ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags21p14
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome 38 1.5
2gb|AC144859.3| Mus musculus BAC clone RP24-158C2 from chromosome... 38 1.5
3emb|BX276180.5| Zebrafish DNA sequence from clone CH211-284K10 i... 38 1.5
4gb|AC103623.13| Mus musculus chromosome 5, clone RP24-253A20, co... 38 1.5
5gb|AC147135.2| Mus musculus BAC clone RP24-475E12 from chromosom... 36 6.0
6gb|AC140386.4| Mus musculus BAC clone RP24-88H19 from chromosome... 36 6.0
7emb|AL139219.12| Human DNA sequence from clone RP5-1117P19 on ch... 36 6.0
8emb|AL596182.28| Mouse DNA sequence from clone RP23-303F24 on ch... 36 6.0
9gb|AC005560.3| Arabidopsis thaliana chromosome 2 clone F2I9 map ... 36 6.0
10gb|AC026434.5| Homo sapiens chromosome 5 clone CTD-2244C20, comp... 36 6.0
11gb|AC034233.5| Homo sapiens chromosome 5 clone CTD-2251M10, comp... 36 6.0
12gb|AC016599.6| Homo sapiens chromosome 5 clone CTD-2054D19, comp... 36 6.0
13emb|BX247948.4| Zebrafish DNA sequence from clone DKEY-34E4 in l... 36 6.0
14emb|AL929390.14| Mouse DNA sequence from clone RP23-107J3 on chr... 36 6.0
15emb|AL732456.6| Mouse DNA sequence from clone RP23-405D18 on chr... 36 6.0
16emb|AL513468.9| Mouse DNA sequence from clone RP23-104I6 on chro... 36 6.0

>gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome
          Length = 5373180

 Score = 38.2 bits (19), Expect = 1.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 10      ttttggtgcttggtctatg 28
               |||||||||||||||||||
Sbjct: 2053340 ttttggtgcttggtctatg 2053358



to top

>gb|AC144859.3| Mus musculus BAC clone RP24-158C2 from chromosome 5, complete
            sequence
          Length = 170762

 Score = 38.2 bits (19), Expect = 1.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 20   tggtctatgtttcctatat 38
            |||||||||||||||||||
Sbjct: 2383 tggtctatgtttcctatat 2365



to top

>emb|BX276180.5| Zebrafish DNA sequence from clone CH211-284K10 in linkage group 20,
             complete sequence
          Length = 107893

 Score = 38.2 bits (19), Expect = 1.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 22    gtctatgtttcctatatta 40
             |||||||||||||||||||
Sbjct: 57738 gtctatgtttcctatatta 57756



to top

>gb|AC103623.13| Mus musculus chromosome 5, clone RP24-253A20, complete sequence
          Length = 170641

 Score = 38.2 bits (19), Expect = 1.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 20    tggtctatgtttcctatat 38
             |||||||||||||||||||
Sbjct: 42674 tggtctatgtttcctatat 42692



to top

>gb|AC147135.2| Mus musculus BAC clone RP24-475E12 from chromosome Y, complete sequence
          Length = 222469

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 8     tcttttggtgcttggtct 25
             ||||||||||||||||||
Sbjct: 39482 tcttttggtgcttggtct 39499



to top

>gb|AC140386.4| Mus musculus BAC clone RP24-88H19 from chromosome Y, complete sequence
          Length = 222469

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 8     tcttttggtgcttggtct 25
             ||||||||||||||||||
Sbjct: 39482 tcttttggtgcttggtct 39499



to top

>emb|AL139219.12| Human DNA sequence from clone RP5-1117P19 on chromosome 1p31.2-32.3
             Contains part of the DAB1 gene for disabled homolog 1
             (Drosophila), complete sequence
          Length = 64855

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                  
Query: 27    tgtttcctatattatnacctg 47
             ||||||||||||||| |||||
Sbjct: 24993 tgtttcctatattattacctg 24973



to top

>emb|AL596182.28| Mouse DNA sequence from clone RP23-303F24 on chromosome 11 Contains a
              pseudogene similar to part of glyceraldehyde-3-phosphate
              dehydrogenase (Gapd), the Irf1 gene for interferon
              regulatory factor 1, a novel gene, the Slc22a5 gene for
              solute carrier family 22 (organic cation transporter)
              member 5, a ribosomal protein L27a (Rpl27a) pseudogene, a
              cyclin-dependent kinase 4 (Cdk4) pseudogene and two CpG
              islands, complete sequence
          Length = 191494

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 24     ctatgtttcctatattat 41
              ||||||||||||||||||
Sbjct: 176130 ctatgtttcctatattat 176147



to top

>gb|AC005560.3| Arabidopsis thaliana chromosome 2 clone F2I9 map rga, complete sequence
          Length = 103125

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                       
Query: 16    tgcttggtctatgtttcctatattat 41
             |||||||||||| |||||| ||||||
Sbjct: 90125 tgcttggtctatctttcctctattat 90150



to top

>gb|AC026434.5| Homo sapiens chromosome 5 clone CTD-2244C20, complete sequence
          Length = 99385

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 19    ttggtctatgtttcctat 36
             ||||||||||||||||||
Sbjct: 36177 ttggtctatgtttcctat 36160



to top

>gb|AC034233.5| Homo sapiens chromosome 5 clone CTD-2251M10, complete sequence
          Length = 168963

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 19     ttggtctatgtttcctat 36
              ||||||||||||||||||
Sbjct: 145240 ttggtctatgtttcctat 145223



to top

>gb|AC016599.6| Homo sapiens chromosome 5 clone CTD-2054D19, complete sequence
          Length = 173736

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 19     ttggtctatgtttcctat 36
              ||||||||||||||||||
Sbjct: 151611 ttggtctatgtttcctat 151594



to top

>emb|BX247948.4| Zebrafish DNA sequence from clone DKEY-34E4 in linkage group 5, complete
              sequence
          Length = 131707

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 24     ctatgtttcctatattat 41
              ||||||||||||||||||
Sbjct: 102306 ctatgtttcctatattat 102323



to top

>emb|AL929390.14| Mouse DNA sequence from clone RP23-107J3 on chromosome 4, complete
              sequence
          Length = 146977

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 8      tcttttggtgcttggtctatgt 29
              |||||||||| |||||||||||
Sbjct: 127198 tcttttggtggttggtctatgt 127177



to top

>emb|AL732456.6| Mouse DNA sequence from clone RP23-405D18 on chromosome X, complete
             sequence
          Length = 136482

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 23    tctatgtttcctatatta 40
             ||||||||||||||||||
Sbjct: 40793 tctatgtttcctatatta 40810



to top

>emb|AL513468.9| Mouse DNA sequence from clone RP23-104I6 on chromosome X, complete
              sequence
          Length = 211194

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 22     gtctatgtttcctatatt 39
              ||||||||||||||||||
Sbjct: 206162 gtctatgtttcctatatt 206179


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 228,836
Number of Sequences: 3902068
Number of extensions: 228836
Number of successful extensions: 58181
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 58137
Number of HSP's gapped (non-prelim): 44
length of query: 47
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 27
effective length of database: 17,155,003,908
effective search space: 463185105516
effective search space used: 463185105516
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top