ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags21n22
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC122218.4| Mus musculus BAC clone RP23-118J7 from chromosome... 40 1.1
2gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome 38 4.3
3emb|AL049394.1|HSM800179 Homo sapiens mRNA; cDNA DKFZp586B1819 (... 38 4.3
4dbj|AK021953.1| Homo sapiens cDNA FLJ11891 fis, clone HEMBA1007267 38 4.3
5gb|AY262821.1| Pinus radiata cellulose synthase (CesA2) mRNA, pa... 38 4.3
6gb|AC005924.2|AC005924 Homo sapiens Chr.14 PAC RPCI4-794B2 (Rosw... 38 4.3
7emb|AL132838.4|CNS01DTQ Human chromosome 14 DNA sequence BAC R-8... 38 4.3

>gb|AC122218.4| Mus musculus BAC clone RP23-118J7 from chromosome 16, complete sequence
          Length = 196599

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 4     cagtatccatccctccactc 23
             ||||||||||||||||||||
Sbjct: 79896 cagtatccatccctccactc 79877



to top

>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome
          Length = 6438405

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 71      catagtgatagtccagacc 89
               |||||||||||||||||||
Sbjct: 4688041 catagtgatagtccagacc 4688059



to top

>emb|AL049394.1|HSM800179 Homo sapiens mRNA; cDNA DKFZp586B1819 (from clone DKFZp586B1819)
          Length = 1926

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 12  atccctccactccactact 30
           |||||||||||||||||||
Sbjct: 614 atccctccactccactact 596



to top

>dbj|AK021953.1| Homo sapiens cDNA FLJ11891 fis, clone HEMBA1007267
          Length = 1964

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 12   atccctccactccactact 30
            |||||||||||||||||||
Sbjct: 1579 atccctccactccactact 1561



to top

>gb|AY262821.1| Pinus radiata cellulose synthase (CesA2) mRNA, partial cds
          Length = 3603

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 4    cagtatccatccctccact 22
            |||||||||||||||||||
Sbjct: 1495 cagtatccatccctccact 1477



to top

>gb|AC005924.2|AC005924 Homo sapiens Chr.14 PAC RPCI4-794B2 (Roswell Park Cancer Institute
             Human PAC Library) complete sequence
          Length = 111107

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 12    atccctccactccactact 30
             |||||||||||||||||||
Sbjct: 91002 atccctccactccactact 91020



to top

>emb|AL132838.4|CNS01DTQ Human chromosome 14 DNA sequence BAC R-85G20 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 175326

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 12    atccctccactccactact 30
             |||||||||||||||||||
Sbjct: 39144 atccctccactccactact 39162


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 702,513
Number of Sequences: 3902068
Number of extensions: 702513
Number of successful extensions: 46946
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 46937
Number of HSP's gapped (non-prelim): 9
length of query: 97
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 76
effective length of database: 17,151,101,840
effective search space: 1303483739840
effective search space used: 1303483739840
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top