ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags22c04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AJ508228.2|HVU508228 Hordeum vulgare subsp. vulgare mRNA for... 94 1e-16
2dbj|AB050957.1| Triticum aestivum arf mRNA for ADP-ribosylation ... 90 2e-15
3ref|XM_776569.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 1.9
4gb|AF422153.1|AF422153 Strongylocentrotus purpuratus receptor fo... 40 1.9
5ref|NM_214636.1| Strongylocentrotus purpuratus receptor for egg ... 40 1.9
6emb|AL954130.8| Zebrafish DNA sequence from clone CH211-214D1 in... 40 1.9
7emb|BX649366.5| Zebrafish DNA sequence from clone DKEY-16I5 in l... 38 7.5
8gb|AC117479.4| Homo sapiens 3 BAC RP11-490P18 (Roswell Park Canc... 38 7.5
9emb|AL672051.14| Mouse DNA sequence from clone RP23-332O3 on chr... 38 7.5
10emb|AL591952.9| Mouse DNA sequence from clone RP23-25N17 on chro... 38 7.5

>emb|AJ508228.2|HVU508228 Hordeum vulgare subsp. vulgare mRNA for ADP-ribosylation factor
           1-like protein
          Length = 934

 Score = 93.7 bits (47), Expect = 1e-16
 Identities = 62/69 (89%)
 Strand = Plus / Minus

                                                                       
Query: 87  cctgncctgatcctagctcacttaangangggagcttntgcctgtcacatacgcncacat 146
           |||| |||||| ||||||||||||| || |||||||| |||||||||||||||| |||||
Sbjct: 846 cctgacctgatactagctcacttaaagaagggagcttctgcctgtcacatacgcacacat 787

                    
Query: 147 nctatctgt 155
            ||||||||
Sbjct: 786 actatctgt 778



 Score = 81.8 bits (41), Expect = 6e-13
 Identities = 48/49 (97%), Gaps = 1/49 (2%)
 Strand = Plus / Minus

                                                            
Query: 26  agtaaaccttgtgaaaaccacggcacagaaatactgataatatccatac 74
           |||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 904 agtaaaccttgt-aaaaccacggcacagaaatactgataatatccatac 857



to top

>dbj|AB050957.1| Triticum aestivum arf mRNA for ADP-ribosylation factor, complete
           cds
          Length = 972

 Score = 89.7 bits (45), Expect = 2e-15
 Identities = 60/67 (89%)
 Strand = Plus / Minus

                                                                       
Query: 87  cctgncctgatcctagctcacttaangangggagcttntgcctgtcacatacgcncacat 146
           |||| |||||| ||||||||||||| || |||||||| |||||||||||||||| |||||
Sbjct: 825 cctgacctgatactagctcacttaaagaagggagcttctgcctgtcacatacgcacacat 766

                  
Query: 147 nctatct 153
            ||||||
Sbjct: 765 actatct 759



to top

>ref|XM_776569.1| PREDICTED: Strongylocentrotus purpuratus similar to Polycystic
           kidney disease and receptor for egg jelly related
           protein precursor (PKD and REJ homolog) (LOC576242),
           partial mRNA
          Length = 3050

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 52  agaaatactgataatatcca 71
           ||||||||||||||||||||
Sbjct: 156 agaaatactgataatatcca 137



to top

>gb|AF422153.1|AF422153 Strongylocentrotus purpuratus receptor for egg jelly 3 protein
           (REJ3) mRNA, complete cds
          Length = 8739

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 52  agaaatactgataatatcca 71
           ||||||||||||||||||||
Sbjct: 244 agaaatactgataatatcca 225



to top

>ref|NM_214636.1| Strongylocentrotus purpuratus receptor for egg jelly 3 (REJ3), mRNA
          Length = 8739

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 52  agaaatactgataatatcca 71
           ||||||||||||||||||||
Sbjct: 244 agaaatactgataatatcca 225



to top

>emb|AL954130.8| Zebrafish DNA sequence from clone CH211-214D1 in linkage group 16,
              complete sequence
          Length = 235236

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 48     gcacagaaatactgataatatcca 71
              ||||| ||||||||||||||||||
Sbjct: 193380 gcacacaaatactgataatatcca 193403



to top

>emb|BX649366.5| Zebrafish DNA sequence from clone DKEY-16I5 in linkage group 12,
             complete sequence
          Length = 222310

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 35    tgtgaaaaccacggcacag 53
             |||||||||||||||||||
Sbjct: 22063 tgtgaaaaccacggcacag 22081



to top

>gb|AC117479.4| Homo sapiens 3 BAC RP11-490P18 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 145285

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 48    gcacagaaatactgataat 66
             |||||||||||||||||||
Sbjct: 32359 gcacagaaatactgataat 32341



to top

>emb|AL672051.14| Mouse DNA sequence from clone RP23-332O3 on chromosome X, complete
             sequence
          Length = 163949

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 56    atactgataatatccatac 74
             |||||||||||||||||||
Sbjct: 28349 atactgataatatccatac 28367



to top

>emb|AL591952.9| Mouse DNA sequence from clone RP23-25N17 on chromosome 15, complete
             sequence
          Length = 208835

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 1     ggttcatacacacaatgttgaca 23
             |||| ||||||||||||||||||
Sbjct: 63497 ggttgatacacacaatgttgaca 63475


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 770,257
Number of Sequences: 3902068
Number of extensions: 770257
Number of successful extensions: 50771
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 50756
Number of HSP's gapped (non-prelim): 15
length of query: 157
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 135
effective length of database: 17,147,199,772
effective search space: 2314871969220
effective search space used: 2314871969220
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top