ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags22b24
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT017257.1| Zea mays clone EL01N0308D08.c mRNA sequence 349 7e-93
2gb|BT018105.1| Zea mays clone EL01N0553D01.c mRNA sequence 301 1e-78
3gb|AY103642.1| Zea mays PCO105720 mRNA sequence 301 1e-78
4ref|NM_194676.1| Oryza sativa (japonica cultivar-group) putative... 214 3e-52
5dbj|AK121991.1| Oryza sativa (japonica cultivar-group) cDNA clon... 214 3e-52
6gb|AY389676.1| Hyacinthus orientalis ribosomal protein L7 (RPL7)... 155 2e-34
7gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 139 1e-29
8gb|AC136136.1| Genomic sequence for Oryza sativa, Nipponbare str... 139 1e-29
9dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 139 1e-29
10gb|DQ459071.1| Sorghum bicolor cultivar BTx623 clone BAC c0156b0... 125 2e-25
11emb|Z49911.1|CEM28 Caenorhabditis elegans Cosmid M28, complete s... 86 2e-13
12ref|NM_063899.3| Caenorhabditis elegans M28.5 (M28.5) mRNA, comp... 86 2e-13
13gb|AC079128.2| Oryza sativa (japonica cultivar-group) chromosome... 78 4e-11
14gb|AC145127.1| Oryza sativa (japonica cultivar-group) chromosome... 78 4e-11
15gb|AC131967.1| Oryza sativa (japonica cultivar-group) chromosome... 78 4e-11
16dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 78 4e-11
17gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 78 4e-11
18ref|XM_531713.2| PREDICTED: Canis familiaris similar to NHP2-lik... 68 4e-08
19ref|XM_571849.1| Cryptococcus neoformans var. neoformans JEC21 c... 66 2e-07
20ref|NM_122023.2| Arabidopsis thaliana RNA binding / structural c... 64 6e-07
21ref|NM_180525.1| Arabidopsis thaliana RNA binding / structural c... 64 6e-07
22gb|AY094018.1| Arabidopsis thaliana AT5g20160/F5O24_50 mRNA, com... 64 6e-07
23gb|AY048213.1| Arabidopsis thaliana AT5g20160/F5O24_50 mRNA, com... 64 6e-07
24gb|AY086996.1| Arabidopsis thaliana clone 30288 mRNA, complete s... 64 6e-07
25ref|NM_200312.1| Danio rerio zgc:56066 (zgc:56066), mRNA 60 9e-06
26ref|XM_757414.1| Ustilago maydis 521 hypothetical protein (UM063... 60 9e-06
27ref|XM_505832.1| Yarrowia lipolytica CLIB122, YALI0F24497g predi... 60 9e-06
28gb|BC050495.1| Danio rerio zgc:56066, mRNA (cDNA clone MGC:56066... 60 9e-06
29emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 60 9e-06
30ref|XM_744631.1| Aspergillus fumigatus Af293 snRNP and snoRNP pr... 58 4e-05
31dbj|AB226025.1| Aspergillus oryzae cDNA, contig sequence: AoEST2881 58 4e-05
32dbj|AP007154.1| Aspergillus oryzae RIB40 genomic DNA, SC001 58 4e-05
33gb|AF296825.1|F5O24 Arabidopsis thaliana BAC F5O24 58 4e-05
34ref|NM_118364.1| Arabidopsis thaliana RNA binding / structural c... 56 1e-04
35gb|BT024580.1| Arabidopsis thaliana At4g22380 mRNA, complete cds 56 1e-04
36gb|AY086674.1| Arabidopsis thaliana clone 2673 mRNA, complete se... 56 1e-04
37gb|AC160992.2| Mus musculus BAC clone RP23-147I23 from chromosom... 54 6e-04
38ref|XM_509501.1| PREDICTED: Pan troglodytes similar to checkpoin... 54 6e-04
39ref|XM_956324.1| Neurospora crassa OR74A probable 13 kD U4/U6.U5... 54 6e-04
40ref|XM_326823.1| Neurospora crassa OR74A probable 13 kD U4/U6.U5... 54 6e-04
41ref|NM_011482.3| Mus musculus NHP2 non-histone chromosome protei... 54 6e-04
42ref|XM_992454.1| PREDICTED: Mus musculus similar to Nhp2 non-his... 54 6e-04
43ref|XM_486217.4| PREDICTED: Mus musculus similar to Nhp2 non-his... 54 6e-04
44gb|BC046579.1| Xenopus laevis NHP2 non-histone chromosome protei... 54 6e-04
45gb|BC083315.1| Mus musculus NHP2 non-histone chromosome protein ... 54 6e-04
46gb|BC054450.1| Mus musculus NHP2 non-histone chromosome protein ... 54 6e-04
47gb|BC026755.1| Mus musculus NHP2 non-histone chromosome protein ... 54 6e-04
48gb|BC058493.1| Rattus norvegicus similar to NHP2-like protein 1 ... 54 6e-04
49emb|AL451017.1|NC12F11 Neurospora crassa DNA linkage group V Cos... 54 6e-04
50dbj|AK134943.1| Mus musculus adult male olfactory brain cDNA, RI... 54 6e-04
51dbj|AK145391.1| Mus musculus morula whole body morula cDNA, RIKE... 54 6e-04
52dbj|AK145608.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 54 6e-04
53dbj|AK168930.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu... 54 6e-04
54dbj|AK168808.1| Mus musculus 17 days embryo stomach cDNA, RIKEN ... 54 6e-04
55dbj|AK169103.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f... 54 6e-04
56gb|AC153579.10| Mus musculus 6 BAC RP23-21F2 (Roswell Park Cance... 54 6e-04
57gb|AC156559.3| Mus musculus BAC clone RP24-421K17 from chromosom... 54 6e-04
58dbj|AK004489.1| Mus musculus 18-day embryo whole body cDNA, RIKE... 54 6e-04
59gb|AC127070.10| Homo sapiens 12 BAC RP11-46H11 (Roswell Park Can... 54 6e-04
60emb|CT030635.8| Mouse DNA sequence from clone RP23-94N7 on chrom... 54 6e-04
61ref|NM_212515.1| Rattus norvegicus similar to NHP2-like protein ... 54 6e-04
62gb|BC061279.1| Xenopus tropicalis hypothetical protein MGC75724,... 52 0.002
63gb|BC066453.1| Danio rerio zgc:56066, mRNA (cDNA clone MGC:77417... 52 0.002
64ref|XM_365765.1| Magnaporthe grisea 70-15 hypothetical protein (... 52 0.002
65ref|XM_860169.1| PREDICTED: Canis familiaris similar to NHP2-lik... 52 0.002
66ref|XM_847115.1| PREDICTED: Canis familiaris similar to NHP2-lik... 52 0.002
67ref|XR_004088.1| PREDICTED: Mus musculus similar to Nhp2 non-his... 52 0.002
68emb|AL161557.2|ATCHRIV57 Arabidopsis thaliana DNA chromosome 4, ... 52 0.002
69emb|AL033545.2|ATF7K2 Arabidopsis thaliana DNA chromosome 4, BAC... 52 0.002
70ref|XM_697178.1| PREDICTED: Danio rerio hypothetical protein LOC... 52 0.002
71ref|NM_203663.1| Xenopus tropicalis hypothetical protein MGC7572... 52 0.002
72emb|CR760372.2| Xenopus tropicalis finished cDNA, clone TNeu005n20 52 0.002
73emb|CR761482.2| Xenopus tropicalis finished cDNA, clone TGas123b15 52 0.002
74emb|AL929165.9| Mouse DNA sequence from clone RP23-446D4 on chro... 52 0.002
75ref|NM_117330.2| Arabidopsis thaliana RNA binding / structural c... 48 0.036
76gb|AF361618.1| Arabidopsis thaliana AT4g12600/T1P17_190 mRNA, co... 48 0.036
77gb|AY055095.1| Arabidopsis thaliana AT4g12600/T1P17_190 mRNA, co... 48 0.036
78gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 48 0.036
79gb|AY087261.1| Arabidopsis thaliana clone 33381 mRNA, complete s... 48 0.036
80ref|NM_210145.1| Eremothecium gossypii AEL070Wp (AEL070W), mRNA 48 0.036
81ref|XM_924350.2| PREDICTED: Mus musculus similar to Nhp2 non-his... 46 0.14
82ref|XR_004053.1| PREDICTED: Mus musculus similar to Nhp2 non-his... 46 0.14
83ref|XM_001003565.1| PREDICTED: Mus musculus similar to Nhp2 non-... 46 0.14
84ref|XM_910204.2| PREDICTED: Mus musculus similar to Nhp2 non-his... 46 0.14
85ref|XM_799370.1| Trypanosoma cruzi strain CL Brener ribosomal pr... 46 0.14
86gb|AC133193.3| Mus musculus BAC clone RP23-396L1 from chromosome... 46 0.14
87ref|XM_815179.1| Trypanosoma cruzi strain CL Brener ribosomal pr... 46 0.14
88ref|XM_970157.1| PREDICTED: Tribolium castaneum similar to Nhp2 ... 46 0.14
89emb|AL161534.2|ATCHRIV34 Arabidopsis thaliana DNA chromosome 4, ... 46 0.14
90emb|AL049730.2|ATT1P17 Arabidopsis thaliana DNA chromosome 4, BA... 46 0.14
91ref|XM_345321.2| PREDICTED: Rattus norvegicus similar to NHP2-li... 46 0.14
92emb|BX284624.4| Mouse DNA sequence from clone RP23-299A2 on chro... 46 0.14
93ref|XM_515161.1| PREDICTED: Pan troglodytes similar to NHP2-like... 44 0.56
94gb|DQ214255.1| Taeniopygia guttata clone 0061P0016A06 NHP2 non-h... 44 0.56
95ref|XM_001005500.1| PREDICTED: Mus musculus similar to Nhp2 non-... 44 0.56
96ref|XM_904370.2| PREDICTED: Mus musculus similar to Nhp2 non-his... 44 0.56
97ref|XM_973339.1| PREDICTED: Mus musculus similar to Nhp2 non-his... 44 0.56
98gb|AC124909.3| Equus caballus clone CH241-91H15, complete sequence 44 0.56
99ref|XM_317299.2| Anopheles gambiae str. PEST ENSANGP00000010500 ... 44 0.56
100emb|CR556713.11| Zebrafish DNA sequence from clone DKEY-28O14 in... 44 0.56
101emb|CT030166.8| Mouse DNA sequence from clone RP23-320I11 on chr... 44 0.56
102gb|DP000020.1| Equus caballus target 1 genomic scaffold 44 0.56
103ref|XM_416225.1| PREDICTED: Gallus gallus similar to NHP2-like p... 42 2.2
104ref|XM_976843.1| PREDICTED: Mus musculus hypothetical LOC544888 ... 42 2.2
105ref|XM_909635.2| PREDICTED: Mus musculus hypothetical LOC544888 ... 42 2.2
106ref|XM_619025.3| PREDICTED: Mus musculus hypothetical LOC544888 ... 42 2.2
107gb|DQ014842.1| Uncultured bacterium clone M1_d03_3 16S ribosomal... 42 2.2
108emb|AL135751.1|SPAC607 S.pombe chromosome I cosmid c607 42 2.2
109emb|BX950527.2| Gallus gallus finished cDNA, clone ChEST568g13 42 2.2
110gb|AC160131.2| Mus musculus BAC clone RP23-226D9 from chromosome... 42 2.2
111ref|NM_001019023.1| Schizosaccharomyces pombe 972h- hypothetical... 42 2.2
112emb|BX934076.2| Gallus gallus finished cDNA, clone ChEST55d24 42 2.2
113emb|BX932329.2| Gallus gallus finished cDNA, clone ChEST359i7 42 2.2
114emb|BX931143.2| Gallus gallus finished cDNA, clone ChEST203b22 42 2.2
115emb|CR352576.1| Gallus gallus finished cDNA, clone ChEST831m24 42 2.2
116gb|AY950656.1| Acanthamoeba castellanii snu13p-like mRNA, comple... 42 2.2
117emb|BX936171.1| Gallus gallus finished cDNA, clone ChEST145m8 42 2.2
118dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 42 2.2
119gb|AF087136.1|AF087136 Schizosaccharomyces pombe SNU13 snRNP sub... 42 2.2
120gb|U95114.1|MMU95114 Mus musculus fertilization antigen-1 mRNA, ... 42 2.2
121gb|AE017347.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 8.7
122gb|AE013216.1| Thermoanaerobacter tengcongensis MB4, section 243... 40 8.7
123ref|XM_389646.1| Gibberella zeae PH-1 chromosome 4 predicted pro... 40 8.7
124gb|AC147031.2| Pan troglodytes BAC clone RP43-98M7 from 7, compl... 40 8.7
125ref|XM_848546.1| PREDICTED: Canis familiaris similar to NHP2-lik... 40 8.7
126gb|AC004911.1| Homo sapiens PAC clone RP5-870F17 from 7, complet... 40 8.7
127emb|AL353661.41| Human DNA sequence from clone RP3-445O1 on chro... 40 8.7
128emb|AL031847.17|HS120G22 Human DNA sequence from clone RP1-120G2... 40 8.7
129emb|CR541725.1| Homo sapiens full open reading frame cDNA clone ... 40 8.7
130gb|AY991238.1| Uncultured bacterium clone C13_O06 16S ribosomal ... 40 8.7
131emb|AL021712.2|ATT10I14 Arabidopsis thaliana DNA chromosome 4, B... 40 8.7
132emb|AJ292371.1|EMU292371 Echinococcus multilocularis mRNA for pu... 40 8.7
133gb|BC095439.1| Homo sapiens NHP2 non-histone chromosome protein ... 40 8.7
134gb|AC069079.11| Homo sapiens chromosome 10 clone RP11-539E19, co... 40 8.7
135gb|AC099063.2| Homo sapiens chromosome 1 clone RP4-620F22, compl... 40 8.7
136ref|NM_005008.2| Homo sapiens NHP2 non-histone chromosome protei... 40 8.7
137ref|NM_001003796.1| Homo sapiens NHP2 non-histone chromosome pro... 40 8.7
138emb|CR623311.1| full-length cDNA clone CS0DE011YM23 of Placenta ... 40 8.7
139emb|CR623174.1| full-length cDNA clone CS0DA009YE02 of Neuroblas... 40 8.7
140emb|CR616994.1| full-length cDNA clone CS0DK010YK23 of HeLa cell... 40 8.7
141emb|CR616990.1| full-length cDNA clone CS0DH007YI19 of T cells (... 40 8.7
142emb|CR614137.1| full-length cDNA clone CS0DJ005YB10 of T cells (... 40 8.7
143emb|CR613725.1| full-length cDNA clone CS0DC017YM06 of Neuroblas... 40 8.7
144emb|CR612873.1| full-length cDNA clone CS0DC024YJ07 of Neuroblas... 40 8.7
145emb|CR605954.1| full-length cDNA clone CS0DC024YA08 of Neuroblas... 40 8.7
146emb|CR602484.1| full-length cDNA clone CS0DJ008YG20 of T cells (... 40 8.7
147emb|CR600974.1| full-length cDNA clone CS0DB009YP18 of Neuroblas... 40 8.7
148emb|CR600000.1| full-length cDNA clone CS0DJ012YD12 of T cells (... 40 8.7
149emb|CR595064.1| full-length cDNA clone CS0DN001YL05 of Adult bra... 40 8.7
150emb|CR593477.1| full-length cDNA clone CS0DC025YF02 of Neuroblas... 40 8.7
151emb|CR593383.1| full-length cDNA clone CS0DK007YN07 of HeLa cell... 40 8.7
152emb|CR593004.1| full-length cDNA clone CS0DC023YC02 of Neuroblas... 40 8.7
153emb|CR591470.1| full-length cDNA clone CS0DB003YC24 of Neuroblas... 40 8.7
154gb|AC012049.8| Homo sapiens chromosome 10 clone RP11-76F22, comp... 40 8.7
155ref|NM_079975.2| Drosophila melanogaster hoi-polloi CG3949-RA (h... 40 8.7
156gb|AC022537.8| Homo sapiens chromosome 10 clone RP11-40C11, comp... 40 8.7
157dbj|AB169618.1| Macaca fascicularis brain cDNA, clone: QtrA-1120... 40 8.7
158gb|BC103317.2| Bos taurus cDNA clone MGC:129115 IMAGE:8122031, c... 40 8.7
159ref|NM_001026666.1| Caenorhabditis elegans Glucose-6-Phosphate I... 40 8.7
160ref|NM_001026667.1| Caenorhabditis elegans Glucose-6-Phosphate I... 40 8.7
161emb|AL115549.1|CNS01CHX Botrytis cinerea strain T4 cDNA library 40 8.7
162gb|AF129858.1|AF129858 Zea mays CENPCB protein (CenpcB) mRNA, pa... 40 8.7
163gb|AC007291.24|AC007291 Drosophila melanogaster, chromosome 2L, ... 40 8.7
164gb|BC019282.2| Homo sapiens NHP2 non-histone chromosome protein ... 40 8.7
165gb|AF208396.1|AF208396 Drosophila melanogaster Hoi-polloi (hoip)... 40 8.7
166gb|AF175919.1|AF175919 Drosophila melanogaster hoip[k07104] P el... 40 8.7
167gb|BT003523.1| Drosophila melanogaster RE22964 full insert cDNA 40 8.7
168ref|XM_234480.3| PREDICTED: Rattus norvegicus similar to RIKEN c... 40 8.7
169gb|AY893533.1| Synthetic construct Homo sapiens clone FLH130980.... 40 8.7
170emb|AL357614.5|HS367B10 Homo sapiens chromosome 9 BAC RP11-367B1... 40 8.7
171gb|AF155235.1|AF155235 Homo sapiens 15.5 kD RNA binding protein ... 40 8.7
172gb|AC007257.9|AC007257 Drosophila melanogaster, chromosome 2L, r... 40 8.7
173emb|CR456531.1| Homo sapiens NHP2L1 full length open reading fra... 40 8.7
174emb|AL110500.1|CEY87G2A Caenorhabditis elegans YAC Y87G2A, compl... 40 8.7
175gb|AE003625.3| Drosophila melanogaster chromosome 2L, section 34... 40 8.7
176gb|AF091076.1|AF091076 Homo sapiens clone 557 OTK27 mRNA, comple... 40 8.7
177gb|AY609481.1| Sus scrofa clone Clu_13005.scr.msk.p1.Contig3, mR... 40 8.7
178gb|AC136008.5| Mus musculus BAC clone RP24-68J1 from 6, complete... 40 8.7
179gb|BC005358.1| Homo sapiens NHP2 non-histone chromosome protein ... 40 8.7
180dbj|AP006388.1| Lotus japonicus genomic DNA, chromosome 1, clone... 40 8.7
181dbj|AB036925.1| Citrus unshiu Cit-VATP B-1 gene for vacuolar H+-... 40 8.7
182dbj|D50420.1| Homo sapiens mRNA for OTK27, complete cds 40 8.7

>gb|BT017257.1| Zea mays clone EL01N0308D08.c mRNA sequence
          Length = 718

 Score =  349 bits (176), Expect = 7e-93
 Identities = 347/400 (86%), Gaps = 3/400 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 acaagacaccatcaccagtccaagcccctgaaaaactgtgtcacacgaggcccatcacac 227
           |||||||||||||||||||||||||| |||||||| |||||| | |||||||||||||||
Sbjct: 492 acaagacaccatcaccagtccaagcctctgaaaaa-tgtgtcgc-cgaggcccatcacac 435

                                                                       
Query: 228 tgaaaggtctt-gataaatcatatgagaagcttctcgatggcatccttgagactctggat 286
           |||||| |||| | ||||||| |||||||||||||| || |  |||||||||| ||| ||
Sbjct: 434 tgaaagatcttaggtaaatcagatgagaagcttctcaatcgagtccttgagaccctgtat 375

                                                                       
Query: 287 cggctgcttcagttggctaccctcattgctggtcactgaacaagcaatgaccggcctagt 346
           | | || ||||| |||||||||||||||||||||||||| ||||||||||| || || ||
Sbjct: 374 ctgttgtttcagctggctaccctcattgctggtcactgagcaagcaatgacgggtcttgt 315

                                                                       
Query: 347 cactccacaagcacgcccaagggcttgctttgaagggacaaagacatacggcacattctt 406
           ||| ||||||||||| ||||| ||||| || || || ||||| ||||| || || |||||
Sbjct: 314 cacaccacaagcacggccaagagcttgtttcgatggaacaaatacatatgggacgttctt 255

                                                                       
Query: 407 gtcctccgcgagcaacgggaggtggaggaggatttcgagcggctccgtgtcagctgccat 466
            ||||| || | ||| ||||||||||| ||||| ||||| ||||||||||| || |||||
Sbjct: 254 atcctcggctaacaaggggaggtggagcaggatctcgagaggctccgtgtccgccgccat 195

                                                                       
Query: 467 caccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctcccttctt 526
           ||| |||||||||||||| ||||| || || || || ||||||||||| |||||||||||
Sbjct: 194 cacaacgaactccgatatccccctattcagggttttcgtcgcttcgttcgctcccttctt 135

                                                   
Query: 527 gagctgcttgtagttggcggcctgctggacgatgtcgagg 566
           ||||||||||||||||||||||||||||| ||| ||||||
Sbjct: 134 gagctgcttgtagttggcggcctgctggatgatatcgagg 95



to top

>gb|BT018105.1| Zea mays clone EL01N0553D01.c mRNA sequence
          Length = 791

 Score =  301 bits (152), Expect = 1e-78
 Identities = 341/400 (85%), Gaps = 3/400 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 acaagacaccatcaccagtccaagcccctgaaaaactgtgtcacacgaggcccatcacac 227
           |||||||||||||||||||||||||| ||||||||  ||||| |  ||||||||||||||
Sbjct: 611 acaagacaccatcaccagtccaagcctctgaaaaaa-gtgtcgct-gaggcccatcacac 554

                                                                       
Query: 228 tgaaaggtctt-gataaatcatatgagaagcttctcgatggcatccttgagactctggat 286
           ||||||||||| |  | |||| |||||||||||||| ||||  |||||||||| ||| ||
Sbjct: 553 tgaaaggtcttcggcagatcagatgagaagcttctcaatggagtccttgagaccctgtat 494

                                                                       
Query: 287 cggctgcttcagttggctaccctcattgctggtcactgaacaagcaatgaccggcctagt 346
           | |  | ||||| |||||||||||||| ||||||||||| |||||||| ||||| || ||
Sbjct: 493 ctgtagtttcagctggctaccctcattactggtcactgagcaagcaataaccggtcttgt 434

                                                                       
Query: 347 cactccacaagcacgcccaagggcttgctttgaagggacaaagacatacggcacattctt 406
           ||| ||||||||||| ||||| |||||||| || || ||||| ||||| ||||| |||||
Sbjct: 433 cacaccacaagcacggccaagagcttgcttcgatggaacaaacacatatggcacgttctt 374

                                                                       
Query: 407 gtcctccgcgagcaacgggaggtggaggaggatttcgagcggctccgtgtcagctgccat 466
            ||||| || | ||| ||||||||||| ||||| ||||| ||||| ||||| || |||||
Sbjct: 373 atcctcagctaacaaggggaggtggagcaggatctcgagaggctctgtgtccgccgccat 314

                                                                       
Query: 467 caccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctcccttctt 526
           ||| || ||||||||||| ||||| || || ||||| |||||||| || |||||||||||
Sbjct: 313 cactacaaactccgatatgcccctattcagggtcttcgtcgcttcattcgctcccttctt 254

                                                   
Query: 527 gagctgcttgtagttggcggcctgctggacgatgtcgagg 566
            ||||| |||||||||||||||||||||| ||| ||||||
Sbjct: 253 aagctgtttgtagttggcggcctgctggatgatatcgagg 214



to top

>gb|AY103642.1| Zea mays PCO105720 mRNA sequence
          Length = 1169

 Score =  301 bits (152), Expect = 1e-78
 Identities = 341/400 (85%), Gaps = 3/400 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 acaagacaccatcaccagtccaagcccctgaaaaactgtgtcacacgaggcccatcacac 227
           |||||||||||||||||||||||||| ||||||||  |||||  | ||||||||||||||
Sbjct: 601 acaagacaccatcaccagtccaagcctctgaaaaaa-gtgtcg-atgaggcccatcacac 544

                                                                       
Query: 228 tgaaaggtctt-gataaatcatatgagaagcttctcgatggcatccttgagactctggat 286
           ||||||||||| |  | |||| |||||||||||||| ||||  |||||||||| ||| ||
Sbjct: 543 tgaaaggtcttcggcagatcagatgagaagcttctcaatggagtccttgagaccctgtat 484

                                                                       
Query: 287 cggctgcttcagttggctaccctcattgctggtcactgaacaagcaatgaccggcctagt 346
           | |  | ||||| |||||||||||||| ||||||||||| |||||||| ||||| || ||
Sbjct: 483 ctgtagtttcagctggctaccctcattactggtcactgagcaagcaataaccggtcttgt 424

                                                                       
Query: 347 cactccacaagcacgcccaagggcttgctttgaagggacaaagacatacggcacattctt 406
           ||| ||||||||||| ||||| |||||||| || || ||||| ||||| ||||| |||||
Sbjct: 423 cacaccacaagcacggccaagagcttgcttcgatggaacaaacacatatggcacgttctt 364

                                                                       
Query: 407 gtcctccgcgagcaacgggaggtggaggaggatttcgagcggctccgtgtcagctgccat 466
            ||||| || | ||| ||||||||||| ||||| ||||| ||||| ||||| || |||||
Sbjct: 363 atcctcagctaacaaggggaggtggagcaggatctcgagaggctctgtgtccgccgccat 304

                                                                       
Query: 467 caccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctcccttctt 526
           ||| || ||||||||||| ||||| || || ||||| |||||||| || |||||||||||
Sbjct: 303 cactacaaactccgatatgcccctattcagggtcttcgtcgcttcattcgctcccttctt 244

                                                   
Query: 527 gagctgcttgtagttggcggcctgctggacgatgtcgagg 566
            ||||| |||||||||||||||||||||| ||| ||||||
Sbjct: 243 aagctgtttgtagttggcggcctgctggatgatatcgagg 204



to top

>ref|NM_194676.1| Oryza sativa (japonica cultivar-group) putative ribosomal protein
           L7Ae-like (OSJNBa0056A20.5), mRNA
          Length = 381

 Score =  214 bits (108), Expect = 3e-52
 Identities = 210/244 (86%)
 Strand = Plus / Minus

                                                                       
Query: 307 cctcattgctggtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaa 366
           |||||||||||||||| || || || || || ||||| ||||| ||||| ||||| || |
Sbjct: 319 cctcattgctggtcaccgagcaggcgatcacgggcctcgtcaccccacatgcacggccga 260

                                                                       
Query: 367 gggcttgctttgaagggacaaagacatacggcacattcttgtcctccgcgagcaacggga 426
           | ||||||||||| ||||||||||| || ||||||||||||||||| ||||| |  || |
Sbjct: 259 gagcttgctttgatgggacaaagacgtatggcacattcttgtcctcggcgaggaggggaa 200

                                                                       
Query: 427 ggtggaggaggatttcgagcggctccgtgtcagctgccatcaccacgaactccgatattc 486
           ||||||| ||||| ||||| ||||| | ||| || |||||||||||||||||||  || |
Sbjct: 199 ggtggagaaggatctcgaggggctcggcgtcggccgccatcaccacgaactccgcgatcc 140

                                                                       
Query: 487 ccctgttgagagtcttggtcgcttcgttggctcccttcttgagctgcttgtagttggcgg 546
           | |||||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 139 ctctgttgagcgtcttcgtcgcttcgttggcgcccttcttgagctgcttgtagttggcgg 80

               
Query: 547 cctg 550
           ||||
Sbjct: 79  cctg 76



to top

>dbj|AK121991.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033109K13, full
           insert sequence
          Length = 675

 Score =  214 bits (108), Expect = 3e-52
 Identities = 210/244 (86%)
 Strand = Plus / Minus

                                                                       
Query: 307 cctcattgctggtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaa 366
           |||||||||||||||| || || || || || ||||| ||||| ||||| ||||| || |
Sbjct: 390 cctcattgctggtcaccgagcaggcgatcacgggcctcgtcaccccacatgcacggccga 331

                                                                       
Query: 367 gggcttgctttgaagggacaaagacatacggcacattcttgtcctccgcgagcaacggga 426
           | ||||||||||| ||||||||||| || ||||||||||||||||| ||||| |  || |
Sbjct: 330 gagcttgctttgatgggacaaagacgtatggcacattcttgtcctcggcgaggaggggaa 271

                                                                       
Query: 427 ggtggaggaggatttcgagcggctccgtgtcagctgccatcaccacgaactccgatattc 486
           ||||||| ||||| ||||| ||||| | ||| || |||||||||||||||||||  || |
Sbjct: 270 ggtggagaaggatctcgaggggctcggcgtcggccgccatcaccacgaactccgcgatcc 211

                                                                       
Query: 487 ccctgttgagagtcttggtcgcttcgttggctcccttcttgagctgcttgtagttggcgg 546
           | |||||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 210 ctctgttgagcgtcttcgtcgcttcgttggcgcccttcttgagctgcttgtagttggcgg 151

               
Query: 547 cctg 550
           ||||
Sbjct: 150 cctg 147



to top

>gb|AY389676.1| Hyacinthus orientalis ribosomal protein L7 (RPL7) mRNA, complete
           cds
          Length = 675

 Score =  155 bits (78), Expect = 2e-34
 Identities = 165/194 (85%)
 Strand = Plus / Minus

                                                                       
Query: 363 ccaagggcttgctttgaagggacaaagacatacggcacattcttgtcctccgcgagcaac 422
           ||||| ||||| || ||||| ||||||||||| ||||||||||||||||| || ||||  
Sbjct: 303 ccaagtgcttgtttggaaggaacaaagacatagggcacattcttgtcctcagcaagcaga 244

                                                                       
Query: 423 gggaggtggaggaggatttcgagcggctccgtgtcagctgccatcaccacgaactccgat 482
           || ||||| || || |||||||| ||||| | ||| || |||||||| || |||||||| 
Sbjct: 243 ggaaggtgaagaagaatttcgaggggctcagcgtccgcagccatcacaacaaactccgag 184

                                                                       
Query: 483 attcccctgttgagagtcttggtcgcttcgttggctcccttcttgagctgcttgtagttg 542
           ||||||||||| |||||||| |||||||| || || ||||| |||||||||||||| |||
Sbjct: 183 attcccctgttcagagtcttagtcgcttcattagcaccctttttgagctgcttgtaattg 124

                         
Query: 543 gcggcctgctggac 556
           || |||||||||||
Sbjct: 123 gccgcctgctggac 110



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  139 bits (70), Expect = 1e-29
 Identities = 104/114 (91%), Gaps = 1/114 (0%)
 Strand = Plus / Minus

                                                                           
Query: 161     ctagcagacaagacaccatcaccagtccaagcccctgaaaaactgtgtcacac-gaggcc 219
               |||||| | |||||||||||||||||||||||| ||||||||||||||| | | ||||||
Sbjct: 7447561 ctagcaaataagacaccatcaccagtccaagcctctgaaaaactgtgtcgctctgaggcc 7447502

                                                                     
Query: 220     catcacactgaaaggtcttgataaatcatatgagaagcttctcgatggcatcct 273
               |||||||||||||||||||| ||||||| ||||| ||||||||||| |||||||
Sbjct: 7447501 catcacactgaaaggtcttggtaaatcaaatgaggagcttctcgatagcatcct 7447448



 Score =  123 bits (62), Expect = 8e-25
 Identities = 94/102 (92%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                           
Query: 508     cttcgttggctcccttcttgagctgcttgtagttggcggcctgctggacgatgtcgaggg 567
               |||||||||| |||||||||||||||||||| |||| |||||||||||||| ||||| ||
Sbjct: 7446242 cttcgttggcccccttcttgagctgcttgtaattggaggcctgctggacgaggtcga-gg 7446184

                                                         
Query: 568     atcgttatcgtcagcttgcgcgtccgccagcgggtaggcctt 609
               || || ||||||||| ||||||||||||||||||||||||||
Sbjct: 7446183 atggtcatcgtcagc-tgcgcgtccgccagcgggtaggcctt 7446143



 Score =  115 bits (58), Expect = 2e-22
 Identities = 91/102 (89%)
 Strand = Plus / Minus

                                                                           
Query: 408     tcctccgcgagcaacgggaggtggaggaggatttcgagcggctccgtgtcagctgccatc 467
               |||||||||||||  ||||||||||| ||||| ||||||||||||||||| || ||||||
Sbjct: 7446432 tcctccgcgagcagggggaggtggagaaggatctcgagcggctccgtgtcggccgccatc 7446373

                                                         
Query: 468     accacgaactccgatattcccctgttgagagtcttggtcgct 509
               ||||||||||| ||||| |||||||| || ||||| ||||||
Sbjct: 7446372 accacgaactctgatatacccctgttcagggtcttcgtcgct 7446331



 Score =  103 bits (52), Expect = 7e-19
 Identities = 106/124 (85%)
 Strand = Plus / Minus

                                                                           
Query: 271     ccttgagactctggatcggctgcttcagttggctaccctcattgctggtcactgaacaag 330
               |||||||| |||| |||||   |||||| || || ||||| |||||||||||||||||||
Sbjct: 7447353 ccttgagattctgtatcggtgtcttcagctgactgccctcgttgctggtcactgaacaag 7447294

                                                                           
Query: 331     caatgaccggcctagtcactccacaagcacgcccaagggcttgctttgaagggacaaaga 390
               ||||||| || ||||| || ||||| || || |||||||||||||| ||||||||||| |
Sbjct: 7447293 caatgacaggtctagtaacgccacatgcgcggccaagggcttgcttcgaagggacaaaaa 7447234

                   
Query: 391     cata 394
               ||||
Sbjct: 7447233 cata 7447230



to top

>gb|AC136136.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBb0071C04, from chromosome 3, complete sequence
          Length = 126078

 Score =  139 bits (70), Expect = 1e-29
 Identities = 104/114 (91%), Gaps = 1/114 (0%)
 Strand = Plus / Minus

                                                                         
Query: 161   ctagcagacaagacaccatcaccagtccaagcccctgaaaaactgtgtcacac-gaggcc 219
             |||||| | |||||||||||||||||||||||| ||||||||||||||| | | ||||||
Sbjct: 86116 ctagcaaataagacaccatcaccagtccaagcctctgaaaaactgtgtcgctctgaggcc 86057

                                                                   
Query: 220   catcacactgaaaggtcttgataaatcatatgagaagcttctcgatggcatcct 273
             |||||||||||||||||||| ||||||| ||||| ||||||||||| |||||||
Sbjct: 86056 catcacactgaaaggtcttggtaaatcaaatgaggagcttctcgatagcatcct 86003



 Score =  123 bits (62), Expect = 8e-25
 Identities = 94/102 (92%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                         
Query: 508   cttcgttggctcccttcttgagctgcttgtagttggcggcctgctggacgatgtcgaggg 567
             |||||||||| |||||||||||||||||||| |||| |||||||||||||| ||||| ||
Sbjct: 84797 cttcgttggcccccttcttgagctgcttgtaattggaggcctgctggacgaggtcga-gg 84739

                                                       
Query: 568   atcgttatcgtcagcttgcgcgtccgccagcgggtaggcctt 609
             || || ||||||||| ||||||||||||||||||||||||||
Sbjct: 84738 atggtcatcgtcagc-tgcgcgtccgccagcgggtaggcctt 84698



 Score =  115 bits (58), Expect = 2e-22
 Identities = 91/102 (89%)
 Strand = Plus / Minus

                                                                         
Query: 408   tcctccgcgagcaacgggaggtggaggaggatttcgagcggctccgtgtcagctgccatc 467
             |||||||||||||  ||||||||||| ||||| ||||||||||||||||| || ||||||
Sbjct: 84987 tcctccgcgagcagggggaggtggagaaggatctcgagcggctccgtgtcggccgccatc 84928

                                                       
Query: 468   accacgaactccgatattcccctgttgagagtcttggtcgct 509
             ||||||||||| ||||| |||||||| || ||||| ||||||
Sbjct: 84927 accacgaactctgatatacccctgttcagggtcttcgtcgct 84886



 Score =  103 bits (52), Expect = 7e-19
 Identities = 106/124 (85%)
 Strand = Plus / Minus

                                                                         
Query: 271   ccttgagactctggatcggctgcttcagttggctaccctcattgctggtcactgaacaag 330
             |||||||| |||| |||||   |||||| || || ||||| |||||||||||||||||||
Sbjct: 85908 ccttgagattctgtatcggtgtcttcagctgactgccctcgttgctggtcactgaacaag 85849

                                                                         
Query: 331   caatgaccggcctagtcactccacaagcacgcccaagggcttgctttgaagggacaaaga 390
             ||||||| || ||||| || ||||| || || |||||||||||||| ||||||||||| |
Sbjct: 85848 caatgacaggtctagtaacgccacatgcgcggccaagggcttgcttcgaagggacaaaaa 85789

                 
Query: 391   cata 394
             ||||
Sbjct: 85788 cata 85785



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  139 bits (70), Expect = 1e-29
 Identities = 104/114 (91%), Gaps = 1/114 (0%)
 Strand = Plus / Minus

                                                                           
Query: 161     ctagcagacaagacaccatcaccagtccaagcccctgaaaaactgtgtcacac-gaggcc 219
               |||||| | |||||||||||||||||||||||| ||||||||||||||| | | ||||||
Sbjct: 7445396 ctagcaaataagacaccatcaccagtccaagcctctgaaaaactgtgtcgctctgaggcc 7445337

                                                                     
Query: 220     catcacactgaaaggtcttgataaatcatatgagaagcttctcgatggcatcct 273
               |||||||||||||||||||| ||||||| ||||| ||||||||||| |||||||
Sbjct: 7445336 catcacactgaaaggtcttggtaaatcaaatgaggagcttctcgatagcatcct 7445283



 Score =  123 bits (62), Expect = 8e-25
 Identities = 94/102 (92%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                           
Query: 508     cttcgttggctcccttcttgagctgcttgtagttggcggcctgctggacgatgtcgaggg 567
               |||||||||| |||||||||||||||||||| |||| |||||||||||||| ||||| ||
Sbjct: 7444077 cttcgttggcccccttcttgagctgcttgtaattggaggcctgctggacgaggtcga-gg 7444019

                                                         
Query: 568     atcgttatcgtcagcttgcgcgtccgccagcgggtaggcctt 609
               || || ||||||||| ||||||||||||||||||||||||||
Sbjct: 7444018 atggtcatcgtcagc-tgcgcgtccgccagcgggtaggcctt 7443978



 Score =  115 bits (58), Expect = 2e-22
 Identities = 91/102 (89%)
 Strand = Plus / Minus

                                                                           
Query: 408     tcctccgcgagcaacgggaggtggaggaggatttcgagcggctccgtgtcagctgccatc 467
               |||||||||||||  ||||||||||| ||||| ||||||||||||||||| || ||||||
Sbjct: 7444267 tcctccgcgagcagggggaggtggagaaggatctcgagcggctccgtgtcggccgccatc 7444208

                                                         
Query: 468     accacgaactccgatattcccctgttgagagtcttggtcgct 509
               ||||||||||| ||||| |||||||| || ||||| ||||||
Sbjct: 7444207 accacgaactctgatatacccctgttcagggtcttcgtcgct 7444166



 Score =  103 bits (52), Expect = 7e-19
 Identities = 106/124 (85%)
 Strand = Plus / Minus

                                                                           
Query: 271     ccttgagactctggatcggctgcttcagttggctaccctcattgctggtcactgaacaag 330
               |||||||| |||| |||||   |||||| || || ||||| |||||||||||||||||||
Sbjct: 7445188 ccttgagattctgtatcggtgtcttcagctgactgccctcgttgctggtcactgaacaag 7445129

                                                                           
Query: 331     caatgaccggcctagtcactccacaagcacgcccaagggcttgctttgaagggacaaaga 390
               ||||||| || ||||| || ||||| || || |||||||||||||| ||||||||||| |
Sbjct: 7445128 caatgacaggtctagtaacgccacatgcgcggccaagggcttgcttcgaagggacaaaaa 7445069

                   
Query: 391     cata 394
               ||||
Sbjct: 7445068 cata 7445065



to top

>gb|DQ459071.1| Sorghum bicolor cultivar BTx623 clone BAC c0156b06, complete sequence
          Length = 112592

 Score =  125 bits (63), Expect = 2e-25
 Identities = 117/135 (86%)
 Strand = Plus / Plus

                                                                          
Query: 271    ccttgagactctggatcggctgcttcagttggctaccctcattgctggtcactgaacaag 330
              ||||||||| ||| ||| | || ||||| |||||||||||||||||||||||||| ||||
Sbjct: 111956 ccttgagaccctgtatctgttgtttcagctggctaccctcattgctggtcactgagcaag 112015

                                                                          
Query: 331    caatgaccggcctagtcactccacaagcacgcccaagggcttgctttgaagggacaaaga 390
              ||||||||||||| ||||| |||||||| || ||||| ||||| ||||| || ||||| |
Sbjct: 112016 caatgaccggccttgtcaccccacaagctcggccaagagcttgttttgatggaacaaata 112075

                             
Query: 391    catacggcacattct 405
              |||| ||||| ||||
Sbjct: 112076 catatggcacgttct 112090



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 87/96 (90%), Gaps = 3/96 (3%)
 Strand = Plus / Plus

                                                                          
Query: 168    acaagacaccatcaccagtccaagcccctgaaaaactgtgtcacacgaggcccatcacac 227
              |||||||||||||||||||||||||| |||||||  |||||| |  ||||||||||||||
Sbjct: 111693 acaagacaccatcaccagtccaagcctctgaaaat-tgtgtccct-gaggcccatcacac 111750

                                                  
Query: 228    tgaaaggtctt-gataaatcatatgagaagcttctc 262
              ||||||||||| | ||||||| ||||||||||||||
Sbjct: 111751 tgaaaggtcttcggtaaatcagatgagaagcttctc 111786



to top

>emb|Z49911.1|CEM28 Caenorhabditis elegans Cosmid M28, complete sequence
          Length = 40265

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 55/59 (93%)
 Strand = Plus / Plus

                                                                        
Query: 483   attcccctgttgagagtcttggtcgcttcgttggctcccttcttgagctgcttgtagtt 541
             ||||| ||||||||||||||||| || ||||||||||||||||||||||| ||||||||
Sbjct: 38927 attcctctgttgagagtcttggtggcctcgttggctcccttcttgagctgtttgtagtt 38985



to top

>ref|NM_063899.3| Caenorhabditis elegans M28.5 (M28.5) mRNA, complete cds
          Length = 531

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 55/59 (93%)
 Strand = Plus / Minus

                                                                      
Query: 483 attcccctgttgagagtcttggtcgcttcgttggctcccttcttgagctgcttgtagtt 541
           ||||| ||||||||||||||||| || ||||||||||||||||||||||| ||||||||
Sbjct: 161 attcctctgttgagagtcttggtggcctcgttggctcccttcttgagctgtttgtagtt 103



to top

>gb|AC079128.2| Oryza sativa (japonica cultivar-group) chromosome 10 clone
             OSJNBa0056A20, complete sequence
          Length = 151163

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 84/99 (84%)
 Strand = Plus / Minus

                                                                         
Query: 307   cctcattgctggtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaa 366
             |||||||||||||||| || || || || || ||||| ||||| ||||| ||||| || |
Sbjct: 29362 cctcattgctggtcaccgagcaggcgatcacgggcctcgtcaccccacatgcacggccga 29303

                                                    
Query: 367   gggcttgctttgaagggacaaagacatacggcacattct 405
             | ||||||||||| ||||||||||| || ||||||||||
Sbjct: 29302 gagcttgctttgatgggacaaagacgtatggcacattct 29264



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 42/43 (97%)
 Strand = Plus / Minus

                                                        
Query: 508   cttcgttggctcccttcttgagctgcttgtagttggcggcctg 550
             |||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 28332 cttcgttggcgcccttcttgagctgcttgtagttggcggcctg 28290



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 88/106 (83%)
 Strand = Plus / Minus

                                                                         
Query: 404   cttgtcctccgcgagcaacgggaggtggaggaggatttcgagcggctccgtgtcagctgc 463
             ||||||||| ||||| |  || |||||||| ||||| ||||| ||||| | ||| || ||
Sbjct: 28523 cttgtcctcggcgaggaggggaaggtggagaaggatctcgaggggctcggcgtcggccgc 28464

                                                           
Query: 464   catcaccacgaactccgatattcccctgttgagagtcttggtcgct 509
             |||||||||||||||||  || || |||||||| ||||| ||||||
Sbjct: 28463 catcaccacgaactccgcgatccctctgttgagcgtcttcgtcgct 28418



to top

>gb|AC145127.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone
               Pseudo10p0.0-10p4.4, complete sequence
          Length = 2331000

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 84/99 (84%)
 Strand = Plus / Minus

                                                                           
Query: 307     cctcattgctggtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaa 366
               |||||||||||||||| || || || || || ||||| ||||| ||||| ||||| || |
Sbjct: 1510789 cctcattgctggtcaccgagcaggcgatcacgggcctcgtcaccccacatgcacggccga 1510730

                                                      
Query: 367     gggcttgctttgaagggacaaagacatacggcacattct 405
               | ||||||||||| ||||||||||| || ||||||||||
Sbjct: 1510729 gagcttgctttgatgggacaaagacgtatggcacattct 1510691



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 42/43 (97%)
 Strand = Plus / Minus

                                                          
Query: 508     cttcgttggctcccttcttgagctgcttgtagttggcggcctg 550
               |||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 1509759 cttcgttggcgcccttcttgagctgcttgtagttggcggcctg 1509717



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 88/106 (83%)
 Strand = Plus / Minus

                                                                           
Query: 404     cttgtcctccgcgagcaacgggaggtggaggaggatttcgagcggctccgtgtcagctgc 463
               ||||||||| ||||| |  || |||||||| ||||| ||||| ||||| | ||| || ||
Sbjct: 1509950 cttgtcctcggcgaggaggggaaggtggagaaggatctcgaggggctcggcgtcggccgc 1509891

                                                             
Query: 464     catcaccacgaactccgatattcccctgttgagagtcttggtcgct 509
               |||||||||||||||||  || || |||||||| ||||| ||||||
Sbjct: 1509890 catcaccacgaactccgcgatccctctgttgagcgtcttcgtcgct 1509845



to top

>gb|AC131967.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNAa0049K09,
              complete sequence
          Length = 154181

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 84/99 (84%)
 Strand = Plus / Minus

                                                                          
Query: 307    cctcattgctggtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaa 366
              |||||||||||||||| || || || || || ||||| ||||| ||||| ||||| || |
Sbjct: 123543 cctcattgctggtcaccgagcaggcgatcacgggcctcgtcaccccacatgcacggccga 123484

                                                     
Query: 367    gggcttgctttgaagggacaaagacatacggcacattct 405
              | ||||||||||| ||||||||||| || ||||||||||
Sbjct: 123483 gagcttgctttgatgggacaaagacgtatggcacattct 123445



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 42/43 (97%)
 Strand = Plus / Minus

                                                         
Query: 508    cttcgttggctcccttcttgagctgcttgtagttggcggcctg 550
              |||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 122513 cttcgttggcgcccttcttgagctgcttgtagttggcggcctg 122471



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 88/106 (83%)
 Strand = Plus / Minus

                                                                          
Query: 404    cttgtcctccgcgagcaacgggaggtggaggaggatttcgagcggctccgtgtcagctgc 463
              ||||||||| ||||| |  || |||||||| ||||| ||||| ||||| | ||| || ||
Sbjct: 122704 cttgtcctcggcgaggaggggaaggtggagaaggatctcgaggggctcggcgtcggccgc 122645

                                                            
Query: 464    catcaccacgaactccgatattcccctgttgagagtcttggtcgct 509
              |||||||||||||||||  || || |||||||| ||||| ||||||
Sbjct: 122644 catcaccacgaactccgcgatccctctgttgagcgtcttcgtcgct 122599



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
               sequence
          Length = 22685906

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 84/99 (84%)
 Strand = Plus / Minus

                                                                           
Query: 307     cctcattgctggtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaa 366
               |||||||||||||||| || || || || || ||||| ||||| ||||| ||||| || |
Sbjct: 1510789 cctcattgctggtcaccgagcaggcgatcacgggcctcgtcaccccacatgcacggccga 1510730

                                                      
Query: 367     gggcttgctttgaagggacaaagacatacggcacattct 405
               | ||||||||||| ||||||||||| || ||||||||||
Sbjct: 1510729 gagcttgctttgatgggacaaagacgtatggcacattct 1510691



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 42/43 (97%)
 Strand = Plus / Minus

                                                          
Query: 508     cttcgttggctcccttcttgagctgcttgtagttggcggcctg 550
               |||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 1509759 cttcgttggcgcccttcttgagctgcttgtagttggcggcctg 1509717



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 88/106 (83%)
 Strand = Plus / Minus

                                                                           
Query: 404     cttgtcctccgcgagcaacgggaggtggaggaggatttcgagcggctccgtgtcagctgc 463
               ||||||||| ||||| |  || |||||||| ||||| ||||| ||||| | ||| || ||
Sbjct: 1509950 cttgtcctcggcgaggaggggaaggtggagaaggatctcgaggggctcggcgtcggccgc 1509891

                                                             
Query: 464     catcaccacgaactccgatattcccctgttgagagtcttggtcgct 509
               |||||||||||||||||  || || |||||||| ||||| ||||||
Sbjct: 1509890 catcaccacgaactccgcgatccctctgttgagcgtcttcgtcgct 1509845



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 84/99 (84%)
 Strand = Plus / Minus

                                                                           
Query: 307     cctcattgctggtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaa 366
               |||||||||||||||| || || || || || ||||| ||||| ||||| ||||| || |
Sbjct: 1510786 cctcattgctggtcaccgagcaggcgatcacgggcctcgtcaccccacatgcacggccga 1510727

                                                      
Query: 367     gggcttgctttgaagggacaaagacatacggcacattct 405
               | ||||||||||| ||||||||||| || ||||||||||
Sbjct: 1510726 gagcttgctttgatgggacaaagacgtatggcacattct 1510688



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 42/43 (97%)
 Strand = Plus / Minus

                                                          
Query: 508     cttcgttggctcccttcttgagctgcttgtagttggcggcctg 550
               |||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 1509756 cttcgttggcgcccttcttgagctgcttgtagttggcggcctg 1509714



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 88/106 (83%)
 Strand = Plus / Minus

                                                                           
Query: 404     cttgtcctccgcgagcaacgggaggtggaggaggatttcgagcggctccgtgtcagctgc 463
               ||||||||| ||||| |  || |||||||| ||||| ||||| ||||| | ||| || ||
Sbjct: 1509947 cttgtcctcggcgaggaggggaaggtggagaaggatctcgaggggctcggcgtcggccgc 1509888

                                                             
Query: 464     catcaccacgaactccgatattcccctgttgagagtcttggtcgct 509
               |||||||||||||||||  || || |||||||| ||||| ||||||
Sbjct: 1509887 catcaccacgaactccgcgatccctctgttgagcgtcttcgtcgct 1509842



to top

>ref|XM_531713.2| PREDICTED: Canis familiaris similar to NHP2-like protein 1 (High
           mobility group-like nuclear protein 2 homolog 1)
           ([U4/U6.U5] tri-snRNP 15.5 kDa protein) (Sperm specific
           antigen 1) (Fertilization antigen 1) (FA-1) (LOC474484),
           mRNA
          Length = 1414

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 172/218 (78%)
 Strand = Plus / Minus

                                                                       
Query: 324 gaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgctttgaaggg 383
           ||||| |||||||| ||||| | ||| ||||| || ||||| ||||| ||||| ||  | 
Sbjct: 373 gaacaggcaatgacaggcctggacaccccacaggcccgcccgagggcctgcttggagcgc 314

                                                                       
Query: 384 acaaagacatacggcacattcttgtcctccgcgagcaacgggaggtggaggaggatttcg 443
           ||||| || || ||||| ||||| || ||    |||| ||| ||||| |||| |||||| 
Sbjct: 313 acaaacacgtagggcacgttcttatcttcacacagcagcggaaggtgcaggatgatttcc 254

                                                                       
Query: 444 agcggctccgtgtcagctgccatcaccacgaactccgatattcccctgttgagagtcttg 503
           || ||||| | ||| || |||||||| | |||||| || || || |||||||| || |||
Sbjct: 253 agaggctcagcgtctgcagccatcacgatgaactcagagatgcctctgttgagggttttg 194

                                                 
Query: 504 gtcgcttcgttggctcccttcttgagctgcttgtagtt 541
           || |||||||||||||| |||   ||||||||||||||
Sbjct: 193 gtggcttcgttggctcctttccgaagctgcttgtagtt 156



to top

>ref|XM_571849.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 7
          Length = 596

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 498 gtcttggtcgcttcgttggctcccttcttgagctgcttgta 538
           |||||||| ||||||||||| ||||||||||||||||||||
Sbjct: 236 gtcttggtggcttcgttggcacccttcttgagctgcttgta 196



to top

>ref|NM_122023.2| Arabidopsis thaliana RNA binding / structural constituent of
           ribosome AT5G20160 transcript variant AT5G20160.1 mRNA,
           complete cds
          Length = 719

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                       
Query: 321 actgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgctttgaa 380
           ||||||||||| || || || |||||||| ||||| || |  || | |||||||||||||
Sbjct: 404 actgaacaagcgataacaggtctagtcacaccacaggctcttcccaaggcttgctttgaa 345

                                           
Query: 381 gggacaaagacatacggcacattcttgtcctc 412
           || ||||||||||| || |||||||| |||||
Sbjct: 344 ggcacaaagacataaggaacattcttatcctc 313



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 495 agagtcttggtcgcttcgttggctcccttcttgagctgcttgtagtt 541
           |||||||| || ||||| || || |||||||||||||||||||||||
Sbjct: 230 agagtcttcgtagcttcattagcacccttcttgagctgcttgtagtt 184



to top

>ref|NM_180525.1| Arabidopsis thaliana RNA binding / structural constituent of
           ribosome AT5G20160 transcript variant AT5G20160.2 mRNA,
           complete cds
          Length = 815

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                       
Query: 321 actgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgctttgaa 380
           ||||||||||| || || || |||||||| ||||| || |  || | |||||||||||||
Sbjct: 500 actgaacaagcgataacaggtctagtcacaccacaggctcttcccaaggcttgctttgaa 441

                                           
Query: 381 gggacaaagacatacggcacattcttgtcctc 412
           || ||||||||||| || |||||||| |||||
Sbjct: 440 ggcacaaagacataaggaacattcttatcctc 409



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 519 cccttcttgagctgcttgtagtt 541
           |||||||||||||||||||||||
Sbjct: 206 cccttcttgagctgcttgtagtt 184



to top

>gb|AY094018.1| Arabidopsis thaliana AT5g20160/F5O24_50 mRNA, complete cds
          Length = 387

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                       
Query: 321 actgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgctttgaa 380
           ||||||||||| || || || |||||||| ||||| || |  || | |||||||||||||
Sbjct: 311 actgaacaagcgataacaggtctagtcacaccacaggctcttcccaaggcttgctttgaa 252

                                           
Query: 381 gggacaaagacatacggcacattcttgtcctc 412
           || ||||||||||| || |||||||| |||||
Sbjct: 251 ggcacaaagacataaggaacattcttatcctc 220



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 495 agagtcttggtcgcttcgttggctcccttcttgagctgcttgtagtt 541
           |||||||| || ||||| || || |||||||||||||||||||||||
Sbjct: 137 agagtcttcgtagcttcattagcacccttcttgagctgcttgtagtt 91



to top

>gb|AY048213.1| Arabidopsis thaliana AT5g20160/F5O24_50 mRNA, complete cds
          Length = 716

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                       
Query: 321 actgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgctttgaa 380
           ||||||||||| || || || |||||||| ||||| || |  || | |||||||||||||
Sbjct: 404 actgaacaagcgataacaggtctagtcacaccacaggctcttcccaaggcttgctttgaa 345

                                           
Query: 381 gggacaaagacatacggcacattcttgtcctc 412
           || ||||||||||| || |||||||| |||||
Sbjct: 344 ggcacaaagacataaggaacattcttatcctc 313



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 495 agagtcttggtcgcttcgttggctcccttcttgagctgcttgtagtt 541
           |||||||| || ||||| || || |||||||||||||||||||||||
Sbjct: 230 agagtcttcgtagcttcattagcacccttcttgagctgcttgtagtt 184



to top

>gb|AY086996.1| Arabidopsis thaliana clone 30288 mRNA, complete sequence
          Length = 726

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                       
Query: 321 actgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgctttgaa 380
           ||||||||||| || || || |||||||| ||||| || |  || | |||||||||||||
Sbjct: 404 actgaacaagcgataacaggtctagtcacaccacaggctcttcccaaggcttgctttgaa 345

                                           
Query: 381 gggacaaagacatacggcacattcttgtcctc 412
           || ||||||||||| || |||||||| |||||
Sbjct: 344 ggcacaaagacataaggaacattcttatcctc 313



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 495 agagtcttggtcgcttcgttggctcccttcttgagctgcttgtagtt 541
           |||||||| || ||||| || || |||||||||||||||||||||||
Sbjct: 230 agagtcttcgtagcttcattagcacccttcttgagctgcttgtagtt 184



to top

>ref|NM_200312.1| Danio rerio zgc:56066 (zgc:56066), mRNA
          Length = 1751

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 135/170 (79%)
 Strand = Plus / Minus

                                                                       
Query: 384 acaaagacatacggcacattcttgtcctccgcgagcaacgggaggtggaggaggatttcg 443
           ||||| |||||||| || |||||||||||    |||| ||| || || |||| ||| || 
Sbjct: 402 acaaacacatacgggacgttcttgtcctcgcacagcagcggcagatgcaggatgatctcc 343

                                                                       
Query: 444 agcggctccgtgtcagctgccatcaccacgaactccgatattcccctgttgagagtcttg 503
           |||||||| | ||| || |||||||| | |||||| || ||||||| ||| || || || 
Sbjct: 342 agcggctctgcgtcggccgccatcacgatgaactctgagattccccggttcagggtttta 283

                                                             
Query: 504 gtcgcttcgttggctcccttcttgagctgcttgtagttggcggcctgctg 553
           || ||||||||||| || ||| | ||||| ||||| ||||| ||||||||
Sbjct: 282 gtggcttcgttggcccctttcctcagctgtttgtaattggctgcctgctg 233



to top

>ref|XM_757414.1| Ustilago maydis 521 hypothetical protein (UM06360.1) partial mRNA
          Length = 381

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 491 gttgagagtcttggtcgcttcgttggctcccttcttgagctgcttgtagt 540
           |||||| |||||||| || ||||| || ||||||||||||||||||||||
Sbjct: 135 gttgagcgtcttggtggcctcgttagcacccttcttgagctgcttgtagt 86



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 378 gaagggacaaagacatacggcacattcttgtcctc 412
           |||||||||||||| || ||||| |||||||||||
Sbjct: 248 gaagggacaaagacgtaaggcacgttcttgtcctc 214



to top

>ref|XM_505832.1| Yarrowia lipolytica CLIB122, YALI0F24497g predicted mRNA
          Length = 381

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 491 gttgagagtcttggtcgcttcgttggctcccttcttgagctg 532
           |||||| |||||||| || |||||||||||||||||||||||
Sbjct: 135 gttgagggtcttggtggcctcgttggctcccttcttgagctg 94



to top

>gb|BC050495.1| Danio rerio zgc:56066, mRNA (cDNA clone MGC:56066 IMAGE:3820656),
           complete cds
          Length = 1751

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 135/170 (79%)
 Strand = Plus / Minus

                                                                       
Query: 384 acaaagacatacggcacattcttgtcctccgcgagcaacgggaggtggaggaggatttcg 443
           ||||| |||||||| || |||||||||||    |||| ||| || || |||| ||| || 
Sbjct: 402 acaaacacatacgggacgttcttgtcctcgcacagcagcggcagatgcaggatgatctcc 343

                                                                       
Query: 444 agcggctccgtgtcagctgccatcaccacgaactccgatattcccctgttgagagtcttg 503
           |||||||| | ||| || |||||||| | |||||| || ||||||| ||| || || || 
Sbjct: 342 agcggctctgcgtcggccgccatcacgatgaactctgagattccccggttcagggtttta 283

                                                             
Query: 504 gtcgcttcgttggctcccttcttgagctgcttgtagttggcggcctgctg 553
           || ||||||||||| || ||| | ||||| ||||| ||||| ||||||||
Sbjct: 282 gtggcttcgttggcccctttcctcagctgtttgtaattggctgcctgctg 233



to top

>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                         
Query: 491     gttgagagtcttggtcgcttcgttggctcccttcttgagctg 532
               |||||| |||||||| || |||||||||||||||||||||||
Sbjct: 3187548 gttgagggtcttggtggcctcgttggctcccttcttgagctg 3187507



to top

>ref|XM_744631.1| Aspergillus fumigatus Af293 snRNP and snoRNP protein Snu13
           (Afu2g05950) partial mRNA
          Length = 381

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 492 ttgagagtcttggtcgcttcgttggctcccttcttgagctg 532
           |||||||||||||| || |||||||| ||||||||||||||
Sbjct: 134 ttgagagtcttggtagcctcgttggcacccttcttgagctg 94



to top

>dbj|AB226025.1| Aspergillus oryzae cDNA, contig sequence: AoEST2881
          Length = 703

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 492 ttgagagtcttggtcgcttcgttggctcccttcttgagctg 532
           ||||| ||||||||||||||||| ||||||||||| |||||
Sbjct: 207 ttgagtgtcttggtcgcttcgtttgctcccttcttcagctg 167



to top

>dbj|AP007154.1| Aspergillus oryzae RIB40 genomic DNA, SC001
          Length = 2005935

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                        
Query: 492     ttgagagtcttggtcgcttcgttggctcccttcttgagctg 532
               ||||| ||||||||||||||||| ||||||||||| |||||
Sbjct: 1888685 ttgagtgtcttggtcgcttcgtttgctcccttcttcagctg 1888725



to top

>gb|AF296825.1|F5O24 Arabidopsis thaliana BAC F5O24
          Length = 101458

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 71/85 (83%)
 Strand = Plus / Plus

                                                                        
Query: 321  actgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgctttgaa 380
            ||||||||||| || || || |||||||| ||||| || |  || | |||||||||||||
Sbjct: 8653 actgaacaagcgataacaggtctagtcacaccacaggctcttcccaaggcttgctttgaa 8712

                                     
Query: 381  gggacaaagacatacggcacattct 405
            || ||||||||||| || |||||||
Sbjct: 8713 ggcacaaagacataaggaacattct 8737



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 519  cccttcttgagctgcttgtagtt 541
            |||||||||||||||||||||||
Sbjct: 9273 cccttcttgagctgcttgtagtt 9295



to top

>ref|NM_118364.1| Arabidopsis thaliana RNA binding / structural constituent of
           ribosome AT4G22380 mRNA, complete cds
          Length = 387

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 175/224 (78%)
 Strand = Plus / Minus

                                                                       
Query: 318 gtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgcttt 377
           ||||||||||||||||| || || || || |||||||| || |  || |  ||||| || 
Sbjct: 314 gtcactgaacaagcaataacaggtcttgttactccacatgctcttcccaatgcttgtttc 255

                                                                       
Query: 378 gaagggacaaagacatacggcacattcttgtcctccgcgagcaacgggaggtggaggagg 437
           ||||| ||||| ||||| ||||||||||| || || || ||||| || || || || || 
Sbjct: 254 gaaggtacaaacacatatggcacattcttatcttcggcaagcaaaggaagatgaagaaga 195

                                                                       
Query: 438 atttcgagcggctccgtgtcagctgccatcaccacgaactccgatattcccctgttgaga 497
           || || || || || |  ||||| ||||| || |||||||| || ||||| | ||| |  
Sbjct: 194 atctcaagtggttcagcatcagcagccataacaacgaactcagagattccacggttcaat 135

                                                       
Query: 498 gtcttggtcgcttcgttggctcccttcttgagctgcttgtagtt 541
           || ||||| ||||| || ||||||||||| ||||||||||||||
Sbjct: 134 gttttggtagcttcattagctcccttcttaagctgcttgtagtt 91



to top

>gb|BT024580.1| Arabidopsis thaliana At4g22380 mRNA, complete cds
          Length = 387

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 175/224 (78%)
 Strand = Plus / Minus

                                                                       
Query: 318 gtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgcttt 377
           ||||||||||||||||| || || || || |||||||| || |  || |  ||||| || 
Sbjct: 314 gtcactgaacaagcaataacaggtcttgttactccacatgctcttcccaatgcttgtttc 255

                                                                       
Query: 378 gaagggacaaagacatacggcacattcttgtcctccgcgagcaacgggaggtggaggagg 437
           ||||| ||||| ||||| ||||||||||| || || || ||||| || || || || || 
Sbjct: 254 gaaggtacaaacacatatggcacattcttatcttcggcaagcaaaggaagatgaagaaga 195

                                                                       
Query: 438 atttcgagcggctccgtgtcagctgccatcaccacgaactccgatattcccctgttgaga 497
           || || || || || |  ||||| ||||| || |||||||| || ||||| | ||| |  
Sbjct: 194 atctcaagtggttcagcatcagcagccataacaacgaactcagagattccacggttcaat 135

                                                       
Query: 498 gtcttggtcgcttcgttggctcccttcttgagctgcttgtagtt 541
           || ||||| ||||| || ||||||||||| ||||||||||||||
Sbjct: 134 gttttggtagcttcattagctcccttcttaagctgcttgtagtt 91



to top

>gb|AY086674.1| Arabidopsis thaliana clone 2673 mRNA, complete sequence
          Length = 624

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 175/224 (78%)
 Strand = Plus / Minus

                                                                       
Query: 318 gtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgcttt 377
           ||||||||||||||||| || || || || |||||||| || |  || |  ||||| || 
Sbjct: 392 gtcactgaacaagcaataacaggtcttgttactccacatgctcttcccaatgcttgtttc 333

                                                                       
Query: 378 gaagggacaaagacatacggcacattcttgtcctccgcgagcaacgggaggtggaggagg 437
           ||||| ||||| ||||| ||||||||||| || || || ||||| || || || || || 
Sbjct: 332 gaaggtacaaacacatatggcacattcttatcttcggcaagcaaaggaagatgaagaaga 273

                                                                       
Query: 438 atttcgagcggctccgtgtcagctgccatcaccacgaactccgatattcccctgttgaga 497
           || || || || || |  ||||| ||||| || |||||||| || ||||| | ||| |  
Sbjct: 272 atctcaagtggttcagcatcagcagccataacaacgaactcagagattccacggttcaat 213

                                                       
Query: 498 gtcttggtcgcttcgttggctcccttcttgagctgcttgtagtt 541
           || ||||| ||||| || ||||||||||| ||||||||||||||
Sbjct: 212 gttttggtagcttcattagctcccttcttaagctgcttgtagtt 169



to top

>gb|AC160992.2| Mus musculus BAC clone RP23-147I23 from chromosome 9, complete sequence
          Length = 215980

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                         
Query: 459   gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 518
             ||||||||||| | |||||| || || || |||||||| || ||||| ||||| ||||||
Sbjct: 84768 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 84709

                                    
Query: 519   cccttcttgagctgcttgtagtt 541
             || |||   ||||||||||||||
Sbjct: 84708 cctttccgaagctgcttgtagtt 84686



to top

>ref|XM_509501.1| PREDICTED: Pan troglodytes similar to checkpoint with forkhead and
           ring finger domains (LOC452391), mRNA
          Length = 1923

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 78/95 (82%)
 Strand = Plus / Plus

                                                                       
Query: 447 ggctccgtgtcagctgccatcaccacgaactccgatattcccctgttgagagtcttggtc 506
           ||||| ||||| || |||||||| | |||||| || || |||||||| || || ||||| 
Sbjct: 179 ggctcggtgtctgcagccatcacgatgaactcagagatgcccctgttaagggttttggtg 238

                                              
Query: 507 gcttcgttggctcccttcttgagctgcttgtagtt 541
           || ||||||||||  ||||  ||||||||||||||
Sbjct: 239 gcctcgttggctcttttctgaagctgcttgtagtt 273



to top

>ref|XM_956324.1| Neurospora crassa OR74A probable 13 kD U4/U6.U5 snRNP associate
           protein [MIPS] (NCU01331.1) partial mRNA
          Length = 387

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 57/67 (85%)
 Strand = Plus / Minus

                                                                       
Query: 500 cttggtcgcttcgttggctcccttcttgagctgcttgtagttggcggcctgctggacgat 559
           |||||| || |||||||| ||||||||||||||  |||||| |  |||||||||||||  
Sbjct: 132 cttggtggcctcgttggcacccttcttgagctgtctgtagtggctggcctgctggacgca 73

                  
Query: 560 gtcgagg 566
           |||||||
Sbjct: 72  gtcgagg 66



to top

>ref|XM_326823.1| Neurospora crassa OR74A probable 13 kD U4/U6.U5 snRNP associate
           protein [MIPS] (NCU01331.1) partial mRNA
          Length = 387

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 57/67 (85%)
 Strand = Plus / Minus

                                                                       
Query: 500 cttggtcgcttcgttggctcccttcttgagctgcttgtagttggcggcctgctggacgat 559
           |||||| || |||||||| ||||||||||||||  |||||| |  |||||||||||||  
Sbjct: 132 cttggtggcctcgttggcacccttcttgagctgtctgtagtggctggcctgctggacgca 73

                  
Query: 560 gtcgagg 566
           |||||||
Sbjct: 72  gtcgagg 66



to top

>ref|NM_011482.3| Mus musculus NHP2 non-histone chromosome protein 2-like 1 (S.
           cerevisiae) (Nhp2l1), mRNA
          Length = 1259

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 459 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 518
           ||||||||||| | |||||| || || || |||||||| || ||||| ||||| ||||||
Sbjct: 284 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 225

                                  
Query: 519 cccttcttgagctgcttgtagtt 541
           || |||   ||||||||||||||
Sbjct: 224 cctttccgaagctgcttgtagtt 202



to top

>ref|XM_992454.1| PREDICTED: Mus musculus similar to Nhp2 non-histone chromosome
           protein 2-like 1 (LOC434401), mRNA
          Length = 1274

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 459 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 518
           ||||||||||| | |||||| || || || |||||||| || ||||| ||||| ||||||
Sbjct: 283 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 224

                                  
Query: 519 cccttcttgagctgcttgtagtt 541
           || |||   ||||||||||||||
Sbjct: 223 cctttccgaagctgcttgtagtt 201



to top

>ref|XM_486217.4| PREDICTED: Mus musculus similar to Nhp2 non-histone chromosome
           protein 2-like 1 (LOC434401), mRNA
          Length = 1274

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 459 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 518
           ||||||||||| | |||||| || || || |||||||| || ||||| ||||| ||||||
Sbjct: 283 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 224

                                  
Query: 519 cccttcttgagctgcttgtagtt 541
           || |||   ||||||||||||||
Sbjct: 223 cctttccgaagctgcttgtagtt 201



to top

>gb|BC046579.1| Xenopus laevis NHP2 non-histone chromosome protein 2-like 1 (S.
           cerevisiae), mRNA (cDNA clone MGC:53430 IMAGE:5571836),
           complete cds
          Length = 812

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 168/215 (78%)
 Strand = Plus / Minus

                                                                       
Query: 324 gaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgctttgaaggg 383
           ||||||| ||| || |||||||  ||||||||||| |  ||||| || ||||| ||| | 
Sbjct: 393 gaacaagaaatcactggcctagagactccacaagctcttccaagtgcctgcttggaacgc 334

                                                                       
Query: 384 acaaagacatacggcacattcttgtcctccgcgagcaacgggaggtggaggaggatttcg 443
           ||||| ||||| || || |||||||||||    || | ||||||||| || | ||| || 
Sbjct: 333 acaaacacataggggacgttcttgtcctcacataggagcgggaggtgtagaatgatctcc 274

                                                                       
Query: 444 agcggctccgtgtcagctgccatcaccacgaactccgatattcccctgttgagagtcttg 503
           || || || |  ||||||||||| || | |||||| ||||| || ||||| || ||||| 
Sbjct: 273 agaggttctgcatcagctgccatgactatgaactcagatatgcctctgtttagggtcttt 214

                                              
Query: 504 gtcgcttcgttggctcccttcttgagctgcttgta 538
           || ||||||||||| |||||   ||||||||||||
Sbjct: 213 gtagcttcgttggcacccttgcggagctgcttgta 179



to top

>gb|BC083315.1| Mus musculus NHP2 non-histone chromosome protein 2-like 1 (S.
           cerevisiae), mRNA (cDNA clone MGC:101925 IMAGE:5714819),
           complete cds
          Length = 1201

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 459 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 518
           ||||||||||| | |||||| || || || |||||||| || ||||| ||||| ||||||
Sbjct: 204 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 145

                                  
Query: 519 cccttcttgagctgcttgtagtt 541
           || |||   ||||||||||||||
Sbjct: 144 cctttccgaagctgcttgtagtt 122



to top

>gb|BC054450.1| Mus musculus NHP2 non-histone chromosome protein 2-like 1 (S.
           cerevisiae), mRNA (cDNA clone MGC:62619 IMAGE:6491298),
           complete cds
          Length = 1218

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 459 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 518
           ||||||||||| | |||||| || || || |||||||| || ||||| ||||| ||||||
Sbjct: 228 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 169

                                  
Query: 519 cccttcttgagctgcttgtagtt 541
           || |||   ||||||||||||||
Sbjct: 168 cctttccgaagctgcttgtagtt 146



to top

>gb|BC026755.1| Mus musculus NHP2 non-histone chromosome protein 2-like 1 (S.
           cerevisiae), mRNA (cDNA clone MGC:25294 IMAGE:3154066),
           complete cds
          Length = 1226

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 459 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 518
           ||||||||||| | |||||| || || || |||||||| || ||||| ||||| ||||||
Sbjct: 228 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 169

                                  
Query: 519 cccttcttgagctgcttgtagtt 541
           || |||   ||||||||||||||
Sbjct: 168 cctttccgaagctgcttgtagtt 146



to top

>gb|BC058493.1| Rattus norvegicus similar to NHP2-like protein 1 (High mobility
           group-like nuclear protein 2 homolog 1) ([U4/U6.U5]
           tri-snRNP 15.5 kDa protein) (OTK27), mRNA (cDNA clone
           MGC:72932 IMAGE:6887059), complete cds
          Length = 635

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 459 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 518
           ||||||||||| | |||||| || || || |||||||| || ||||| ||||| ||||||
Sbjct: 287 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 228

                                  
Query: 519 cccttcttgagctgcttgtagtt 541
           || |||   ||||||||||||||
Sbjct: 227 cctttccgaagctgcttgtagtt 205



to top

>emb|AL451017.1|NC12F11 Neurospora crassa DNA linkage group V Cosmid contig 12F11
          Length = 74317

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                         
Query: 500   cttggtcgcttcgttggctcccttcttgagctgcttgtagttggcggcctgctggacgat 559
             |||||| || |||||||| ||||||||||||||  |||||| |  |||||||||||||  
Sbjct: 35066 cttggtggcctcgttggcacccttcttgagctgtctgtagtggctggcctgctggacgca 35125

                    
Query: 560   gtcgagg 566
             |||||||
Sbjct: 35126 gtcgagg 35132



to top

>dbj|AK134943.1| Mus musculus adult male olfactory brain cDNA, RIKEN full-length
           enriched library, clone:6430523H23 product:sperm
           specific antigen 1, full insert sequence
          Length = 1763

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 459 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 518
           ||||||||||| | |||||| || || || |||||||| || ||||| ||||| ||||||
Sbjct: 220 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 161

                                  
Query: 519 cccttcttgagctgcttgtagtt 541
           || |||   ||||||||||||||
Sbjct: 160 cctttccgaagctgcttgtagtt 138



to top

>dbj|AK145391.1| Mus musculus morula whole body morula cDNA, RIKEN full-length
           enriched library, clone:I0C0032L12 product:sperm
           specific antigen 1, full insert sequence
          Length = 1259

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 459 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 518
           ||||||||||| | |||||| || || || |||||||| || ||||| ||||| ||||||
Sbjct: 284 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 225

                                  
Query: 519 cccttcttgagctgcttgtagtt 541
           || |||   ||||||||||||||
Sbjct: 224 cctttccgaagctgcttgtagtt 202



to top

>dbj|AK145608.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0021G14 product:sperm specific antigen
           1, full insert sequence
          Length = 1244

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 459 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 518
           ||||||||||| | |||||| || || || |||||||| || ||||| ||||| ||||||
Sbjct: 264 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 205

                                  
Query: 519 cccttcttgagctgcttgtagtt 541
           || |||   ||||||||||||||
Sbjct: 204 cctttccgaagctgcttgtagtt 182



to top

>dbj|AK168930.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched
           library, clone:I920065L05 product:sperm specific antigen
           1, full insert sequence
          Length = 1210

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 459 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 518
           ||||||||||| | |||||| || || || |||||||| || ||||| ||||| ||||||
Sbjct: 235 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 176

                                  
Query: 519 cccttcttgagctgcttgtagtt 541
           || |||   ||||||||||||||
Sbjct: 175 cctttccgaagctgcttgtagtt 153



to top

>dbj|AK168808.1| Mus musculus 17 days embryo stomach cDNA, RIKEN full-length
           enriched library, clone:I920056H18 product:NHP2-like
           protein 1 (High mobility group-like nuclear protein 2
           homolog 1) ([U4/U6.U5] tri-snRNP 15.5 kDa protein)
           (OTK27) homolog [Homo sapiens], full insert sequence
          Length = 836

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 459 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 518
           ||||||||||| | |||||| || || || |||||||| || ||||| ||||| ||||||
Sbjct: 252 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 193

                                  
Query: 519 cccttcttgagctgcttgtagtt 541
           || |||   ||||||||||||||
Sbjct: 192 cctttccgaagctgcttgtagtt 170



to top

>dbj|AK169103.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched
           library, clone:I920080B21 product:sperm specific antigen
           1, full insert sequence
          Length = 1247

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 459 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 518
           ||||||||||| | |||||| || || || |||||||| || ||||| ||||| ||||||
Sbjct: 266 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 207

                                  
Query: 519 cccttcttgagctgcttgtagtt 541
           || |||   ||||||||||||||
Sbjct: 206 cctttccgaagctgcttgtagtt 184



to top

>gb|AC153579.10| Mus musculus 6 BAC RP23-21F2 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 228481

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                         
Query: 459   gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 518
             ||||||||||| | |||||| || || || ||||||||||| ||| | |||||  |||||
Sbjct: 83437 gctgccatcacaatgaactcagagatgcctctgttgagagttttgctggcttcactggct 83378

                                    
Query: 519   cccttcttgagctgcttgtagtt 541
             || ||||  ||||||||||||||
Sbjct: 83377 cctttctgaagctgcttgtagtt 83355



to top

>gb|AC156559.3| Mus musculus BAC clone RP24-421K17 from chromosome 13, complete
             sequence
          Length = 151183

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                         
Query: 459   gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 518
             |||||| |||| | |||||| || || || ||||||||||| ||||| ||||| ||||||
Sbjct: 65709 gctgccttcacaatgaactcagagatgcctctgttgagagttttggtggcttcattggct 65768

                                    
Query: 519   cccttcttgagctgcttgtagtt 541
             || ||||  |||| |||||||||
Sbjct: 65769 cctttctgaagcttcttgtagtt 65791



to top

>dbj|AK004489.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1190005A22 product:sperm
           specific antigen 1, full insert sequence
          Length = 1210

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 459 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 518
           ||||||||||| | |||||| || || || |||||||| || ||||| ||||| ||||||
Sbjct: 230 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 171

                                  
Query: 519 cccttcttgagctgcttgtagtt 541
           || |||   ||||||||||||||
Sbjct: 170 cctttccgaagctgcttgtagtt 148



to top

>gb|AC127070.10| Homo sapiens 12 BAC RP11-46H11 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 181012

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 78/95 (82%)
 Strand = Plus / Plus

                                                                         
Query: 447   ggctccgtgtcagctgccatcaccacgaactccgatattcccctgttgagagtcttggtc 506
             ||||| ||||| || |||||||| | |||||| || || |||||||| || || ||||| 
Sbjct: 49648 ggctcggtgtctgcagccatcacgatgaactcagagatgcccctgttaagggttttggtg 49707

                                                
Query: 507   gcttcgttggctcccttcttgagctgcttgtagtt 541
             || ||||||||||  ||||  ||||||||||||||
Sbjct: 49708 gcctcgttggctcttttctgaagctgcttgtagtt 49742



to top

>emb|CT030635.8| Mouse DNA sequence from clone RP23-94N7 on chromosome 9, complete
              sequence
          Length = 228508

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                          
Query: 459    gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 518
              ||||||||||| | |||||| || || || |||||||| || ||||| ||||| ||||||
Sbjct: 209844 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 209785

                                     
Query: 519    cccttcttgagctgcttgtagtt 541
              || |||   ||||||||||||||
Sbjct: 209784 cctttccgaagctgcttgtagtt 209762



to top

>ref|NM_212515.1| Rattus norvegicus similar to NHP2-like protein 1 (High mobility
           group-like nuclear protein 2 homolog 1) ([U4/U6.U5]
           tri-snRNP 15.5 kDa protein) (OTK27) (MGC72932), mRNA
          Length = 635

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 459 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 518
           ||||||||||| | |||||| || || || |||||||| || ||||| ||||| ||||||
Sbjct: 287 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 228

                                  
Query: 519 cccttcttgagctgcttgtagtt 541
           || |||   ||||||||||||||
Sbjct: 227 cctttccgaagctgcttgtagtt 205



to top

>gb|BC061279.1| Xenopus tropicalis hypothetical protein MGC75724, mRNA (cDNA clone
           MGC:75724 IMAGE:5380980), complete cds
          Length = 848

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 77/94 (81%)
 Strand = Plus / Minus

                                                                       
Query: 316 tggtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgct 375
           |||| |||| ||||||||| || |||||||  ||||||||||| |  ||||| |||||||
Sbjct: 421 tggtgactgcacaagcaatcactggcctagagactccacaagctcttccaagtgcttgct 362

                                             
Query: 376 ttgaagggacaaagacatacggcacattcttgtc 409
           | ||  | ||||| ||||| || |||||||||||
Sbjct: 361 tggagcgcacaaacacataggggacattcttgtc 328



to top

>gb|BC066453.1| Danio rerio zgc:56066, mRNA (cDNA clone MGC:77417 IMAGE:6970302),
           complete cds
          Length = 1786

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 89/110 (80%)
 Strand = Plus / Minus

                                                                       
Query: 444 agcggctccgtgtcagctgccatcaccacgaactccgatattcccctgttgagagtcttg 503
           |||||||| | ||| || |||||||| | |||||| || ||||||| ||| || || || 
Sbjct: 334 agcggctctgcgtcggccgccatcacgatgaactctgagattccccggttcagggtttta 275

                                                             
Query: 504 gtcgcttcgttggctcccttcttgagctgcttgtagttggcggcctgctg 553
           || ||||||||||| || ||| | ||||| ||||| ||||| ||||||||
Sbjct: 274 gtggcttcgttggcccctttcctcagctgtttgtaattggctgcctgctg 225



to top

>ref|XM_365765.1| Magnaporthe grisea 70-15 hypothetical protein (MG02467.4) partial
           mRNA
          Length = 381

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 495 agagtcttggtcgcttcgttggctcccttcttgagctg 532
           ||||||||||| || ||||||||||||||||| |||||
Sbjct: 131 agagtcttggtagcctcgttggctcccttcttcagctg 94



to top

>ref|XM_860169.1| PREDICTED: Canis familiaris similar to NHP2-like protein 1 (High
           mobility group-like nuclear protein 2 homolog 1)
           ([U4/U6.U5] tri-snRNP 15.5 kDa protein) (Sperm specific
           antigen 1) (Fertilization antigen 1) (FA-1), transcript
           variant 2 (LOC609886), mRNA
          Length = 1394

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 170/218 (77%)
 Strand = Plus / Minus

                                                                       
Query: 324 gaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgctttgaaggg 383
           ||||| |||||||| ||||| | ||| ||||| || ||||| ||||| ||||| ||  | 
Sbjct: 350 gaacaggcaatgacaggcctggacaccccacaggcccgcccgagggcctgcttggagcgc 291

                                                                       
Query: 384 acaaagacatacggcacattcttgtcctccgcgagcaacgggaggtggaggaggatttcg 443
           ||||| || || ||||| ||||| || ||    |||| ||| ||||| |||| |||||| 
Sbjct: 290 acaaacacgtagggcacgttcttatcttcacacagcagcggaaggtgcaggatgatttcc 231

                                                                       
Query: 444 agcggctccgtgtcagctgccatcaccacgaactccgatattcccctgttgagagtcttg 503
           || ||||  | ||| || |||||||| | |||||| || || || |||||||| || || 
Sbjct: 230 agaggcttagcgtctgcagccatcacgatgaactcagagatgcctctgttgagggtttta 171

                                                 
Query: 504 gtcgcttcgttggctcccttcttgagctgcttgtagtt 541
           || |||||||||||||| |||   ||||||||||||||
Sbjct: 170 gtggcttcgttggctcctttccgaagctgcttgtagtt 133



to top

>ref|XM_847115.1| PREDICTED: Canis familiaris similar to NHP2-like protein 1 (High
           mobility group-like nuclear protein 2 homolog 1)
           ([U4/U6.U5] tri-snRNP 15.5 kDa protein) (Sperm specific
           antigen 1) (Fertilization antigen 1) (FA-1), transcript
           variant 1 (LOC609886), mRNA
          Length = 735

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 170/218 (77%)
 Strand = Plus / Minus

                                                                       
Query: 324 gaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgctttgaaggg 383
           ||||| |||||||| ||||| | ||| ||||| || ||||| ||||| ||||| ||  | 
Sbjct: 322 gaacaggcaatgacaggcctggacaccccacaggcccgcccgagggcctgcttggagcgc 263

                                                                       
Query: 384 acaaagacatacggcacattcttgtcctccgcgagcaacgggaggtggaggaggatttcg 443
           ||||| || || ||||| ||||| || ||    |||| ||| ||||| |||| |||||| 
Sbjct: 262 acaaacacgtagggcacgttcttatcttcacacagcagcggaaggtgcaggatgatttcc 203

                                                                       
Query: 444 agcggctccgtgtcagctgccatcaccacgaactccgatattcccctgttgagagtcttg 503
           || ||||  | ||| || |||||||| | |||||| || || || |||||||| || || 
Sbjct: 202 agaggcttagcgtctgcagccatcacgatgaactcagagatgcctctgttgagggtttta 143

                                                 
Query: 504 gtcgcttcgttggctcccttcttgagctgcttgtagtt 541
           || |||||||||||||| |||   ||||||||||||||
Sbjct: 142 gtggcttcgttggctcctttccgaagctgcttgtagtt 105



to top

>ref|XR_004088.1| PREDICTED: Mus musculus similar to Nhp2 non-histone chromosome
           protein 2-like 1 (LOC636276), mRNA
          Length = 1155

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 68/82 (82%)
 Strand = Plus / Minus

                                                                       
Query: 460 ctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctc 519
           |||||||||| | |||||| || || || |||||||| || ||||| ||||| |||||||
Sbjct: 172 ctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggctc 113

                                 
Query: 520 ccttcttgagctgcttgtagtt 541
           | |||   ||||||||||||||
Sbjct: 112 ctttccgaagctgcttgtagtt 91



to top

>emb|AL161557.2|ATCHRIV57 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 57
          Length = 199577

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 71/86 (82%)
 Strand = Plus / Plus

                                                                         
Query: 456   tcagctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttg 515
             ||||| ||||| || |||||||| || ||||| | ||| |  || ||||| ||||| || 
Sbjct: 49454 tcagcagccataacaacgaactcagagattccacggttcaatgttttggtagcttcatta 49513

                                       
Query: 516   gctcccttcttgagctgcttgtagtt 541
             ||||||||||| ||||||||||||||
Sbjct: 49514 gctcccttcttaagctgcttgtagtt 49539



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 71/88 (80%)
 Strand = Plus / Plus

                                                                         
Query: 318   gtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgcttt 377
             ||||||||||||||||| || || || || |||||||| || |  || |  ||||| || 
Sbjct: 48821 gtcactgaacaagcaataacaggtcttgttactccacatgctcttcccaatgcttgtttc 48880

                                         
Query: 378   gaagggacaaagacatacggcacattct 405
             ||||| ||||| ||||| ||||||||||
Sbjct: 48881 gaaggtacaaacacatatggcacattct 48908



to top

>emb|AL033545.2|ATF7K2 Arabidopsis thaliana DNA chromosome 4, BAC clone F7K2 (ESSA
           project)
          Length = 106702

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 71/86 (82%)
 Strand = Plus / Plus

                                                                       
Query: 456 tcagctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttg 515
           ||||| ||||| || |||||||| || ||||| | ||| |  || ||||| ||||| || 
Sbjct: 646 tcagcagccataacaacgaactcagagattccacggttcaatgttttggtagcttcatta 705

                                     
Query: 516 gctcccttcttgagctgcttgtagtt 541
           ||||||||||| ||||||||||||||
Sbjct: 706 gctcccttcttaagctgcttgtagtt 731



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 71/88 (80%)
 Strand = Plus / Plus

                                                                       
Query: 318 gtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgcttt 377
           ||||||||||||||||| || || || || |||||||| || |  || |  ||||| || 
Sbjct: 13  gtcactgaacaagcaataacaggtcttgttactccacatgctcttcccaatgcttgtttc 72

                                       
Query: 378 gaagggacaaagacatacggcacattct 405
           ||||| ||||| ||||| ||||||||||
Sbjct: 73  gaaggtacaaacacatatggcacattct 100



to top

>ref|XM_697178.1| PREDICTED: Danio rerio hypothetical protein LOC554671 (LOC554671),
           mRNA
          Length = 1702

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 89/110 (80%)
 Strand = Plus / Minus

                                                                       
Query: 444 agcggctccgtgtcagctgccatcaccacgaactccgatattcccctgttgagagtcttg 503
           |||||||| | ||| || |||||||| | |||||| || ||||||| ||| || || || 
Sbjct: 332 agcggctctgcgtcggccgccatcacgatgaactctgagattccccggttcagggtttta 273

                                                             
Query: 504 gtcgcttcgttggctcccttcttgagctgcttgtagttggcggcctgctg 553
           || ||||||||||| || ||| | ||||| ||||| ||||| ||||||||
Sbjct: 272 gtggcttcgttggcccctttcctcagctgtttgtaattggctgcctgctg 223



to top

>ref|NM_203663.1| Xenopus tropicalis hypothetical protein MGC75724 (MGC75724), mRNA
          Length = 848

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 77/94 (81%)
 Strand = Plus / Minus

                                                                       
Query: 316 tggtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgct 375
           |||| |||| ||||||||| || |||||||  ||||||||||| |  ||||| |||||||
Sbjct: 421 tggtgactgcacaagcaatcactggcctagagactccacaagctcttccaagtgcttgct 362

                                             
Query: 376 ttgaagggacaaagacatacggcacattcttgtc 409
           | ||  | ||||| ||||| || |||||||||||
Sbjct: 361 tggagcgcacaaacacataggggacattcttgtc 328



to top

>emb|CR760372.2| Xenopus tropicalis finished cDNA, clone TNeu005n20
          Length = 789

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 77/94 (81%)
 Strand = Plus / Minus

                                                                       
Query: 316 tggtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgct 375
           |||| |||| ||||||||| || |||||||  ||||||||||| |  ||||| |||||||
Sbjct: 377 tggtgactgcacaagcaatcactggcctagagactccacaagctcttccaagtgcttgct 318

                                             
Query: 376 ttgaagggacaaagacatacggcacattcttgtc 409
           | ||  | ||||| ||||| || |||||||||||
Sbjct: 317 tggagcgcacaaacacataggggacattcttgtc 284



to top

>emb|CR761482.2| Xenopus tropicalis finished cDNA, clone TGas123b15
          Length = 808

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 77/94 (81%)
 Strand = Plus / Minus

                                                                       
Query: 316 tggtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgct 375
           |||| |||| ||||||||| || |||||||  ||||||||||| |  ||||| |||||||
Sbjct: 377 tggtgactgcacaagcaatcactggcctagagactccacaagctcttccaagtgcttgct 318

                                             
Query: 376 ttgaagggacaaagacatacggcacattcttgtc 409
           | ||  | ||||| ||||| || |||||||||||
Sbjct: 317 tggagcgcacaaacacataggggacattcttgtc 284



to top

>emb|AL929165.9| Mouse DNA sequence from clone RP23-446D4 on chromosome 2, complete
             sequence
          Length = 181326

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 68/82 (82%)
 Strand = Plus / Plus

                                                                         
Query: 460   ctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctc 519
             |||||||||| | |||||| || || || |||||||| || ||||| ||||| |||||||
Sbjct: 39855 ctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggctc 39914

                                   
Query: 520   ccttcttgagctgcttgtagtt 541
             | |||   ||||||||||||||
Sbjct: 39915 ctttccgaagctgcttgtagtt 39936



to top

>ref|NM_117330.2| Arabidopsis thaliana RNA binding / structural constituent of
           ribosome AT4G12600 mRNA, complete cds
          Length = 754

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 363 ccaagggcttgctttgaagggacaaagacatacggcacattctt 406
           ||||||||||| || || || ||||| |||||||||||||||||
Sbjct: 363 ccaagggcttgtttcgatggcacaaacacatacggcacattctt 320



to top

>gb|AF361618.1| Arabidopsis thaliana AT4g12600/T1P17_190 mRNA, complete cds
          Length = 679

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 363 ccaagggcttgctttgaagggacaaagacatacggcacattctt 406
           ||||||||||| || || || ||||| |||||||||||||||||
Sbjct: 339 ccaagggcttgtttcgatggcacaaacacatacggcacattctt 296



to top

>gb|AY055095.1| Arabidopsis thaliana AT4g12600/T1P17_190 mRNA, complete cds
          Length = 387

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 363 ccaagggcttgctttgaagggacaaagacatacggcacattctt 406
           ||||||||||| || || || ||||| |||||||||||||||||
Sbjct: 269 ccaagggcttgtttcgatggcacaaacacatacggcacattctt 226



to top

>gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome V,
              complete sequence
          Length = 1519138

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                              
Query: 495    agagtcttggtcgcttcgttggctcccttctt 526
              |||||||||||||| |||||||| ||||||||
Sbjct: 497967 agagtcttggtcgcctcgttggcacccttctt 497936



to top

>gb|AY087261.1| Arabidopsis thaliana clone 33381 mRNA, complete sequence
          Length = 715

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 363 ccaagggcttgctttgaagggacaaagacatacggcacattctt 406
           ||||||||||| || || || ||||| |||||||||||||||||
Sbjct: 363 ccaagggcttgtttcgatggcacaaacacatacggcacattctt 320



to top

>ref|NM_210145.1| Eremothecium gossypii AEL070Wp (AEL070W), mRNA
          Length = 384

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 495 agagtcttggtcgcttcgttggctcccttctt 526
           |||||||||||||| |||||||| ||||||||
Sbjct: 134 agagtcttggtcgcctcgttggcacccttctt 103



to top

>ref|XM_924350.2| PREDICTED: Mus musculus similar to Nhp2 non-histone chromosome
           protein 2-like 1, transcript variant 2 (LOC637555), mRNA
          Length = 1274

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                       
Query: 459 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 518
           ||||||||||| |  ||||| || || || |||||||| || ||||| ||||| ||||||
Sbjct: 282 gctgccatcacaattaactcagagatgcctctgttgagggttttggtggcttcattggct 223

                                  
Query: 519 cccttcttgagctgcttgtagtt 541
           || |||   ||||||||||||||
Sbjct: 222 cctttccgaagctgcttgtagtt 200



to top

>ref|XR_004053.1| PREDICTED: Mus musculus similar to Nhp2 non-histone chromosome
           protein 2-like 1 (LOC672066), mRNA
          Length = 836

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                       
Query: 459 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 518
           ||||||||||| | |||||| || || || |||||| | || ||||| ||||| ||||||
Sbjct: 173 gctgccatcacaatgaactcagagatgcctctgttgggggttttggtggcttcattggct 114

                                  
Query: 519 cccttcttgagctgcttgtagtt 541
           || |||   ||||||||||||||
Sbjct: 113 cctttccgaagctgcttgtagtt 91



to top

>ref|XM_001003565.1| PREDICTED: Mus musculus similar to Nhp2 non-histone chromosome
           protein 2-like 1 (LOC667539), mRNA
          Length = 897

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                       
Query: 459 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 518
           ||||||||||| | |||||| || || || |||||| | || ||||| ||||| ||||||
Sbjct: 173 gctgccatcacaatgaactcagagatgcctctgttgggggttttggtggcttcattggct 114

                                  
Query: 519 cccttcttgagctgcttgtagtt 541
           || |||   ||||||||||||||
Sbjct: 113 cctttccgaagctgcttgtagtt 91



to top

>ref|XM_910204.2| PREDICTED: Mus musculus similar to Nhp2 non-histone chromosome
           protein 2-like 1 (LOC633304), mRNA
          Length = 897

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                       
Query: 459 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 518
           ||||||||||| | |||||| || || || |||||| | || ||||| ||||| ||||||
Sbjct: 173 gctgccatcacaatgaactcagagatgcctctgttgggggttttggtggcttcattggct 114

                                  
Query: 519 cccttcttgagctgcttgtagtt 541
           || |||   ||||||||||||||
Sbjct: 113 cctttccgaagctgcttgtagtt 91



to top

>ref|XM_799370.1| Trypanosoma cruzi strain CL Brener ribosomal protein S6
           (Tc00.1047053509943.30) partial mRNA
          Length = 381

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 378 gaagggacaaagacatacggcacattcttgtcctc 412
           ||||| ||||| ||||||||||| |||||||||||
Sbjct: 251 gaaggcacaaaaacatacggcacgttcttgtcctc 217



to top

>gb|AC133193.3| Mus musculus BAC clone RP23-396L1 from chromosome 2, complete sequence
          Length = 180931

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                         
Query: 459   gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 518
             ||||||||||| | |||||| || || || |||||| | || ||||| ||||| ||||||
Sbjct: 64064 gctgccatcacaatgaactcagagatgcctctgttgggggttttggtggcttcattggct 64005

                                    
Query: 519   cccttcttgagctgcttgtagtt 541
             || |||   ||||||||||||||
Sbjct: 64004 cctttccgaagctgcttgtagtt 63982



to top

>ref|XM_815179.1| Trypanosoma cruzi strain CL Brener ribosomal protein S6
           (Tc00.1047053508277.120) partial mRNA
          Length = 381

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 378 gaagggacaaagacatacggcacattcttgtcctc 412
           ||||| ||||| ||||||||||| |||||||||||
Sbjct: 251 gaaggcacaaaaacatacggcacgttcttgtcctc 217



to top

>ref|XM_970157.1| PREDICTED: Tribolium castaneum similar to Nhp2 non-histone
           chromosome protein 2-like 1 (LOC664143), mRNA
          Length = 405

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                       
Query: 327 caagcaatgaccggcctagtcactccacaagcacgcccaagggcttgctttgaagggaca 386
           ||||||||||||| ||| |  || |||||||| ||||| || || || || ||  |||| 
Sbjct: 323 caagcaatgaccgaccttgagacgccacaagcgcgccccagtgcctgtttcgagcggacg 264

                                  
Query: 387 aagacatacggcacattcttgtc 409
           || ||||||||||||||||||||
Sbjct: 263 aaaacatacggcacattcttgtc 241



to top

>emb|AL161534.2|ATCHRIV34 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 34
          Length = 196107

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                         
Query: 363    ccaagggcttgctttgaagggacaaagacatacggcacattct 405
              ||||||||||| || || || ||||| ||||||||||||||||
Sbjct: 126217 ccaagggcttgtttcgatggcacaaacacatacggcacattct 126175



to top

>emb|AL049730.2|ATT1P17 Arabidopsis thaliana DNA chromosome 4, BAC clone T1P17 (ESSA project)
          Length = 137519

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                         
Query: 363    ccaagggcttgctttgaagggacaaagacatacggcacattct 405
              ||||||||||| || || || ||||| ||||||||||||||||
Sbjct: 121685 ccaagggcttgtttcgatggcacaaacacatacggcacattct 121643



to top

>ref|XM_345321.2| PREDICTED: Rattus norvegicus similar to NHP2-like protein 1 (High
           mobility group-like nuclear protein 2 homolog 1)
           ([U4/U6.U5] tri-snRNP 15.5 kDa protein) (Sperm specific
           antigen 1) (Fertilization antigen 1) (FA-1) (LOC365987),
           mRNA
          Length = 543

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                       
Query: 459 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 518
           ||||||||||| | |||||| || |  || |||||||| || ||||| ||||| ||||||
Sbjct: 380 gctgccatcacaatgaactcagagacacctctgttgagggttttggtggcttcattggct 321

                                  
Query: 519 cccttcttgagctgcttgtagtt 541
           || |||   ||||||||||||||
Sbjct: 320 cctttccgaagctgcttgtagtt 298



to top

>emb|BX284624.4| Mouse DNA sequence from clone RP23-299A2 on chromosome 2, complete
              sequence
          Length = 209836

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 68/83 (81%)
 Strand = Plus / Plus

                                                                          
Query: 459    gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 518
              ||||||||||| | |||||| || || || |||||| | || ||||| ||||| ||||||
Sbjct: 188827 gctgccatcacaatgaactcagagatgcctctgttgggggttttggtggcttcattggct 188886

                                     
Query: 519    cccttcttgagctgcttgtagtt 541
              || |||   ||||||||||||||
Sbjct: 188887 cctttccgaagctgcttgtagtt 188909



to top

>ref|XM_515161.1| PREDICTED: Pan troglodytes similar to NHP2-like protein 1 (High
           mobility group-like nuclear protein 2 homolog 1)
           ([U4/U6.U5] tri-snRNP 15.5 kDa protein) (Sperm specific
           antigen 1) (Fertilization antigen 1) (FA-1) (LOC458869),
           mRNA
          Length = 912

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 115/146 (78%)
 Strand = Plus / Minus

                                                                       
Query: 396 ggcacattcttgtcctccgcgagcaacgggaggtggaggaggatttcgagcggctccgtg 455
           |||||||||||||| ||    |||| ||||||||| || | ||| || || ||||| | |
Sbjct: 629 ggcacattcttgtcttcacacagcagcgggaggtgcagaatgatctccagtggctcggcg 570

                                                                       
Query: 456 tcagctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttg 515
           || || |||||||| | |||||| || || ||||||||||| || ||||| || || |||
Sbjct: 569 tctgcagccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattg 510

                                     
Query: 516 gctcccttcttgagctgcttgtagtt 541
           ||||| |||   |||||||| |||||
Sbjct: 509 gctcctttccgaagctgcttatagtt 484



to top

>gb|DQ214255.1| Taeniopygia guttata clone 0061P0016A06 NHP2 non-histone chromosome
           protein 2-like 1-like mRNA, complete sequence
          Length = 1118

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 124/158 (78%)
 Strand = Plus / Minus

                                                                       
Query: 366 agggcttgctttgaagggacaaagacatacggcacattcttgtcctccgcgagcaacggg 425
           ||||||||||| ||  | ||||| ||||| || || |||||||||||   ||| |  |||
Sbjct: 296 agggcttgcttggagcgcacaaacacatagggtacgttcttgtcctcgcagagaagaggg 237

                                                                       
Query: 426 aggtggaggaggatttcgagcggctccgtgtcagctgccatcaccacgaactccgatatt 485
           ||||| |||| ||| || |  |||||||  || ||||||||||| | |||||| | ||| 
Sbjct: 236 aggtgcaggatgatctccaagggctccgcatctgctgccatcacaatgaactctgctatc 177

                                                 
Query: 486 cccctgttgagagtcttggtcgcttcgttggctccctt 523
           || ||||| || || ||||| ||||| |||||||||||
Sbjct: 176 cctctgttcagtgttttggtggcttcattggctccctt 139



to top

>ref|XM_001005500.1| PREDICTED: Mus musculus similar to Nhp2 non-histone chromosome
           protein 2-like 1 (LOC626361), mRNA
          Length = 1229

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 67/82 (81%)
 Strand = Plus / Minus

                                                                       
Query: 460 ctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctc 519
           |||| ||||| | |||||| || || || |||||||| || ||||| ||||| |||||||
Sbjct: 237 ctgctatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggctc 178

                                 
Query: 520 ccttcttgagctgcttgtagtt 541
           | |||   ||||||||||||||
Sbjct: 177 ctttccgaagctgcttgtagtt 156



to top

>ref|XM_904370.2| PREDICTED: Mus musculus similar to Nhp2 non-histone chromosome
           protein 2-like 1 (LOC630757), mRNA
          Length = 1228

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 67/82 (81%)
 Strand = Plus / Minus

                                                                       
Query: 460 ctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctc 519
           |||| ||||| | |||||| || || || |||||||| || ||||| ||||| |||||||
Sbjct: 237 ctgctatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggctc 178

                                 
Query: 520 ccttcttgagctgcttgtagtt 541
           | |||   ||||||||||||||
Sbjct: 177 ctttccgaagctgcttgtagtt 156



to top

>ref|XM_973339.1| PREDICTED: Mus musculus similar to Nhp2 non-histone chromosome
           protein 2-like 1 (LOC630757), mRNA
          Length = 1228

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 67/82 (81%)
 Strand = Plus / Minus

                                                                       
Query: 460 ctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctc 519
           |||| ||||| | |||||| || || || |||||||| || ||||| ||||| |||||||
Sbjct: 237 ctgctatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggctc 178

                                 
Query: 520 ccttcttgagctgcttgtagtt 541
           | |||   ||||||||||||||
Sbjct: 177 ctttccgaagctgcttgtagtt 156



to top

>gb|AC124909.3| Equus caballus clone CH241-91H15, complete sequence
          Length = 171421

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 120   cataacagtcttgcaaaatata 141
             ||||||||||||||||||||||
Sbjct: 32531 cataacagtcttgcaaaatata 32552



to top

>ref|XM_317299.2| Anopheles gambiae str. PEST ENSANGP00000010500
           (ENSANGG00000008011), partial mRNA
          Length = 384

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 79/98 (80%)
 Strand = Plus / Minus

                                                                       
Query: 384 acaaagacatacggcacattcttgtcctccgcgagcaacgggaggtggaggaggatttcg 443
           ||||| || ||||||||||||||||||||    |||| ||| || || || | |||||||
Sbjct: 245 acaaacacgtacggcacattcttgtcctcgcacagcagcggaagatgcagaatgatttcg 186

                                                 
Query: 444 agcggctccgtgtcagctgccatcaccacgaactccga 481
           | ||||||||  || || |||||||| | |||||||||
Sbjct: 185 atcggctccgcatccgccgccatcacgatgaactccga 148



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 528 agctgcttgtagttggcggcctgctgga 555
           ||||||||||||||| | ||||||||||
Sbjct: 101 agctgcttgtagttgaccgcctgctgga 74



to top

>emb|CR556713.11| Zebrafish DNA sequence from clone DKEY-28O14 in linkage group 11,
              complete sequence
          Length = 229692

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 195    ctgaaaaactgtgtcacacgag 216
              ||||||||||||||||||||||
Sbjct: 101736 ctgaaaaactgtgtcacacgag 101757



to top

>emb|CT030166.8| Mouse DNA sequence from clone RP23-320I11 on chromosome 13, complete
              sequence
          Length = 222942

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 67/82 (81%)
 Strand = Plus / Minus

                                                                          
Query: 460    ctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctc 519
              |||| ||||| | |||||| || || || |||||||| || ||||| ||||| |||||||
Sbjct: 176812 ctgctatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggctc 176753

                                    
Query: 520    ccttcttgagctgcttgtagtt 541
              | |||   ||||||||||||||
Sbjct: 176752 ctttccgaagctgcttgtagtt 176731



to top

>gb|DP000020.1| Equus caballus target 1 genomic scaffold
          Length = 1907055

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 120     cataacagtcttgcaaaatata 141
               ||||||||||||||||||||||
Sbjct: 1045999 cataacagtcttgcaaaatata 1046020



to top

>ref|XM_416225.1| PREDICTED: Gallus gallus similar to NHP2-like protein 1 (High
           mobility group-like nuclear protein 2 homolog 1)
           ([U4/U6.U5] tri-snRNP 15.5 kDa protein) (Sperm specific
           antigen 1) (Fertilization antigen 1) (FA-1) (LOC417986),
           mRNA
          Length = 782

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 66/81 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| | |||||| | ||| || || ||||| |||||||||||||| 
Sbjct: 233 gccatcacgatgaactctgctattcctcggttcagtgttttggtggcttcgttggctcct 174

                                
Query: 522 ttcttgagctgcttgtagttg 542
           ||    |||||||||||||||
Sbjct: 173 ttgcgtagctgcttgtagttg 153



to top

>ref|XM_976843.1| PREDICTED: Mus musculus hypothetical LOC544888 (LOC544888), mRNA
          Length = 1406

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 454 tgtcagctgccatcaccacga 474
           |||||||||||||||||||||
Sbjct: 191 tgtcagctgccatcaccacga 171



to top

>ref|XM_909635.2| PREDICTED: Mus musculus hypothetical LOC544888 (LOC544888), mRNA
          Length = 1406

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 454 tgtcagctgccatcaccacga 474
           |||||||||||||||||||||
Sbjct: 191 tgtcagctgccatcaccacga 171



to top

>ref|XM_619025.3| PREDICTED: Mus musculus hypothetical LOC544888 (LOC544888), mRNA
          Length = 1406

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 454 tgtcagctgccatcaccacga 474
           |||||||||||||||||||||
Sbjct: 191 tgtcagctgccatcaccacga 171



to top

>gb|DQ014842.1| Uncultured bacterium clone M1_d03_3 16S ribosomal RNA gene, partial
           sequence
          Length = 1341

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 542 ggcggcctgctggacgatgtc 562
           |||||||||||||||||||||
Sbjct: 693 ggcggcctgctggacgatgtc 713



to top

>emb|AL135751.1|SPAC607 S.pombe chromosome I cosmid c607
          Length = 19559

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 384  acaaagacatacggcacattcttgtcctc 412
            ||||| ||||| |||||||||||||||||
Sbjct: 3083 acaaaaacataaggcacattcttgtcctc 3111



to top

>emb|BX950527.2| Gallus gallus finished cDNA, clone ChEST568g13
          Length = 801

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 66/81 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| | |||||| | ||| || || ||||| |||||||||||||| 
Sbjct: 252 gccatcacgatgaactctgctattcctcggttcagtgttttggtggcttcgttggctcct 193

                                
Query: 522 ttcttgagctgcttgtagttg 542
           ||    |||||||||||||||
Sbjct: 192 ttgcgtagctgcttgtagttg 172



to top

>gb|AC160131.2| Mus musculus BAC clone RP23-226D9 from chromosome 12, complete sequence
          Length = 202807

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 454    tgtcagctgccatcaccacga 474
              |||||||||||||||||||||
Sbjct: 126668 tgtcagctgccatcaccacga 126648



to top

>ref|NM_001019023.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPAC607.03c),
           partial mRNA
          Length = 378

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 384 acaaagacatacggcacattcttgtcctc 412
           ||||| ||||| |||||||||||||||||
Sbjct: 239 acaaaaacataaggcacattcttgtcctc 211



to top

>emb|BX934076.2| Gallus gallus finished cDNA, clone ChEST55d24
          Length = 1170

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 66/81 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| | |||||| | ||| || || ||||| |||||||||||||| 
Sbjct: 267 gccatcacgatgaactctgctattcctcggttcagtgttttggtggcttcgttggctcct 208

                                
Query: 522 ttcttgagctgcttgtagttg 542
           ||    |||||||||||||||
Sbjct: 207 ttgcgtagctgcttgtagttg 187



to top

>emb|BX932329.2| Gallus gallus finished cDNA, clone ChEST359i7
          Length = 818

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 66/81 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| | |||||| | ||| || || ||||| |||||||||||||| 
Sbjct: 341 gccatcacgatgaactctgctattcctcggttcagtgttttggtggcttcgttggctcct 282

                                
Query: 522 ttcttgagctgcttgtagttg 542
           ||    |||||||||||||||
Sbjct: 281 ttgcgtagctgcttgtagttg 261



to top

>emb|BX931143.2| Gallus gallus finished cDNA, clone ChEST203b22
          Length = 723

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 66/81 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| | |||||| | ||| || || ||||| |||||||||||||| 
Sbjct: 246 gccatcacgatgaactctgctattcctcggttcagtgttttggtggcttcgttggctcct 187

                                
Query: 522 ttcttgagctgcttgtagttg 542
           ||    |||||||||||||||
Sbjct: 186 ttgcgtagctgcttgtagttg 166



to top

>emb|CR352576.1| Gallus gallus finished cDNA, clone ChEST831m24
          Length = 727

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 66/81 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| | |||||| | ||| || || ||||| |||||||||||||| 
Sbjct: 250 gccatcacgatgaactctgctattcctcggttcagtgttttggtggcttcgttggctcct 191

                                
Query: 522 ttcttgagctgcttgtagttg 542
           ||    |||||||||||||||
Sbjct: 190 ttgcgtagctgcttgtagttg 170



to top

>gb|AY950656.1| Acanthamoeba castellanii snu13p-like mRNA, complete cds
          Length = 619

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 528 agctgcttgtagttggcggcctgctggac 556
           ||||||||||||||||  |||||||||||
Sbjct: 227 agctgcttgtagttggtcgcctgctggac 199



to top

>emb|BX936171.1| Gallus gallus finished cDNA, clone ChEST145m8
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 66/81 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| | |||||| | ||| || || ||||| |||||||||||||| 
Sbjct: 241 gccatcacgatgaactctgctattcctcggttcagtgttttggtggcttcgttggctcct 182

                                
Query: 522 ttcttgagctgcttgtagttg 542
           ||    |||||||||||||||
Sbjct: 181 ttgcgtagctgcttgtagttg 161



to top

>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 540     ttggcggcctgctggacgatgtcga 564
               ||||||||||||||| |||||||||
Sbjct: 1971230 ttggcggcctgctgggcgatgtcga 1971206



to top

>gb|AF087136.1|AF087136 Schizosaccharomyces pombe SNU13 snRNP subunit homolog (snu13) gene,
           complete cds
          Length = 725

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 384 acaaagacatacggcacattcttgtcctc 412
           ||||| ||||| |||||||||||||||||
Sbjct: 442 acaaaaacataaggcacattcttgtcctc 414



to top

>gb|U95114.1|MMU95114 Mus musculus fertilization antigen-1 mRNA, complete cds
          Length = 642

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 489 ctgttgagagtcttggtcgcttcgttggctcccttcttgagctgcttgtagtt 541
           |||||||| || ||||| ||||| |||||||| |||   ||||||||||||||
Sbjct: 224 ctgttgagggttttggtggcttcattggctcctttccgaagctgcttgtagtt 172



to top

>gb|AE017347.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 7, complete
              sequence
          Length = 1347793

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 519    cccttcttgagctgcttgta 538
              ||||||||||||||||||||
Sbjct: 435028 cccttcttgagctgcttgta 435047



to top

>gb|AE013216.1| Thermoanaerobacter tengcongensis MB4, section 243 of 244 of the
           complete genome
          Length = 10099

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 88  aagatggcagacataatggcagca 111
           ||||||||||||||||| ||||||
Sbjct: 588 aagatggcagacataattgcagca 611



to top

>ref|XM_389646.1| Gibberella zeae PH-1 chromosome 4 predicted protein (FG09470.1)
           partial mRNA
          Length = 1089

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 256 gcttctcgatggcatccttgagac 279
           |||||| |||||||||||||||||
Sbjct: 34  gcttcttgatggcatccttgagac 11



to top

>gb|AC147031.2| Pan troglodytes BAC clone RP43-98M7 from 7, complete sequence
          Length = 175794

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 30     ggagaaaattcaactgccat 49
              ||||||||||||||||||||
Sbjct: 138572 ggagaaaattcaactgccat 138553



to top

>ref|XM_848546.1| PREDICTED: Canis familiaris similar to NHP2-like protein 1 (High
           mobility group-like nuclear protein 2 homolog 1)
           ([U4/U6.U5] tri-snRNP 15.5 kDa protein) (Sperm specific
           antigen 1) (Fertilization antigen 1) (FA-1) (LOC610953),
           mRNA
          Length = 397

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 489 ctgttgagagtcttggtcgcttcgttggctcc 520
           |||||||| || ||||| ||||||||||||||
Sbjct: 152 ctgttgagggttttggtggcttcgttggctcc 121



to top

>gb|AC004911.1| Homo sapiens PAC clone RP5-870F17 from 7, complete sequence
          Length = 155382

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 103    atggcagcatgatttaacat 122
              ||||||||||||||||||||
Sbjct: 151798 atggcagcatgatttaacat 151779



to top

>emb|AL353661.41| Human DNA sequence from clone RP3-445O1 on chromosome 6, complete
             sequence
          Length = 61334

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 258   ttctcgatggcatccttgag 277
             ||||||||||||||||||||
Sbjct: 15632 ttctcgatggcatccttgag 15613



to top

>emb|AL031847.17|HS120G22 Human DNA sequence from clone RP1-120G22 on chromosome 1p36.21-36.33
             Contains the 5' end of the CHD5 gene for  chromodomain
             helicase DNA binding protein 5, the RPL22 gene for
             ribosomal protein L22, eight novel genes, the ICMT gene
             for isoprenylcysteine carboxyl methyltransferase, possible
             ortholog of rodent transcription factor HES-3, the 3' end
             of the gene for brain acyl-CoA hydrolase (BACH) and seven
             CpG islands, complete sequence
          Length = 166518

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 594   ccagcgggtaggcctttggg 613
             ||||||||||||||||||||
Sbjct: 28969 ccagcgggtaggcctttggg 28988



to top

>emb|CR541725.1| Homo sapiens full open reading frame cDNA clone RZPDo834A1029D for
           gene NHP2L1, NHP2 non-histone chromosome protein 2-like
           1 (S. cerevisiae); complete cds, incl. stopcodon
          Length = 387

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| 
Sbjct: 170 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 111

                               
Query: 522 ttcttgagctgcttgtagtt 541
           |||   |||||||| |||||
Sbjct: 110 ttccgaagctgcttatagtt 91



to top

>gb|AY991238.1| Uncultured bacterium clone C13_O06 16S ribosomal RNA gene, partial
           sequence
          Length = 1283

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 539 gttggcggcctgctggacga 558
           ||||||||||||||||||||
Sbjct: 654 gttggcggcctgctggacga 673



to top

>emb|AL021712.2|ATT10I14 Arabidopsis thaliana DNA chromosome 4, BAC clone T10I14 (ESSA project)
          Length = 82891

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 71/88 (80%)
 Strand = Plus / Plus

                                                                         
Query: 318   gtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgcttt 377
             ||||||||||||||||| || || || || |||||||| || |  || |  ||||| || 
Sbjct: 82726 gtcactgaacaagcaataacaggtcttgttactccacatgctcttcccaatgcttgtttc 82785

                                         
Query: 378   gaagggacaaagacatacggcacattct 405
             ||||| ||||| ||||| ||||||||||
Sbjct: 82786 gaaggtacaaacacatatggcacattct 82813



to top

>emb|AJ292371.1|EMU292371 Echinococcus multilocularis mRNA for putative high mobility
           group-like nuclear protein 2 (hmg2 gene)
          Length = 483

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 495 agagtcttggtcgcttcgttggctcccttcttgagctgcttgta 538
           |||| |||||| || || ||||| ||||| ||||||||||||||
Sbjct: 167 agagccttggtagcctcattggcaccctttttgagctgcttgta 124



to top

>gb|BC095439.1| Homo sapiens NHP2 non-histone chromosome protein 2-like 1 (S.
           cerevisiae), transcript variant 1, mRNA (cDNA clone
           MGC:111142 IMAGE:30719732), complete cds
          Length = 1499

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| 
Sbjct: 252 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 193

                               
Query: 522 ttcttgagctgcttgtagtt 541
           |||   |||||||| |||||
Sbjct: 192 ttccgaagctgcttatagtt 173



to top

>gb|AC069079.11| Homo sapiens chromosome 10 clone RP11-539E19, complete sequence
          Length = 216006

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 138    tatagctgaaaaacataaaa 157
              ||||||||||||||||||||
Sbjct: 154314 tatagctgaaaaacataaaa 154333



to top

>gb|AC099063.2| Homo sapiens chromosome 1 clone RP4-620F22, complete sequence
          Length = 110724

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 480   gatattcccctgttgagagt 499
             ||||||||||||||||||||
Sbjct: 13547 gatattcccctgttgagagt 13566



to top

>ref|NM_005008.2| Homo sapiens NHP2 non-histone chromosome protein 2-like 1 (S.
           cerevisiae) (NHP2L1), transcript variant 1, mRNA
          Length = 1601

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| 
Sbjct: 364 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 305

                               
Query: 522 ttcttgagctgcttgtagtt 541
           |||   |||||||| |||||
Sbjct: 304 ttccgaagctgcttatagtt 285



to top

>ref|NM_001003796.1| Homo sapiens NHP2 non-histone chromosome protein 2-like 1 (S.
           cerevisiae) (NHP2L1), transcript variant 2, mRNA
          Length = 1520

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| 
Sbjct: 283 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 224

                               
Query: 522 ttcttgagctgcttgtagtt 541
           |||   |||||||| |||||
Sbjct: 223 ttccgaagctgcttatagtt 204



to top

>emb|CR623311.1| full-length cDNA clone CS0DE011YM23 of Placenta of Homo sapiens
           (human)
          Length = 1382

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| 
Sbjct: 173 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 114

                               
Query: 522 ttcttgagctgcttgtagtt 541
           |||   |||||||| |||||
Sbjct: 113 ttccgaagctgcttatagtt 94



to top

>emb|CR623174.1| full-length cDNA clone CS0DA009YE02 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1092

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| 
Sbjct: 208 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 149

                               
Query: 522 ttcttgagctgcttgtagtt 541
           |||   |||||||| |||||
Sbjct: 148 ttccgaagctgcttatagtt 129



to top

>emb|CR616994.1| full-length cDNA clone CS0DK010YK23 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 1366

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| 
Sbjct: 211 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 152

                               
Query: 522 ttcttgagctgcttgtagtt 541
           |||   |||||||| |||||
Sbjct: 151 ttccgaagctgcttatagtt 132



to top

>emb|CR616990.1| full-length cDNA clone CS0DH007YI19 of T cells (Jurkat cell line)
           of Homo sapiens (human)
          Length = 1413

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| 
Sbjct: 202 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 143

                               
Query: 522 ttcttgagctgcttgtagtt 541
           |||   |||||||| |||||
Sbjct: 142 ttccgaagctgcttatagtt 123



to top

>emb|CR614137.1| full-length cDNA clone CS0DJ005YB10 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 1353

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| 
Sbjct: 173 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 114

                               
Query: 522 ttcttgagctgcttgtagtt 541
           |||   |||||||| |||||
Sbjct: 113 ttccgaagctgcttatagtt 94



to top

>emb|CR613725.1| full-length cDNA clone CS0DC017YM06 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1459

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| 
Sbjct: 251 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 192

                               
Query: 522 ttcttgagctgcttgtagtt 541
           |||   |||||||| |||||
Sbjct: 191 ttccgaagctgcttatagtt 172



to top

>emb|CR612873.1| full-length cDNA clone CS0DC024YJ07 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1659

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| 
Sbjct: 476 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 417

                               
Query: 522 ttcttgagctgcttgtagtt 541
           |||   |||||||| |||||
Sbjct: 416 ttccgaagctgcttatagtt 397



to top

>emb|CR605954.1| full-length cDNA clone CS0DC024YA08 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1626

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| 
Sbjct: 442 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 383

                               
Query: 522 ttcttgagctgcttgtagtt 541
           |||   |||||||| |||||
Sbjct: 382 ttccgaagctgcttatagtt 363



to top

>emb|CR602484.1| full-length cDNA clone CS0DJ008YG20 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 1481

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| 
Sbjct: 267 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 208

                               
Query: 522 ttcttgagctgcttgtagtt 541
           |||   |||||||| |||||
Sbjct: 207 ttccgaagctgcttatagtt 188



to top

>emb|CR600974.1| full-length cDNA clone CS0DB009YP18 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 1358

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| 
Sbjct: 162 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 103

                               
Query: 522 ttcttgagctgcttgtagtt 541
           |||   |||||||| |||||
Sbjct: 102 ttccgaagctgcttatagtt 83



to top

>emb|CR600000.1| full-length cDNA clone CS0DJ012YD12 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 991

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| 
Sbjct: 248 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 189

                               
Query: 522 ttcttgagctgcttgtagtt 541
           |||   |||||||| |||||
Sbjct: 188 ttccgaagctgcttatagtt 169



to top

>emb|CR595064.1| full-length cDNA clone CS0DN001YL05 of Adult brain of Homo sapiens
           (human)
          Length = 1349

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| 
Sbjct: 173 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 114

                               
Query: 522 ttcttgagctgcttgtagtt 541
           |||   |||||||| |||||
Sbjct: 113 ttccgaagctgcttatagtt 94



to top

>emb|CR593477.1| full-length cDNA clone CS0DC025YF02 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1424

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| 
Sbjct: 270 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 211

                               
Query: 522 ttcttgagctgcttgtagtt 541
           |||   |||||||| |||||
Sbjct: 210 ttccgaagctgcttatagtt 191



to top

>emb|CR593383.1| full-length cDNA clone CS0DK007YN07 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 1449

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| 
Sbjct: 261 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 202

                               
Query: 522 ttcttgagctgcttgtagtt 541
           |||   |||||||| |||||
Sbjct: 201 ttccgaagctgcttatagtt 182



to top

>emb|CR593004.1| full-length cDNA clone CS0DC023YC02 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1659

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| 
Sbjct: 476 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 417

                               
Query: 522 ttcttgagctgcttgtagtt 541
           |||   |||||||| |||||
Sbjct: 416 ttccgaagctgcttatagtt 397



to top

>emb|CR591470.1| full-length cDNA clone CS0DB003YC24 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 1630

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| 
Sbjct: 434 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 375

                               
Query: 522 ttcttgagctgcttgtagtt 541
           |||   |||||||| |||||
Sbjct: 374 ttccgaagctgcttatagtt 355



to top

>gb|AC012049.8| Homo sapiens chromosome 10 clone RP11-76F22, complete sequence
          Length = 142656

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 138   tatagctgaaaaacataaaa 157
             ||||||||||||||||||||
Sbjct: 53447 tatagctgaaaaacataaaa 53466



to top

>ref|NM_079975.2| Drosophila melanogaster hoi-polloi CG3949-RA (hoip), mRNA
          Length = 570

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 492 ttgagagtcttggtcgcttcgttggctccctt 523
           ||||| |||||||| || ||||||||||||||
Sbjct: 238 ttgagggtcttggtggcctcgttggctccctt 207



to top

>gb|AC022537.8| Homo sapiens chromosome 10 clone RP11-40C11, complete sequence
          Length = 154939

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 138  tatagctgaaaaacataaaa 157
            ||||||||||||||||||||
Sbjct: 4433 tatagctgaaaaacataaaa 4452



to top

>dbj|AB169618.1| Macaca fascicularis brain cDNA, clone: QtrA-11204, similar to human
           NHP2 non-histone chromosome protein 2-like 1
           (S.cerevisiae) (NHP2L1), mRNA, RefSeq: NM_005008.1
          Length = 1534

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| 
Sbjct: 277 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 218

                               
Query: 522 ttcttgagctgcttgtagtt 541
           |||   |||||||| |||||
Sbjct: 217 ttccgaagctgcttatagtt 198



to top

>gb|BC103317.2| Bos taurus cDNA clone MGC:129115 IMAGE:8122031, complete cds
          Length = 1438

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 119/152 (78%)
 Strand = Plus / Minus

                                                                       
Query: 390 acatacggcacattcttgtcctccgcgagcaacgggaggtggaggaggatttcgagcggc 449
           ||||| ||||| |||||||||||    |||| ||||||||| |||| ||| || |  |||
Sbjct: 300 acatagggcacgttcttgtcctcacacagcagcgggaggtgcaggatgatctccaagggc 241

                                                                       
Query: 450 tccgtgtcagctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgct 509
           ||||  || || |||||||| | |||||| || || || |||||||| || ||||| || 
Sbjct: 240 tccgcatctgcggccatcacaatgaactcagagatgcctctgttgagggttttggtggcc 181

                                           
Query: 510 tcgttggctcccttcttgagctgcttgtagtt 541
           || |||||||| ||    ||||||||||||||
Sbjct: 180 tcattggctccttttcgaagctgcttgtagtt 149



to top

>ref|NM_001026666.1| Caenorhabditis elegans Glucose-6-Phosphate Isomerase family member
           (gpi-1) (gpi-1) mRNA, complete cds
          Length = 1708

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 248 tatgagaagcttctcgatgg 267
           ||||||||||||||||||||
Sbjct: 923 tatgagaagcttctcgatgg 942



to top

>ref|NM_001026667.1| Caenorhabditis elegans Glucose-6-Phosphate Isomerase family member
           (gpi-1) (gpi-1) mRNA, complete cds
          Length = 1914

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 248 tatgagaagcttctcgatgg 267
           ||||||||||||||||||||
Sbjct: 976 tatgagaagcttctcgatgg 995



to top

>emb|AL115549.1|CNS01CHX Botrytis cinerea strain T4 cDNA library
          Length = 636

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 491 gttgagagtcttggtcgcttcgttggctcccttctt 526
           |||||| |||||||| |  |||||||||||||||||
Sbjct: 223 gttgagggtcttggtggtctcgttggctcccttctt 188



to top

>gb|AF129858.1|AF129858 Zea mays CENPCB protein (CenpcB) mRNA, partial cds
          Length = 1495

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 518 tcccttcttgagctgcttgt 537
           ||||||||||||||||||||
Sbjct: 912 tcccttcttgagctgcttgt 893



to top

>gb|AC007291.24|AC007291 Drosophila melanogaster, chromosome 2L, region 30B-, BAC clone BACR02I05,
              complete sequence
          Length = 176075

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 492    ttgagagtcttggtcgcttcgttggctccctt 523
              ||||| |||||||| || ||||||||||||||
Sbjct: 120131 ttgagggtcttggtggcctcgttggctccctt 120162



to top

>gb|BC019282.2| Homo sapiens NHP2 non-histone chromosome protein 2-like 1 (S.
           cerevisiae), mRNA (cDNA clone IMAGE:2823291), partial
           cds
          Length = 1408

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| 
Sbjct: 171 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 112

                               
Query: 522 ttcttgagctgcttgtagtt 541
           |||   |||||||| |||||
Sbjct: 111 ttccgaagctgcttatagtt 92



to top

>gb|AF208396.1|AF208396 Drosophila melanogaster Hoi-polloi (hoip) mRNA, complete cds
          Length = 566

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 492 ttgagagtcttggtcgcttcgttggctccctt 523
           ||||| |||||||| || ||||||||||||||
Sbjct: 222 ttgagggtcttggtggcctcgttggctccctt 191



to top

>gb|AF175919.1|AF175919 Drosophila melanogaster hoip[k07104] P element insertion region
          Length = 394

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 492 ttgagagtcttggtcgcttcgttggctccctt 523
           ||||| |||||||| || ||||||||||||||
Sbjct: 253 ttgagggtcttggtggcctcgttggctccctt 222



to top

>gb|BT003523.1| Drosophila melanogaster RE22964 full insert cDNA
          Length = 3782

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 492 ttgagagtcttggtcgcttcgttggctccctt 523
           ||||| |||||||| || ||||||||||||||
Sbjct: 238 ttgagggtcttggtggcctcgttggctccctt 207



to top

>ref|XM_234480.3| PREDICTED: Rattus norvegicus similar to RIKEN cDNA A830059I20
           (predicted) (LOC299265), mRNA
          Length = 1213

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 454 tgtcagctgccatcaccacg 473
           ||||||||||||||||||||
Sbjct: 346 tgtcagctgccatcaccacg 327



to top

>gb|AY893533.1| Synthetic construct Homo sapiens clone FLH130980.01X NHP2
           non-histone chromosome protein 2-like 1 (NHP2L1) mRNA,
           complete cds
          Length = 387

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| 
Sbjct: 170 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 111

                               
Query: 522 ttcttgagctgcttgtagtt 541
           |||   |||||||| |||||
Sbjct: 110 ttccgaagctgcttatagtt 91



to top

>emb|AL357614.5|HS367B10 Homo sapiens chromosome 9 BAC RP11-367B10, complete sequence
          Length = 182378

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 130    ttgcaaaatatagctgaaaa 149
              ||||||||||||||||||||
Sbjct: 127144 ttgcaaaatatagctgaaaa 127125



to top

>gb|AF155235.1|AF155235 Homo sapiens 15.5 kD RNA binding protein mRNA, complete cds
          Length = 596

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| 
Sbjct: 246 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 187

                               
Query: 522 ttcttgagctgcttgtagtt 541
           |||   |||||||| |||||
Sbjct: 186 ttccgaagctgcttatagtt 167



to top

>gb|AC007257.9|AC007257 Drosophila melanogaster, chromosome 2L, region 30B-, BAC clone
            BACR24A22, complete sequence
          Length = 183007

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 492  ttgagagtcttggtcgcttcgttggctccctt 523
            ||||| |||||||| || ||||||||||||||
Sbjct: 3984 ttgagggtcttggtggcctcgttggctccctt 4015



to top

>emb|CR456531.1| Homo sapiens NHP2L1 full length open reading frame (ORF) cDNA clone
           (cDNA clone C22ORF:pGEM.NHP2L1)
          Length = 630

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| 
Sbjct: 199 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 140

                               
Query: 522 ttcttgagctgcttgtagtt 541
           |||   |||||||| |||||
Sbjct: 139 ttccgaagctgcttatagtt 120



to top

>emb|AL110500.1|CEY87G2A Caenorhabditis elegans YAC Y87G2A, complete sequence
          Length = 123091

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 248   tatgagaagcttctcgatgg 267
             ||||||||||||||||||||
Sbjct: 88178 tatgagaagcttctcgatgg 88197



to top

>gb|AE003625.3| Drosophila melanogaster chromosome 2L, section 34 of 83 of the complete
              sequence
          Length = 271507

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 492    ttgagagtcttggtcgcttcgttggctccctt 523
              ||||| |||||||| || ||||||||||||||
Sbjct: 262721 ttgagggtcttggtggcctcgttggctccctt 262690



to top

>gb|AF091076.1|AF091076 Homo sapiens clone 557 OTK27 mRNA, complete cds
          Length = 554

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| 
Sbjct: 185 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 126

                               
Query: 522 ttcttgagctgcttgtagtt 541
           |||   |||||||| |||||
Sbjct: 125 ttccgaagctgcttatagtt 106



to top

>gb|AY609481.1| Sus scrofa clone Clu_13005.scr.msk.p1.Contig3, mRNA sequence
          Length = 1436

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 119/152 (78%)
 Strand = Plus / Minus

                                                                       
Query: 390 acatacggcacattcttgtcctccgcgagcaacgggaggtggaggaggatttcgagcggc 449
           ||||| ||||| |||||||||||    ||||  |||||||| ||||  || || || |||
Sbjct: 326 acatagggcacgttcttgtcctcacacagcagtgggaggtgcaggataatctccaggggc 267

                                                                       
Query: 450 tccgtgtcagctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgct 509
           |||| ||| || |||||||| | |||||| || || || |||||||| || ||||| || 
Sbjct: 266 tccgcgtctgcagccatcacaatgaactcagagatgcctctgttgagggttttggtggcc 207

                                           
Query: 510 tcgttggctcccttcttgagctgcttgtagtt 541
           || |||||||| ||    ||||||||||||||
Sbjct: 206 tcattggctccttttcgaagctgcttgtagtt 175



to top

>gb|AC136008.5| Mus musculus BAC clone RP24-68J1 from 6, complete sequence
          Length = 181220

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 341    cctagtcactccacaagcac 360
              ||||||||||||||||||||
Sbjct: 141123 cctagtcactccacaagcac 141104



to top

>gb|BC005358.1| Homo sapiens NHP2 non-histone chromosome protein 2-like 1 (S.
           cerevisiae), mRNA (cDNA clone MGC:12461 IMAGE:3681386),
           complete cds
          Length = 589

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| 
Sbjct: 221 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 162

                               
Query: 522 ttcttgagctgcttgtagtt 541
           |||   |||||||| |||||
Sbjct: 161 ttccgaagctgcttatagtt 142



to top

>dbj|AP006388.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT39K18, TM0252d,
             complete sequence
          Length = 35261

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 447   ggctccgtgtcagctgccatcaccacgaactc 478
             ||||| ||||| ||||||||||| ||||||||
Sbjct: 29057 ggctcagtgtctgctgccatcacaacgaactc 29088



to top

>dbj|AB036925.1| Citrus unshiu Cit-VATP B-1 gene for vacuolar H+-ATPase B subunit,
           partial cds
          Length = 2644

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 155 aaagacctagcagacaagacacca 178
           |||||||| |||||||||||||||
Sbjct: 686 aaagacctggcagacaagacacca 663



to top

>dbj|D50420.1| Homo sapiens mRNA for OTK27, complete cds
          Length = 1475

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 462 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 521
           |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| 
Sbjct: 264 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 205

                               
Query: 522 ttcttgagctgcttgtagtt 541
           |||   |||||||| |||||
Sbjct: 204 ttccgaagctgcttatagtt 185


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,330,641
Number of Sequences: 3902068
Number of extensions: 5330641
Number of successful extensions: 107585
Number of sequences better than 10.0: 182
Number of HSP's better than 10.0 without gapping: 172
Number of HSP's successfully gapped in prelim test: 10
Number of HSP's that attempted gapping in prelim test: 106931
Number of HSP's gapped (non-prelim): 632
length of query: 640
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 617
effective length of database: 17,143,297,704
effective search space: 10577414683368
effective search space used: 10577414683368
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top