ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags22e02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_721278.1| Plasmodium yoelii yoelii str. 17XNL cysteine re... 44 0.25
2ref|XM_720614.1| Plasmodium yoelii yoelii str. 17XNL cysteine re... 44 0.25
3ref|XM_737878.1| Plasmodium chabaudi chabaudi cysteine repeat mo... 44 0.25
4emb|BX323029.6| Zebrafish DNA sequence from clone CH211-261O16, ... 44 0.25
5gb|AY769434.1| Homo sapiens matrix metalloproteinase 1 (intersti... 42 0.98
6emb|BX005426.16| Zebrafish DNA sequence from clone DKEY-1H24 in ... 42 0.98
7emb|AL356957.27| Human DNA sequence from clone RP11-403I13 on ch... 42 0.98
8emb|AL683873.14| Mouse DNA sequence from clone RP23-119G22 on ch... 42 0.98
9gb|U78045.1|HSU78045 Human collagenase and stromelysin genes, co... 42 0.98
10emb|BX545854.10| Zebrafish DNA sequence from clone CH211-195N8 i... 42 0.98
11dbj|AP000647.5| Homo sapiens genomic DNA, chromosome 11 clone:CM... 42 0.98
12dbj|AP000619.5| Homo sapiens genomic DNA, chromosome 11 clone:CM... 42 0.98
13gb|AC100967.15| Mus musculus chromosome 5, clone RP23-74L20, com... 42 0.98
14gb|U19976.1|HSU19976 Human transposon-like element homolog, repe... 42 0.98
15gb|AY708000.1| Triticum monococcum clone EStm-4 transposon En/Sp... 40 3.9
16gb|AC183596.2| Pan troglodytes BAC clone CH251-679I13 from chrom... 40 3.9
17emb|CT025602.8| Mouse DNA sequence from clone RP23-458L4 on chro... 40 3.9
18gb|AC132282.3| Mus musculus BAC clone RP24-348O21 from chromosom... 40 3.9
19emb|AL356866.22| Human DNA sequence from clone RP11-211D10 on ch... 40 3.9
20emb|AL133325.20| Human DNA sequence from clone RP5-984P4 on chro... 40 3.9
21gb|AC090229.15| Homo sapiens chromosome 18, clone RP11-873E20, c... 40 3.9
22emb|CR391971.7| Zebrafish DNA sequence from clone CH211-260O6 in... 40 3.9
23gb|AC118757.12| Homo sapiens chromosome 18, clone RP11-905K4, co... 40 3.9
24emb|AL662810.16| Mouse DNA sequence from clone RP23-42P24 on chr... 40 3.9
25gb|AC155246.1| Mus musculus BAC clone RP24-303C15 from 14, compl... 40 3.9
26gb|AC131029.6| Mus musculus chromosome 14, clone RP23-304N24, co... 40 3.9
27gb|AC087782.34| Mus musculus strain C57BL/6J chromosome 16 clone... 40 3.9

>ref|XM_721278.1| Plasmodium yoelii yoelii str. 17XNL cysteine repeat modular protein
           2 PbCRM2-related (PY05845) partial mRNA
          Length = 3189

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 268 aaaagaaaaactgttcactatg 289
           ||||||||||||||||||||||
Sbjct: 124 aaaagaaaaactgttcactatg 145



to top

>ref|XM_720614.1| Plasmodium yoelii yoelii str. 17XNL cysteine repeat modular protein 2
            PbCRM2-related (PY05272) partial mRNA
          Length = 5148

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 268  aaaagaaaaactgttcactatg 289
            ||||||||||||||||||||||
Sbjct: 4543 aaaagaaaaactgttcactatg 4564



to top

>ref|XM_737878.1| Plasmodium chabaudi chabaudi cysteine repeat modular protein
            (PC000204.00.0) partial mRNA
          Length = 3192

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 268  aaaagaaaaactgttcactatg 289
            ||||||||||||||||||||||
Sbjct: 1759 aaaagaaaaactgttcactatg 1780



to top

>emb|BX323029.6| Zebrafish DNA sequence from clone CH211-261O16, complete sequence
          Length = 175261

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 56     atacatgcatatatttcaacat 77
              ||||||||||||||||||||||
Sbjct: 165044 atacatgcatatatttcaacat 165065



to top

>gb|AY769434.1| Homo sapiens matrix metalloproteinase 1 (interstitial collagenase)
            (MMP1) gene, complete cds
          Length = 12187

 Score = 42.1 bits (21), Expect = 0.98
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 54   atatacatgcatatatttcaa 74
            |||||||||||||||||||||
Sbjct: 4362 atatacatgcatatatttcaa 4382



to top

>emb|BX005426.16| Zebrafish DNA sequence from clone DKEY-1H24 in linkage group 1, complete
              sequence
          Length = 202018

 Score = 42.1 bits (21), Expect = 0.98
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 268    aaaagaaaaactgttcactat 288
              |||||||||||||||||||||
Sbjct: 177489 aaaagaaaaactgttcactat 177469



to top

>emb|AL356957.27| Human DNA sequence from clone RP11-403I13 on chromosome 1 Contains the
             5' end of a novel pseudogene, a profilin 1 (PFN1)
             pseudogene, six novel genes and a novel pseudogene,
             complete sequence
          Length = 204702

 Score = 42.1 bits (21), Expect = 0.98
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 14    tatacaatgaaattacatggt 34
             |||||||||||||||||||||
Sbjct: 70325 tatacaatgaaattacatggt 70305



to top

>emb|AL683873.14| Mouse DNA sequence from clone RP23-119G22 on chromosome 13 Contains
             part of a novel gene, complete sequence
          Length = 104602

 Score = 42.1 bits (21), Expect = 0.98
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aacctatatacatgcatatat 69
             |||||||||||||||||||||
Sbjct: 21806 aacctatatacatgcatatat 21786



to top

>gb|U78045.1|HSU78045 Human collagenase and stromelysin genes, complete cds, and
            metalloelastase gene, partial cds
          Length = 81826

 Score = 42.1 bits (21), Expect = 0.98
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 54   atatacatgcatatatttcaa 74
            |||||||||||||||||||||
Sbjct: 9558 atatacatgcatatatttcaa 9538



to top

>emb|BX545854.10| Zebrafish DNA sequence from clone CH211-195N8 in linkage group 11,
             complete sequence
          Length = 190179

 Score = 42.1 bits (21), Expect = 0.98
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 54    atatacatgcatatatttcaa 74
             |||||||||||||||||||||
Sbjct: 65128 atatacatgcatatatttcaa 65148



to top

>dbj|AP000647.5| Homo sapiens genomic DNA, chromosome 11 clone:CMB9-75I23, complete
             sequence
          Length = 118818

 Score = 42.1 bits (21), Expect = 0.98
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 54    atatacatgcatatatttcaa 74
             |||||||||||||||||||||
Sbjct: 96494 atatacatgcatatatttcaa 96474



to top

>dbj|AP000619.5| Homo sapiens genomic DNA, chromosome 11 clone:CMB9-42C6, complete
             sequence
          Length = 103181

 Score = 42.1 bits (21), Expect = 0.98
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 54    atatacatgcatatatttcaa 74
             |||||||||||||||||||||
Sbjct: 47272 atatacatgcatatatttcaa 47252



to top

>gb|AC100967.15| Mus musculus chromosome 5, clone RP23-74L20, complete sequence
          Length = 229660

 Score = 42.1 bits (21), Expect = 0.98
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 53     tatatacatgcatatatttca 73
              |||||||||||||||||||||
Sbjct: 106509 tatatacatgcatatatttca 106489



to top

>gb|U19976.1|HSU19976 Human transposon-like element homolog, repetitive sequence
          Length = 3199

 Score = 42.1 bits (21), Expect = 0.98
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 225 agtcagccaagaaccaagctg 245
           |||||||||||||||||||||
Sbjct: 161 agtcagccaagaaccaagctg 141



to top

>gb|AY708000.1| Triticum monococcum clone EStm-4 transposon En/Spm-like, partial
           sequence
          Length = 653

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 257 tggacaaggtgaaaagaaaa 276
           ||||||||||||||||||||
Sbjct: 211 tggacaaggtgaaaagaaaa 230



to top

>gb|AC183596.2| Pan troglodytes BAC clone CH251-679I13 from chromosome 6, complete
              sequence
          Length = 214528

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 16     tacaatgaaattacatggta 35
              ||||||||||||||||||||
Sbjct: 161196 tacaatgaaattacatggta 161215



to top

>emb|CT025602.8| Mouse DNA sequence from clone RP23-458L4 on chromosome 14, complete
              sequence
          Length = 207863

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 53     tatatacatgcatatatttc 72
              ||||||||||||||||||||
Sbjct: 169978 tatatacatgcatatatttc 169959



to top

>gb|AC132282.3| Mus musculus BAC clone RP24-348O21 from chromosome 14, complete
             sequence
          Length = 166747

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 53    tatatacatgcatatatttc 72
             ||||||||||||||||||||
Sbjct: 87341 tatatacatgcatatatttc 87322



to top

>emb|AL356866.22| Human DNA sequence from clone RP11-211D10 on chromosome 13 Contains a
            CpG island, complete sequence
          Length = 182321

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 99   tgtgtcaaaattgtacatct 118
            ||||||||||||||||||||
Sbjct: 6491 tgtgtcaaaattgtacatct 6510



to top

>emb|AL133325.20| Human DNA sequence from clone RP5-984P4 on chromosome 20 Contains the
             NKX2-2 gene for NK2 transcription factor related locus 2
             (Drosophila), a hydroxysteroid (17-beta) dehydrogenase 12
             (HSD17B12) pseudogene, the GSTM3P gene for glutathione
             S-transferase M3 pseudogene, a novel gene and two CpG
             islands, complete sequence
          Length = 160013

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 53    tatatacatgcatatatttc 72
             ||||||||||||||||||||
Sbjct: 46108 tatatacatgcatatatttc 46127



to top

>gb|AC090229.15| Homo sapiens chromosome 18, clone RP11-873E20, complete sequence
          Length = 192106

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 50     acctatatacatgcatatat 69
              ||||||||||||||||||||
Sbjct: 153653 acctatatacatgcatatat 153672



to top

>emb|CR391971.7| Zebrafish DNA sequence from clone CH211-260O6 in linkage group 21,
            complete sequence
          Length = 129478

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 7    tctttattatacaatgaaat 26
            ||||||||||||||||||||
Sbjct: 1778 tctttattatacaatgaaat 1797



to top

>gb|AC118757.12| Homo sapiens chromosome 18, clone RP11-905K4, complete sequence
          Length = 185308

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 50     acctatatacatgcatatat 69
              ||||||||||||||||||||
Sbjct: 141297 acctatatacatgcatatat 141278



to top

>emb|AL662810.16| Mouse DNA sequence from clone RP23-42P24 on chromosome 11 Contains a
              novel gene (9630006B20Rik), a novel gene, a ribosomal
              protein S12 (Rps12) pseudogene, a novel gene (LOC268391),
              the Bcl11a gene for B-cell CLL/lymphoma 11A (zinc finger
              protein), two novel genes and three CpG islands, complete
              sequence
          Length = 267641

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 124    cagtgaagggaagccagaag 143
              ||||||||||||||||||||
Sbjct: 192311 cagtgaagggaagccagaag 192330



to top

>gb|AC155246.1| Mus musculus BAC clone RP24-303C15 from 14, complete sequence
          Length = 151983

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 156  aatgggaccatctcttccca 175
            ||||||||||||||||||||
Sbjct: 5611 aatgggaccatctcttccca 5630



to top

>gb|AC131029.6| Mus musculus chromosome 14, clone RP23-304N24, complete sequence
          Length = 239588

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 156   aatgggaccatctcttccca 175
             ||||||||||||||||||||
Sbjct: 39043 aatgggaccatctcttccca 39024



to top

>gb|AC087782.34| Mus musculus strain C57BL/6J chromosome 16 clone rp23-81d13, complete
              sequence
          Length = 177250

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 124    cagtgaagggaagccagaag 143
              ||||||||||||||||||||
Sbjct: 146964 cagtgaagggaagccagaag 146945


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,519,831
Number of Sequences: 3902068
Number of extensions: 3519831
Number of successful extensions: 75003
Number of sequences better than 10.0: 27
Number of HSP's better than 10.0 without gapping: 27
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 74946
Number of HSP's gapped (non-prelim): 57
length of query: 295
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 273
effective length of database: 17,147,199,772
effective search space: 4681185537756
effective search space used: 4681185537756
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top