1| PREDICTED: Canis familiaris similar to eukaryot... 40 6.0
365ref|XM_851583.1| PREDICTED: Canis familiaris similar to eukaryot... 40 6.0
366ref|XM_851537.1| PREDICTED: Canis familiaris similar to eukaryot... 40 6.0
367ref|XM_851498.1| PREDICTED: Canis familiaris similar to eukaryot... 40 6.0
368ref|XM_851462.1| PREDICTED: Canis familiaris similar to eukaryot... 40 6.0
369ref|XM_570842.1| Cryptococcus neoformans var. neoformans JEC21 h... 40 6.0
370gb|AC122273.4| Mus musculus BAC clone RP23-228B2 from 9, complet... 40 6.0
371emb|CR693558.2|CNS0FY3M Tetraodon nigroviridis full-length cDNA 40 6.0
372gb|AC108423.10| Mus musculus chromosome 16, clone RP23-443N12, c... 40 6.0
373gb|AC175493.3| Mus musculus BAC clone RP24-70B12 from chromosome... 40 6.0
374emb|AL158080.21| Human DNA sequence from clone RP13-399N6 on chr... 40 6.0
375gb|AC175667.3| Mus musculus BAC clone RP24-372I14 from chromosom... 40 6.0
376gb|AC046185.14| Homo sapiens chromosome 17, clone RP11-51F16, co... 40 6.0
377emb|AL080315.18|HSDJ6P5 Human DNA sequence from clone RP1-6P5 on... 40 6.0
378emb|AL078602.14|HSJ360M22 Human DNA sequence from clone RP3-360M... 40 6.0
379gb|AC161175.5| Mus musculus chromosome 18, clone RP23-2J13, comp... 40 6.0
380gb|AC142409.4| Mus musculus BAC clone RP24-185L20 from chromosom... 40 6.0
381gb|AC098614.3| Homo sapiens chromosome 3 clone RP11-222K16, comp... 40 6.0
382gb|AC184103.1| Mus musculus chromosome UNK clone CH35-73N5, comp... 40 6.0
383gb|AC182253.3| Mus musculus BAC clone RP24-320A8 from chromosome... 40 6.0
384gb|AC182448.2| Mus musculus BAC clone RP24-490J20 from chromosom... 40 6.0
385gb|AC179922.3| Mus musculus BAC clone RP24-571K5 from chromosome... 40 6.0
386gb|AC103706.2| Homo sapiens chromosome 8, clone RP11-629O1, comp... 40 6.0
387gb|AC182761.2| Mus musculus BAC clone RP24-91P5 from chromosome ... 40 6.0
388gb|AC175744.2| Mus musculus BAC clone RP24-163J18 from chromosom... 40 6.0
389gb|AC093608.3| Homo sapiens BAC clone RP11-700C8 from 4, complet... 40 6.0
390gb|AC079925.6| Homo sapiens BAC clone RP11-544E17 from 4, comple... 40 6.0
391ref|XM_695588.1| PREDICTED: Danio rerio similar to Elongation fa... 40 6.0
392gb|BT024774.1| Arabidopsis thaliana At5g12110 mRNA, complete cds 40 6.0
393gb|AC175818.2| Mus musculus BAC clone RP24-566J3 from chromosome... 40 6.0
394gb|AF366456.1|AF366456 Allium cepa clone API063 maintainer line ... 40 6.0
395gb|AE009951.2| Fusobacterium nucleatum subsp. nucleatum ATCC 255... 40 6.0
396gb|AC182111.1| Mus musculus BAC clone RP24-415L2 from chromosome... 40 6.0
397gb|AF129078.2|AF129078 Homo sapiens chromosome 21 clone PAC B222... 40 6.0
398ref|NM_070415.3| Caenorhabditis elegans Y41E3.10 (Y41E3.10) mRNA... 40 6.0
399ref|NM_066336.2| Caenorhabditis elegans F54H12.6 (F54H12.6) mRNA... 40 6.0
400gb|AC175461.3| Mus musculus BAC clone RP24-64J17 from chromosome... 40 6.0
401gb|AC175710.2| Mus musculus BAC clone RP24-44O16 from chromosome... 40 6.0
402emb|BX908741.7| Mouse DNA sequence from clone RP23-189F6 on chro... 40 6.0
403gb|AC090524.1|AC090524 Caenorhabditis briggsae cosmid CB019H23, ... 40 6.0
404gb|AF204787.1|AF204787 Lycopersicon esculentum ripening regulate... 40 6.0
405gb|AC159235.2| Mus musculus BAC clone RP24-432L4 from chromosome... 40 6.0
406gb|AC145572.4| Mus musculus BAC clone RP24-95P13 from chromosome... 40 6.0
407gb|AC009107.11| Homo sapiens chromosome 16 clone RP11-459F6, com... 40 6.0
408gb|AC139712.1| Homo sapiens BAC clone RP11-754G3 from 2, complet... 40 6.0
409ref|XM_343580.2| PREDICTED: Rattus norvegicus eukaryotic transla... 40 6.0
410gb|BT002990.1| Arabidopsis thaliana clone RAFL15-16-K06 (R20516)... 40 6.0
411gb|AC173708.4| Mus musculus BAC clone RP24-140O8 from chromosome... 40 6.0
412gb|AC175389.2| Mus musculus BAC clone RP24-152N3 from chromosome... 40 6.0
413gb|AC175033.2| Mus musculus BAC clone RP24-283I7 from chromosome... 40 6.0
414emb|BX255896.4| Zebrafish DNA sequence from clone CH211-249O11 i... 40 6.0
415gb|BC081476.1| Danio rerio im:7233939, mRNA (cDNA clone IMAGE:72... 40 6.0
416emb|AL954170.4| Mouse DNA sequence from clone RP23-467H15 on chr... 40 6.0
417dbj|AB007727.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 6.0
418gb|AF212832.5| Homo sapiens chromosome 8 clone CTC-806C5 map 8q2... 40 6.0
419gb|AF155238.4| Homo sapiens chromosome 8 clone GS1-180I23 map 8q... 40 6.0
420emb|AJ249598.1|ATH249598 Arabidopsis thaliana mRNA for elongatio... 40 6.0
421gb|AF225898.1|AF225898 Homo sapiens BAC clone 13d21, complete se... 40 6.0
422gb|AF207955.1|AF207955 Homo sapiens chromosome 21q22.1 PAC N2139... 40 6.0
423emb|AL163247.2|HS21C047 Homo sapiens chromosome 21 segment HS21C047 40 6.0
424gb|AC005877.3|AC005877 citb_19_o_18, complete sequence 40 6.0
425emb|AL929003.17| Zebrafish DNA sequence from clone DKEY-235D18 i... 40 6.0
426gb|AC007073.2|AC007073 Homo sapiens chromosome 4 clone C0310G15 ... 40 6.0
427dbj|AP000642.5| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 6.0
428emb|Z95559.1|CEY41E3 Caenorhabditis elegans YAC Y41E3, complete ... 40 6.0
429gb|DQ306840.1| Hevea brasiliensis isolate SSH111 mRNA sequence 40 6.0
430gb|DQ306812.1| Hevea brasiliensis isolate SSH83 mRNA sequence 40 6.0
431gb|AC142490.3| Mus musculus BAC clone RP24-362J19 from Y, comple... 40 6.0
432gb|AC145575.3| Mus musculus BAC clone RP24-103M14 from Y, comple... 40 6.0
433gb|AC140421.4| Mus musculus BAC clone RP24-441H14 from Y, comple... 40 6.0
434gb|AC131661.4| Mus musculus BAC clone RP23-251N10 from 1, comple... 40 6.0
435dbj|AP005638.2| Homo sapiens genomic DNA, chromosome 11 clone:CM... 40 6.0
436emb|AL772282.9| Mouse DNA sequence from clone RP23-328F3 on chro... 40 6.0

>dbj|D13147.1|WHTNANBU Triticum aestivum mRNA for elongation factor 1 beta', complete cds
          Length = 884

 Score =  470 bits (237), Expect = e-129
 Identities = 294/310 (94%), Gaps = 6/310 (1%)
 Strand = Plus / Minus

                                                                       
Query: 137 accaatcccagtaccaagaatccagcagcaacaggtgagcggacaaagattctagatctt 196
           ||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||
Sbjct: 704 accaatcccagtaccaagaatccagcagcaacaggtgggcgaacaaagattctagatctt 645

                                                                       
Query: 197 gttgaaggcaacgatgtcacacgactggacgtactcgttgatgggcgcctcgcagagcac 256
           |||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||
Sbjct: 644 gttgaaggcaacgatgtcacacgactggacatactcgttgatgggcgcctcacagagcac 585

                                                                       
Query: 257 ttcctcaatgagagtgtcgacagacacgaggtcatcaatgatcgtcagcatgatctggag 316
           ||||||||| || ||||||||  |    ||||| || |||||||||||||||||||||||
Sbjct: 584 ttcctcaat-ag-gtgtcgacgca----aggtcgtcgatgatcgtcagcatgatctggag 531

                                                                       
Query: 317 cttcttgatgccataacccacaggcatgagcttagatgcaccccaggtgagaccctccat 376
           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 530 cttcttgatgccataacccacaggcataagcttagatgcaccccaggtgagaccctccat 471

                                                                       
Query: 377 ttgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 436
           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 470 ttgaacactgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 411

                     
Query: 437 gatgtccatg 446
           ||||||||||
Sbjct: 410 gatgtccatg 401



 Score =  202 bits (102), Expect = 7e-49
 Identities = 124/130 (95%), Gaps = 1/130 (0%)
 Strand = Plus / Minus

                                                                       
Query: 1   tagatgtttcgcc-ttacaaactgctcagcaattcaactatttaaaggtaacagacattc 59
           ||||||||||||| |||||||| ||||||||||||||||||||||||||| ||| |||||
Sbjct: 851 tagatgtttcgccattacaaaccgctcagcaattcaactatttaaaggtagcaggcattc 792

                                                                       
Query: 60  aagaccagggcttgactcaaaaacaaaaccagtagcatttctgtaagaggggtaactaaa 119
           ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 791 aagaccagggcatcactcaaaaacaaaaccagtagcatttctgtaagaggggtaactaaa 732

                     
Query: 120 tgggacgaca 129
           ||||||||||
Sbjct: 731 tgggacgaca 722



to top

>ref|NM_186038.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 998

 Score =  165 bits (83), Expect = 2e-37
 Identities = 143/163 (87%)
 Strand = Plus / Minus

                                                                       
Query: 276 acagacacgaggtcatcaatgatcgtcagcatgatctggagcttcttgatgccataaccc 335
           |||||||| | ||||||||  || |||| ||||||||| | ||||||||| || ||||||
Sbjct: 680 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 621

                                                                       
Query: 336 acaggcatgagcttagatgcaccccaggtgagaccctccatttgaacaccgcggacagcc 395
           |||||||  ||||| ||||| |||||||||||||||||||| || |||| ||||||||||
Sbjct: 620 acaggcacaagctttgatgctccccaggtgagaccctccatctgcacactgcggacagcc 561

                                                      
Query: 396 tcctccaacttcttcatgtcagtctcatcgtcccatggcttga 438
           ||||||||||||||||| |||||||| ||||||||||| ||||
Sbjct: 560 tcctccaacttcttcatatcagtctcgtcgtcccatggtttga 518



to top

>ref|XM_506540.1| PREDICTED Oryza sativa (japonica cultivar-group), P0453E03.111 mRNA
          Length = 1000

 Score =  165 bits (83), Expect = 2e-37
 Identities = 143/163 (87%)
 Strand = Plus / Minus

                                                                       
Query: 276 acagacacgaggtcatcaatgatcgtcagcatgatctggagcttcttgatgccataaccc 335
           |||||||| | ||||||||  || |||| ||||||||| | ||||||||| || ||||||
Sbjct: 682 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 623

                                                                       
Query: 336 acaggcatgagcttagatgcaccccaggtgagaccctccatttgaacaccgcggacagcc 395
           |||||||  ||||| ||||| |||||||||||||||||||| || |||| ||||||||||
Sbjct: 622 acaggcacaagctttgatgctccccaggtgagaccctccatctgcacactgcggacagcc 563

                                                      
Query: 396 tcctccaacttcttcatgtcagtctcatcgtcccatggcttga 438
           ||||||||||||||||| |||||||| ||||||||||| ||||
Sbjct: 562 tcctccaacttcttcatatcagtctcgtcgtcccatggtttga 520



to top

>dbj|AK121942.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033107E20, full
           insert sequence
          Length = 1028

 Score =  165 bits (83), Expect = 2e-37
 Identities = 143/163 (87%)
 Strand = Plus / Minus

                                                                       
Query: 276 acagacacgaggtcatcaatgatcgtcagcatgatctggagcttcttgatgccataaccc 335
           |||||||| | ||||||||  || |||| ||||||||| | ||||||||| || ||||||
Sbjct: 683 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 624

                                                                       
Query: 336 acaggcatgagcttagatgcaccccaggtgagaccctccatttgaacaccgcggacagcc 395
           |||||||  ||||| ||||| |||||||||||||||||||| || |||| ||||||||||
Sbjct: 623 acaggcacaagctttgatgctccccaggtgagaccctccatctgcacactgcggacagcc 564

                                                      
Query: 396 tcctccaacttcttcatgtcagtctcatcgtcccatggcttga 438
           ||||||||||||||||| |||||||| ||||||||||| ||||
Sbjct: 563 tcctccaacttcttcatatcagtctcgtcgtcccatggtttga 521



to top

>dbj|AK098892.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001M09, full
           insert sequence
          Length = 998

 Score =  165 bits (83), Expect = 2e-37
 Identities = 143/163 (87%)
 Strand = Plus / Minus

                                                                       
Query: 276 acagacacgaggtcatcaatgatcgtcagcatgatctggagcttcttgatgccataaccc 335
           |||||||| | ||||||||  || |||| ||||||||| | ||||||||| || ||||||
Sbjct: 680 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 621

                                                                       
Query: 336 acaggcatgagcttagatgcaccccaggtgagaccctccatttgaacaccgcggacagcc 395
           |||||||  ||||| ||||| |||||||||||||||||||| || |||| ||||||||||
Sbjct: 620 acaggcacaagctttgatgctccccaggtgagaccctccatctgcacactgcggacagcc 561

                                                      
Query: 396 tcctccaacttcttcatgtcagtctcatcgtcccatggcttga 438
           ||||||||||||||||| |||||||| ||||||||||| ||||
Sbjct: 560 tcctccaacttcttcatatcagtctcgtcgtcccatggtttga 518



to top

>dbj|AK061761.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-B01, full
           insert sequence
          Length = 1000

 Score =  165 bits (83), Expect = 2e-37
 Identities = 143/163 (87%)
 Strand = Plus / Minus

                                                                       
Query: 276 acagacacgaggtcatcaatgatcgtcagcatgatctggagcttcttgatgccataaccc 335
           |||||||| | ||||||||  || |||| ||||||||| | ||||||||| || ||||||
Sbjct: 682 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 623

                                                                       
Query: 336 acaggcatgagcttagatgcaccccaggtgagaccctccatttgaacaccgcggacagcc 395
           |||||||  ||||| ||||| |||||||||||||||||||| || |||| ||||||||||
Sbjct: 622 acaggcacaagctttgatgctccccaggtgagaccctccatctgcacactgcggacagcc 563

                                                      
Query: 396 tcctccaacttcttcatgtcagtctcatcgtcccatggcttga 438
           ||||||||||||||||| |||||||| ||||||||||| ||||
Sbjct: 562 tcctccaacttcttcatatcagtctcgtcgtcccatggtttga 520



to top

>dbj|D12821.1|RICEF1B Oryza sativa (japonica cultivar-group) mRNA for elongation factor 1
           beta', complete cds
          Length = 956

 Score =  165 bits (83), Expect = 2e-37
 Identities = 143/163 (87%)
 Strand = Plus / Minus

                                                                       
Query: 276 acagacacgaggtcatcaatgatcgtcagcatgatctggagcttcttgatgccataaccc 335
           |||||||| | ||||||||  || |||| ||||||||| | ||||||||| || ||||||
Sbjct: 641 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 582

                                                                       
Query: 336 acaggcatgagcttagatgcaccccaggtgagaccctccatttgaacaccgcggacagcc 395
           |||||||  ||||| ||||| |||||||||||||||||||| || |||| ||||||||||
Sbjct: 581 acaggcacaagctttgatgctccccaggtgagaccctccatctgcacactgcggacagcc 522

                                                      
Query: 396 tcctccaacttcttcatgtcagtctcatcgtcccatggcttga 438
           ||||||||||||||||| |||||||| ||||||||||| ||||
Sbjct: 521 tcctccaacttcttcatatcagtctcgtcgtcccatggtttga 479



to top

>gb|BT016181.1| Zea mays clone Contig14 mRNA sequence
          Length = 1084

 Score =  121 bits (61), Expect = 2e-24
 Identities = 103/117 (88%)
 Strand = Plus / Minus

                                                                       
Query: 317 cttcttgatgccataacccacaggcatgagcttagatgcaccccaggtgagaccctccat 376
           |||||||||||| || || |||||||  ||||| ||||| ||||| || |||||||||||
Sbjct: 628 cttcttgatgccgtatccaacaggcacaagctttgatgctccccaagtcagaccctccat 569

                                                                    
Query: 377 ttgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatgg 433
            || |||| ||||||||||||||||| ||||||||| ||||||||||||||||||||
Sbjct: 568 ctggacactgcggacagcctcctccagcttcttcatatcagtctcatcgtcccatgg 512



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 187 tctagatcttgttgaaggcaacgatgtcacacgactggacgtactcgttgatgggc 242
           |||||||||||||||| || || ||||| ||   |||||||||||| |||||||||
Sbjct: 758 tctagatcttgttgaaagccacaatgtcgcaactctggacgtactcattgatgggc 703



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  117 bits (59), Expect = 3e-23
 Identities = 80/87 (91%)
 Strand = Plus / Minus

                                                                            
Query: 352      atgcaccccaggtgagaccctccatttgaacaccgcggacagcctcctccaacttcttca 411
                |||| |||||||||||||||||||| || |||| ||||||||||||||||||||||||||
Sbjct: 27890071 atgctccccaggtgagaccctccatctgcacactgcggacagcctcctccaacttcttca 27890012

                                           
Query: 412      tgtcagtctcatcgtcccatggcttga 438
                | |||||||| ||||||||||| ||||
Sbjct: 27890011 tatcagtctcgtcgtcccatggtttga 27889985



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 57/67 (85%)
 Strand = Plus / Minus

                                                                            
Query: 276      acagacacgaggtcatcaatgatcgtcagcatgatctggagcttcttgatgccataaccc 335
                |||||||| | ||||||||  || |||| ||||||||| | ||||||||| || ||||||
Sbjct: 27890238 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 27890179

                       
Query: 336      acaggca 342
                |||||||
Sbjct: 27890178 acaggca 27890172



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                              
Query: 409      tcatgtcagtctcatcgtcccatggcttga 438
                ||||||||||||||||||||||||| ||||
Sbjct: 25261256 tcatgtcagtctcatcgtcccatggtttga 25261285



to top

>dbj|AP005452.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0453E03
          Length = 159980

 Score =  117 bits (59), Expect = 3e-23
 Identities = 80/87 (91%)
 Strand = Plus / Minus

                                                                         
Query: 352   atgcaccccaggtgagaccctccatttgaacaccgcggacagcctcctccaacttcttca 411
             |||| |||||||||||||||||||| || |||| ||||||||||||||||||||||||||
Sbjct: 53429 atgctccccaggtgagaccctccatctgcacactgcggacagcctcctccaacttcttca 53370

                                        
Query: 412   tgtcagtctcatcgtcccatggcttga 438
             | |||||||| ||||||||||| ||||
Sbjct: 53369 tatcagtctcgtcgtcccatggtttga 53343



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 57/67 (85%)
 Strand = Plus / Minus

                                                                         
Query: 276   acagacacgaggtcatcaatgatcgtcagcatgatctggagcttcttgatgccataaccc 335
             |||||||| | ||||||||  || |||| ||||||||| | ||||||||| || ||||||
Sbjct: 53596 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 53537

                    
Query: 336   acaggca 342
             |||||||
Sbjct: 53536 acaggca 53530



to top

>gb|BT017490.1| Zea mays clone EL01N0413C10.c mRNA sequence
          Length = 951

 Score =  105 bits (53), Expect = 1e-19
 Identities = 101/117 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 cttcttgatgccataacccacaggcatgagcttagatgcaccccaggtgagaccctccat 376
           |||||||||||| || || ||||| |  ||||| ||||| ||||| || |||||||||||
Sbjct: 615 cttcttgatgccgtatccaacagggacaagctttgatgctccccaagtcagaccctccat 556

                                                                    
Query: 377 ttgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatgg 433
            || |||| | ||||||||||||||| ||||||||| ||||||||||||||||||||
Sbjct: 555 ctggacactggggacagcctcctccagcttcttcatatcagtctcatcgtcccatgg 499



to top

>emb|AJ277799.1|HVU277799 Hordeum vulgare mRNA for putative elongation factor 1 beta
           (eEF1Bbeta 25 gene)
          Length = 1000

 Score =  105 bits (53), Expect = 1e-19
 Identities = 89/101 (88%)
 Strand = Plus / Minus

                                                                       
Query: 261 tcaatgagagtgtcgacagacacgaggtcatcaatgatcgtcagcatgatctggagcttc 320
           ||||| |||||||| ||||| || |||||||||||||| |||| ||| ||||||||||||
Sbjct: 701 tcaatcagagtgtcaacagagacaaggtcatcaatgatggtcatcataatctggagcttc 642

                                                    
Query: 321 ttgatgccataacccacaggcatgagcttagatgcacccca 361
           ||||||||||| || || ||||||||||| || ||||||||
Sbjct: 641 ttgatgccatatccaactggcatgagcttggaagcacccca 601



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 189 tagatcttgttgaaggcaacgatgtcacacgactggacgtactcgtt 235
           ||||| |||||||||||||| ||||||||   ||||| |||||||||
Sbjct: 773 tagattttgttgaaggcaacaatgtcacagctctggatgtactcgtt 727



to top

>gb|BT016185.1| Zea mays clone Contig18 mRNA sequence
          Length = 1070

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 197/249 (79%)
 Strand = Plus / Minus

                                                                       
Query: 188 ctagatcttgttgaaggcaacgatgtcacacgactggacgtactcgttgatgggcgcctc 247
           ||||||||||||||||||||| ||||| ||   ||| ||||||||||| |  ||| |  |
Sbjct: 821 ctagatcttgttgaaggcaactatgtcgcagctctgcacgtactcgttcactggctcagc 762

                                                                       
Query: 248 gcagagcacttcctcaatgagagtgtcgacagacacgaggtcatcaatgatcgtcagcat 307
           ||| ||    ||||||||||||||||||||||| || ||||| || | ||| |||| |||
Sbjct: 761 gcacagatagtcctcaatgagagtgtcgacagagacaaggtcgtcgacgatggtcatcat 702

                                                                       
Query: 308 gatctggagcttcttgatgccataacccacaggcatgagcttagatgcaccccaggtgag 367
           ||| || ||||||||||| ||||| || || || |  ||||| ||||| ||||||   ||
Sbjct: 701 gatttgcagcttcttgataccatatccaactgggacaagcttggatgcgccccagagcag 642

                                                                       
Query: 368 accctccatttgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtc 427
            || ||||| || ||||  |  ||||| ||||| | |||   ||||||||||||||||||
Sbjct: 641 cccttccatctggacactcctaacagcttcctcgagcttggccatgtcagtctcatcgtc 582

                    
Query: 428 ccatggctt 436
           |||||||||
Sbjct: 581 ccatggctt 573



to top

>gb|BT016424.1| Zea mays clone Contig257 mRNA sequence
          Length = 1064

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 144/179 (80%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcctcaatgagagtgtcgacagacacgaggtcatcaatgatcgtcagcatgatctggagc 317
           ||||||||||||||||||||||| || ||||| || | ||| |||| |||||| || |||
Sbjct: 723 tcctcaatgagagtgtcgacagagacaaggtcgtcgacgatggtcatcatgatttgcagc 664

                                                                       
Query: 318 ttcttgatgccataacccacaggcatgagcttagatgcaccccaggtgagaccctccatt 377
           |||||||| ||||| || || || |  ||||| ||||| ||||||   || || ||||| 
Sbjct: 663 ttcttgataccatatccaactgggacaagcttggatgcgccccagagcagcccttccatc 604

                                                                      
Query: 378 tgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 436
           || ||||  |  ||||| ||||| | |||   |||||||||||||||||||||||||||
Sbjct: 603 tggacactcctaacagcttcctcgagcttggccatgtcagtctcatcgtcccatggctt 545



to top

>gb|AY103717.1| Zea mays PCO098989 mRNA sequence
          Length = 1312

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 117/144 (81%)
 Strand = Plus / Minus

                                                                       
Query: 188 ctagatcttgttgaaggcaacgatgtcacacgactggacgtactcgttgatgggcgcctc 247
           ||||||||||||||||||||| ||||| ||   ||| ||||||||||| |  ||| |  |
Sbjct: 987 ctagatcttgttgaaggcaactatgtcgcaactctgtacgtactcgttaactggctcagc 928

                                                                       
Query: 248 gcagagcacttcctcaatgagagtgtcgacagacacgaggtcatcaatgatcgtcagcat 307
           ||| ||    ||||||||||||||||||||||| || ||||| || | ||| |||| |||
Sbjct: 927 gcacagatagtcctcaatgagagtgtcgacagagacaaggtcgtcgacgatggtcatcat 868

                                   
Query: 308 gatctggagcttcttgatgccata 331
           ||| || ||||||||||| |||||
Sbjct: 867 gatttgcagcttcttgataccata 844



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 410 catgtcagtctcatcgtcccatggctt 436
           |||||||||||||||||||||||||||
Sbjct: 765 catgtcagtctcatcgtcccatggctt 739



to top

>emb|CR954185.2| Medicago truncatula chromosome 5 clone mth4-20m5, COMPLETE SEQUENCE
          Length = 210708

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                             
Query: 390    acagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 436
              |||||||| |||| |||||||||||| |||||||| |||||||||||
Sbjct: 171387 acagcctcttccagcttcttcatgtctgtctcatcatcccatggctt 171433



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                             
Query: 390    acagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 436
              ||||| || |||| ||||||||| || |||||||| |||||||||||
Sbjct: 158087 acagcttcttccagcttcttcatatctgtctcatcatcccatggctt 158133



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                    
Query: 288    tcatcaatgatcgtcagcatgatctggagcttcttgat 325
              |||||||| || |||| ||||||||| |||||||||||
Sbjct: 171154 tcatcaataatggtcaacatgatctgcagcttcttgat 171191



to top

>gb|AY111648.1| Zea mays CL2935_1 mRNA sequence
          Length = 1119

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 258 tcctcaatgagagtgtcgacagacacgaggtcatcaatgatcgtcagcatgatctggagc 317
           ||||| ||||||||||| ||||| || |||||||| |  || |||| |||||| || |||
Sbjct: 391 tcctcgatgagagtgtcaacagagacaaggtcatcgacaatggtcatcatgatttgcagc 450

                         
Query: 318 ttcttgatgccata 331
           ||||||||||||||
Sbjct: 451 ttcttgatgccata 464



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 410 catgtcagtctcatcgtcccatggctt 436
           |||||||||||||||||||||||||||
Sbjct: 543 catgtcagtctcatcgtcccatggctt 569



to top

>gb|DQ226877.1| Boechera divaricarpa isolate SLW-C-G10 mRNA sequence
          Length = 459

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 380 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 436
           ||||| ||| |||||||||||||   |||||||||| |||||||| |||||||||||
Sbjct: 308 aacactgcgaacagcctcctccagtctcttcatgtcggtctcatcatcccatggctt 252



to top

>gb|AY909456.1| Siniperca chuatsi clone C279 translation elongation factor eEF-1
           delta mRNA, partial cds
          Length = 391

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 308 gatctggagcttcttgatgccataacccacagg 340
           ||||||||||||||||||||| |||||||||||
Sbjct: 191 gatctggagcttcttgatgccgtaacccacagg 159



to top

>ref|NM_127367.1| Arabidopsis thaliana translation elongation factor AT2G18110 mRNA,
           complete cds
          Length = 974

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 390 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 445
           ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 577 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 522



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 192 atcttgttgaaggcaacgatgtcaca 217
           ||||||||||||||||| ||||||||
Sbjct: 775 atcttgttgaaggcaacaatgtcaca 750



to top

>emb|BX071583.1|CNS09REB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9AG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 366 cttcatgtcggtttcatcgtcccatggcttgatgtc 401



to top

>emb|BX071358.1|CNS09R82 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 490 cttcatgtcggtttcatcgtcccatggcttgatgtc 525



to top

>emb|BX071357.1|CNS09R81 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 776 cttcatgtcggtttcatcgtcccatggcttgatgtc 741



to top

>emb|BX068711.1|CNS09P6J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 494 cttcatgtcggtttcatcgtcccatggcttgatgtc 529



to top

>emb|BX068710.1|CNS09P6I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 781 cttcatgtcggtttcatcgtcccatggcttgatgtc 746



to top

>emb|BX065206.1|CNS09MH6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 775 cttcatgtcggtttcatcgtcccatggcttgatgtc 740



to top

>emb|BX063619.1|CNS09L93 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45CC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 564

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 301 cttcatgtcggtttcatcgtcccatggcttgatgtc 336



to top

>emb|BX063618.1|CNS09L92 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45CC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 558

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 85  cttcatgtcggtttcatcgtcccatggcttgatgtc 50



to top

>emb|BX063276.1|CNS09KZK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1007

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 363 cttcatgtcggtttcatcgtcccatggcttgatgtc 398



to top

>emb|BX063275.1|CNS09KZJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1025

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 758 cttcatgtcggtttcatcgtcccatggcttgatgtc 723



to top

>emb|BX053674.1|CNS09DKU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 897

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 503 cttcatgtcggtttcatcgtcccatggcttgatgtc 538



to top

>emb|BX053673.1|CNS09DKT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1020

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 785 cttcatgtcggtttcatcgtcccatggcttgatgtc 750



to top

>emb|BX052417.1|CNS09CLX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3CA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 352 cttcatgtcggtttcatcgtcccatggcttgatgtc 387



to top

>emb|BX052416.1|CNS09CLW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3CA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 760 cttcatgtcggtttcatcgtcccatggcttgatgtc 725



to top

>emb|BX052150.1|CNS09CEI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 323 cttcatgtcggtttcatcgtcccatggcttgatgtc 358



to top

>emb|BX052149.1|CNS09CEH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 736 cttcatgtcggtttcatcgtcccatggcttgatgtc 701



to top

>emb|BX052078.1|CNS09CCI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 707

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 498 cttcatgtcggtttcatcgtcccatggcttgatgtc 533



to top

>emb|BX052058.1|CNS09CBY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1013

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 813 cttcatgtcggtttcatcgtcccatggcttgatgtc 778



to top

>emb|BX047220.1|CNS098LK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC21BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 310

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 140 cttcatgtcggtttcatcgtcccatggcttgatgtc 175



to top

>emb|BX047219.1|CNS098LJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 832

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 743 cttcatgtcggtttcatcgtcccatggcttgatgtc 708



to top

>emb|BX046233.1|CNS097U5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC2DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 716

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 615 cttcatgtcggtttcatcgtcccatggcttgatgtc 650



to top

>emb|BX046232.1|CNS097U4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1018

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 786 cttcatgtcggtttcatcgtcccatggcttgatgtc 751



to top

>emb|BX042348.1|CNS094U8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC14BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 598 cttcatgtcggtttcatcgtcccatggcttgatgtc 633



to top

>emb|BX042347.1|CNS094U7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC14BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 796

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 521 cttcatgtcggtttcatcgtcccatggcttgatgtc 486



to top

>emb|BX041605.1|CNS0949L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC13AE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 510

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 245 cttcatgtcggtttcatcgtcccatggcttgatgtc 280



to top

>emb|BX041604.1|CNS0949K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13AE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 829

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 728 cttcatgtcggtttcatcgtcccatggcttgatgtc 693



to top

>emb|BX041307.1|CNS0941B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 886

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 607 cttcatgtcggtttcatcgtcccatggcttgatgtc 572



to top

>emb|BX039708.1|CNS092SW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC10AE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 559

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 258 cttcatgtcggtttcatcgtcccatggcttgatgtc 293



to top

>emb|BX039707.1|CNS092SV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10AE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 491

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 279 cttcatgtcggtttcatcgtcccatggcttgatgtc 244



to top

>emb|BX037290.1|CNS090XQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 785 cttcatgtcggtttcatcgtcccatggcttgatgtc 750



to top

>emb|BX036523.1|CNS090CF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA8BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 112

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 9   cttcatgtcggtttcatcgtcccatggcttgatgtc 44



to top

>emb|BX036522.1|CNS090CE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 102

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 61  cttcatgtcggtttcatcgtcccatggcttgatgtc 26



to top

>emb|BX035983.1|CNS08ZXF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1001

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 494 cttcatgtcggtttcatcgtcccatggcttgatgtc 459



to top

>emb|BX035891.1|CNS08ZUV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7BG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 479 cttcatgtcggtttcatcgtcccatggcttgatgtc 514



to top

>emb|BX035890.1|CNS08ZUU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7BG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 841

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 728 cttcatgtcggtttcatcgtcccatggcttgatgtc 693



to top

>emb|BX035827.1|CNS08ZT3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 527 cttcatgtcggtttcatcgtcccatggcttgatgtc 562



to top

>emb|BX035826.1|CNS08ZT2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 785 cttcatgtcggtttcatcgtcccatggcttgatgtc 750



to top

>emb|BX035202.1|CNS08ZBQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA6BG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 714

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 594 cttcatgtcggtttcatcgtcccatggcttgatgtc 629



to top

>emb|BX034842.1|CNS08Z1Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA50DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 469 cttcatgtcggtttcatcgtcccatggcttgatgtc 504



to top

>emb|BX034841.1|CNS08Z1P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 752 cttcatgtcggtttcatcgtcccatggcttgatgtc 717



to top

>emb|BX034961.1|CNS08Z51 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA6AD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 863

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 607 cttcatgtcggtttcatcgtcccatggcttgatgtc 642



to top

>emb|BX032179.1|CNS08WZR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 599 cttcatgtcggtttcatcgtcccatggcttgatgtc 634



to top

>emb|BX032178.1|CNS08WZQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 586 cttcatgtcggtttcatcgtcccatggcttgatgtc 551



to top

>emb|BX032163.1|CNS08WZB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 555 cttcatgtcggtttcatcgtcccatggcttgatgtc 590



to top

>emb|BX029545.1|CNS08UYL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 550 cttcatgtcggtttcatcgtcccatggcttgatgtc 585



to top

>emb|BX029544.1|CNS08UYK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1041

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 781 cttcatgtcggtttcatcgtcccatggcttgatgtc 746



to top

>emb|BX022261.1|CNS08PC9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA34AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 270

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 81  cttcatgtcggtttcatcgtcccatggcttgatgtc 116



to top

>emb|BX022260.1|CNS08PC8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 866

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 758 cttcatgtcggtttcatcgtcccatggcttgatgtc 723



to top

>emb|BX027369.1|CNS08TA5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 613

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 309 cttcatgtcggtttcatcgtcccatggcttgatgtc 344



to top

>emb|BX027135.1|CNS08T3N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA40CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 603 cttcatgtcggtttcatcgtcccatggcttgatgtc 638



to top

>emb|BX027134.1|CNS08T3M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 785 cttcatgtcggtttcatcgtcccatggcttgatgtc 750



to top

>emb|BX026630.1|CNS08SPM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 600 cttcatgtcggtttcatcgtcccatggcttgatgtc 635



to top

>emb|BX026629.1|CNS08SPL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 894

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 758 cttcatgtcggtttcatcgtcccatggcttgatgtc 723



to top

>emb|BX026387.1|CNS08SIV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 817

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 607 cttcatgtcggtttcatcgtcccatggcttgatgtc 642



to top

>emb|BX026386.1|CNS08SIU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1035

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 445 cttcatgtcggtttcatcgtcccatggcttgatgtc 410



to top

>emb|BX025444.1|CNS08RSO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA39AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 884

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 500 cttcatgtcggtttcatcgtcccatggcttgatgtc 535



to top

>emb|BX025443.1|CNS08RSN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 728 cttcatgtcggtttcatcgtcccatggcttgatgtc 693



to top

>emb|BX024844.1|CNS08RC0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 788 cttcatgtcggtttcatcgtcccatggcttgatgtc 753



to top

>emb|BX024401.1|CNS08QZP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA37AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 605 cttcatgtcggtttcatcgtcccatggcttgatgtc 640



to top

>emb|BX024400.1|CNS08QZO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1013

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 780 cttcatgtcggtttcatcgtcccatggcttgatgtc 745



to top

>emb|BX023680.1|CNS08QFO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA36AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 879

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 527 cttcatgtcggtttcatcgtcccatggcttgatgtc 562



to top

>emb|BX023679.1|CNS08QFN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA36AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 806 cttcatgtcggtttcatcgtcccatggcttgatgtc 771



to top

>emb|BX019648.1|CNS08NBO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1023

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 380 cttcatgtcggtttcatcgtcccatggcttgatgtc 415



to top

>emb|BX019647.1|CNS08NBN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1025

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 797 cttcatgtcggtttcatcgtcccatggcttgatgtc 762



to top

>emb|BX019885.1|CNS08NI9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3BC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1009

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 503 cttcatgtcggtttcatcgtcccatggcttgatgtc 538



to top

>emb|BX019884.1|CNS08NI8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3BC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 788 cttcatgtcggtttcatcgtcccatggcttgatgtc 753



to top

>emb|BX018057.1|CNS08M3H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 643

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 437 cttcatgtcggtttcatcgtcccatggcttgatgtc 472



to top

>emb|BX018056.1|CNS08M3G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 345

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 288 cttcatgtcggtttcatcgtcccatggcttgatgtc 253



to top

>emb|BX016732.1|CNS08L2O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25AF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1019

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 618 cttcatgtcggtttcatcgtcccatggcttgatgtc 653



to top

>emb|BX016731.1|CNS08L2N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25AF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1027

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 624 cttcatgtcggtttcatcgtcccatggcttgatgtc 589



to top

>emb|BX016339.1|CNS08KRR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 755

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 518 cttcatgtcggtttcatcgtcccatggcttgatgtc 553



to top

>emb|BX016338.1|CNS08KRQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 881

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 778 cttcatgtcggtttcatcgtcccatggcttgatgtc 743



to top

>emb|BX015846.1|CNS08KE2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA23DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 298 cttcatgtcggtttcatcgtcccatggcttgatgtc 333



to top

>emb|BX015845.1|CNS08KE1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA23DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 794 cttcatgtcggtttcatcgtcccatggcttgatgtc 759



to top

>emb|BX015954.1|CNS08KH2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA23DG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 842

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 264 cttcatgtcggtttcatcgtcccatggcttgatgtc 299



to top

>emb|BX015953.1|CNS08KH1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA23DG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 690

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 655 cttcatgtcggtttcatcgtcccatggcttgatgtc 620



to top

>emb|BX015235.1|CNS08JX3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 503 cttcatgtcggtttcatcgtcccatggcttgatgtc 538



to top

>emb|BX015234.1|CNS08JX2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1016

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 787 cttcatgtcggtttcatcgtcccatggcttgatgtc 752



to top

>emb|BX012178.1|CNS08HK6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 606 cttcatgtcggtttcatcgtcccatggcttgatgtc 641



to top

>emb|BX012177.1|CNS08HK5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 785 cttcatgtcggtttcatcgtcccatggcttgatgtc 750



to top

>emb|BX010493.1|CNS08G9D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 603 cttcatgtcggtttcatcgtcccatggcttgatgtc 638



to top

>emb|BX010492.1|CNS08G9C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 614 cttcatgtcggtttcatcgtcccatggcttgatgtc 579



to top

>emb|BX010211.1|CNS08G1J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16BG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 978

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 778 cttcatgtcggtttcatcgtcccatggcttgatgtc 743



to top

>emb|BX010113.1|CNS08FYT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 874

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 605 cttcatgtcggtttcatcgtcccatggcttgatgtc 640



to top

>emb|BX010112.1|CNS08FYS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 614 cttcatgtcggtttcatcgtcccatggcttgatgtc 579



to top

>emb|BX009646.1|CNS08FLU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 826

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 727 cttcatgtcggtttcatcgtcccatggcttgatgtc 692



to top

>emb|BX008302.1|CNS08EKI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 889

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 496 cttcatgtcggtttcatcgtcccatggcttgatgtc 531



to top

>emb|BX008301.1|CNS08EKH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 794 cttcatgtcggtttcatcgtcccatggcttgatgtc 759



to top

>gb|AC007212.7| Arabidopsis thaliana chromosome 2 clone F8D23 map PhyB, complete
             sequence
          Length = 57550

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                     
Query: 390   acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 445
             ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 54608 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 54663



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 192   atcttgttgaaggcaacgatgtcaca 217
             ||||||||||||||||| ||||||||
Sbjct: 54410 atcttgttgaaggcaacaatgtcaca 54435



to top

>gb|AC006201.4| Arabidopsis thaliana chromosome 2 clone T27K22 map c245, complete
            sequence
          Length = 88149

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                    
Query: 390  acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 445
            ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 2484 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 2539



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 192  atcttgttgaaggcaacgatgtcaca 217
            ||||||||||||||||| ||||||||
Sbjct: 2286 atcttgttgaaggcaacaatgtcaca 2311



to top

>gb|AY081568.1| Arabidopsis thaliana putative elongation factor 1-beta (At2g18110)
           mRNA, complete cds
          Length = 805

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 390 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 445
           ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 494 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 439



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 192 atcttgttgaaggcaacgatgtcaca 217
           ||||||||||||||||| ||||||||
Sbjct: 692 atcttgttgaaggcaacaatgtcaca 667



to top

>gb|AY065159.1| Arabidopsis thaliana putative elongation factor 1-beta (At2g18110;
           F8D23.11) mRNA, complete cds
          Length = 928

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 390 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 445
           ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 575 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 520



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 192 atcttgttgaaggcaacgatgtcaca 217
           ||||||||||||||||| ||||||||
Sbjct: 773 atcttgttgaaggcaacaatgtcaca 748



to top

>emb|BX820727.1|CNS0A8QL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH63ZE01 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 920

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 390 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 445
           ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 564 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 509



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 192 atcttgttgaaggcaacgatgtcaca 217
           ||||||||||||||||| ||||||||
Sbjct: 762 atcttgttgaaggcaacaatgtcaca 737



to top

>emb|BX820611.1|CNS0A8PL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH52ZC12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 900

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 390 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 445
           ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 544 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 489



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 192 atcttgttgaaggcaacgatgtcaca 217
           ||||||||||||||||| ||||||||
Sbjct: 742 atcttgttgaaggcaacaatgtcaca 717



to top

>emb|BX842001.1|CNS09Y84 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB64ZA01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 824

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 390 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 445
           ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 523 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 468



to top

>gb|AY087429.1| Arabidopsis thaliana clone 35337 mRNA, complete sequence
          Length = 974

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 390 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 445
           ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 577 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 522



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 192 atcttgttgaaggcaacgatgtcaca 217
           ||||||||||||||||| ||||||||
Sbjct: 775 atcttgttgaaggcaacaatgtcaca 750



to top

>ref|XM_313149.2| Anopheles gambiae str. PEST ENSANGP00000013448
           (ENSANGG00000010959), partial mRNA
          Length = 717

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || |||||||||||||||||||||||
Sbjct: 507 cttcatgtcggtttcatcgtcccatggcttgatgtc 472



to top

>emb|BX037291.1|CNS090XR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 743

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 408 ttcatgtcagtctcatcgtcccatggcttgatgtc 442
           |||||||| || |||||||||||||||||||||||
Sbjct: 608 ttcatgtcggtttcatcgtcccatggcttgatgtc 642



to top

>emb|X74734.1|ATHEFBI Arabidopsis thaliana gene for elongation factor 1 beta
          Length = 1996

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                   
Query: 390  acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtcca 444
            ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| ||||
Sbjct: 1632 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatcca 1578



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 192  atcttgttgaaggcaacgatgtcaca 217
            ||||||||||||||||| ||||||||
Sbjct: 1830 atcttgttgaaggcaacaatgtcaca 1805



to top

>ref|NM_102762.2| Arabidopsis thaliana translation elongation factor AT1G30230 mRNA,
           complete cds
          Length = 1028

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 390 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 439
           ||||| ||||| | ||||||||||||||||||||| ||||| || |||||
Sbjct: 568 acagcttcctcaagcttcttcatgtcagtctcatcatcccacggtttgat 519



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 192 atcttgttgaaggcaacgatgtcaca 217
           ||||||||||||||||| ||||||||
Sbjct: 766 atcttgttgaaggcaacaatgtcaca 741



to top

>ref|XM_479153.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1025

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 409 tcatgtcagtctcatcgtcccatggcttga 438
           ||||||||||||||||||||||||| ||||
Sbjct: 576 tcatgtcagtctcatcgtcccatggtttga 547



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 187 tctagatcttgttgaaggcaacgatgtc 214
           |||||||||||||||| ||||| |||||
Sbjct: 798 tctagatcttgttgaacgcaacaatgtc 771



to top

>ref|XM_506463.1| PREDICTED Oryza sativa (japonica cultivar-group), P0616D06.117 mRNA
          Length = 1363

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 409 tcatgtcagtctcatcgtcccatggcttga 438
           ||||||||||||||||||||||||| ||||
Sbjct: 571 tcatgtcagtctcatcgtcccatggtttga 542



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 187 tctagatcttgttgaaggcaacgatgtc 214
           |||||||||||||||| ||||| |||||
Sbjct: 793 tctagatcttgttgaacgcaacaatgtc 766



to top

>gb|DQ207867.1| Solanum tuberosum clone 085E09 putative elongation factor 1B
           alpha-subunit0like mRNA, complete cds
          Length = 957

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 372 tccatttgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccat 431
           ||||| |||||||| || |||||||||||||  |||||||| || || ||||| ||||| 
Sbjct: 545 tccatctgaacaccacgaacagcctcctccagtttcttcatatcggtttcatcatcccaa 486

                         
Query: 432 ggcttgatgtccat 445
           ||||| | ||||||
Sbjct: 485 ggcttaacgtccat 472



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 195 ttgttgaaggcaacgatgtcacacgactggacgtactcgttgatgggc 242
           |||||||||||||| || |||||   ||||||||| ||||||||||||
Sbjct: 722 ttgttgaaggcaacaatatcacagctctggacgtattcgttgatgggc 675



to top

>gb|AC136471.1| Solanum demissum chromosome 11 BAC PGEC561 genomic sequence, complete
             sequence
          Length = 123428

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                         
Query: 372   tccatttgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccat 431
             ||||| |||||||| || |||||||||||||  |||||||| || || ||||| ||||| 
Sbjct: 11090 tccatctgaacaccacgaacagcctcctccagtttcttcatatcggtttcatcatcccaa 11149

                           
Query: 432   ggcttgatgtccat 445
             ||||| | ||||||
Sbjct: 11150 ggcttaacgtccat 11163



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                      
Query: 257   ttcctcaatgagagtgtcgacagacacgaggtcatcaatgatcgtcagcatgatctg 313
             |||||||||||| || || ||||| || |||||||| ||||| || |||||||||||
Sbjct: 10878 ttcctcaatgagggtatccacagagacaaggtcatcgatgatggtaagcatgatctg 10934



to top

>gb|DQ191626.1| Solanum tuberosum unknown mRNA
          Length = 1088

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 372 tccatttgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccat 431
           ||||| |||||||| || |||||||||||||  |||||||| || || ||||| ||||| 
Sbjct: 529 tccatctgaacaccacgaacagcctcctccagtttcttcatatcggtttcatcatcccaa 470

                         
Query: 432 ggcttgatgtccat 445
           ||||| | ||||||
Sbjct: 469 ggcttaacgtccat 456



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 195 ttgttgaaggcaacgatgtcacacgactggacgtactcgttgatgggc 242
           |||||||||||||| || |||||   ||||||||| ||||||||||||
Sbjct: 706 ttgttgaaggcaacaatatcacagctctggacgtattcgttgatgggc 659



to top

>gb|AY480020.1| Capsicum annuum putative elongation factor 1B alpha-subunit mRNA,
           partial sequence
          Length = 728

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 348 ttagatgcaccccaggtgagaccctccatttgaacaccgcggacagcctcctccaacttc 407
           |||||||| ||||||   ||||| ||||| | ||||| ||| ||||||||||| |  |||
Sbjct: 577 ttagatgctccccagagaagaccttccatctcaacactgcgaacagcctcctcaagtttc 518

                                                 
Query: 408 ttcatgtcagtctcatcgtcccatggcttgatgtccat 445
           ||||||||||| || || ||||| ||||| | ||||||
Sbjct: 517 ttcatgtcagtttcgtcatcccaaggcttaacgtccat 480



to top

>emb|BX816984.1|CNS0AE2C Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH7ZA05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 728

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 390 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 439
           ||||| ||||| | ||||||||||||||||||||| ||||| || |||||
Sbjct: 353 acagcttcctcaagcttcttcatgtcagtctcatcatcccacggtttgat 304



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 192 atcttgttgaaggcaacgatgtcaca 217
           ||||||||||||||||| ||||||||
Sbjct: 551 atcttgttgaaggcaacaatgtcaca 526



to top

>emb|BX817009.1|CNS0ABWL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH80ZD06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 908

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 390 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 439
           ||||| ||||| | ||||||||||||||||||||| ||||| || |||||
Sbjct: 546 acagcttcctcaagcttcttcatgtcagtctcatcatcccacggtttgat 497



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 192 atcttgttgaaggcaacgatgtcaca 217
           ||||||||||||||||| ||||||||
Sbjct: 744 atcttgttgaaggcaacaatgtcaca 719



to top

>emb|BX817138.1|CNS0ABNH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH89ZB09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 925

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 390 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 439
           ||||| ||||| | ||||||||||||||||||||| ||||| || |||||
Sbjct: 559 acagcttcctcaagcttcttcatgtcagtctcatcatcccacggtttgat 510



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 192 atcttgttgaaggcaacgatgtcaca 217
           ||||||||||||||||| ||||||||
Sbjct: 757 atcttgttgaaggcaacaatgtcaca 732



to top

>gb|AC073506.11|AC073506 Arabidopsis thaliana chromosome 1 BAC F12P21 genomic sequence, complete
             sequence
          Length = 55095

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                               
Query: 390   acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 439
             ||||| ||||| | ||||||||||||||||||||| ||||| || |||||
Sbjct: 19386 acagcttcctcaagcttcttcatgtcagtctcatcatcccacggtttgat 19337



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 192   atcttgttgaaggcaacgatgtcaca 217
             ||||||||||||||||| ||||||||
Sbjct: 19584 atcttgttgaaggcaacaatgtcaca 19559



to top

>dbj|AP005198.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0616D06
          Length = 153800

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                           
Query: 409   tcatgtcagtctcatcgtcccatggcttga 438
             ||||||||||||||||||||||||| ||||
Sbjct: 77927 tcatgtcagtctcatcgtcccatggtttga 77956



to top

>dbj|AB180443.1| Plutella xylostella eEF-1 beta' mRNA for elongation factor 1 beta',
           complete cds
          Length = 776

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtcca 444
           |||||||||||| ||||||||||| ||||||| |||||
Sbjct: 520 cttcatgtcagtttcatcgtcccagggcttgacgtcca 483



to top

>dbj|AK071736.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023109L04, full
           insert sequence
          Length = 1364

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 409 tcatgtcagtctcatcgtcccatggcttga 438
           ||||||||||||||||||||||||| ||||
Sbjct: 571 tcatgtcagtctcatcgtcccatggtttga 542



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 187 tctagatcttgttgaaggcaacgatgtc 214
           |||||||||||||||| ||||| |||||
Sbjct: 793 tctagatcttgttgaacgcaacaatgtc 766



to top

>dbj|AK061069.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-206-C03, full
           insert sequence
          Length = 1025

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 409 tcatgtcagtctcatcgtcccatggcttga 438
           ||||||||||||||||||||||||| ||||
Sbjct: 576 tcatgtcagtctcatcgtcccatggtttga 547



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 187 tctagatcttgttgaaggcaacgatgtc 214
           |||||||||||||||| ||||| |||||
Sbjct: 798 tctagatcttgttgaacgcaacaatgtc 771



to top

>dbj|AK059384.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-026-G07, full
           insert sequence
          Length = 636

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 409 tcatgtcagtctcatcgtcccatggcttga 438
           ||||||||||||||||||||||||| ||||
Sbjct: 193 tcatgtcagtctcatcgtcccatggtttga 164



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 187 tctagatcttgttgaaggcaacgatgtc 214
           |||||||||||||||| ||||| |||||
Sbjct: 415 tctagatcttgttgaacgcaacaatgtc 388



to top

>dbj|D23674.1|RICEF1BRB Oryza sativa (japonica cultivar-group) mRNA for elongation factor 1
           beta, complete cds
          Length = 1420

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 409 tcatgtcagtctcatcgtcccatggcttga 438
           ||||||||||||||||||||||||| ||||
Sbjct: 556 tcatgtcagtctcatcgtcccatggtttga 527



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 187 tctagatcttgttgaaggcaacgatgtc 214
           |||||||||||||||| ||||| |||||
Sbjct: 778 tctagatcttgttgaacgcaacaatgtc 751



to top

>ref|NM_121956.2| Arabidopsis thaliana translation elongation factor AT5G19510 mRNA,
           complete cds
          Length = 945

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 380 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 436
           |||||| || |||||||| ||||  ||||||||||| || ||||| |||||||||||
Sbjct: 557 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggctt 501



to top

>ref|XM_520696.1| PREDICTED: Pan troglodytes similar to bA526D8.4 (novel KRAB box
            containing C2H2 type zinc finger protein) (LOC465235),
            mRNA
          Length = 3627

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 410  catgtcagtctcatcgtcccatggcttga 438
            ||||||||||||||||||||| |||||||
Sbjct: 3492 catgtcagtctcatcgtcccaaggcttga 3464



to top

>ref|NM_001010925.1| Homo sapiens ankyrin repeat domain 19 (ANKRD19), mRNA
          Length = 2285

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                         
Query: 410  catgtcagtctcatcgtcccatggcttga 438
            ||||||||||||||||||||| |||||||
Sbjct: 1176 catgtcagtctcatcgtcccaaggcttga 1204



to top

>emb|AJ249597.1|ATH249597 Arabidopsis thaliana mRNA for elongation factor 1B alpha-subunit
           (eEF1Balpha2 gene)
          Length = 680

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 380 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 436
           |||||| || |||||||| ||||  ||||||||||| || ||||| |||||||||||
Sbjct: 485 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggctt 429



to top

>emb|AL136981.22| Human DNA sequence from clone RP11-526D8 on chromosome 9 Contains the 5'
              end of the gene for coiled-coil protein (BICD2) (KIAA0699),
              a novel gene, a eukaryotic translation elongation factor 1
              delta (guanine nucleotide exchange protein) (EEF1D)
              pseudogene, the gene for a novel KRAB box-containing C2H2
              type zinc finger protein, a novel gene, a pseudogene
              similar to part of sorting nexin associated golgi protein 1
              (SNAG1), a novel pseudogene, a melanoma antigen pseudogene
              and three CpG islands, complete sequence
          Length = 182280

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 410    catgtcagtctcatcgtcccatggcttga 438
              ||||||||||||||||||||| |||||||
Sbjct: 106674 catgtcagtctcatcgtcccaaggcttga 106702



to top

>gb|AY056354.1| Arabidopsis thaliana putative elongation factor 1B alpha-subunit
           (At5g19510) mRNA, complete cds
          Length = 706

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 380 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 436
           |||||| || |||||||| ||||  ||||||||||| || ||||| |||||||||||
Sbjct: 483 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggctt 427



to top

>gb|AF360304.1| Arabidopsis thaliana putative elongation factor 1B alpha-subunit
           (At5g19510) mRNA, complete cds
          Length = 881

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 380 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 436
           |||||| || |||||||| ||||  ||||||||||| || ||||| |||||||||||
Sbjct: 522 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggctt 466



to top

>gb|BC028712.1| Homo sapiens ankyrin repeat domain 19, mRNA (cDNA clone MGC:27029
            IMAGE:4837806), complete cds
          Length = 2351

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                         
Query: 410  catgtcagtctcatcgtcccatggcttga 438
            ||||||||||||||||||||| |||||||
Sbjct: 1366 catgtcagtctcatcgtcccaaggcttga 1394



to top

>dbj|AK093497.1| Homo sapiens cDNA FLJ36178 fis, clone TESTI2026534
          Length = 1899

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                         
Query: 410  catgtcagtctcatcgtcccatggcttga 438
            ||||||||||||||||||||| |||||||
Sbjct: 994  catgtcagtctcatcgtcccaaggcttga 1022



to top

>emb|AL116697.1|CNS01DDT Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 410 catgtcagtctcatcgtcccatggcttga 438
           |||||| ||||||||||||||||||||||
Sbjct: 348 catgtcggtctcatcgtcccatggcttga 320



to top

>emb|AL116510.1|CNS01D8M Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 410 catgtcagtctcatcgtcccatggcttga 438
           |||||| ||||||||||||||||||||||
Sbjct: 532 catgtcggtctcatcgtcccatggcttga 504



to top

>emb|AL116208.1|CNS01D08 Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 410 catgtcagtctcatcgtcccatggcttga 438
           |||||| ||||||||||||||||||||||
Sbjct: 405 catgtcggtctcatcgtcccatggcttga 377



to top

>emb|AL115318.1|CNS01CBI Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 410 catgtcagtctcatcgtcccatggcttga 438
           |||||| ||||||||||||||||||||||
Sbjct: 584 catgtcggtctcatcgtcccatggcttga 556



to top

>emb|AL114622.1|CNS01BS6 Botrytis cinerea strain T4 cDNA library
          Length = 480

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 410 catgtcagtctcatcgtcccatggcttga 438
           |||||| ||||||||||||||||||||||
Sbjct: 82  catgtcggtctcatcgtcccatggcttga 54



to top

>emb|AL114417.1|CNS01BMH Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 410 catgtcagtctcatcgtcccatggcttga 438
           |||||| ||||||||||||||||||||||
Sbjct: 551 catgtcggtctcatcgtcccatggcttga 523



to top

>emb|AL112302.1|CNS019ZQ Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 410 catgtcagtctcatcgtcccatggcttga 438
           |||||| ||||||||||||||||||||||
Sbjct: 532 catgtcggtctcatcgtcccatggcttga 504



to top

>emb|AL111685.1|CNS019IL Botrytis cinerea strain T4 cDNA library
          Length = 636

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 410 catgtcagtctcatcgtcccatggcttga 438
           |||||| ||||||||||||||||||||||
Sbjct: 548 catgtcggtctcatcgtcccatggcttga 520



to top

>emb|BX830320.1|CNS0A1AJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB73ZB12 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 820

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 380 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 436
           |||||| || |||||||| ||||  ||||||||||| || ||||| |||||||||||
Sbjct: 453 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggctt 397



to top

>emb|BX830295.1|CNS0A1LL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB71ZA05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 883

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 380 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 436
           |||||| || |||||||| ||||  ||||||||||| || ||||| |||||||||||
Sbjct: 540 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggctt 484



to top

>emb|BX832129.1|CNS0A0XD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZE09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 835

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 380 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 436
           |||||| || |||||||| ||||  ||||||||||| || ||||| |||||||||||
Sbjct: 498 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggctt 442



to top

>emb|BX831615.1|CNS0A14O Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH19ZB11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 868

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 380 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 436
           |||||| || |||||||| ||||  ||||||||||| || ||||| |||||||||||
Sbjct: 540 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggctt 484



to top

>emb|BX830589.1|CNS0A17N Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB91ZF03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 712

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 380 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 436
           |||||| || |||||||| ||||  ||||||||||| || ||||| |||||||||||
Sbjct: 369 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggctt 313



to top

>gb|AY089071.1| Arabidopsis thaliana clone 26936 mRNA, complete sequence
          Length = 849

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 380 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 436
           |||||| || |||||||| ||||  ||||||||||| || ||||| |||||||||||
Sbjct: 497 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggctt 441



to top

>gb|AF296830.1|T20D1 Arabidopsis thaliana BAC T20D1
          Length = 35369

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                     
Query: 380  aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 436
            |||||| || |||||||| ||||  ||||||||||| || ||||| |||||||||||
Sbjct: 6435 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggctt 6491



to top

>gb|BC038951.1| Homo sapiens ankyrin repeat domain 19, mRNA (cDNA clone MGC:47831
            IMAGE:5733799), complete cds
          Length = 2285

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                         
Query: 410  catgtcagtctcatcgtcccatggcttga 438
            ||||||||||||||||||||| |||||||
Sbjct: 1176 catgtcagtctcatcgtcccaaggcttga 1204



to top

>ref|XM_752243.1| Ustilago maydis 521 hypothetical protein (UM01189.1) partial mRNA
          Length = 678

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| |||||||| ||||| |||||||||||
Sbjct: 465 cttcatgtcggtctcatcatcccagggcttgatgtc 430



to top

>emb|BX046091.1|CNS097Q7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC2CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || ||||||||||||| |||||||||
Sbjct: 591 cttcatgtcggtttcatcgtcccatgccttgatgtc 626



to top

>emb|BX046090.1|CNS097Q6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 942

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 407 cttcatgtcagtctcatcgtcccatggcttgatgtc 442
           ||||||||| || ||||||||||||| |||||||||
Sbjct: 611 cttcatgtcggtttcatcgtcccatgccttgatgtc 576



to top

>emb|Z97067.1|BVEF1BETA Beta vulgaris mRNA for elongation factor 1-beta
          Length = 1069

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 389 gacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 436
           |||||| ||||| | |||||||||||| || ||||| |||||||||||
Sbjct: 581 gacagcttcctcaagcttcttcatgtctgtttcatcatcccatggctt 534



to top

>emb|X74733.1|ATL1BETA A.thaliana mRNA for elongation factor 1 beta
          Length = 900

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 404 cttcttcatgtcagtctcatcgtcccatggcttgat 439
           ||||||||||||||||||||| ||||| || |||||
Sbjct: 525 cttcttcatgtcagtctcatcatcccacggtttgat 490



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 192 atcttgttgaaggcaacgatgtcaca 217
           ||||||||||||||||| ||||||||
Sbjct: 737 atcttgttgaaggcaacaatgtcaca 712



to top

>gb|AC090680.11| Homo sapiens 12 BAC RP11-87P13 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 183896

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 80   aaacaaaaccagtagcatttctgt 103
            ||||||||||||||||||||||||
Sbjct: 7442 aaacaaaaccagtagcatttctgt 7465



to top

>emb|BX820768.1|CNS0A8OK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH68ZB10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 558

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 390 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 445
           ||||| ||||| | |||||||||||| || ||||| ||||| |||||||| |||||
Sbjct: 201 acagcttcctctagcttcttcatgtccgtttcatcatcccacggcttgatatccat 146



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 192 atcttgttgaaggcaacgatgtcaca 217
           ||||||||||||||||| ||||||||
Sbjct: 399 atcttgttgaaggcaacaatgtcaca 374



to top

>gb|DQ235167.1| Solanum tuberosum clone 154B05 ripening regulated protein
           DDTFR10-like mRNA, complete cds
          Length = 928

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 408 ttcatgtcagtctcatcgtcccatggcttga 438
           ||||| ||||||||||| |||||||||||||
Sbjct: 541 ttcatatcagtctcatcatcccatggcttga 511



to top

>gb|AY398339.1| Danio rerio clone RK121A4C07 eukaryotic translation elongation
           factor 1 beta 2 (EEF1B2) mRNA, complete cds
          Length = 1045

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 308 gatctggagcttcttgatgccataacccacaggca 342
           |||||| ||||||||||||||||| || |||||||
Sbjct: 850 gatctgcagcttcttgatgccatagccaacaggca 816



to top

>gb|BC046042.1| Danio rerio eukaryotic translation elongation factor 1 beta 2, mRNA
           (cDNA clone MGC:56277 IMAGE:5602371), complete cds
          Length = 806

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 308 gatctggagcttcttgatgccataacccacaggca 342
           |||||| ||||||||||||||||| || |||||||
Sbjct: 633 gatctgcagcttcttgatgccatagccaacaggca 599



to top

>gb|AC129594.3| Mus musculus BAC clone RP24-319J19 from chromosome Y, complete sequence
          Length = 147674

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 73    gactcaaaaacaaaaccagtagc 95
             |||||||||||||||||||||||
Sbjct: 97310 gactcaaaaacaaaaccagtagc 97332



to top

>gb|AC140925.4| Mus musculus BAC clone RP24-140B17 from chromosome Y, complete sequence
          Length = 172606

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 73     gactcaaaaacaaaaccagtagc 95
              |||||||||||||||||||||||
Sbjct: 145559 gactcaaaaacaaaaccagtagc 145537



to top

>gb|AC145266.3| Mus musculus BAC clone RP24-174A3 from chromosome Y, complete sequence
          Length = 143481

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 73    gactcaaaaacaaaaccagtagc 95
             |||||||||||||||||||||||
Sbjct: 38840 gactcaaaaacaaaaccagtagc 38862



to top

>emb|CT009620.9| Zebrafish DNA sequence from clone CH73-187F10 in linkage group 6,
             complete sequence
          Length = 95528

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 308   gatctggagcttcttgatgccataacccacaggca 342
             |||||| ||||||||||||||||| || |||||||
Sbjct: 89778 gatctgcagcttcttgatgccatagccaacaggca 89812



to top

>gb|AY444796.1| Pisum sativum translational elongation factor 1 subunit Bbeta
           (eEF1Bbeta) mRNA, complete cds
          Length = 709

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 404 cttcttcatgtcagtctcatcgtccca 430
           ||||||||||||||| |||||||||||
Sbjct: 493 cttcttcatgtcagtttcatcgtccca 467



to top

>emb|BX029538.1|CNS08UYE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 685

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 407 cttcatgtcagtctcatcgtcccatggcttg 437
           ||||||||| || ||||||||||||||||||
Sbjct: 604 cttcatgtcggtttcatcgtcccatggcttg 634



to top

>emb|AJ237772.1|OLA237772 Oryzias latipes mRNA for elongation factor 1 beta, partial
          Length = 283

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 307 tgatctggagcttcttgatgccataacccac 337
           ||||||| |||||||||||||| ||||||||
Sbjct: 148 tgatctgcagcttcttgatgccgtaacccac 118



to top

>ref|NM_199949.2| Danio rerio eukaryotic translation elongation factor 1 beta 2
           (eef1b2), mRNA
          Length = 1045

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 308 gatctggagcttcttgatgccataacccacaggca 342
           |||||| ||||||||||||||||| || |||||||
Sbjct: 850 gatctgcagcttcttgatgccatagccaacaggca 816



to top

>gb|AC149597.4| Mus musculus BAC clone RP24-90B12 from Y, complete sequence
          Length = 198224

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 73     gactcaaaaacaaaaccagtagc 95
              |||||||||||||||||||||||
Sbjct: 102524 gactcaaaaacaaaaccagtagc 102546



to top

>gb|BC071464.1| Danio rerio eukaryotic translation elongation factor 1 beta 2, mRNA
           (cDNA clone MGC:86802 IMAGE:6901030), complete cds
          Length = 823

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 308 gatctggagcttcttgatgccataacccacaggca 342
           |||||| ||||||||||||||||| || |||||||
Sbjct: 635 gatctgcagcttcttgatgccatagccaacaggca 601



to top

>gb|BC055643.1| Danio rerio cDNA clone IMAGE:5915478, **** WARNING: chimeric clone
           ****
          Length = 996

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 395 ctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtcca 444
           |||||||| ||||  |||||| |||||||||||||| || |||| |||||
Sbjct: 695 ctcctccagcttcgacatgtccgtctcatcgtcccaaggtttgacgtcca 646



to top

>emb|AL353136.21| Human DNA sequence from clone RP11-133K18 on chromosome X Contains a
              pyruvate kinase muscle (PKM2) pseudogene and the gene for
              ectodysplasin A2 isoform receptor (XEDAR), complete
              sequence
          Length = 192505

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 79     aaaacaaaaccagtagcatttctgta 104
              |||| |||||||||||||||||||||
Sbjct: 186554 aaaaaaaaaccagtagcatttctgta 186529



to top

>gb|AY321330.1| Rattus norvegicus Ac2-067 mRNA, complete cds
          Length = 808

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 395 ctcctccaacttcttcatgtcagtctcatcgtcccatggctt 436
           |||||| | |||| ||||||| |||||||||||||| |||||
Sbjct: 664 ctcctcgagcttcgtcatgtctgtctcatcgtcccaaggctt 623



to top

>emb|AJ291984.1|PFL291984 Platichthys flesus partial mRNA for translation elongation factor
           1-delta (ef1D gene)
          Length = 430

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 395 ctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtcca 444
           |||||||| ||||  |||||| |||||||||||||| || |||| |||||
Sbjct: 342 ctcctccagcttcgccatgtccgtctcatcgtcccaaggtttgacgtcca 293



to top

>emb|AL645962.22| Mouse DNA sequence from clone RP23-217L7 on chromosome 11 Contains the
             Olfr54 gene for olfactory receptor 54, the gene for a
             novel protein (olfactory receptor MOR126-2 (MOR126-2)) and
             the Zfp354a gene for zinc finger protein 354A, complete
             sequence
          Length = 82484

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 152   aagaatccagcagcaacaggtg 173
             ||||||||||||||||||||||
Sbjct: 37065 aagaatccagcagcaacaggtg 37044



to top

>dbj|AB254814.1| Cryptomeria japonica mRNA for putative elongation factor, complete
           cds
          Length = 916

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 389 gacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttga 438
           |||||||||||| |  |||| |||||| |||||||| |||||||| ||||
Sbjct: 538 gacagcctcctcaagtttctgcatgtccgtctcatcatcccatggtttga 489



to top

>ref|XM_703998.1| PREDICTED: Danio rerio similar to Elongation factor 1-delta
           (EF-1-delta), transcript variant 2 (LOC565501), mRNA
          Length = 753

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 395 ctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtcca 444
           |||||||| ||||  |||||| |||||||||||||| || |||| |||||
Sbjct: 576 ctcctccagcttcgacatgtccgtctcatcgtcccaaggtttgacgtcca 527



to top

>ref|XM_683289.1| PREDICTED: Danio rerio similar to Elongation factor 1-delta
            (EF-1-delta), transcript variant 1 (LOC565501), mRNA
          Length = 1479

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                              
Query: 395  ctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtcca 444
            |||||||| ||||  |||||| |||||||||||||| || |||| |||||
Sbjct: 1196 ctcctccagcttcgacatgtccgtctcatcgtcccaaggtttgacgtcca 1147



to top

>emb|CR387695.1| Gallus gallus finished cDNA, clone ChEST70j23
          Length = 936

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 395 ctcctccaacttcttcatgtcagtctcatcgtcccatggctt 436
           |||||||| ||||  ||||||||||||||| ||||| |||||
Sbjct: 685 ctcctccatcttcgccatgtcagtctcatcatcccacggctt 644



to top

>gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VI,
              complete sequence
          Length = 1813164

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 417    gtctcatcgtcccatggcttgatgtccatg 446
              ||||| |||||||||||||||| |||||||
Sbjct: 442596 gtctcgtcgtcccatggcttgacgtccatg 442625



to top

>emb|BX933683.2| Gallus gallus finished cDNA, clone ChEST942d7
          Length = 820

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 395 ctcctccaacttcttcatgtcagtctcatcgtcccatggctt 436
           |||||||| ||||  ||||||||||||||| ||||| |||||
Sbjct: 652 ctcctccatcttcgccatgtcagtctcatcatcccacggctt 611



to top

>emb|AL116212.1|CNS01D0C Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 410 catgtcagtctcatcgtcccatggcttga 438
           |||||| |||| |||||||||||||||||
Sbjct: 405 catgtcggtctnatcgtcccatggcttga 377



to top

>emb|BX813340.1|CNS0AC3L Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB10ZC06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 699

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 192 atcttgttgaaggcaacgatgtcaca 217
           ||||||||||||||||| ||||||||
Sbjct: 534 atcttgttgaaggcaacaatgtcaca 509



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 390 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 439
           ||||| ||||| | ||||||||||| ||||||||| ||||| || |||||
Sbjct: 336 acagcttcctcaagcttcttcatgtaagtctcatcatcccacggtttgat 287



to top

>emb|BX818274.1|CNS0AB2B Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL6ZG08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 879

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 390 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 439
           ||||| ||||| | ||||||||||| ||||||||| ||||| || |||||
Sbjct: 517 acagcttcctcaagcttcttcatgtgagtctcatcatcccacggtttgat 468



to top

>emb|BX841878.1|CNS09Y45 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH80ZE05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 895

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 390 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 439
           ||||| ||||| | ||||||||||||||| ||||| ||||| || |||||
Sbjct: 533 acagcttcctcaagcttcttcatgtcagtttcatcatcccacggtttgat 484



to top

>emb|BX841873.1|CNS09Y2H Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH57ZC11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 946

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 406 tcttcatgtcagtctcatcgtcccatggcttgat 439
           ||||||||||||||||||| ||||| || |||||
Sbjct: 596 tcttcatgtcagtctcatcatcccacggtttgat 563



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 193 tcttgttgaaggcaacgatgtcaca 217
           |||||||||||||||| ||||||||
Sbjct: 819 tcttgttgaaggcaacaatgtcaca 795



to top

>emb|BX935015.1| Gallus gallus finished cDNA, clone ChEST301p14
          Length = 978

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 395 ctcctccaacttcttcatgtcagtctcatcgtcccatggctt 436
           |||||||| ||||  ||||||||||||||| ||||| |||||
Sbjct: 731 ctcctccatcttcgccatgtcagtctcatcatcccacggctt 690



to top

>ref|XM_342043.2| PREDICTED: Rattus norvegicus similar to eukaryotic translation
           elongation factor 1 beta 2 (LOC361750), mRNA
          Length = 672

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 395 ctcctccaacttcttcatgtcagtctcatcgtcccatggctt 436
           |||||| | |||| ||||||| |||||||||||||| |||||
Sbjct: 474 ctcctcgagcttcgtcatgtctgtctcatcgtcccaaggctt 433



to top

>ref|NM_210904.1| Eremothecium gossypii AFR003Cp (AFR003C), mRNA
          Length = 621

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 417 gtctcatcgtcccatggcttgatgtccatg 446
           ||||| |||||||||||||||| |||||||
Sbjct: 401 gtctcgtcgtcccatggcttgacgtccatg 372



to top

>gb|BC096865.1| Danio rerio cold inducible RNA binding protein, mRNA (cDNA clone
           MGC:111981 IMAGE:7401032), complete cds
          Length = 919

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 395 ctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtcca 444
           |||||||| ||||  |||||| |||||||||||||| || |||| |||||
Sbjct: 616 ctcctccagcttcgacatgtccgtctcatcgtcccaaggtttgacgtcca 567



to top

>gb|AC170424.1| Rhesus Macaque  BAC CH250-53N5 (Children's Hospital Oakland Research
              Institute Rhesus macaque Adult Male BAC Library) complete
              sequence
          Length = 175619

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 84     aaaaccagtagcatttctgta 104
              |||||||||||||||||||||
Sbjct: 109571 aaaaccagtagcatttctgta 109551



to top

>ref|XM_524853.1| PREDICTED: Pan troglodytes similar to Elongation factor 1-delta
            (EF-1-delta) (Antigen NY-CO-4) (LOC469470), mRNA
          Length = 3660

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 410  catgtcagtctcatcgtcccatggcttga 438
            |||||| |||||||||||||| |||||||
Sbjct: 1332 catgtccgtctcatcgtcccaaggcttga 1304



to top

>ref|XM_414267.1| PREDICTED: Gallus gallus similar to ring finger protein 123
            (LOC415923), mRNA
          Length = 7740

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 401  caacttcttcatgtcagtctcatcgtccc 429
            |||||||||||| ||||||||| ||||||
Sbjct: 5546 caacttcttcatctcagtctcagcgtccc 5574



to top

>gb|DQ440296.1| Aedes aegypti clone AET-374 elongation factor 1 beta/delta chain
           mRNA, complete cds
          Length = 798

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 408 ttcatgtcagtctcatcgtcccatggcttgatgtcca 444
           |||||||| || || || |||||||||||||||||||
Sbjct: 587 ttcatgtcggtttcgtcatcccatggcttgatgtcca 551



to top

>gb|DQ191662.1| Solanum tuberosum elongation factor-like protein mRNA, complete cds
          Length = 903

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                    
Query: 257 ttcctcaatgagagtgtcgacagacacgaggtcatcaatgatcgtcagcatgatctg 313
           |||||||||||| || || ||||| || |||||||| | ||| || |||||||||||
Sbjct: 667 ttcctcaatgagggtatccacagagacaaggtcatcgacgatggtaagcatgatctg 611



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 195 ttgttgaaggcaacgatgtcacacgactggacgtactcgttgatgggc 242
           |||||||||||||| || |||||   |||||| || ||||||||||||
Sbjct: 729 ttgttgaaggcaacaatatcacagctctggacatattcgttgatgggc 682



to top

>gb|BC021729.1| Homo sapiens similar to hypothetical protein FLJ20897, mRNA (cDNA
           clone IMAGE:5267252)
          Length = 1330

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 412 tgtcagtctcatcgtcccatggcttgatgtcca 444
           |||| |||||||||||||| ||||||| |||||
Sbjct: 995 tgtccgtctcatcgtcccaaggcttgaagtcca 963



to top

>gb|AC144711.2| Danio rerio clone CH211-218M15, complete sequence
          Length = 208866

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 30    aattcaactatttaaaggtaa 50
             |||||||||||||||||||||
Sbjct: 14426 aattcaactatttaaaggtaa 14446



to top

>gb|AC004682.1|HUAC004682 Homo sapiens Chromosome 16 BAC clone CIT987SK-A-259H10, complete
             sequence
          Length = 189134

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 395   ctcctccaacttcttcatgtcagtc 419
             |||||||||| ||||||||||||||
Sbjct: 14005 ctcctccaacctcttcatgtcagtc 14029



to top

>emb|CR733792.2|CNS0GSZ3 Tetraodon nigroviridis full-length cDNA
          Length = 370

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 186 ttctagatcttgttgaaggca 206
           |||||||||||||||||||||
Sbjct: 340 ttctagatcttgttgaaggca 320



to top

>emb|CR728524.2|CNS0GP2Q Tetraodon nigroviridis full-length cDNA
          Length = 571

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 186 ttctagatcttgttgaaggca 206
           |||||||||||||||||||||
Sbjct: 541 ttctagatcttgttgaaggca 521



to top

>emb|CR720100.2|CNS0GIKQ Tetraodon nigroviridis full-length cDNA
          Length = 753

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 186 ttctagatcttgttgaaggca 206
           |||||||||||||||||||||
Sbjct: 723 ttctagatcttgttgaaggca 703



to top

>emb|CR722642.2|CNS0GKJC Tetraodon nigroviridis full-length cDNA
          Length = 754

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 186 ttctagatcttgttgaaggca 206
           |||||||||||||||||||||
Sbjct: 724 ttctagatcttgttgaaggca 704



to top

>emb|CR719902.2|CNS0GIF8 Tetraodon nigroviridis full-length cDNA
          Length = 750

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 186 ttctagatcttgttgaaggca 206
           |||||||||||||||||||||
Sbjct: 720 ttctagatcttgttgaaggca 700



to top

>emb|CR703454.2|CNS0G5QI Tetraodon nigroviridis full-length cDNA
          Length = 753

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 186 ttctagatcttgttgaaggca 206
           |||||||||||||||||||||
Sbjct: 723 ttctagatcttgttgaaggca 703



to top

>emb|CR701463.2|CNS0G477 Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 186 ttctagatcttgttgaaggca 206
           |||||||||||||||||||||
Sbjct: 485 ttctagatcttgttgaaggca 465



to top

>emb|CR698877.2|CNS0G27D Tetraodon nigroviridis full-length cDNA
          Length = 753

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 186 ttctagatcttgttgaaggca 206
           |||||||||||||||||||||
Sbjct: 723 ttctagatcttgttgaaggca 703



to top

>emb|CR691105.2|CNS0FW7H Tetraodon nigroviridis full-length cDNA
          Length = 753

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 186 ttctagatcttgttgaaggca 206
           |||||||||||||||||||||
Sbjct: 723 ttctagatcttgttgaaggca 703



to top

>emb|CR688433.2|CNS0FU59 Tetraodon nigroviridis full-length cDNA
          Length = 936

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 186 ttctagatcttgttgaaggca 206
           |||||||||||||||||||||
Sbjct: 907 ttctagatcttgttgaaggca 887



to top

>emb|CR687149.2|CNS0FT5L Tetraodon nigroviridis full-length cDNA
          Length = 753

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 186 ttctagatcttgttgaaggca 206
           |||||||||||||||||||||
Sbjct: 723 ttctagatcttgttgaaggca 703



to top

>emb|CR687009.2|CNS0FT1P Tetraodon nigroviridis full-length cDNA
          Length = 752

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 186 ttctagatcttgttgaaggca 206
           |||||||||||||||||||||
Sbjct: 722 ttctagatcttgttgaaggca 702



to top

>emb|CR686677.2|CNS0FSSH Tetraodon nigroviridis full-length cDNA
          Length = 1052

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 186  ttctagatcttgttgaaggca 206
            |||||||||||||||||||||
Sbjct: 1022 ttctagatcttgttgaaggca 1002



to top

>emb|CR685114.3|CNS0FRL2 Tetraodon nigroviridis full-length cDNA
          Length = 746

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 186 ttctagatcttgttgaaggca 206
           |||||||||||||||||||||
Sbjct: 723 ttctagatcttgttgaaggca 703



to top

>emb|CR683419.2|CNS0FQ9Z Tetraodon nigroviridis full-length cDNA
          Length = 1053

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 186  ttctagatcttgttgaaggca 206
            |||||||||||||||||||||
Sbjct: 1024 ttctagatcttgttgaaggca 1004



to top

>emb|CR681006.2|CNS0FOEY Tetraodon nigroviridis full-length cDNA
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 186  ttctagatcttgttgaaggca 206
            |||||||||||||||||||||
Sbjct: 1031 ttctagatcttgttgaaggca 1011



to top

>emb|CR680575.2|CNS0FO2Z Tetraodon nigroviridis full-length cDNA
          Length = 752

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 186 ttctagatcttgttgaaggca 206
           |||||||||||||||||||||
Sbjct: 722 ttctagatcttgttgaaggca 702



to top

>emb|CR680242.2|CNS0FNTQ Tetraodon nigroviridis full-length cDNA
          Length = 1040

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 186  ttctagatcttgttgaaggca 206
            |||||||||||||||||||||
Sbjct: 1010 ttctagatcttgttgaaggca 990



to top

>emb|CR679939.2|CNS0FNLB Tetraodon nigroviridis full-length cDNA
          Length = 753

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 186 ttctagatcttgttgaaggca 206
           |||||||||||||||||||||
Sbjct: 723 ttctagatcttgttgaaggca 703



to top

>emb|CR677929.1|CNS0FM1T Tetraodon nigroviridis full-length cDNA
          Length = 1032

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 186  ttctagatcttgttgaaggca 206
            |||||||||||||||||||||
Sbjct: 1011 ttctagatcttgttgaaggca 991



to top

>emb|CR677980.2|CNS0FM38 Tetraodon nigroviridis full-length cDNA
          Length = 1072

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 186  ttctagatcttgttgaaggca 206
            |||||||||||||||||||||
Sbjct: 1042 ttctagatcttgttgaaggca 1022



to top

>emb|CR677281.2|CNS0FLJX Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 186 ttctagatcttgttgaaggca 206
           |||||||||||||||||||||
Sbjct: 723 ttctagatcttgttgaaggca 703



to top

>emb|CR677181.2|CNS0FLH5 Tetraodon nigroviridis full-length cDNA
          Length = 753

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 186 ttctagatcttgttgaaggca 206
           |||||||||||||||||||||
Sbjct: 723 ttctagatcttgttgaaggca 703



to top

>emb|CR676468.2|CNS0FKXC Tetraodon nigroviridis full-length cDNA
          Length = 1048

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 186  ttctagatcttgttgaaggca 206
            |||||||||||||||||||||
Sbjct: 1018 ttctagatcttgttgaaggca 998



to top

>emb|CR676870.2|CNS0FL8I Tetraodon nigroviridis full-length cDNA
          Length = 968

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 186 ttctagatcttgttgaaggca 206
           |||||||||||||||||||||
Sbjct: 938 ttctagatcttgttgaaggca 918



to top

>emb|CR674225.2|CNS0FJ7B Tetraodon nigroviridis full-length cDNA
          Length = 1034

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 186  ttctagatcttgttgaaggca 206
            |||||||||||||||||||||
Sbjct: 1018 ttctagatcttgttgaaggca 998



to top

>emb|CR673965.2|CNS0FJ03 Tetraodon nigroviridis full-length cDNA
          Length = 1031

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 186  ttctagatcttgttgaaggca 206
            |||||||||||||||||||||
Sbjct: 1001 ttctagatcttgttgaaggca 981



to top

>emb|CR673115.2|CNS0FICH Tetraodon nigroviridis full-length cDNA
          Length = 753

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 186 ttctagatcttgttgaaggca 206
           |||||||||||||||||||||
Sbjct: 723 ttctagatcttgttgaaggca 703



to top

>emb|CR672809.2|CNS0FI3Z Tetraodon nigroviridis full-length cDNA
          Length = 1044

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 186  ttctagatcttgttgaaggca 206
            |||||||||||||||||||||
Sbjct: 1014 ttctagatcttgttgaaggca 994



to top

>emb|CR672714.2|CNS0FI1C Tetraodon nigroviridis full-length cDNA
          Length = 1043

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 186  ttctagatcttgttgaaggca 206
            |||||||||||||||||||||
Sbjct: 1013 ttctagatcttgttgaaggca 993



to top

>emb|CR672557.2|CNS0FHWZ Tetraodon nigroviridis full-length cDNA
          Length = 1046

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 186  ttctagatcttgttgaaggca 206
            |||||||||||||||||||||
Sbjct: 1016 ttctagatcttgttgaaggca 996



to top

>emb|CR672233.2|CNS0FHNZ Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 186 ttctagatcttgttgaaggca 206
           |||||||||||||||||||||
Sbjct: 723 ttctagatcttgttgaaggca 703



to top

>emb|CR671039.2|CNS0FGQT Tetraodon nigroviridis full-length cDNA
          Length = 754

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 186 ttctagatcttgttgaaggca 206
           |||||||||||||||||||||
Sbjct: 724 ttctagatcttgttgaaggca 704



to top

>emb|CR671013.2|CNS0FGQ3 Tetraodon nigroviridis full-length cDNA
          Length = 1069

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 186  ttctagatcttgttgaaggca 206
            |||||||||||||||||||||
Sbjct: 1039 ttctagatcttgttgaaggca 1019



to top

>emb|CR671520.2|CNS0FH46 Tetraodon nigroviridis full-length cDNA
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 186  ttctagatcttgttgaaggca 206
            |||||||||||||||||||||
Sbjct: 1019 ttctagatcttgttgaaggca 999



to top

>emb|CR670534.2|CNS0FGCS Tetraodon nigroviridis full-length cDNA
          Length = 750

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 186 ttctagatcttgttgaaggca 206
           |||||||||||||||||||||
Sbjct: 723 ttctagatcttgttgaaggca 703



to top

>emb|CR668627.2|CNS0FEVT Tetraodon nigroviridis full-length cDNA
          Length = 512

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 186 ttctagatcttgttgaaggca 206
           |||||||||||||||||||||
Sbjct: 482 ttctagatcttgttgaaggca 462



to top

>emb|CR668461.2|CNS0FER7 Tetraodon nigroviridis full-length cDNA
          Length = 753

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 186 ttctagatcttgttgaaggca 206
           |||||||||||||||||||||
Sbjct: 723 ttctagatcttgttgaaggca 703



to top

>emb|CR668249.2|CNS0FELB Tetraodon nigroviridis full-length cDNA
          Length = 1037

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 186  ttctagatcttgttgaaggca 206
            |||||||||||||||||||||
Sbjct: 1004 ttctagatcttgttgaaggca 984



to top

>emb|CR667660.2|CNS0FE4Y Tetraodon nigroviridis full-length cDNA
          Length = 1044

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 186  ttctagatcttgttgaaggca 206
            |||||||||||||||||||||
Sbjct: 1014 ttctagatcttgttgaaggca 994



to top

>emb|CR666943.2|CNS0FDL1 Tetraodon nigroviridis full-length cDNA
          Length = 512

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 186 ttctagatcttgttgaaggca 206
           |||||||||||||||||||||
Sbjct: 482 ttctagatcttgttgaaggca 462


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,954,372
Number of Sequences: 3902068
Number of extensions: 4954372
Number of successful extensions: 93503
Number of sequences better than 10.0: 436
Number of HSP's better than 10.0 without gapping: 436
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 92635
Number of HSP's gapped (non-prelim): 868
length of query: 446
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 424
effective length of database: 17,147,199,772
effective search space: 7270412703328
effective search space used: 7270412703328
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top