Clone Name	rbags22a19
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|AF479049.1| Triticum aestivum ribosomal protein L2 mRNA, part...	450	e-123
2	dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D...	424	e-115
3	gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome...	424	e-115
4	emb|AL731784.3|CNS08C88 Oryza sativa chromosome 12, . BAC OSJNBa...	424	e-115
5	dbj|AK104806.1| Oryza sativa (japonica cultivar-group) cDNA clon...	416	e-113
6	dbj|AK070647.1| Oryza sativa (japonica cultivar-group) cDNA clon...	416	e-113
7	gb|AY108123.1| Zea mays PCO067267 mRNA sequence	363	3e-97
8	gb|AY105581.1| Zea mays PCO150618 mRNA sequence	311	1e-81
9	gb|AY109618.1| Zea mays CL8996_1 mRNA sequence	299	4e-78
10	ref|NM_119780.2| Arabidopsis thaliana structural constituent of ...	264	2e-67
11	emb|AL161588.2|ATCHRIV84 Arabidopsis thaliana DNA chromosome 4, ...	264	2e-67
12	emb|AL022141.1|ATF23E13 Arabidopsis thaliana DNA chromosome 4, B...	264	2e-67
13	emb|AL022373.1|ATT19K4 Arabidopsis thaliana DNA chromosome 4, BA...	264	2e-67
14	gb|AF361610.1| Arabidopsis thaliana AT4g36130/F23E13_20 mRNA, co...	264	2e-67
15	gb|AF367335.1| Arabidopsis thaliana AT4g36130/F23E13_20 mRNA, co...	264	2e-67
16	gb|AY058221.1| Arabidopsis thaliana AT4g36130/F23E13_20 mRNA, co...	264	2e-67
17	ref|NM_127358.3| Arabidopsis thaliana EMB2296; structural consti...	242	8e-61
18	gb|AY128314.1| Arabidopsis thaliana 60S ribosomal protein L2 (At...	242	8e-61
19	gb|AC006201.4| Arabidopsis thaliana chromosome 2 clone T27K22 ma...	242	8e-61
20	emb|BX820589.1|CNS0A8QO Arabidopsis thaliana Full-length cDNA Co...	242	8e-61
21	emb|BX820233.1|CNS0A8O8 Arabidopsis thaliana Full-length cDNA Co...	242	8e-61
22	emb|BX820387.1|CNS0A8NL Arabidopsis thaliana Full-length cDNA Co...	242	8e-61
23	gb|BT001177.1| Arabidopsis thaliana 60S ribosomal protein L2 (At...	242	8e-61
24	emb|BX827983.1|CNS0A32V Arabidopsis thaliana Full-length cDNA Co...	238	1e-59
25	emb|X86765.1|ATC24RPL2 A.thaliana mRNA for ribosomal protein L2	234	2e-58
26	emb|AJ404848.1|GMA404848 Glycine max mRNA for ribosomal protein ...	230	3e-57
27	emb|BX820018.1|CNS0A8IW Arabidopsis thaliana Full-length cDNA Co...	228	1e-56
28	gb|AC135311.13| Medicago truncatula clone mth2-27l9, complete se...	226	5e-56
29	emb|BX820320.1|CNS0A7WS Arabidopsis thaliana Full-length cDNA Co...	226	5e-56
30	gb|AF156372.1| Nicotiana tabacum clone PR60 60S ribosomal protei...	224	2e-55
31	emb|BX820333.1|CNS0A8NS Arabidopsis thaliana Full-length cDNA Co...	214	2e-52
32	emb|X64562.1|LERPL2MR L.esculentum mRNA for ribosomal protein L2	208	1e-50
33	gb|DQ252497.1| Solanum tuberosum clone 068C11 ribosomal protein ...	208	1e-50
34	gb|BT013866.1| Lycopersicon esculentum clone 132846R, mRNA sequence	204	2e-49
35	emb|BX818795.1|CNS0A8ZD Arabidopsis thaliana Full-length cDNA Co...	188	1e-44
36	emb|X62500.1|NTRL2RNA N.tabacum RL2 mRNA for 60S ribosomal prote...	176	4e-41
37	gb|DQ316258.1| Litopenaeus vannamei ribosomal protein L8 mRNA, c...	147	4e-32
38	emb|CT033188.1| Platynereis dumerilii EST IB0AAA25AH04EM1	107	3e-20
39	emb|CT033187.1| Platynereis dumerilii EST IB0AAA25AH04FM1	107	3e-20
40	gb|AF098520.1|AF098520 Drosophila melanogaster ribosomal protein...	105	1e-19
41	gb|AY485337.1| Mamestra brassicae ribosomal protein L8 (rpl8) mR...	101	2e-18
42	emb|CT033650.1| Platynereis dumerilii EST IB0AAA16CH07EM1	100	8e-18
43	emb|CT033649.1| Platynereis dumerilii EST IB0AAA16CH07FM1	100	8e-18
44	emb|CT033017.1| Platynereis dumerilii EST IB0AAA27DH06EM1	100	8e-18
45	emb|CT033016.1| Platynereis dumerilii EST IB0AAA27DH06FM1	100	8e-18
46	gb|BT014913.1| Drosophila melanogaster RH21963 full insert cDNA	98	3e-17
47	gb|DQ440262.1| Aedes aegypti clone AET-322 60S ribosomal protein...	98	3e-17
48	emb|CR938630.1| Single read from an extremity of a full-length c...	98	3e-17
49	emb|CR938124.1| Single read from an extremity of a full-length c...	98	3e-17
50	gb|AC011905.4| Drosophila melanogaster 3L BAC RP98-27A3 (Roswell...	98	3e-17
51	ref|NM_167955.1| Drosophila melanogaster Ribosomal protein L8 CG...	98	3e-17
52	ref|NM_079987.2| Drosophila melanogaster Ribosomal protein L8 CG...	98	3e-17
53	gb|AY071342.1| Drosophila melanogaster RE37829 full length cDNA	98	3e-17
54	gb|BT022891.1| Drosophila melanogaster IP12501 full insert cDNA	98	3e-17
55	gb|AE003475.4| Drosophila melanogaster chromosome 3L, section 9 ...	98	3e-17
56	emb|CR937651.1| Single read from an extremity of a cDNA clone ma...	96	1e-16
57	emb|CR937650.1| Single read from an extremity of a cDNA clone ma...	96	1e-16
58	emb|CT033621.1| Platynereis dumerilii EST IB0AAA17BB03EM1	96	1e-16
59	emb|CT033394.1| Platynereis dumerilii EST IB0AAA21BA08EM1	96	1e-16
60	emb|CT033393.1| Platynereis dumerilii EST IB0AAA21BA08FM1	96	1e-16
61	emb|CT032883.1| Platynereis dumerilii EST IB0AAA30AD02EM1	96	1e-16
62	emb|CT032882.1| Platynereis dumerilii EST IB0AAA30AD02FM1	96	1e-16
63	emb|CT032622.1| Platynereis dumerilii EST IB0AAA35AA08FM1	96	1e-16
64	emb|CT032614.1| Platynereis dumerilii EST IB0AAA35BC06EM1	96	1e-16
65	emb|CT032322.1| Platynereis dumerilii EST IB0AAA40CH03EM1	96	1e-16
66	emb|CT032321.1| Platynereis dumerilii EST IB0AAA40CH03FM1	96	1e-16
67	emb|CT032290.1| Platynereis dumerilii EST IB0AAA41CE04EM1	96	1e-16
68	emb|CT032289.1| Platynereis dumerilii EST IB0AAA41CE04FM1	96	1e-16
69	emb|CT032278.1| Platynereis dumerilii EST IB0AAA41DB03EM1	96	1e-16
70	emb|CT032277.1| Platynereis dumerilii EST IB0AAA41DB03FM1	96	1e-16
71	ref|NM_114978.1| Arabidopsis thaliana structural constituent of ...	94	5e-16
72	emb|AL132980.3|ATF24M12 Arabidopsis thaliana DNA chromosome 3, B...	94	5e-16
73	gb|DQ056619.1| Arabidopsis thaliana 60S ribosomal protein L8 (At...	94	5e-16
74	dbj|AU066544.1| Chlamydomonas sp. HS-5 mRNA for 60S ribosomal pr...	94	5e-16
75	gb|AY432072.1| Aedes aegypti ASAP ID: 34485 cytosolic large ribo...	90	7e-15
76	emb|AM049012.1| Timarcha balearica partial mRNA for ribosomal pr...	90	7e-15
77	gb|AY128671.1| Drosophila virilis daughter of sevenless (dos) ge...	90	7e-15
78	gb|AF526214.1| Argopecten irradians isolate iolsaicl63ct83cn90 r...	90	7e-15
79	emb|CR937938.1| Single read from an extremity of a full-length c...	90	7e-15
80	dbj|AK060350.1| Oryza sativa (japonica cultivar-group) cDNA clon...	88	3e-14
81	emb|CT032253.1| Platynereis dumerilii EST IB0AAA42BC10FM1	88	3e-14
82	gb|AF429973.1| Spodoptera frugiperda ribosomal protein L8 mRNA, ...	86	1e-13
83	ref|XM_962890.1| PREDICTED: Tribolium castaneum similar to CG126...	84	5e-13
84	gb|AY957563.1| Oncorhynchus mykiss ribosomal protein L8 mRNA, pa...	84	5e-13
85	emb|CR938631.1| Single read from an extremity of a full-length c...	84	5e-13
86	gb|M99055.1|MQSRPL8X Mosquito ribosomal protein L8 (rpL8) gene e...	84	5e-13
87	gb|AY943311.1| Wyeomyia smithii ribosomal protein L8 mRNA, parti...	82	2e-12
88	gb|DQ213524.1| Taeniopygia guttata clone 0058P0020H02 ribosomal ...	80	7e-12
89	gb|DQ213521.1| Taeniopygia guttata clone 0058P0051G10 ribosomal ...	80	7e-12
90	ref|XM_447807.1| Candida glabrata CBS138, CAGL0J02354g partial mRNA	80	7e-12
91	emb|CR380956.1| Candida glabrata strain CBS138 chromosome J comp...	80	7e-12
92	gb|DQ213522.1| Taeniopygia guttata clone 0061P0021C08 ribosomal ...	78	3e-11
93	ref|XM_582676.2| PREDICTED: Bos taurus similar to 60S ribosomal ...	78	3e-11
94	gb|AY919670.1| Pimephales promelas 60S ribosomal protein L8 mRNA...	78	3e-11
95	dbj|AB242299.1| Asterias amurensis PKA-R mRNA for protein kinase...	78	3e-11
96	emb|AL116103.1|CNS01CXB Botrytis cinerea strain T4 cDNA library	78	3e-11
97	emb|AL114960.1|CNS01C1K Botrytis cinerea strain T4 cDNA library	78	3e-11
98	emb|AL112851.1|CNS01AEZ Botrytis cinerea strain T4 cDNA library	78	3e-11
99	emb|AL112838.1|CNS01AEM Botrytis cinerea strain T4 cDNA library	78	3e-11
100	emb|AL112486.1|CNS01A4U Botrytis cinerea strain T4 cDNA library	78	3e-11
101	gb|AF164152.1|AF164152 Anopheles gambiae strain M2 ribosomal pro...	78	3e-11
102	gb|AY190734.1| Pagrus major ribosomal protein L8 mRNA, partial cds	76	1e-10
103	emb|AM049010.1| Meladema coriacea partial mRNA for ribosomal pro...	76	1e-10
104	emb|AL112254.1|CNS019YE Botrytis cinerea strain T4 cDNA library	76	1e-10
105	emb|AJ563478.1|CGI563478 Crassostrea gigas partial mRNA for ribo...	76	1e-10
106	gb|AY769276.1| Bombyx mori ribosomal protein L8 (RpL8) mRNA, com...	74	4e-10
107	emb|AM049009.1| Georissus sp. APV-2005 mRNA for ribosomal protei...	74	4e-10
108	gb|BC102277.1| Bos taurus similar to 60S ribosomal protein L8, m...	74	4e-10
109	ref|NM_001034625.1| Bos taurus similar to 60S ribosomal protein ...	74	4e-10
110	gb|DQ213525.1| Taeniopygia guttata clone 0058P0034B06 ribosomal ...	72	2e-09
111	gb|DQ213523.1| Taeniopygia guttata clone 0058P0011G02 ribosomal ...	72	2e-09
112	emb|AM049011.1| Mycetophagus quadripustulatus mRNA for ribosomal...	72	2e-09
113	emb|CR938453.1| Single read from an extremity of a full-length c...	72	2e-09
114	ref|XM_393671.2| PREDICTED: Apis mellifera similar to ribosomal ...	72	2e-09
115	gb|BC059473.1| Danio rerio ribosomal protein L8, mRNA (cDNA clon...	70	7e-09
116	ref|NM_200713.1| Danio rerio ribosomal protein L8 (rpl8), mRNA	70	7e-09
117	gb|AY533227.1| Chinchilla lanigera ribosomal protein L8 mRNA, pa...	70	7e-09
118	emb|BX071470.1|CNS09RB6 Single read from an extremity of a full-...	70	7e-09
119	emb|BX071012.1|CNS09QYG Single read from an extremity of a full-...	70	7e-09
120	emb|BX070207.1|CNS09QC3 Single read from an extremity of a full-...	70	7e-09
121	emb|BX061050.1|CNS09J9Q Single read from an extremity of a full-...	70	7e-09
122	emb|BX068769.1|CNS09P85 Single read from an extremity of a full-...	70	7e-09
123	emb|BX067648.1|CNS09OD0 Single read from an extremity of a full-...	70	7e-09
124	emb|BX067520.1|CNS09O9G Single read from an extremity of a full-...	70	7e-09
125	emb|BX066574.1|CNS09NJ6 Single read from an extremity of a full-...	70	7e-09
126	emb|BX066544.1|CNS09NIC Single read from an extremity of a full-...	70	7e-09
127	emb|BX065896.1|CNS09N0C Single read from an extremity of a full-...	70	7e-09
128	emb|BX064864.1|CNS09M7O Single read from an extremity of a full-...	70	7e-09
129	emb|BX064747.1|CNS09M4F Single read from an extremity of a full-...	70	7e-09
130	emb|BX064211.1|CNS09LPJ Single read from an extremity of a full-...	70	7e-09
131	emb|BX063827.1|CNS09LEV Single read from an extremity of a full-...	70	7e-09
132	emb|BX063245.1|CNS09KYP Single read from an extremity of a full-...	70	7e-09
133	emb|BX063171.1|CNS09KWN Single read from an extremity of a full-...	70	7e-09
134	emb|BX062318.1|CNS09K8Y Single read from an extremity of a full-...	70	7e-09
135	emb|BX062038.1|CNS09K16 Single read from an extremity of a full-...	70	7e-09
136	emb|BX061861.1|CNS09JW9 Single read from an extremity of a full-...	70	7e-09
137	emb|BX061503.1|CNS09JMB Single read from an extremity of a full-...	70	7e-09
138	emb|BX061238.1|CNS09JEY Single read from an extremity of a full-...	70	7e-09
139	emb|BX060724.1|CNS09J0O Single read from an extremity of a full-...	70	7e-09
140	emb|BX059267.1|CNS09HW7 Single read from an extremity of a full-...	70	7e-09
141	emb|BX059235.1|CNS09HVB Single read from an extremity of a full-...	70	7e-09
142	emb|BX057044.1|CNS09G6G Single read from an extremity of a full-...	70	7e-09
143	emb|BX056961.1|CNS09G45 Single read from an extremity of a full-...	70	7e-09
144	emb|BX055189.1|CNS09EQX Single read from an extremity of a full-...	70	7e-09
145	emb|BX054843.1|CNS09EHB Single read from an extremity of a full-...	70	7e-09
146	emb|BX054769.1|CNS09EF9 Single read from an extremity of a full-...	70	7e-09
147	emb|BX054768.1|CNS09EF8 Single read from an extremity of a full-...	70	7e-09
148	emb|BX053031.1|CNS09D2Z Single read from an extremity of a full-...	70	7e-09
149	emb|BX054430.1|CNS09E5U Single read from an extremity of a full-...	70	7e-09
150	emb|BX054417.1|CNS09E5H Single read from an extremity of a full-...	70	7e-09
151	emb|BX054379.1|CNS09E4F Single read from an extremity of a full-...	70	7e-09
152	emb|BX053844.1|CNS09DPK Single read from an extremity of a full-...	70	7e-09
153	emb|BX053555.1|CNS09DHJ Single read from an extremity of a full-...	70	7e-09
154	emb|BX052540.1|CNS09CPC Single read from an extremity of a full-...	70	7e-09
155	emb|BX052387.1|CNS09CL3 Single read from an extremity of a full-...	70	7e-09
156	emb|BX051644.1|CNS09C0G Single read from an extremity of a full-...	70	7e-09
157	emb|BX051423.1|CNS09BUB Single read from an extremity of a full-...	70	7e-09
158	emb|BX050118.1|CNS09AU2 Single read from an extremity of a full-...	70	7e-09
159	emb|BX050810.1|CNS09BDA Single read from an extremity of a full-...	70	7e-09
160	emb|BX050569.1|CNS09B6L Single read from an extremity of a full-...	70	7e-09
161	emb|BX049265.1|CNS09A6D Single read from an extremity of a full-...	70	7e-09
162	emb|BX048973.1|CNS099Y9 Single read from an extremity of a full-...	70	7e-09
163	emb|BX046434.1|CNS097ZQ Single read from an extremity of a full-...	70	7e-09
164	emb|BX047425.1|CNS098R9 Single read from an extremity of a full-...	70	7e-09
165	emb|BX047145.1|CNS098JH Single read from an extremity of a full-...	70	7e-09
166	emb|BX045582.1|CNS097C2 Single read from an extremity of a full-...	70	7e-09
167	emb|BX045137.1|CNS096ZP Single read from an extremity of a full-...	70	7e-09
168	emb|BX043850.1|CNS095ZY Single read from an extremity of a full-...	70	7e-09
169	emb|BX043551.1|CNS095RN Single read from an extremity of a full-...	70	7e-09
170	emb|BX041268.1|CNS09408 Single read from an extremity of a full-...	70	7e-09
171	emb|BX041134.1|CNS093WI Single read from an extremity of a full-...	70	7e-09
172	emb|BX041072.1|CNS093US Single read from an extremity of a full-...	70	7e-09
173	emb|BX040787.1|CNS093MV Single read from an extremity of a full-...	70	7e-09
174	emb|BX040786.1|CNS093MU Single read from an extremity of a full-...	70	7e-09
175	emb|BX039654.1|CNS092RE Single read from an extremity of a full-...	70	7e-09
176	emb|BX036687.1|CNS090GZ Single read from an extremity of a full-...	70	7e-09
177	emb|BX037078.1|CNS090RU Single read from an extremity of a full-...	70	7e-09
178	emb|BX035978.1|CNS08ZXA Single read from an extremity of a full-...	70	7e-09
179	emb|BX034653.1|CNS08YWH Single read from an extremity of a full-...	70	7e-09
180	emb|BX033967.1|CNS08YDF Single read from an extremity of a full-...	70	7e-09
181	emb|BX033761.1|CNS08Y7P Single read from an extremity of a full-...	70	7e-09
182	emb|BX033234.1|CNS08XT2 Single read from an extremity of a full-...	70	7e-09
183	emb|BX033107.1|CNS08XPJ Single read from an extremity of a full-...	70	7e-09
184	emb|BX032954.1|CNS08XLA Single read from an extremity of a full-...	70	7e-09
185	emb|BX032912.1|CNS08XK4 Single read from an extremity of a full-...	70	7e-09
186	emb|BX032378.1|CNS08X5A Single read from an extremity of a full-...	70	7e-09
187	emb|BX031877.1|CNS08WRD Single read from an extremity of a full-...	70	7e-09
188	emb|BX031828.1|CNS08WQ0 Single read from an extremity of a full-...	70	7e-09
189	emb|BX031537.1|CNS08WHX Single read from an extremity of a full-...	70	7e-09
190	emb|BX030749.1|CNS08VW1 Single read from an extremity of a full-...	70	7e-09
191	emb|BX031289.1|CNS08WB1 Single read from an extremity of a full-...	70	7e-09
192	emb|BX030002.1|CNS08VBA Single read from an extremity of a full-...	70	7e-09
193	emb|BX029262.1|CNS08UQQ Single read from an extremity of a full-...	70	7e-09
194	emb|BX029602.1|CNS08V06 Single read from an extremity of a full-...	70	7e-09
195	emb|BX028637.1|CNS08U9D Single read from an extremity of a full-...	70	7e-09
196	emb|BX022357.1|CNS08PEX Single read from an extremity of a full-...	70	7e-09
197	emb|BX026844.1|CNS08SVK Single read from an extremity of a full-...	70	7e-09
198	emb|BX026789.1|CNS08SU1 Single read from an extremity of a full-...	70	7e-09
199	emb|BX025698.1|CNS08RZQ Single read from an extremity of a full-...	70	7e-09
200	emb|BX025349.1|CNS08RQ1 Single read from an extremity of a full-...	70	7e-09
201	emb|BX025079.1|CNS08RIJ Single read from an extremity of a full-...	70	7e-09
202	emb|BX025073.1|CNS08RID Single read from an extremity of a full-...	70	7e-09
203	emb|BX025038.1|CNS08RHE Single read from an extremity of a full-...	70	7e-09
204	emb|BX025033.1|CNS08RH9 Single read from an extremity of a full-...	70	7e-09
205	emb|BX024670.1|CNS08R76 Single read from an extremity of a full-...	70	7e-09
206	emb|BX024145.1|CNS08QSL Single read from an extremity of a full-...	70	7e-09
207	emb|BX023815.1|CNS08QJF Single read from an extremity of a full-...	70	7e-09
208	emb|BX022223.1|CNS08PB7 Single read from an extremity of a full-...	70	7e-09
209	emb|BX021031.1|CNS08OE3 Single read from an extremity of a full-...	70	7e-09
210	emb|BX020305.1|CNS08NTX Single read from an extremity of a full-...	70	7e-09
211	emb|BX018974.1|CNS08MSY Single read from an extremity of a full-...	70	7e-09
212	emb|BX018003.1|CNS08M1Z Single read from an extremity of a full-...	70	7e-09
213	emb|BX017981.1|CNS08M1D Single read from an extremity of a full-...	70	7e-09
214	emb|BX018524.1|CNS08MGG Single read from an extremity of a full-...	70	7e-09
215	emb|BX018377.1|CNS08MCD Single read from an extremity of a full-...	70	7e-09
216	emb|BX017737.1|CNS08LUL Single read from an extremity of a full-...	70	7e-09
217	emb|BX017331.1|CNS08LJB Single read from an extremity of a full-...	70	7e-09
218	emb|BX016524.1|CNS08KWW Single read from an extremity of a full-...	70	7e-09
219	emb|BX016411.1|CNS08KTR Single read from an extremity of a full-...	70	7e-09
220	emb|BX015958.1|CNS08KH6 Single read from an extremity of a full-...	70	7e-09
221	emb|BX014218.1|CNS08J4U Single read from an extremity of a full-...	70	7e-09
222	emb|BX013506.1|CNS08IL2 Single read from an extremity of a full-...	70	7e-09
223	emb|BX013505.1|CNS08IL1 Single read from an extremity of a full-...	70	7e-09
224	emb|BX013494.1|CNS08IKQ Single read from an extremity of a full-...	70	7e-09
225	emb|BX012299.1|CNS08HNJ Single read from an extremity of a full-...	70	7e-09
226	emb|BX010378.1|CNS08G66 Single read from an extremity of a full-...	70	7e-09
227	emb|BX009864.1|CNS08FRW Single read from an extremity of a full-...	70	7e-09
228	emb|BX009834.1|CNS08FR2 Single read from an extremity of a full-...	70	7e-09
229	emb|BX008448.1|CNS08EOK Single read from an extremity of a full-...	70	7e-09
230	emb|BX008129.1|CNS08EFP Single read from an extremity of a full-...	70	7e-09
231	emb|BX008128.1|CNS08EFO Single read from an extremity of a full-...	70	7e-09
232	emb|BX007575.1|CNS08E0B Single read from an extremity of a full-...	70	7e-09
233	emb|BX006812.1|CNS08DF4 Single read from an extremity of a full-...	70	7e-09
234	emb|BX005817.1|CNS08CNH Single read from an extremity of a full-...	70	7e-09
235	gb|BC065432.1| Danio rerio ribosomal protein L8, mRNA (cDNA clon...	70	7e-09
236	emb|AL111256.1|CNS0196O Botrytis cinerea strain T4 cDNA library	70	7e-09
237	gb|AF401561.1| Ictalurus punctatus ribosomal protein L8 mRNA, co...	70	7e-09
238	gb|AY168762.1| Branchiostoma belcheri tsingtaunese ribosomal pro...	70	7e-09
239	dbj|AB180407.1| Plutella xylostella mRNA for Ribosomal protein L...	70	7e-09
240	ref|XM_315817.2| Anopheles gambiae str. PEST ENSANGP00000010416 ...	70	7e-09
241	dbj|AK108964.1| Oryza sativa (japonica cultivar-group) cDNA clon...	70	7e-09
242	dbj|AK108169.1| Oryza sativa (japonica cultivar-group) cDNA clon...	70	7e-09
243	emb|BX046386.1|CNS097YE Single read from an extremity of a full-...	68	3e-08
244	emb|AJ414568.1| Paracentrotus mRNA for ribosomal protein L8 (suL...	68	3e-08
245	emb|AL115964.1|CNS01CTG Botrytis cinerea strain T4 cDNA library	68	3e-08
246	gb|BC043017.1| Mus musculus ribosomal protein L8, mRNA (cDNA clo...	66	1e-07
247	ref|NM_012053.1| Mus musculus ribosomal protein L8 (Rpl8), mRNA	66	1e-07
248	ref|XM_453766.1| Kluyveromyces lactis NRRL Y-1140, KLLA0D16027g ...	66	1e-07
249	emb|BX054108.1|CNS09DWW Single read from an extremity of a full-...	66	1e-07
250	emb|BX007182.1|CNS08DPE Single read from an extremity of a full-...	66	1e-07
251	emb|BX005504.1|CNS08CES Single read from an extremity of a full-...	66	1e-07
252	emb|CR382124.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso...	66	1e-07
253	dbj|AK131970.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu...	66	1e-07
254	dbj|AK145498.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f...	66	1e-07
255	dbj|AK146330.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-...	66	1e-07
256	dbj|AK152063.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	66	1e-07
257	dbj|AK151408.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	66	1e-07
258	dbj|AK167775.1| Mus musculus cDNA, RIKEN full-length enriched li...	66	1e-07
259	dbj|AK168769.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu...	66	1e-07
260	dbj|AK168332.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length...	66	1e-07
261	dbj|AK088263.1| Mus musculus 2 days neonate thymus thymic cells ...	66	1e-07
262	gb|U67771.1|MMU67771 Mus musculus ribosomal protein L8 (RPL8) mR...	66	1e-07
263	ref|XM_505841.1| Yarrowia lipolytica CLIB122, YALI0F24739g predi...	64	4e-07
264	dbj|AK175100.1| Ciona intestinalis cDNA, clone:cixxx00151, full ...	64	4e-07
265	dbj|AK175099.1| Ciona intestinalis cDNA, clone:cixxx00150, full ...	64	4e-07
266	dbj|AK174301.1| Ciona intestinalis cDNA, clone:cicl028m21, full ...	64	4e-07
267	emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1...	64	4e-07
268	ref|XM_369754.1| Magnaporthe grisea 70-15 hypothetical protein (...	62	2e-06
269	ref|XM_322498.1| Neurospora crassa OR74A hypothetical protein ( ...	62	2e-06
270	ref|XM_952206.1| Neurospora crassa OR74A hypothetical protein ( ...	62	2e-06
271	gb|AF481057.1| Aplysia californica ribosomal protein L8 mRNA, pa...	62	2e-06
272	emb|BX060935.1|CNS09J6J Single read from an extremity of a full-...	62	2e-06
273	emb|BX063741.1|CNS09LCH Single read from an extremity of a full-...	62	2e-06
274	emb|BX055232.1|CNS09ES4 Single read from an extremity of a full-...	62	2e-06
275	emb|BX052582.1|CNS09CQI Single read from an extremity of a full-...	62	2e-06
276	emb|BX052386.1|CNS09CL2 Single read from an extremity of a full-...	62	2e-06
277	emb|BX044908.1|CNS096TC Single read from an extremity of a full-...	62	2e-06
278	emb|BX043909.1|CNS0961L Single read from an extremity of a full-...	62	2e-06
279	emb|BX036920.1|CNS090NG Single read from an extremity of a full-...	62	2e-06
280	emb|BX025869.1|CNS08S4H Single read from an extremity of a full-...	62	2e-06
281	emb|BX022874.1|CNS08PTA Single read from an extremity of a full-...	62	2e-06
282	emb|BX021963.1|CNS08P3Z Single read from an extremity of a full-...	62	2e-06
283	emb|BX012237.1|CNS08HLT Single read from an extremity of a full-...	62	2e-06
284	emb|BX010208.1|CNS08G1G Single read from an extremity of a full-...	62	2e-06
285	emb|BX008408.1|CNS08ENG Single read from an extremity of a full-...	62	2e-06
286	emb|BX007216.1|CNS08DQC Single read from an extremity of a full-...	62	2e-06
287	gb|AF440009.1|AF440009 Talaromyces emersonii 60S ribosomal prote...	62	2e-06
288	ref|XM_628385.1| Cryptosporidium parvum Iowa II 60S ribosomal pr...	62	2e-06
289	gb|AY130440.1| Danio rerio ribosomal protein L8-like mRNA, parti...	62	2e-06
290	gb|AY130436.1| Branchiostoma lanceolatum ribosomal protein L8 mR...	62	2e-06
291	gb|DQ206473.1| Platynereis dumerilii isolate TOA23 ribosomal pro...	62	2e-06
292	gb|AF057288.1|AF057288 Aplysia californica ribosomal protein L8 ...	62	2e-06
293	gb|AY829774.1| Lonomia obliqua ribosomal protein 17 mRNA, comple...	60	7e-06
294	ref|XM_791845.1| PREDICTED: Strongylocentrotus purpuratus simila...	60	7e-06
295	emb|BX036193.1|CNS09039 Single read from an extremity of a full-...	60	7e-06
296	ref|XM_790908.1| PREDICTED: Strongylocentrotus purpuratus simila...	60	7e-06
297	gb|AY857413.1| Suberites domuncula L2/L8 mRNA, partial cds	60	7e-06
298	ref|XM_568209.1| Cryptococcus neoformans var. neoformans JEC21 h...	58	3e-05
299	emb|BX036225.1|CNS09045 Single read from an extremity of a full-...	58	3e-05
300	emb|BX006811.1|CNS08DF3 Single read from an extremity of a full-...	58	3e-05
301	ref|NM_075539.2| Caenorhabditis elegans Ribosomal Protein, Large...	58	3e-05
302	emb|Z81453.1|CEB0250 Caenorhabditis elegans Cosmid B0250, comple...	58	3e-05
303	gb|AE017352.1| Cryptococcus neoformans var. neoformans JEC21 chr...	56	1e-04
304	ref|XM_654787.1| Aspergillus nidulans FGSC A4 hypothetical prote...	56	1e-04
305	ref|XM_757274.1| Ustilago maydis 521 hypothetical protein (UM062...	56	1e-04
306	ref|XM_748904.1| Aspergillus fumigatus Af293 60s ribosomal prote...	56	1e-04
307	ref|XM_661983.1| Cryptosporidium hominis TU502 60S ribosomal pro...	56	1e-04
308	emb|BX070723.1|CNS09QQF Single read from an extremity of a full-...	56	1e-04
309	gb|AY130438.1| Petromyzon marinus ribosomal protein L8 mRNA, par...	56	1e-04
310	dbj|AB010072.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	56	1e-04
311	gb|BC059744.1| Xenopus tropicalis 60S ribosomal protein L8, mRNA...	54	4e-04
312	ref|XM_387107.1| Gibberella zeae PH-1 chromosome 4 hypothetical ...	54	4e-04
313	gb|BC043823.1| Xenopus laevis ribosomal protein L8, mRNA (cDNA c...	54	4e-04
314	ref|XM_773289.1| Giardia lamblia ATCC 50803 60S ribosomal protei...	54	4e-04
315	emb|BX068768.1|CNS09P84 Single read from an extremity of a full-...	54	4e-04
316	emb|BX066573.1|CNS09NJ5 Single read from an extremity of a full-...	54	4e-04
317	emb|BX064210.1|CNS09LPI Single read from an extremity of a full-...	54	4e-04
318	emb|BX061860.1|CNS09JW8 Single read from an extremity of a full-...	54	4e-04
319	emb|BX058354.1|CNS09H6U Single read from an extremity of a full-...	54	4e-04
320	emb|BX053072.1|CNS09D44 Single read from an extremity of a full-...	54	4e-04
321	emb|BX052868.1|CNS09CYG Single read from an extremity of a full-...	54	4e-04
322	emb|BX052221.1|CNS09CGH Single read from an extremity of a full-...	54	4e-04
323	emb|BX050253.1|CNS09AXT Single read from an extremity of a full-...	54	4e-04
324	emb|BX050252.1|CNS09AXS Single read from an extremity of a full-...	54	4e-04
325	emb|BX047421.1|CNS098R5 Single read from an extremity of a full-...	54	4e-04
326	emb|BX033148.1|CNS08XQO Single read from an extremity of a full-...	54	4e-04
327	emb|BX025144.1|CNS08RKC Single read from an extremity of a full-...	54	4e-04
328	emb|BX025032.1|CNS08RH8 Single read from an extremity of a full-...	54	4e-04
329	emb|BX022054.1|CNS08P6I Single read from an extremity of a full-...	54	4e-04
330	emb|BX018523.1|CNS08MGF Single read from an extremity of a full-...	54	4e-04
331	emb|BX017330.1|CNS08LJA Single read from an extremity of a full-...	54	4e-04
332	emb|BX016910.1|CNS08L7M Single read from an extremity of a full-...	54	4e-04
333	emb|BX013459.1|CNS08IJR Single read from an extremity of a full-...	54	4e-04
334	emb|BX012210.1|CNS08HL2 Single read from an extremity of a full-...	54	4e-04
335	emb|BX010377.1|CNS08G65 Single read from an extremity of a full-...	54	4e-04
336	gb|AE016817.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10...	54	4e-04
337	ref|NM_001026174.2| Caenorhabditis elegans B0250.3 (B0250.3) mRN...	54	4e-04
338	ref|NM_203594.1| Xenopus tropicalis 60S ribosomal protein L8 (MG...	54	4e-04
339	dbj|AB089491.1| Giardia intestinalis gene for ribosomal protein ...	54	4e-04
340	ref|NM_209322.1| Eremothecium gossypii ADL127Cp (ADL127C), mRNA	54	4e-04
341	emb|CR760793.2| Xenopus tropicalis finished cDNA, clone TTpA008p15	54	4e-04
342	gb|U00920.1|U00920 Xenopus laevis ribosomal protein L8 mRNA, com...	54	4e-04
343	ref|NM_001034916.2| Rattus norvegicus ribosomal protein L8 (Rpl8...	50	0.006
344	emb|AL031229.2|HS15D7 Human DNA sequence from clone RP1-15D7 on ...	50	0.006
345	emb|BX057209.1|CNS09GB1 Single read from an extremity of a full-...	50	0.006
346	emb|BX034140.1|CNS08YI8 Single read from an extremity of a full-...	50	0.006
347	emb|BX008695.1|CNS08EVF Single read from an extremity of a full-...	50	0.006
348	emb|X62145.1|RRRPL8 R.rattus mRNA for ribosomal protein L8	50	0.006
349	emb|AL929353.1|PFA929353 Plasmodium falciparum strain 3D7, chrom...	50	0.006
350	emb|AL445067.1|TACID5 Thermoplasma acidophilum complete genome; ...	50	0.006
351	gb|AC069218.13| Homo sapiens 3 BAC RP11-393N4 (Roswell Park Canc...	50	0.006
352	emb|AL112347.1|CNS01A0Z Botrytis cinerea strain T4 cDNA library	50	0.006
353	dbj|AB011475.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	50	0.006
354	gb|AY389974.1| Latimeria chalumnae ribosomal protein L8 mRNA, pa...	48	0.025
355	gb|DQ206502.1| Priapulus caudatus isolate TOA23 ribosomal protei...	48	0.025
356	ref|XM_853403.1| PREDICTED: Canis familiaris similar to 60S ribo...	46	0.099
357	ref|XM_853369.1| PREDICTED: Canis familiaris similar to 60S ribo...	46	0.099
358	ref|XM_532360.2| PREDICTED: Canis familiaris similar to 60S ribo...	46	0.099
359	ref|XM_719533.1| Plasmodium yoelii yoelii str. 17XNL 60S ribosom...	46	0.099
360	ref|XM_849369.1| PREDICTED: Canis familiaris similar to 60S ribo...	46	0.099
361	emb|BX070722.1|CNS09QQE Single read from an extremity of a full-...	46	0.099
362	emb|BX065161.1|CNS09MFX Single read from an extremity of a full-...	46	0.099
363	emb|BX044907.1|CNS096TB Single read from an extremity of a full-...	46	0.099
364	emb|BX019695.1|CNS08NCZ Single read from an extremity of a full-...	46	0.099
365	emb|BX571661.1| Wolinella succinogenes, complete genome; segment...	46	0.099
366	dbj|AB226245.1| Aspergillus oryzae cDNA, contig sequence: AoEST3104	46	0.099
367	gb|AY967668.1| Schmidtea mediterranea clone NBE.7.02A mRNA sequence	46	0.099
368	gb|DQ206602.1| Monosiga brevicollis isolate TOA23 ribosomal prot...	46	0.099
369	gb|AY871293.1| Gekko japonicus GekBS074P mRNA, complete cds	46	0.099
370	gb|AY067189.1| Schmidtea mediterranea clone HB.15.4h unknown mRN...	46	0.099
371	ref|XM_416772.1| PREDICTED: Gallus gallus similar to 60S ribosom...	44	0.39
372	gb|AY452063.1| Rana catesbeiana ribosomal protein L8 mRNA, parti...	44	0.39
373	gb|AC098683.18| Mus musculus strain 129/Sv clone ct7-128f23 map ...	44	0.39
374	gb|AC115293.5| Mus musculus BAC clone RP23-92N2 from chromosome ...	44	0.39
375	emb|BX569793.13| Zebrafish DNA sequence from clone DKEY-183K8 in...	44	0.39
376	gb|AC098684.13| Mus musculus strain 129/Sv clone ct7-391l15 map ...	44	0.39
377	emb|BX088541.17| Zebrafish DNA sequence from clone CH211-244I2 i...	44	0.39
378	emb|BX935284.2| Gallus gallus finished cDNA, clone ChEST961c19	44	0.39
379	emb|BX933795.2| Gallus gallus finished cDNA, clone ChEST911e3	44	0.39
380	emb|CR386367.1| Gallus gallus finished cDNA, clone ChEST931o12	44	0.39
381	emb|AL111994.1|CNS019R6 Botrytis cinerea strain T4 cDNA library	44	0.39
382	gb|AC156029.2| Mus musculus BAC clone RP23-42O8 from chromosome ...	44	0.39
383	emb|BX935079.1| Gallus gallus finished cDNA, clone ChEST72m12	44	0.39
384	gb|BC013104.1| Homo sapiens ribosomal protein L8, transcript var...	42	1.5
385	gb|CP000081.1| Leishmania major chromosome 35, complete sequence	42	1.5
386	gb|CP000127.1| Nitrosococcus oceani ATCC 19707, complete genome	42	1.5
387	ref|NM_000973.3| Homo sapiens ribosomal protein L8 (RPL8), trans...	42	1.5
388	ref|NM_033301.1| Homo sapiens ribosomal protein L8 (RPL8), trans...	42	1.5
389	ref|XM_838156.1| Leishmania major strain Friedlin 60S ribosomal ...	42	1.5
390	ref|XM_838157.1| Leishmania major strain Friedlin 60S ribosomal ...	42	1.5
391	gb|AY116659.1| Trimenia moorei ribosomal protein L2 (rpl2) gene,...	42	1.5
392	gb|BC002423.1| Homo sapiens ribosomal protein L8, mRNA (cDNA clo...	42	1.5
393	ref|XM_804562.1| Trypanosoma cruzi strain CL Brener 60S ribosoma...	42	1.5
394	ref|XM_805929.1| Trypanosoma cruzi strain CL Brener 60S ribosoma...	42	1.5
395	ref|XM_811273.1| Trypanosoma cruzi strain CL Brener 60S ribosoma...	42	1.5
396	gb|BC000047.2| Homo sapiens ribosomal protein L8, mRNA (cDNA clo...	42	1.5
397	gb|AE004288.1| Vibrio cholerae O1 biovar eltor str. N16961 chrom...	42	1.5
398	gb|BC000077.2| Homo sapiens ribosomal protein L8, transcript var...	42	1.5
399	emb|BX545856.10| Zebrafish DNA sequence from clone DKEY-216E24 i...	42	1.5
400	gb|BC021069.1| Homo sapiens cDNA clone IMAGE:2964491, **** WARNI...	42	1.5
401	gb|BC021039.1| Homo sapiens cDNA clone IMAGE:2964491, **** WARNI...	42	1.5
402	gb|BC090060.1| Homo sapiens cDNA clone IMAGE:6568950, **** WARNI...	42	1.5
403	gb|BC099919.1| Homo sapiens cDNA clone IMAGE:4549190, **** WARNI...	42	1.5
404	gb|BC015588.1| Homo sapiens cDNA clone IMAGE:4643311, **** WARNI...	42	1.5
405	emb|AL356794.10| Human DNA sequence from clone RP11-551A11 on ch...	42	1.5
406	gb|BT009875.1| Synthetic construct Homo sapiens ribosomal protei...	42	1.5
407	emb|Z28407.1|HSRBPL8 H.sapiens mRNA for ribosomal protein L8	42	1.5
408	emb|CR859970.1| Pongo pygmaeus mRNA; cDNA DKFZp468G132 (from clo...	42	1.5
409	emb|CR457046.1| Homo sapiens full open reading frame cDNA clone ...	42	1.5
410	gb|BT007379.1| Homo sapiens ribosomal protein L8 mRNA, complete cds	42	1.5
411	gb|BC012197.1| Homo sapiens ribosomal protein L8, transcript var...	42	1.5
412	emb|CR615771.1| full-length cDNA clone CS0DA007YK24 of Neuroblas...	42	1.5
413	emb|CR626383.1| full-length cDNA clone CS0DC017YA07 of Neuroblas...	42	1.5
414	emb|CR625384.1| full-length cDNA clone CS0DJ005YH06 of T cells (...	42	1.5
415	emb|CR625112.1| full-length cDNA clone CS0DJ013YB05 of T cells (...	42	1.5
416	emb|CR624942.1| full-length cDNA clone CS0DB004YO19 of Neuroblas...	42	1.5
417	emb|CR623747.1| full-length cDNA clone CS0DL002YC07 of B cells (...	42	1.5
418	emb|CR623386.1| full-length cDNA clone CS0DC016YE12 of Neuroblas...	42	1.5
419	emb|CR619989.1| full-length cDNA clone CS0DI087YD17 of Placenta ...	42	1.5
420	emb|CR614795.1| full-length cDNA clone CS0DG007YO04 of B cells (...	42	1.5
421	emb|CR614597.1| full-length cDNA clone CS0DK003YN23 of HeLa cell...	42	1.5
422	emb|CR612339.1| full-length cDNA clone CS0DF019YP10 of Fetal bra...	42	1.5
423	emb|CR611740.1| full-length cDNA clone CS0DJ005YH14 of T cells (...	42	1.5
424	emb|CR610036.1| full-length cDNA clone CS0DL002YC15 of B cells (...	42	1.5
425	emb|CR607220.1| full-length cDNA clone CS0DB007YI18 of Neuroblas...	42	1.5
426	emb|CR606016.1| full-length cDNA clone CS0DJ014YC19 of T cells (...	42	1.5
427	emb|CR605549.1| full-length cDNA clone CS0DI051YJ22 of Placenta ...	42	1.5
428	emb|CR604122.1| full-length cDNA clone CS0DC004YG24 of Neuroblas...	42	1.5
429	emb|CR604065.1| full-length cDNA clone CS0DD005YI10 of Neuroblas...	42	1.5
430	emb|CR603238.1| full-length cDNA clone CL0BA003ZC08 of Placenta ...	42	1.5
431	emb|CR601765.1| full-length cDNA clone CS0DI015YA02 of Placenta ...	42	1.5
432	emb|CR601648.1| full-length cDNA clone CS0DI025YJ10 of Placenta ...	42	1.5
433	emb|CR601133.1| full-length cDNA clone CS0DB005YD21 of Neuroblas...	42	1.5
434	emb|CR599267.1| full-length cDNA clone CS0CAP005YM14 of Thymus o...	42	1.5
435	emb|CR599190.1| full-length cDNA clone CS0DK003YE12 of HeLa cell...	42	1.5
436	emb|CR599063.1| full-length cDNA clone CS0DC008YC19 of Neuroblas...	42	1.5
437	emb|CR596459.1| full-length cDNA clone CS0DK008YJ05 of HeLa cell...	42	1.5
438	emb|CR595877.1| full-length cDNA clone CS0DK006YP04 of HeLa cell...	42	1.5
439	emb|CR595000.1| full-length cDNA clone CS0DL010YC19 of B cells (...	42	1.5
440	emb|CR592009.1| full-length cDNA clone CS0DM014YC11 of Fetal liv...	42	1.5
441	emb|CR590460.1| full-length cDNA clone CS0DC024YH14 of Neuroblas...	42	1.5
442	emb|CR590177.1| full-length cDNA clone CS0DI071YE07 of Placenta ...	42	1.5
443	gb|BC093064.1| Homo sapiens ribosomal protein L8, transcript var...	42	1.5
444	gb|AY961525.1| Lysiphlebus testaceipes ribosomal protein L8 (RpL...	42	1.5
445	gb|AY892765.1| Synthetic construct Homo sapiens clone FLH024583....	42	1.5
446	gb|AY892421.1| Synthetic construct Homo sapiens clone FLH028535....	42	1.5
447	gb|AY890288.1| Synthetic construct Homo sapiens clone FLH024588....	42	1.5
448	gb|AY890287.1| Synthetic construct Homo sapiens clone FLH024587....	42	1.5
449	gb|AY889944.1| Synthetic construct Homo sapiens clone FLH028539....	42	1.5
450	gb|DQ206527.1| Suberites fuscus isolate TOA23 ribosomal protein ...	42	1.5
451	gb|BC030151.2| Homo sapiens ribosomal protein L8, transcript var...	42	1.5
452	gb|AC152111.1| Pichia stipitis clone JGIAHYZ-17L1, complete sequ...	40	6.1
453	ref|XM_507655.1| PREDICTED: Pan troglodytes similar to chromosom...	40	6.1
454	gb|AC161505.4| Mus musculus chromosome 8, clone RP24-307K17, com...	40	6.1
455	gb|AC157554.7| Mus musculus chromosome 15, clone RP24-324P21, co...	40	6.1
456	ref|XM_458992.1| Debaryomyces hansenii CBS767 hypothetical prote...	40	6.1
457	ref|XM_457613.1| Debaryomyces hansenii CBS767 hypothetical prote...	40	6.1
458	ref|NM_153256.2| Homo sapiens chromosome 10 open reading frame 4...	40	6.1
459	gb|AY813786.1| Schistosoma japonicum SJCHGC01239 protein mRNA, c...	40	6.1
460	gb|AC137096.10| Mus musculus chromosome 8, clone RP24-473D4, com...	40	6.1
461	gb|BC017269.2| Homo sapiens chromosome 10 open reading frame 47,...	40	6.1
462	gb|AC127677.4| Mus musculus BAC clone RP24-226C2 from chromosome...	40	6.1
463	gb|CP000107.1| Ehrlichia canis str. Jake, complete genome	40	6.1
464	emb|AL138898.19| Human DNA sequence from clone RP11-401F24 on ch...	40	6.1
465	emb|BX012209.1|CNS08HL1 Single read from an extremity of a full-...	40	6.1
466	emb|CR628337.1| Legionella pneumophila str. Lens complete genome	40	6.1
467	emb|CR382136.1| Debaryomyces hansenii chromosome D of strain CBS...	40	6.1
468	emb|CR382134.1| Debaryomyces hansenii chromosome B of strain CBS...	40	6.1
469	dbj|AP008230.1| Desulfitobacterium hafniense Y51 genomic DNA, co...	40	6.1
470	emb|CR621861.1| full-length cDNA clone CS0DK003YK10 of HeLa cell...	40	6.1
471	gb|CP000264.1| Jannaschia sp. CCS1, complete genome	40	6.1
472	ref|XM_697241.1| PREDICTED: Danio rerio hypothetical protein LOC...	40	6.1
473	gb|AE006470.1| Chlorobium tepidum TLS, complete genome	40	6.1
474	dbj|BA000003.2| Buchnera aphidicola str. APS (Acyrthosiphon pisu...	40	6.1
475	gb|AY325816.1| Zea mays BAC clone Z013I05, complete sequence	40	6.1
476	gb|BC048800.1| Homo sapiens chromosome 10 open reading frame 47,...	40	6.1
477	gb|AC172370.2| Gallus gallus BAC clone CH261-119J18 from chromos...	40	6.1

---

>gb|AF479049.1| Triticum aestivum ribosomal protein L2 mRNA, partial cds
          Length = 270

 Score =  450 bits (227), Expect = e-123
 Identities = 259/270 (95%)
 Strand = Plus / Minus

                                                                       
Query: 143 ctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgaccagt 202
           ||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||
Sbjct: 270 ctaagtggccttgtcggccttggcagcagaggcggcagcctggcctctgagacgaccagt 211

                                                                       
Query: 203 cctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagtgga 262
           |||||| ||||| |||||||||||||||||||| ||||||||||||||||| ||||||||
Sbjct: 210 cctcctagcagcgatgagaccaaccttctggccaggtggtgcatcacggcggacagtgga 151

                                                                       
Query: 263 agcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggc 322
           ||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 150 agcgtgaccaatatgctggtggttacctcctccgtggggatgctccacagggttcatggc 91

                                                                       
Query: 323 cacaccacgcaccttangccaggagttcctcttcacacggtacttgtggtaggcgttacc 382
           |||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 90  cacaccacgcaccttaggccacgagttcctcttcacacggtacttgtggtaggcgttacc 31

                                         
Query: 383 agccttcagcattggcttctcagtcctgcc 412
           |||||| |||||||||||||||||||||||
Sbjct: 30  agccttgagcattggcttctcagtcctgcc 1

---

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score =  424 bits (214), Expect = e-115
 Identities = 287/312 (91%)
 Strand = Plus / Minus

                                                                            
Query: 140      actctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgacc 199
                |||||||||||||||||||||||| ||||| |  ||||| ||||||||||| ||||||||
Sbjct: 23385250 actctaagtggccttgtcggccttggcagcggtagcggcggcctggcctctgagacgacc 23385191

                                                                            
Query: 200      agtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagt 259
                ||||||||| ||||| |||||||||||||||||||| || |||||||||||||| || ||
Sbjct: 23385190 agtcctccttgcagcgatgagaccaaccttctggccaggaggtgcatcacggcggacggt 23385131

                                                                            
Query: 260      ggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcat 319
                ||| || |||||||| ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 23385130 ggaggcgtgaccaatgtgctggtggttacctcctccgtggggatgctcaacggggttcat 23385071

                                                                            
Query: 320      ggccacaccacgcaccttangccaggagttcctcttcacacggtacttgtggtaggcgtt 379
                ||||||||||||||||||| ||||| ||||||||||||| ||||||||||||||||||||
Sbjct: 23385070 ggccacaccacgcaccttaggccagcagttcctcttcacgcggtacttgtggtaggcgtt 23385011

                                                                            
Query: 380      accagccttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatcatagc 439
                 |||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||| ||
Sbjct: 23385010 tccagccttgagcatcggcttctcagtcctgccaccaccagcaacctgaccgatcatggc 23384951

                            
Query: 440      acggnagctgct 451
                |||| |||||||
Sbjct: 23384950 acggcagctgct 23384939



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                                
Query: 47       accaaagtaccgagcaaaaacgacaaccttactgcaatacatgtcctt 94
                |||| |||||| ||||||||  || ||| ||||| |||||||||||||
Sbjct: 23385354 accagagtaccaagcaaaaagcacgaccatactggaatacatgtcctt 23385307

---

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  424 bits (214), Expect = e-115
 Identities = 287/312 (91%)
 Strand = Plus / Minus

                                                                            
Query: 140      actctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgacc 199
                |||||||||||||||||||||||| ||||| |  ||||| ||||||||||| ||||||||
Sbjct: 23313441 actctaagtggccttgtcggccttggcagcggtagcggcggcctggcctctgagacgacc 23313382

                                                                            
Query: 200      agtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagt 259
                ||||||||| ||||| |||||||||||||||||||| || |||||||||||||| || ||
Sbjct: 23313381 agtcctccttgcagcgatgagaccaaccttctggccaggaggtgcatcacggcggacggt 23313322

                                                                            
Query: 260      ggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcat 319
                ||| || |||||||| ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 23313321 ggaggcgtgaccaatgtgctggtggttacctcctccgtggggatgctcaacggggttcat 23313262

                                                                            
Query: 320      ggccacaccacgcaccttangccaggagttcctcttcacacggtacttgtggtaggcgtt 379
                ||||||||||||||||||| ||||| ||||||||||||| ||||||||||||||||||||
Sbjct: 23313261 ggccacaccacgcaccttaggccagcagttcctcttcacgcggtacttgtggtaggcgtt 23313202

                                                                            
Query: 380      accagccttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatcatagc 439
                 |||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||| ||
Sbjct: 23313201 tccagccttgagcatcggcttctcagtcctgccaccaccagcaacctgaccgatcatggc 23313142

                            
Query: 440      acggnagctgct 451
                |||| |||||||
Sbjct: 23313141 acggcagctgct 23313130



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                                
Query: 47       accaaagtaccgagcaaaaacgacaaccttactgcaatacatgtcctt 94
                |||| |||||| ||||||||  || ||| ||||| |||||||||||||
Sbjct: 23313545 accagagtaccaagcaaaaagcacgaccatactggaatacatgtcctt 23313498

---

>emb|AL731784.3|CNS08C88 Oryza sativa chromosome 12, . BAC OSJNBa0016C14 of library OSJNBa from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 162261

 Score =  424 bits (214), Expect = e-115
 Identities = 287/312 (91%)
 Strand = Plus / Plus

                                                                          
Query: 140    actctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgacc 199
              |||||||||||||||||||||||| ||||| |  ||||| ||||||||||| ||||||||
Sbjct: 116909 actctaagtggccttgtcggccttggcagcggtagcggcggcctggcctctgagacgacc 116968

                                                                          
Query: 200    agtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagt 259
              ||||||||| ||||| |||||||||||||||||||| || |||||||||||||| || ||
Sbjct: 116969 agtcctccttgcagcgatgagaccaaccttctggccaggaggtgcatcacggcggacggt 117028

                                                                          
Query: 260    ggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcat 319
              ||| || |||||||| ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 117029 ggaggcgtgaccaatgtgctggtggttacctcctccgtggggatgctcaacggggttcat 117088

                                                                          
Query: 320    ggccacaccacgcaccttangccaggagttcctcttcacacggtacttgtggtaggcgtt 379
              ||||||||||||||||||| ||||| ||||||||||||| ||||||||||||||||||||
Sbjct: 117089 ggccacaccacgcaccttaggccagcagttcctcttcacgcggtacttgtggtaggcgtt 117148

                                                                          
Query: 380    accagccttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatcatagc 439
               |||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||| ||
Sbjct: 117149 tccagccttgagcatcggcttctcagtcctgccaccaccagcaacctgaccgatcatggc 117208

                          
Query: 440    acggnagctgct 451
              |||| |||||||
Sbjct: 117209 acggcagctgct 117220



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                              
Query: 47     accaaagtaccgagcaaaaacgacaaccttactgcaatacatgtcctt 94
              |||| |||||| ||||||||  || ||| ||||| |||||||||||||
Sbjct: 116805 accagagtaccaagcaaaaagcacgaccatactggaatacatgtcctt 116852

---

>dbj|AK104806.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-E03, full
           insert sequence
          Length = 1037

 Score =  416 bits (210), Expect = e-113
 Identities = 286/312 (91%)
 Strand = Plus / Minus

                                                                       
Query: 140 actctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgacc 199
           |||||||||||||||||||| ||| ||||| |  ||||| ||||||||||| ||||||||
Sbjct: 854 actctaagtggccttgtcggtcttggcagcggtagcggcggcctggcctctgagacgacc 795

                                                                       
Query: 200 agtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagt 259
           ||||||||| ||||| |||||||||||||||||||| || |||||||||||||| || ||
Sbjct: 794 agtcctccttgcagcgatgagaccaaccttctggccaggaggtgcatcacggcggacggt 735

                                                                       
Query: 260 ggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcat 319
           ||| || |||||||| ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 734 ggaggcgtgaccaatgtgctggtggttacctcctccgtggggatgctcaacggggttcat 675

                                                                       
Query: 320 ggccacaccacgcaccttangccaggagttcctcttcacacggtacttgtggtaggcgtt 379
           ||||||||||||||||||| ||||| ||||||||||||| ||||||||||||||||||||
Sbjct: 674 ggccacaccacgcaccttaggccagcagttcctcttcacgcggtacttgtggtaggcgtt 615

                                                                       
Query: 380 accagccttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatcatagc 439
            |||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||| ||
Sbjct: 614 tccagccttgagcatcggcttctcagtcctgccaccaccagcaacctgaccgatcatggc 555

                       
Query: 440 acggnagctgct 451
           |||| |||||||
Sbjct: 554 acggcagctgct 543



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 47  accaaagtaccgagcaaaaacgacaaccttactgcaatacatgtcctt 94
           |||| |||||| ||||||||  || ||| ||||| |||||||||||||
Sbjct: 958 accagagtaccaagcaaaaagcacgaccatactggaatacatgtcctt 911

---

>dbj|AK070647.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023063F19, full
           insert sequence
          Length = 1072

 Score =  416 bits (210), Expect = e-113
 Identities = 286/312 (91%)
 Strand = Plus / Minus

                                                                       
Query: 140 actctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgacc 199
           |||||||||||||||||||||||| ||||| |  ||||| ||||||||||| ||||||||
Sbjct: 855 actctaagtggccttgtcggccttggcagcggtagcggcggcctggcctctgagacgacc 796

                                                                       
Query: 200 agtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagt 259
           ||||||||| ||||| |||||||||||||||||||| || |||||||||||||| || ||
Sbjct: 795 agtcctccttgcagcgatgagaccaaccttctggccaggaggtgcatcacggcggacggt 736

                                                                       
Query: 260 ggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcat 319
           ||| || |||||||| ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 735 ggaggcgtgaccaatgtgctggtggttacctcctccgtggggatgctcaacggggttcat 676

                                                                       
Query: 320 ggccacaccacgcaccttangccaggagttcctcttcacacggtacttgtggtaggcgtt 379
           |||||||||||||||| || ||||| ||||||||||||| ||||||||||||||||||||
Sbjct: 675 ggccacaccacgcaccctaggccagcagttcctcttcacgcggtacttgtggtaggcgtt 616

                                                                       
Query: 380 accagccttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatcatagc 439
            |||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||| ||
Sbjct: 615 tccagccttgagcatcggcttctcagtcctgccaccaccagcaacctgaccgatcatggc 556

                       
Query: 440 acggnagctgct 451
           |||| |||||||
Sbjct: 555 acggcagctgct 544



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 47  accaaagtaccgagcaaaaacgacaaccttactgcaatacatgtcctt 94
           |||| |||||| ||||||||  || ||| ||||| |||||||||||||
Sbjct: 959 accagagtaccaagcaaaaagcacgaccatactggaatacatgtcctt 912

---

>gb|AY108123.1| Zea mays PCO067267 mRNA sequence
          Length = 1062

 Score =  363 bits (183), Expect = 3e-97
 Identities = 274/305 (89%)
 Strand = Plus / Minus

                                                                       
Query: 149 ggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcct 208
           ||||||||| ||||| |||||||  || ||||| ||||| |||||||||||||| |||||
Sbjct: 876 ggccttgtcagccttggcagcagtagcagcagcttggcccctaagacgaccagttctcct 817

                                                                       
Query: 209 ggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatg 268
            || ||||| ||||||||||||||||| || || ||||||||||| |||||||| |||||
Sbjct: 816 tgcggcaataagaccaaccttctggccaggaggagcatcacggcggacagtggaggcatg 757

                                                                       
Query: 269 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
           |||||| |||||||||||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 756 accaatgtgctggtggttacctcctccatgaggatgctcaacagggttcatggccacacc 697

                                                                       
Query: 329 acgcaccttangccaggagttcctcttcacacggtacttgtggtaggcgttaccagcctt 388
           |||||||||| |||||  ||||||||| || ||||||||||||||||| || ||||||||
Sbjct: 696 acgcaccttaggccagctgttcctcttgacgcggtacttgtggtaggcattgccagcctt 637

                                                                       
Query: 389 cagcattggcttctcagtcctgccaccaccagcaacctgaccaatcatagcacggnagct 448
           ||||||||||||||||||||||||||||||||| ||||| |||||||| |||||| ||||
Sbjct: 636 cagcattggcttctcagtcctgccaccaccagcgacctgcccaatcatggcacggcagct 577

                
Query: 449 gcttg 453
            ||||
Sbjct: 576 acttg 572

---

>gb|AY105581.1| Zea mays PCO150618 mRNA sequence
          Length = 1102

 Score =  311 bits (157), Expect = 1e-81
 Identities = 275/315 (87%)
 Strand = Plus / Minus

                                                                       
Query: 137 ataactctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacg 196
           ||||||||| ||||||||||| ||||| |  || | ||| ||||| || || || || | 
Sbjct: 863 ataactctaggtggccttgtcagccttggaggctgtggcagcagcttgacccctgagcct 804

                                                                       
Query: 197 accagtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaac 256
            ||||||||||| || ||||||||||||||||||||||| || || || || ||||| ||
Sbjct: 803 tccagtcctcctagcggcaatgagaccaaccttctggccagggggagcgtctcggcggac 744

                                                                       
Query: 257 agtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggtt 316
           ||| || || ||||| || || ||||||||||||||||||||||||||||| ||||||||
Sbjct: 743 agtagaggcgtgaccgatgtgttggtggttacctcctccgtggggatgctccacagggtt 684

                                                                       
Query: 317 catggccacaccacgcaccttangccaggagttcctcttcacacggtacttgtggtaggc 376
           |||||||||||||||||||||  |||||  ||||||||||||||||||||||||||| ||
Sbjct: 683 catggccacaccacgcaccttgggccagctgttcctcttcacacggtacttgtggtacgc 624

                                                                       
Query: 377 gttaccagccttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatcat 436
           |||||||||||| ||||| ||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 623 gttaccagccttgagcatcggcttctcagtcctgcctccaccagcaacctgcccaatcat 564

                          
Query: 437 agcacggnagctgct 451
           ||||||| |||||||
Sbjct: 563 agcacggcagctgct 549

---

>gb|AY109618.1| Zea mays CL8996_1 mRNA sequence
          Length = 1322

 Score =  299 bits (151), Expect = 4e-78
 Identities = 270/312 (86%)
 Strand = Plus / Minus

                                                                       
Query: 140 actctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgacc 199
           |||||| ||||||||||| ||||| |  || | ||| |||||||||||||| || |  ||
Sbjct: 864 actctaggtggccttgtcagccttggaggctgtggcagcagcctggcctctgagccttcc 805

                                                                       
Query: 200 agtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagt 259
           ||||||||| || ||||| ||||| |||||||||||       ||||| ||||| |||||
Sbjct: 804 agtcctcctagccgcaataagaccgaccttctggccannnnnagcatcgcggcggacagt 745

                                                                       
Query: 260 ggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcat 319
            || |||||||| ||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 744 agaggcatgaccgatatgctggtggttacctcctccgtggggatgctccacggggttcat 685

                                                                       
Query: 320 ggccacaccacgcaccttangccaggagttcctcttcacacggtacttgtggtaggcgtt 379
           |||||||||||| |||||  |||||  |||||||||||||||||||||| ||||||||||
Sbjct: 684 ggccacaccacggaccttgggccagctgttcctcttcacacggtacttggggtaggcgtt 625

                                                                       
Query: 380 accagccttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatcatagc 439
            |||||||||||||| ||||||||||||||||||||||| |||||||| |||||||| ||
Sbjct: 624 gccagccttcagcatcggcttctcagtcctgccaccaccggcaacctgcccaatcatggc 565

                       
Query: 440 acggnagctgct 451
           |||| |||||||
Sbjct: 564 acggcagctgct 553

---

>ref|NM_119780.2| Arabidopsis thaliana structural constituent of ribosome AT4G36130
           mRNA, complete cds
          Length = 1048

 Score =  264 bits (133), Expect = 2e-67
 Identities = 228/260 (87%)
 Strand = Plus / Minus

                                                                       
Query: 177 gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 236
           ||||| || ||||| ||||||||||||||||| |||||||| ||||||||||| |  || 
Sbjct: 800 gcagcttgacctctgagacgaccagtcctccttgcagcaataagaccaaccttttttcct 741

                                                                       
Query: 237 ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 296
           |||||||||||||| ||||||||   ||| ||||||||||| || |||||||||||||||
Sbjct: 740 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 681

                                                                       
Query: 297 tggggatgctcaacagggttcatggccacaccacgcaccttangccaggagttcctcttc 356
           || ||||||||||| || ||||| ||||||||||| |||||| ||||| |||| ||||||
Sbjct: 680 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 621

                                                                       
Query: 357 acacggtacttgtggtaggcgttaccagccttcagcattggcttctcagtcctgccacca 416
           ||||||||||||||||| |||||||||||||| ||||| |||||||| || || ||||||
Sbjct: 620 acacggtacttgtggtatgcgttaccagccttgagcatcggcttctctgttcttccacca 561

                               
Query: 417 ccagcaacctgaccaatcat 436
           || ||||| |||||||||||
Sbjct: 560 cctgcaacttgaccaatcat 541

---

>emb|AL161588.2|ATCHRIV84 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 84
          Length = 195452

 Score =  264 bits (133), Expect = 2e-67
 Identities = 228/260 (87%)
 Strand = Plus / Minus

                                                                          
Query: 177    gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 236
              ||||| || ||||| ||||||||||||||||| |||||||| ||||||||||| |  || 
Sbjct: 170391 gcagcttgacctctgagacgaccagtcctccttgcagcaataagaccaaccttttttcct 170332

                                                                          
Query: 237    ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 296
              |||||||||||||| ||||||||   ||| ||||||||||| || |||||||||||||||
Sbjct: 170331 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 170272

                                                                          
Query: 297    tggggatgctcaacagggttcatggccacaccacgcaccttangccaggagttcctcttc 356
              || ||||||||||| || ||||| ||||||||||| |||||| ||||| |||| ||||||
Sbjct: 170271 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 170212

                                                                          
Query: 357    acacggtacttgtggtaggcgttaccagccttcagcattggcttctcagtcctgccacca 416
              ||||||||||||||||| |||||||||||||| ||||| |||||||| || || ||||||
Sbjct: 170211 acacggtacttgtggtatgcgttaccagccttgagcatcggcttctctgttcttccacca 170152

                                  
Query: 417    ccagcaacctgaccaatcat 436
              || ||||| |||||||||||
Sbjct: 170151 cctgcaacttgaccaatcat 170132

---

>emb|AL022141.1|ATF23E13 Arabidopsis thaliana DNA chromosome 4, BAC clone F23E13 (ESSAII
            project)
          Length = 94695

 Score =  264 bits (133), Expect = 2e-67
 Identities = 228/260 (87%)
 Strand = Plus / Minus

                                                                        
Query: 177  gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 236
            ||||| || ||||| ||||||||||||||||| |||||||| ||||||||||| |  || 
Sbjct: 3218 gcagcttgacctctgagacgaccagtcctccttgcagcaataagaccaaccttttttcct 3159

                                                                        
Query: 237  ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 296
            |||||||||||||| ||||||||   ||| ||||||||||| || |||||||||||||||
Sbjct: 3158 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 3099

                                                                        
Query: 297  tggggatgctcaacagggttcatggccacaccacgcaccttangccaggagttcctcttc 356
            || ||||||||||| || ||||| ||||||||||| |||||| ||||| |||| ||||||
Sbjct: 3098 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 3039

                                                                        
Query: 357  acacggtacttgtggtaggcgttaccagccttcagcattggcttctcagtcctgccacca 416
            ||||||||||||||||| |||||||||||||| ||||| |||||||| || || ||||||
Sbjct: 3038 acacggtacttgtggtatgcgttaccagccttgagcatcggcttctctgttcttccacca 2979

                                
Query: 417  ccagcaacctgaccaatcat 436
            || ||||| |||||||||||
Sbjct: 2978 cctgcaacttgaccaatcat 2959

---

>emb|AL022373.1|ATT19K4 Arabidopsis thaliana DNA chromosome 4, BAC clone T19K4 (ESSAII project)
          Length = 106007

 Score =  264 bits (133), Expect = 2e-67
 Identities = 228/260 (87%)
 Strand = Plus / Minus

                                                                          
Query: 177    gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 236
              ||||| || ||||| ||||||||||||||||| |||||||| ||||||||||| |  || 
Sbjct: 105120 gcagcttgacctctgagacgaccagtcctccttgcagcaataagaccaaccttttttcct 105061

                                                                          
Query: 237    ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 296
              |||||||||||||| ||||||||   ||| ||||||||||| || |||||||||||||||
Sbjct: 105060 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 105001

                                                                          
Query: 297    tggggatgctcaacagggttcatggccacaccacgcaccttangccaggagttcctcttc 356
              || ||||||||||| || ||||| ||||||||||| |||||| ||||| |||| ||||||
Sbjct: 105000 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 104941

                                                                          
Query: 357    acacggtacttgtggtaggcgttaccagccttcagcattggcttctcagtcctgccacca 416
              ||||||||||||||||| |||||||||||||| ||||| |||||||| || || ||||||
Sbjct: 104940 acacggtacttgtggtatgcgttaccagccttgagcatcggcttctctgttcttccacca 104881

                                  
Query: 417    ccagcaacctgaccaatcat 436
              || ||||| |||||||||||
Sbjct: 104880 cctgcaacttgaccaatcat 104861

---

>gb|AF361610.1| Arabidopsis thaliana AT4g36130/F23E13_20 mRNA, complete cds
          Length = 1029

 Score =  264 bits (133), Expect = 2e-67
 Identities = 228/260 (87%)
 Strand = Plus / Minus

                                                                       
Query: 177 gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 236
           ||||| || ||||| ||||||||||||||||| |||||||| ||||||||||| |  || 
Sbjct: 800 gcagcttgacctctgagacgaccagtcctccttgcagcaataagaccaaccttttttcct 741

                                                                       
Query: 237 ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 296
           |||||||||||||| ||||||||   ||| ||||||||||| || |||||||||||||||
Sbjct: 740 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 681

                                                                       
Query: 297 tggggatgctcaacagggttcatggccacaccacgcaccttangccaggagttcctcttc 356
           || ||||||||||| || ||||| ||||||||||| |||||| ||||| |||| ||||||
Sbjct: 680 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 621

                                                                       
Query: 357 acacggtacttgtggtaggcgttaccagccttcagcattggcttctcagtcctgccacca 416
           ||||||||||||||||| |||||||||||||| ||||| |||||||| || || ||||||
Sbjct: 620 acacggtacttgtggtatgcgttaccagccttgagcatcggcttctctgttcttccacca 561

                               
Query: 417 ccagcaacctgaccaatcat 436
           || ||||| |||||||||||
Sbjct: 560 cctgcaacttgaccaatcat 541

---

>gb|AF367335.1| Arabidopsis thaliana AT4g36130/F23E13_20 mRNA, complete cds
          Length = 972

 Score =  264 bits (133), Expect = 2e-67
 Identities = 228/260 (87%)
 Strand = Plus / Minus

                                                                       
Query: 177 gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 236
           ||||| || ||||| ||||||||||||||||| |||||||| ||||||||||| |  || 
Sbjct: 800 gcagcttgacctctgagacgaccagtcctccttgcagcaataagaccaaccttttttcct 741

                                                                       
Query: 237 ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 296
           |||||||||||||| ||||||||   ||| ||||||||||| || |||||||||||||||
Sbjct: 740 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 681

                                                                       
Query: 297 tggggatgctcaacagggttcatggccacaccacgcaccttangccaggagttcctcttc 356
           || ||||||||||| || ||||| ||||||||||| |||||| ||||| |||| ||||||
Sbjct: 680 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 621

                                                                       
Query: 357 acacggtacttgtggtaggcgttaccagccttcagcattggcttctcagtcctgccacca 416
           ||||||||||||||||| |||||||||||||| ||||| |||||||| || || ||||||
Sbjct: 620 acacggtacttgtggtatgcgttaccagccttgagcatcggcttctctgttcttccacca 561

                               
Query: 417 ccagcaacctgaccaatcat 436
           || ||||| |||||||||||
Sbjct: 560 cctgcaacttgaccaatcat 541

---

>gb|AY058221.1| Arabidopsis thaliana AT4g36130/F23E13_20 mRNA, complete cds
          Length = 777

 Score =  264 bits (133), Expect = 2e-67
 Identities = 228/260 (87%)
 Strand = Plus / Minus

                                                                       
Query: 177 gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 236
           ||||| || ||||| ||||||||||||||||| |||||||| ||||||||||| |  || 
Sbjct: 752 gcagcttgacctctgagacgaccagtcctccttgcagcaataagaccaaccttttttcct 693

                                                                       
Query: 237 ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 296
           |||||||||||||| ||||||||   ||| ||||||||||| || |||||||||||||||
Sbjct: 692 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 633

                                                                       
Query: 297 tggggatgctcaacagggttcatggccacaccacgcaccttangccaggagttcctcttc 356
           || ||||||||||| || ||||| ||||||||||| |||||| ||||| |||| ||||||
Sbjct: 632 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 573

                                                                       
Query: 357 acacggtacttgtggtaggcgttaccagccttcagcattggcttctcagtcctgccacca 416
           ||||||||||||||||| |||||||||||||| ||||| |||||||| || || ||||||
Sbjct: 572 acacggtacttgtggtatgcgttaccagccttgagcatcggcttctctgttcttccacca 513

                               
Query: 417 ccagcaacctgaccaatcat 436
           || ||||| |||||||||||
Sbjct: 512 cctgcaacttgaccaatcat 493

---

>ref|NM_127358.3| Arabidopsis thaliana EMB2296; structural constituent of ribosome
           AT2G18020 (EMB2296) mRNA, complete cds
          Length = 968

 Score =  242 bits (122), Expect = 8e-61
 Identities = 241/281 (85%)
 Strand = Plus / Minus

                                                                       
Query: 159 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 218
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 817 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 758

                                                                       
Query: 219 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 278
           |||||||||||||| || || ||||||||||| | ||||||    || |||||||| |||
Sbjct: 757 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 698

                                                                       
Query: 279 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 338
           || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||||
Sbjct: 697 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 638

                                                                       
Query: 339 ngccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattggc 398
            |||| ||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 637 ggccatgagttcctcttcacacggtacttgtggtacgcgtttcctgccttgagcatcggc 578

                                                    
Query: 399 ttctcagtcctgccaccaccagcaacctgaccaatcatagc 439
           |||||||| || ||||| |||||||| || |||||||||||
Sbjct: 577 ttctcagttcttccacctccagcaacttgtccaatcatagc 537

---

>gb|AY128314.1| Arabidopsis thaliana 60S ribosomal protein L2 (At2g18020) mRNA,
           complete cds
          Length = 944

 Score =  242 bits (122), Expect = 8e-61
 Identities = 241/281 (85%)
 Strand = Plus / Minus

                                                                       
Query: 159 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 218
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 817 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 758

                                                                       
Query: 219 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 278
           |||||||||||||| || || ||||||||||| | ||||||    || |||||||| |||
Sbjct: 757 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 698

                                                                       
Query: 279 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 338
           || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||||
Sbjct: 697 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 638

                                                                       
Query: 339 ngccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattggc 398
            |||| ||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 637 ggccatgagttcctcttcacacggtacttgtggtacgcgtttcctgccttgagcatcggc 578

                                                    
Query: 399 ttctcagtcctgccaccaccagcaacctgaccaatcatagc 439
           |||||||| || ||||| |||||||| || |||||||||||
Sbjct: 577 ttctcagttcttccacctccagcaacttgtccaatcatagc 537

---

>gb|AC006201.4| Arabidopsis thaliana chromosome 2 clone T27K22 map c245, complete
             sequence
          Length = 88149

 Score =  242 bits (122), Expect = 8e-61
 Identities = 241/281 (85%)
 Strand = Plus / Plus

                                                                         
Query: 159   gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 218
             ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 37736 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 37795

                                                                         
Query: 219   agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 278
             |||||||||||||| || || ||||||||||| | ||||||    || |||||||| |||
Sbjct: 37796 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 37855

                                                                         
Query: 279   tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 338
             || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||||
Sbjct: 37856 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 37915

                                                                         
Query: 339   ngccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattggc 398
              |||| ||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 37916 ggccatgagttcctcttcacacggtacttgtggtacgcgtttcctgccttgagcatcggc 37975

                                                      
Query: 399   ttctcagtcctgccaccaccagcaacctgaccaatcatagc 439
             |||||||| || ||||| |||||||| || |||||||||||
Sbjct: 37976 ttctcagttcttccacctccagcaacttgtccaatcatagc 38016

---

>emb|BX820589.1|CNS0A8QO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH50ZB11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score =  242 bits (122), Expect = 8e-61
 Identities = 241/281 (85%)
 Strand = Plus / Minus

                                                                       
Query: 159 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 218
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 795 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 736

                                                                       
Query: 219 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 278
           |||||||||||||| || || ||||||||||| | ||||||    || |||||||| |||
Sbjct: 735 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 676

                                                                       
Query: 279 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 338
           || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||||
Sbjct: 675 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 616

                                                                       
Query: 339 ngccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattggc 398
            |||| ||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 615 ggccatgagttcctcttcacacggtacttgtggtacgcgtttcctgccttgagcatcggc 556

                                                    
Query: 399 ttctcagtcctgccaccaccagcaacctgaccaatcatagc 439
           |||||||| || ||||| |||||||| || |||||||||||
Sbjct: 555 ttctcagttcttccacctccagcaacttgtccaatcatagc 515

---

>emb|BX820233.1|CNS0A8O8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH10ZE05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 881

 Score =  242 bits (122), Expect = 8e-61
 Identities = 241/281 (85%)
 Strand = Plus / Minus

                                                                       
Query: 159 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 218
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 781 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 722

                                                                       
Query: 219 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 278
           |||||||||||||| || || ||||||||||| | ||||||    || |||||||| |||
Sbjct: 721 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 662

                                                                       
Query: 279 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 338
           || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||||
Sbjct: 661 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 602

                                                                       
Query: 339 ngccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattggc 398
            |||| ||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 601 ggccatgagttcctcttcacacggtacttgtggtacgcgtttcctgccttgagcatcggc 542

                                                    
Query: 399 ttctcagtcctgccaccaccagcaacctgaccaatcatagc 439
           |||||||| || ||||| |||||||| || |||||||||||
Sbjct: 541 ttctcagttcttccacctccagcaacttgtccaatcatagc 501

---

>emb|BX820387.1|CNS0A8NL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH28ZH04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 946

 Score =  242 bits (122), Expect = 8e-61
 Identities = 241/281 (85%)
 Strand = Plus / Minus

                                                                       
Query: 159 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 218
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 795 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 736

                                                                       
Query: 219 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 278
           |||||||||||||| || || ||||||||||| | ||||||    || |||||||| |||
Sbjct: 735 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 676

                                                                       
Query: 279 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 338
           || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||||
Sbjct: 675 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 616

                                                                       
Query: 339 ngccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattggc 398
            |||| ||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 615 ggccatgagttcctcttcacacggtacttgtggtacgcgtttcctgccttgagcatcggc 556

                                                    
Query: 399 ttctcagtcctgccaccaccagcaacctgaccaatcatagc 439
           |||||||| || ||||| |||||||| || |||||||||||
Sbjct: 555 ttctcagttcttccacctccagcaacttgtccaatcatagc 515

---

>gb|BT001177.1| Arabidopsis thaliana 60S ribosomal protein L2 (At2g18020) mRNA,
           complete cds
          Length = 858

 Score =  242 bits (122), Expect = 8e-61
 Identities = 241/281 (85%)
 Strand = Plus / Minus

                                                                       
Query: 159 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 218
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 770 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 711

                                                                       
Query: 219 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 278
           |||||||||||||| || || ||||||||||| | ||||||    || |||||||| |||
Sbjct: 710 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 651

                                                                       
Query: 279 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 338
           || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||||
Sbjct: 650 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 591

                                                                       
Query: 339 ngccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattggc 398
            |||| ||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 590 ggccatgagttcctcttcacacggtacttgtggtacgcgtttcctgccttgagcatcggc 531

                                                    
Query: 399 ttctcagtcctgccaccaccagcaacctgaccaatcatagc 439
           |||||||| || ||||| |||||||| || |||||||||||
Sbjct: 530 ttctcagttcttccacctccagcaacttgtccaatcatagc 490

---

>emb|BX827983.1|CNS0A32V Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH41ZD03 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 965

 Score =  238 bits (120), Expect = 1e-59
 Identities = 227/262 (86%), Gaps = 2/262 (0%)
 Strand = Plus / Minus

                                                                       
Query: 177 gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 236
           ||||| || ||||| ||||||||||||||||| ||||| || ||||||||||| |  || 
Sbjct: 787 gcagcttgacctctgagacgaccagtcctccttgcagcgataagaccaaccttttttcct 728

                                                                       
Query: 237 ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 296
           |||||||||||||| ||||||||   ||| ||||||||||| || |||||||||||||||
Sbjct: 727 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 668

                                                                       
Query: 297 tggggatgctcaacagggttcatggccacaccacgcaccttangccaggagttcctcttc 356
           || ||||||||||| || ||||| ||||||||||| |||||| ||||| |||| ||||||
Sbjct: 667 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 608

                                                                       
Query: 357 acac--ggtacttgtggtaggcgttaccagccttcagcattggcttctcagtcctgccac 414
           ||||  ||||||||||||| |||||||||||||| ||||| |||||||| || || ||||
Sbjct: 607 acaccgggtacttgtggtatgcgttaccagccttgagcatcggcttctctgttcttccac 548

                                 
Query: 415 caccagcaacctgaccaatcat 436
           |||| ||||| |||||||||||
Sbjct: 547 cacctgcaacttgaccaatcat 526

---

>emb|X86765.1|ATC24RPL2 A.thaliana mRNA for ribosomal protein L2
          Length = 1002

 Score =  234 bits (118), Expect = 2e-58
 Identities = 240/281 (85%)
 Strand = Plus / Minus

                                                                       
Query: 159 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 218
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 834 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 775

                                                                       
Query: 219 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 278
           |||||||||||||| || || ||||||||||| | ||||||    |  |||||||| |||
Sbjct: 774 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggagtgaccaatgtgc 715

                                                                       
Query: 279 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 338
           || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||||
Sbjct: 714 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 655

                                                                       
Query: 339 ngccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattggc 398
            |||| ||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 654 ggccatgagttcctcttcacacggtacttgtggtacgcgtttcctgccttgagcatcggc 595

                                                    
Query: 399 ttctcagtcctgccaccaccagcaacctgaccaatcatagc 439
           |||||||| || ||||| |||||||| || |||||||||||
Sbjct: 594 ttctcagttcttccacctccagcaacttgtccaatcatagc 554

---

>emb|AJ404848.1|GMA404848 Glycine max mRNA for ribosomal protein L2 (rpL2 gene)
          Length = 1000

 Score =  230 bits (116), Expect = 3e-57
 Identities = 244/287 (85%)
 Strand = Plus / Minus

                                                                       
Query: 150 gccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctg 209
           ||||| || ||||| |||||||  || ||||| || ||||||||||||||||||||||| 
Sbjct: 823 gccttatcagccttggcagcagttgcagcagcttgtcctctaagacgaccagtcctccta 764

                                                                       
Query: 210 gcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatga 269
           ||||||||||||||||||||||| || || || ||||||||||  |||||    || |||
Sbjct: 763 gcagcaatgagaccaaccttctgtccaggaggagcatcacggctgacagtacttgcgtga 704

                                                                       
Query: 270 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 329
           |||||||||||||| ||||||||||||||||||||||||||||||||||| || ||||||
Sbjct: 703 ccaatatgctggtgattacctcctccgtggggatgctcaacagggttcatagcaacacca 644

                                                                       
Query: 330 cgcaccttangccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttc 389
           || |||||  ||||| | ||||||||||| | | |||||||||| || || |||||||| 
Sbjct: 643 cgaaccttgggccagcaattcctcttcactctgaacttgtggtaagcatttccagccttg 584

                                                          
Query: 390 agcattggcttctcagtcctgccaccaccagcaacctgaccaatcat 436
           || |  ||||||||||| || || ||||| ||||| |||||||||||
Sbjct: 583 agaagaggcttctcagttctccctccacctgcaacttgaccaatcat 537

---

>emb|BX820018.1|CNS0A8IW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS61ZG10 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 887

 Score =  228 bits (115), Expect = 1e-56
 Identities = 241/282 (85%), Gaps = 1/282 (0%)
 Strand = Plus / Minus

                                                                       
Query: 159 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 218
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 788 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 729

                                                                       
Query: 219 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 278
           |||||||||||||| || || ||||||||||| | ||||||    || |||||||| |||
Sbjct: 728 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 669

                                                                       
Query: 279 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 338
           || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||||
Sbjct: 668 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 609

                                                                       
Query: 339 ngccaggagttcctcttcacacgg-tacttgtggtaggcgttaccagccttcagcattgg 397
            |||| |||||||||||||||||| ||||||||||| ||||| || ||||| ||||| ||
Sbjct: 608 ggccatgagttcctcttcacacggatacttgtggtacgcgtttcctgccttgagcatcgg 549

                                                     
Query: 398 cttctcagtcctgccaccaccagcaacctgaccaatcatagc 439
           ||||||||| || ||||| |||||||| || |||||||||||
Sbjct: 548 cttctcagttcttccacctccagcaacttgtccaatcatagc 507

---

>gb|AC135311.13| Medicago truncatula clone mth2-27l9, complete sequence
          Length = 112635

 Score =  226 bits (114), Expect = 5e-56
 Identities = 212/245 (86%)
 Strand = Plus / Plus

                                                                          
Query: 192    agacgaccagtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacgg 251
              ||||||||||||||| ||||||||||||||||||||||||| || || || |||||||| 
Sbjct: 107018 agacgaccagtcctcttggcagcaatgagaccaaccttctgtccaggaggagcatcacgt 107077

                                                                          
Query: 252    cgaacagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaaca 311
              |  |||||    |||||||||||||| ||||| |||||||||||||||||||||||||| 
Sbjct: 107078 ctgacagtactcgcatgaccaatatgttggtgattacctcctccgtggggatgctcaact 107137

                                                                          
Query: 312    gggttcatggccacaccacgcaccttangccaggagttcctcttcacacggtacttgtgg 371
              || ||||| || |||||||| |||||| ||||| |||| |||||||| | | ||||||||
Sbjct: 107138 ggattcatagcaacaccacgaaccttaggccagcagtttctcttcactctgaacttgtgg 107197

                                                                          
Query: 372    taggcgttaccagccttcagcattggcttctcagtcctgccaccaccagcaacctgacca 431
              || || ||||||||||||| |||||||||||| || || |||||||||||||| || |||
Sbjct: 107198 taagcattaccagccttcaacattggcttctcggttcttccaccaccagcaacttgccca 107257

                   
Query: 432    atcat 436
              |||||
Sbjct: 107258 atcat 107262

---

>emb|BX820320.1|CNS0A7WS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH22ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 901

 Score =  226 bits (114), Expect = 5e-56
 Identities = 239/281 (85%)
 Strand = Plus / Minus

                                                                       
Query: 159 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 218
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 766 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 707

                                                                       
Query: 219 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 278
           |||||||||||||| || || ||||||||||| | ||||||    || | |||||| | |
Sbjct: 706 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgttaccaatgttc 647

                                                                       
Query: 279 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 338
           || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||||
Sbjct: 646 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 587

                                                                       
Query: 339 ngccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattggc 398
            |||| ||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 586 ggccatgagttcctcttcacacggtacttgtggtacgcgtttcctgccttgagcatcggc 527

                                                    
Query: 399 ttctcagtcctgccaccaccagcaacctgaccaatcatagc 439
           |||||||| || ||||| |||||||| || |||||||||||
Sbjct: 526 ttctcagttcttccacctccagcaacttgtccaatcatagc 486

---

>gb|AF156372.1| Nicotiana tabacum clone PR60 60S ribosomal protein L2 mRNA, partial
           cds
          Length = 644

 Score =  224 bits (113), Expect = 2e-55
 Identities = 217/252 (86%)
 Strand = Plus / Minus

                                                                       
Query: 191 aagacgaccagtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacg 250
           |||||||||||||||||| |||||||| ||||| ||||| || || ||||||||||||||
Sbjct: 480 aagacgaccagtcctccttgcagcaataagaccgaccttttgaccaggtggtgcatcacg 421

                                                                       
Query: 251 gcgaacagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaac 310
            || |||||   ||||||||||||||| || |||||||| || || || |||||||| ||
Sbjct: 420 acggacagtactagcatgaccaatatgttgatggttaccaccaccatgaggatgctccac 361

                                                                       
Query: 311 agggttcatggccacaccacgcaccttangccaggagttcctcttcacacggtacttgtg 370
           |||||||||||| |||||||| |||||  ||||| |||||||||| || |||||||||||
Sbjct: 360 agggttcatggcaacaccacgaaccttgggccagcagttcctctttacccggtacttgtg 301

                                                                       
Query: 371 gtaggcgttaccagccttcagcattggcttctcagtcctgccaccaccagcaacctgacc 430
           ||| |||||||| ||||| |||||||| |||||||| |  || || |||||||| |||||
Sbjct: 300 gtatgcgttaccggccttaagcattggtttctcagtacgtcctcctccagcaacttgacc 241

                       
Query: 431 aatcatagcacg 442
           ||||||||||||
Sbjct: 240 aatcatagcacg 229

---

>emb|BX820333.1|CNS0A8NS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH23ZG05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 916

 Score =  214 bits (108), Expect = 2e-52
 Identities = 241/283 (85%), Gaps = 2/283 (0%)
 Strand = Plus / Minus

                                                                       
Query: 159 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 218
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 801 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 742

                                                                       
Query: 219 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 278
           |||||||||||||| || || ||||||||||| | ||||||    || |||||||| |||
Sbjct: 741 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 682

                                                                       
Query: 279 tggtggttacctcctccgtggggatgctc-aacagggttcatggccacaccacgcacctt 337
           || |||||||||||||| || ||||||||  || || ||||| ||||||||||| |||||
Sbjct: 681 tgatggttacctcctccatgaggatgctcgcactggattcatagccacaccacgaacctt 622

                                                                       
Query: 338 angccaggagttcctcttcacac-ggtacttgtggtaggcgttaccagccttcagcattg 396
           | |||| |||||||||||||||| ||||||||||||| ||||| || ||||| ||||| |
Sbjct: 621 aggccatgagttcctcttcacacgggtacttgtggtacgcgtttcctgccttgagcatcg 562

                                                      
Query: 397 gcttctcagtcctgccaccaccagcaacctgaccaatcatagc 439
           |||||||||| || ||||| |||||||| || |||||||||||
Sbjct: 561 gcttctcagttcttccacctccagcaacttgtccaatcatagc 519

---

>emb|X64562.1|LERPL2MR L.esculentum mRNA for ribosomal protein L2
          Length = 816

 Score =  208 bits (105), Expect = 1e-50
 Identities = 215/252 (85%)
 Strand = Plus / Minus

                                                                       
Query: 191 aagacgaccagtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacg 250
           |||||||||||||||||| |||||||| ||||||||||| || || || |||||||||||
Sbjct: 743 aagacgaccagtcctccttgcagcaataagaccaaccttttgtccaggaggtgcatcacg 684

                                                                       
Query: 251 gcgaacagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaac 310
            || || ||    ||||||||||| || || |||||||| || || ||||||||||| ||
Sbjct: 683 acggactgtactggcatgaccaatgtgttgatggttaccaccaccatggggatgctccac 624

                                                                       
Query: 311 agggttcatggccacaccacgcaccttangccaggagttcctcttcacacggtacttgtg 370
            || ||||| || |||||||| |||||| ||||| |||||||||||||||||||||| ||
Sbjct: 623 tggattcatagcaacaccacgaaccttaggccagcagttcctcttcacacggtacttatg 564

                                                                       
Query: 371 gtaggcgttaccagccttcagcattggcttctcagtcctgccaccaccagcaacctgacc 430
           ||| || |||||||| || |||||||| |||||||| |  || |||||||||||||||||
Sbjct: 563 gtaagcattaccagctttaagcattggtttctcagtacgccctccaccagcaacctgacc 504

                       
Query: 431 aatcatagcacg 442
           ||||||||||||
Sbjct: 503 aatcatagcacg 492

---

>gb|DQ252497.1| Solanum tuberosum clone 068C11 ribosomal protein L2-like mRNA,
           complete cds
          Length = 899

 Score =  208 bits (105), Expect = 1e-50
 Identities = 215/252 (85%)
 Strand = Plus / Minus

                                                                       
Query: 191 aagacgaccagtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacg 250
           |||||||||||||||||| |||||||| ||||||||||| || || || |||||||||||
Sbjct: 789 aagacgaccagtcctccttgcagcaataagaccaaccttttgtccaggaggtgcatcacg 730

                                                                       
Query: 251 gcgaacagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaac 310
            || || ||    ||||||||||| || || |||||||| || || ||||||||||| ||
Sbjct: 729 acggactgtactggcatgaccaatgtgttgatggttaccaccaccatggggatgctccac 670

                                                                       
Query: 311 agggttcatggccacaccacgcaccttangccaggagttcctcttcacacggtacttgtg 370
            || ||||| || |||||||| |||||| ||||| |||||||||||||||||||||| ||
Sbjct: 669 gggattcatagcaacaccacgaaccttaggccagcagttcctcttcacacggtacttatg 610

                                                                       
Query: 371 gtaggcgttaccagccttcagcattggcttctcagtcctgccaccaccagcaacctgacc 430
           ||| || |||||||| || |||||||| |||||||| |  || |||||||||||||||||
Sbjct: 609 gtaagcattaccagctttaagcattggtttctcagtacgtcctccaccagcaacctgacc 550

                       
Query: 431 aatcatagcacg 442
           ||||||||||||
Sbjct: 549 aatcatagcacg 538

---

>gb|BT013866.1| Lycopersicon esculentum clone 132846R, mRNA sequence
          Length = 983

 Score =  204 bits (103), Expect = 2e-49
 Identities = 210/246 (85%)
 Strand = Plus / Minus

                                                                       
Query: 191 aagacgaccagtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacg 250
           |||||||||||||||||| || ||||| ||||||||| | || || ||||||||||||||
Sbjct: 756 aagacgaccagtcctccttgctgcaataagaccaaccctttgcccaggtggtgcatcacg 697

                                                                       
Query: 251 gcgaacagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaac 310
            || |||||    |||||||||||||| || |||||||| || || || |||||||| ||
Sbjct: 696 acgcacagtactggcatgaccaatatgttgatggttaccaccaccatgaggatgctccac 637

                                                                       
Query: 311 agggttcatggccacaccacgcaccttangccaggagttcctcttcacacggtacttgtg 370
           ||| ||||| || |||||||| |||||| ||||| |||||||||| || ||||| |||||
Sbjct: 636 aggattcatagcaacaccacgaaccttaggccagcagttcctcttaacgcggtatttgtg 577

                                                                       
Query: 371 gtaggcgttaccagccttcagcattggcttctcagtcctgccaccaccagcaacctgacc 430
           ||| ||||||||||| || |||||||| |||||||| || || |||||||||||||||||
Sbjct: 576 gtatgcgttaccagctttaagcattggtttctcagttcttcctccaccagcaacctgacc 517

                 
Query: 431 aatcat 436
           ||||||
Sbjct: 516 aatcat 511

---

>emb|BX818795.1|CNS0A8ZD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB13ZH09 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 878

 Score =  188 bits (95), Expect = 1e-44
 Identities = 236/282 (83%), Gaps = 1/282 (0%)
 Strand = Plus / Minus

                                                                       
Query: 159 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaa-t 217
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| ||||||| |
Sbjct: 789 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaaat 730

                                                                       
Query: 218 gagaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatg 277
            |||||||||||||| || || ||||||| ||| | || |||    || |||||||| | 
Sbjct: 729 aagaccaaccttctgtccaggaggtgcatgacgcctaagagtactggcgtgaccaatgta 670

                                                                       
Query: 278 ctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctt 337
           ||| |||||||||||||| || |||||||| || || ||||| |||||| |||| |||||
Sbjct: 669 ctgatggttacctcctccatgaggatgctccactggattcatagccacaacacgaacctt 610

                                                                       
Query: 338 angccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattgg 397
           | |||| |||| |||||||||||||||||||||||| ||||| || ||||| ||||| ||
Sbjct: 609 aggccatgagtgcctcttcacacggtacttgtggtacgcgtttcctgccttgagcatcgg 550

                                                     
Query: 398 cttctcagtcctgccaccaccagcaacctgaccaatcatagc 439
           ||||||||| || ||||| |||||||| || |||||||||||
Sbjct: 549 cttctcagttcttccacctccagcaacttgtccaatcatagc 508

---

>emb|X62500.1|NTRL2RNA N.tabacum RL2 mRNA for 60S ribosomal protein L2
          Length = 917

 Score =  176 bits (89), Expect = 4e-41
 Identities = 210/248 (84%), Gaps = 2/248 (0%)
 Strand = Plus / Minus

                                                                       
Query: 191 aagacgaccagtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacg 250
           ||||||||||||||||||  | ||||| ||||| ||||| || || ||||||||||| ||
Sbjct: 745 aagacgaccagtcctccttcctgcaataagaccgaccttttgaccaggtggtgcatcgcg 686

                                                                       
Query: 251 -gcgaacagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaa 309
            |||| ||||   ||||||||||||||| || |||||||| || || || |||||||| |
Sbjct: 685 agcga-cagtactagcatgaccaatatgttgatggttaccaccaccatgaggatgctcca 627

                                                                       
Query: 310 cagggttcatggccacaccacgcaccttangccaggagttcctcttcacacggtacttgt 369
           ||||||||||||| |||||||| |||||  ||||| |||||||||| || ||||||||||
Sbjct: 626 cagggttcatggcaacaccacgaaccttgggccagcagttcctctttacccggtacttgt 567

                                                                       
Query: 370 ggtaggcgttaccagccttcagcattggcttctcagtcctgccaccaccagcaacctgac 429
           |||| |||||||| ||||| |||||||| |||||||| |  || || |||||||| ||||
Sbjct: 566 ggtatgcgttaccggccttaagcattggtttctcagtacgtcctcctccagcaacttgac 507

                   
Query: 430 caatcata 437
           ||||||||
Sbjct: 506 caatcata 499

---

>gb|DQ316258.1| Litopenaeus vannamei ribosomal protein L8 mRNA, complete cds
          Length = 871

 Score =  147 bits (74), Expect = 4e-32
 Identities = 160/189 (84%)
 Strand = Plus / Minus

                                                                       
Query: 255 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 314
           ||||||||||| | ||||||||| || |||||||| || || || |||||||| ||||||
Sbjct: 715 acagtggaagccttaccaatatgttgatggttaccaccaccatgaggatgctctacaggg 656

                                                                       
Query: 315 ttcatggccacaccacgcaccttangccaggagttcctcttcacacggtacttgtggtag 374
           |||||||||||||||||||||||| ||||| ||||||||||||| |  ||||| ||||||
Sbjct: 655 ttcatggccacaccacgcaccttaggccagcagttcctcttcaccctatacttatggtag 596

                                                                       
Query: 375 gcgttaccagccttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatc 434
           ||   |||||||||||| || ||||| ||| | |  ||||||||||||||   |||||||
Sbjct: 595 gcacgaccagccttcaggataggcttgtcaatacgtccaccaccagcaacaataccaatc 536

                    
Query: 435 atagcacgg 443
           || ||||||
Sbjct: 535 atggcacgg 527

---

>emb|CT033188.1| Platynereis dumerilii EST IB0AAA25AH04EM1
          Length = 878

 Score =  107 bits (54), Expect = 3e-20
 Identities = 74/81 (91%)
 Strand = Plus / Minus

                                                                       
Query: 269 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
           |||||||||||| |||||||| |||||||||||||||||||| |||||||| ||||||||
Sbjct: 705 accaatatgctgatggttaccacctccgtggggatgctcaacggggttcatagccacacc 646

                                
Query: 329 acgcaccttangccaggagtt 349
           |||||||||  ||||| ||||
Sbjct: 645 acgcaccttgggccagcagtt 625

---

>emb|CT033187.1| Platynereis dumerilii EST IB0AAA25AH04FM1
          Length = 823

 Score =  107 bits (54), Expect = 3e-20
 Identities = 74/81 (91%)
 Strand = Plus / Plus

                                                                       
Query: 269 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
           |||||||||||| |||||||| |||||||||||||||||||| |||||||| ||||||||
Sbjct: 174 accaatatgctgatggttaccacctccgtggggatgctcaacggggttcatagccacacc 233

                                
Query: 329 acgcaccttangccaggagtt 349
           |||||||||  ||||| ||||
Sbjct: 234 acgcaccttgggccagcagtt 254

---

>gb|AF098520.1|AF098520 Drosophila melanogaster ribosomal protein L8 (rpL8) gene, complete
            cds
          Length = 1718

 Score =  105 bits (53), Expect = 1e-19
 Identities = 94/108 (87%)
 Strand = Plus / Minus

                                                                        
Query: 269  accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
            |||||| ||||| |||||||| || |||||||||||||| || |||||||||||||||||
Sbjct: 1438 accaatgtgctgatggttaccaccaccgtggggatgctccacggggttcatggccacacc 1379

                                                            
Query: 329  acgcaccttangccaggagttcctcttcacacggtacttgtggtaggc 376
            |||||||||| |||||  ||| | ||||||   |||||||||||||||
Sbjct: 1378 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 1331

---

>gb|AY485337.1| Mamestra brassicae ribosomal protein L8 (rpl8) mRNA, complete cds
          Length = 877

 Score =  101 bits (51), Expect = 2e-18
 Identities = 122/146 (83%)
 Strand = Plus / Minus

                                                                       
Query: 255 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 314
           ||||||||||| | ||||||||| || |||||||| || || || |||||||||||||||
Sbjct: 715 acagtggaagccttaccaatatgttgatggttaccaccaccatgaggatgctcaacaggg 656

                                                                       
Query: 315 ttcatggccacaccacgcaccttangccaggagttcctcttcacacggtacttgtggtag 374
           |||||||||||||||||||| |   ||||| |||| | ||| ||   |||||||||||| 
Sbjct: 655 ttcatggccacaccacgcacatatggccagcagtttcgcttgactttgtacttgtggtat 596

                                     
Query: 375 gcgttaccagccttcagcattggctt 400
           |||  |||||||||||| || |||||
Sbjct: 595 gcgcgaccagccttcaggatgggctt 570

---

>emb|CT033650.1| Platynereis dumerilii EST IB0AAA16CH07EM1
          Length = 867

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 73/81 (90%)
 Strand = Plus / Minus

                                                                       
Query: 269 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
           |||||||||||| |||||||| |||||||| ||||||||||| |||||||| ||||||||
Sbjct: 694 accaatatgctgatggttaccacctccgtgaggatgctcaacggggttcatagccacacc 635

                                
Query: 329 acgcaccttangccaggagtt 349
           |||||||||  ||||| ||||
Sbjct: 634 acgcaccttgggccagcagtt 614

---

>emb|CT033649.1| Platynereis dumerilii EST IB0AAA16CH07FM1
          Length = 744

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 73/81 (90%)
 Strand = Plus / Plus

                                                                       
Query: 269 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
           |||||||||||| |||||||| |||||||| ||||||||||| |||||||| ||||||||
Sbjct: 174 accaatatgctgatggttaccacctccgtgaggatgctcaacggggttcatagccacacc 233

                                
Query: 329 acgcaccttangccaggagtt 349
           |||||||||  ||||| ||||
Sbjct: 234 acgcaccttgggccagcagtt 254

---

>emb|CT033017.1| Platynereis dumerilii EST IB0AAA27DH06EM1
          Length = 868

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 73/81 (90%)
 Strand = Plus / Minus

                                                                       
Query: 269 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
           |||||||||||| |||||||| |||||||| ||||||||||| |||||||| ||||||||
Sbjct: 696 accaatatgctgatggttaccacctccgtgaggatgctcaacggggttcatagccacacc 637

                                
Query: 329 acgcaccttangccaggagtt 349
           |||||||||  ||||| ||||
Sbjct: 636 acgcaccttgggccagcagtt 616

---

>emb|CT033016.1| Platynereis dumerilii EST IB0AAA27DH06FM1
          Length = 826

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 73/81 (90%)
 Strand = Plus / Plus

                                                                       
Query: 269 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
           |||||||||||| |||||||| |||||||| ||||||||||| |||||||| ||||||||
Sbjct: 174 accaatatgctgatggttaccacctccgtgaggatgctcaacggggttcatagccacacc 233

                                
Query: 329 acgcaccttangccaggagtt 349
           |||||||||  ||||| ||||
Sbjct: 234 acgcaccttgggccagcagtt 254

---

>gb|BT014913.1| Drosophila melanogaster RH21963 full insert cDNA
          Length = 2439

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                        
Query: 269  accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
            |||||| ||||| |||||||| || ||||| |||||||| || |||||||||||||||||
Sbjct: 2151 accaatgtgctgatggttaccaccaccgtgaggatgctccacggggttcatggccacacc 2092

                                                            
Query: 329  acgcaccttangccaggagttcctcttcacacggtacttgtggtaggc 376
            |||||||||| |||||  ||| | ||||||   |||||||||||||||
Sbjct: 2091 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 2044

---

>gb|DQ440262.1| Aedes aegypti clone AET-322 60S ribosomal protein L2/L8 mRNA,
           complete cds
          Length = 786

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 108/128 (84%)
 Strand = Plus / Minus

                                                                       
Query: 273 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 332
           |||||||| |||||||| || ||||||||||||||||| |||||||| || |||||||| 
Sbjct: 656 atatgctgatggttaccaccaccgtggggatgctcaacggggttcatagcaacaccacgt 597

                                                                       
Query: 333 accttangccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagc 392
           |||||  ||||| |||| | ||||||   |||||||||||||||   |||||||||||| 
Sbjct: 596 acctttggccagcagttacgcttcaccttgtacttgtggtaggcacgaccagccttcagg 537

                   
Query: 393 attggctt 400
           || |||||
Sbjct: 536 ataggctt 529

---

>emb|CR938630.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 3-prime end of clone
           KW0AAA1YD12BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 701

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 108/128 (84%)
 Strand = Plus / Plus

                                                                       
Query: 273 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 332
           |||||||| |||||||| || ||||||||||||||||| |||||||| || |||||||| 
Sbjct: 320 atatgctgatggttaccaccaccgtggggatgctcaacggggttcatagcaacaccacgt 379

                                                                       
Query: 333 accttangccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagc 392
           |||||  ||||| |||| | ||||||   |||||||||||||||   |||||||||||| 
Sbjct: 380 acctttggccagcagttacgcttcaccttgtacttgtggtaggcacgaccagccttcagg 439

                   
Query: 393 attggctt 400
           || |||||
Sbjct: 440 ataggctt 447

---

>emb|CR938124.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YJ17AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 817

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 108/128 (84%)
 Strand = Plus / Minus

                                                                       
Query: 273 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 332
           |||||||| |||||||| || ||||||||||||||||| |||||||| || |||||||| 
Sbjct: 737 atatgctgatggttaccaccaccgtggggatgctcaacggggttcatagcaacaccacgt 678

                                                                       
Query: 333 accttangccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagc 392
           |||||  ||||| |||| | ||||||   |||||||||||||||   |||||||||||| 
Sbjct: 677 acctttggccagcagttacgcttcaccttgtacttgtggtaggcacgaccagccttcagg 618

                   
Query: 393 attggctt 400
           || |||||
Sbjct: 617 ataggctt 610

---

>gb|AC011905.4| Drosophila melanogaster 3L BAC RP98-27A3 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 192681

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                          
Query: 269    accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
              |||||| ||||| |||||||| || ||||| |||||||| || |||||||||||||||||
Sbjct: 127344 accaatgtgctgatggttaccaccaccgtgaggatgctccacggggttcatggccacacc 127285

                                                              
Query: 329    acgcaccttangccaggagttcctcttcacacggtacttgtggtaggc 376
              |||||||||| |||||  ||| | ||||||   |||||||||||||||
Sbjct: 127284 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 127237

---

>ref|NM_167955.1| Drosophila melanogaster Ribosomal protein L8 CG1263-RB, transcript
           variant B (RpL8), mRNA
          Length = 1264

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 269 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
           |||||| ||||| |||||||| || ||||| |||||||| || |||||||||||||||||
Sbjct: 872 accaatgtgctgatggttaccaccaccgtgaggatgctccacggggttcatggccacacc 813

                                                           
Query: 329 acgcaccttangccaggagttcctcttcacacggtacttgtggtaggc 376
           |||||||||| |||||  ||| | ||||||   |||||||||||||||
Sbjct: 812 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 765

---

>ref|NM_079987.2| Drosophila melanogaster Ribosomal protein L8 CG1263-RA, transcript
           variant A (RpL8), mRNA
          Length = 1118

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 269 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
           |||||| ||||| |||||||| || ||||| |||||||| || |||||||||||||||||
Sbjct: 726 accaatgtgctgatggttaccaccaccgtgaggatgctccacggggttcatggccacacc 667

                                                           
Query: 329 acgcaccttangccaggagttcctcttcacacggtacttgtggtaggc 376
           |||||||||| |||||  ||| | ||||||   |||||||||||||||
Sbjct: 666 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 619

---

>gb|AY071342.1| Drosophila melanogaster RE37829 full length cDNA
          Length = 1019

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 269 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
           |||||| ||||| |||||||| || ||||| |||||||| || |||||||||||||||||
Sbjct: 724 accaatgtgctgatggttaccaccaccgtgaggatgctccacggggttcatggccacacc 665

                                                           
Query: 329 acgcaccttangccaggagttcctcttcacacggtacttgtggtaggc 376
           |||||||||| |||||  ||| | ||||||   |||||||||||||||
Sbjct: 664 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 617

---

>gb|BT022891.1| Drosophila melanogaster IP12501 full insert cDNA
          Length = 1776

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 269 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
           |||||| ||||| |||||||| || ||||| |||||||| || |||||||||||||||||
Sbjct: 527 accaatgtgctgatggttaccaccaccgtgaggatgctccacggggttcatggccacacc 468

                                                           
Query: 329 acgcaccttangccaggagttcctcttcacacggtacttgtggtaggc 376
           |||||||||| |||||  ||| | ||||||   |||||||||||||||
Sbjct: 467 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 420

---

>gb|AE003475.4| Drosophila melanogaster chromosome 3L, section 9 of 83 of the complete
              sequence
          Length = 301691

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                          
Query: 269    accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
              |||||| ||||| |||||||| || ||||| |||||||| || |||||||||||||||||
Sbjct: 123716 accaatgtgctgatggttaccaccaccgtgaggatgctccacggggttcatggccacacc 123657

                                                              
Query: 329    acgcaccttangccaggagttcctcttcacacggtacttgtggtaggc 376
              |||||||||| |||||  ||| | ||||||   |||||||||||||||
Sbjct: 123656 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 123609

---

>emb|CR937651.1| Single read from an extremity of a cDNA clone made from Aedes
           aegypti total adult females. 5-prime end of clone
           KW0AAB1YJ18AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 765

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 101/119 (84%)
 Strand = Plus / Minus

                                                                       
Query: 273 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 332
           |||||||| |||||||| || ||||||||||||||||| |||||||| || |||||||| 
Sbjct: 739 atatgctgatggttaccaccaccgtggggatgctcaacggggttcatagcaacaccacgt 680

                                                                      
Query: 333 accttangccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcag 391
           |||||  ||||| |||| | ||||||   |||||||||||||||   ||||||||||||
Sbjct: 679 acctttggccagcagttacgcttcaccttgtacttgtggtaggcacgaccagccttcag 621

---

>emb|CR937650.1| Single read from an extremity of a cDNA clone made from Aedes
           aegypti total adult females. 3-prime end of clone
           KW0AAB1YJ18BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 616

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 101/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 273 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 332
           |||||||| |||||||| || ||||||||||||||||| |||||||| || |||||||| 
Sbjct: 319 atatgctgatggttaccaccaccgtggggatgctcaacggggttcatagcaacaccacgt 378

                                                                      
Query: 333 accttangccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcag 391
           |||||  ||||| |||| | ||||||   |||||||||||||||   ||||||||||||
Sbjct: 379 acctttggccagcagttacgcttcaccttgtacttgtggtaggcacgaccagccttcag 437

---

>emb|CT033621.1| Platynereis dumerilii EST IB0AAA17BB03EM1
          Length = 884

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 83/95 (87%)
 Strand = Plus / Minus

                                                                       
Query: 255 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 314
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 710 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 651

                                              
Query: 315 ttcatggccacaccacgcaccttangccaggagtt 349
           ||||| |||||||||||||||||  ||||| ||||
Sbjct: 650 ttcatagccacaccacgcaccttgggccagcagtt 616

---

>emb|CT033394.1| Platynereis dumerilii EST IB0AAA21BA08EM1
          Length = 883

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 83/95 (87%)
 Strand = Plus / Minus

                                                                       
Query: 255 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 314
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 724 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 665

                                              
Query: 315 ttcatggccacaccacgcaccttangccaggagtt 349
           ||||| |||||||||||||||||  ||||| ||||
Sbjct: 664 ttcatagccacaccacgcaccttgggccagcagtt 630

---

>emb|CT033393.1| Platynereis dumerilii EST IB0AAA21BA08FM1
          Length = 814

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 83/95 (87%)
 Strand = Plus / Plus

                                                                       
Query: 255 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 314
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 161 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 220

                                              
Query: 315 ttcatggccacaccacgcaccttangccaggagtt 349
           ||||| |||||||||||||||||  ||||| ||||
Sbjct: 221 ttcatagccacaccacgcaccttgggccagcagtt 255

---

>emb|CT032883.1| Platynereis dumerilii EST IB0AAA30AD02EM1
          Length = 834

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 83/95 (87%)
 Strand = Plus / Minus

                                                                       
Query: 255 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 314
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 706 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 647

                                              
Query: 315 ttcatggccacaccacgcaccttangccaggagtt 349
           ||||| |||||||||||||||||  ||||| ||||
Sbjct: 646 ttcatagccacaccacgcaccttgggccagcagtt 612

---

>emb|CT032882.1| Platynereis dumerilii EST IB0AAA30AD02FM1
          Length = 838

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 83/95 (87%)
 Strand = Plus / Plus

                                                                       
Query: 255 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 314
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 161 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 220

                                              
Query: 315 ttcatggccacaccacgcaccttangccaggagtt 349
           ||||| |||||||||||||||||  ||||| ||||
Sbjct: 221 ttcatagccacaccacgcaccttgggccagcagtt 255

---

>emb|CT032622.1| Platynereis dumerilii EST IB0AAA35AA08FM1
          Length = 834

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 83/95 (87%)
 Strand = Plus / Plus

                                                                       
Query: 255 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 314
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 174 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 233

                                              
Query: 315 ttcatggccacaccacgcaccttangccaggagtt 349
           ||||| |||||||||||||||||  ||||| ||||
Sbjct: 234 ttcatagccacaccacgcaccttgggccagcagtt 268

---

>emb|CT032614.1| Platynereis dumerilii EST IB0AAA35BC06EM1
          Length = 854

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 83/95 (87%)
 Strand = Plus / Minus

                                                                       
Query: 255 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 314
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 710 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 651

                                              
Query: 315 ttcatggccacaccacgcaccttangccaggagtt 349
           ||||| |||||||||||||||||  ||||| ||||
Sbjct: 650 ttcatagccacaccacgcaccttgggccagcagtt 616

---

>emb|CT032322.1| Platynereis dumerilii EST IB0AAA40CH03EM1
          Length = 759

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 83/95 (87%)
 Strand = Plus / Minus

                                                                       
Query: 255 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 314
           ||||| ||||| | ||||||||| || |||||||||||||| || ||||||||||| |||
Sbjct: 707 acagttgaagctttaccaatatgatgatggttacctcctccatgaggatgctcaacgggg 648

                                              
Query: 315 ttcatggccacaccacgcaccttangccaggagtt 349
           ||||| |||||||||||||||||  ||||| ||||
Sbjct: 647 ttcatagccacaccacgcaccttgggccagcagtt 613

---

>emb|CT032321.1| Platynereis dumerilii EST IB0AAA40CH03FM1
          Length = 475

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 83/95 (87%)
 Strand = Plus / Plus

                                                                       
Query: 255 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 314
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 161 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 220

                                              
Query: 315 ttcatggccacaccacgcaccttangccaggagtt 349
           ||||| ||| |||||||||||||  ||||||||||
Sbjct: 221 ttcatagcctcaccacgcaccttgggccaggagtt 255

---

>emb|CT032290.1| Platynereis dumerilii EST IB0AAA41CE04EM1
          Length = 869

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 83/95 (87%)
 Strand = Plus / Minus

                                                                       
Query: 255 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 314
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 708 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 649

                                              
Query: 315 ttcatggccacaccacgcaccttangccaggagtt 349
           ||||| |||||||||||||||||  ||||| ||||
Sbjct: 648 ttcatagccacaccacgcaccttgggccagcagtt 614

---

>emb|CT032289.1| Platynereis dumerilii EST IB0AAA41CE04FM1
          Length = 844

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 83/95 (87%)
 Strand = Plus / Plus

                                                                       
Query: 255 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 314
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 161 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 220

                                              
Query: 315 ttcatggccacaccacgcaccttangccaggagtt 349
           ||||| |||||||||||||||||  ||||| ||||
Sbjct: 221 ttcatagccacaccacgcaccttgggccagcagtt 255

---

>emb|CT032278.1| Platynereis dumerilii EST IB0AAA41DB03EM1
          Length = 868

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 83/95 (87%)
 Strand = Plus / Minus

                                                                       
Query: 255 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 314
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 708 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 649

                                              
Query: 315 ttcatggccacaccacgcaccttangccaggagtt 349
           ||||| |||||||||||||||||  ||||| ||||
Sbjct: 648 ttcatagccacaccacgcaccttgggccagcagtt 614

---

>emb|CT032277.1| Platynereis dumerilii EST IB0AAA41DB03FM1
          Length = 822

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 83/95 (87%)
 Strand = Plus / Plus

                                                                       
Query: 255 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 314
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 161 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 220

                                              
Query: 315 ttcatggccacaccacgcaccttangccaggagtt 349
           ||||| |||||||||||||||||  ||||| ||||
Sbjct: 221 ttcatagccacaccacgcaccttgggccagcagtt 255

---

>ref|NM_114978.1| Arabidopsis thaliana structural constituent of ribosome AT3G51190
           mRNA, complete cds
          Length = 783

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 139/170 (81%)
 Strand = Plus / Minus

                                                                       
Query: 267 tgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccaca 326
           |||||||| ||||||||||| ||||||||||||||||| || || |||||||| || |||
Sbjct: 665 tgaccaatgtgctggtggtttcctcctccgtggggatgttccactgggttcatcgcaaca 606

                                                                       
Query: 327 ccacgcaccttangccaggagttcctcttcacacggtacttgtggtaggcgttaccagcc 386
           ||||| ||   | ||||  ||||||||||| |   |||||||||||| || || ||||||
Sbjct: 605 ccacgtacaacaggccaacagttcctcttcgctttgtacttgtggtatgcatttccagcc 546

                                                             
Query: 387 ttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatcat 436
           || || | ||||||||| || || || ||||| ||||| || ||||||||
Sbjct: 545 ttgagaaatggcttctctgttcttcctccacctgcaacttgcccaatcat 496

---

>emb|AL132980.3|ATF24M12 Arabidopsis thaliana DNA chromosome 3, BAC clone F24M12
          Length = 129516

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 139/170 (81%)
 Strand = Plus / Plus

                                                                         
Query: 267   tgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccaca 326
             |||||||| ||||||||||| ||||||||||||||||| || || |||||||| || |||
Sbjct: 76049 tgaccaatgtgctggtggtttcctcctccgtggggatgttccactgggttcatcgcaaca 76108

                                                                         
Query: 327   ccacgcaccttangccaggagttcctcttcacacggtacttgtggtaggcgttaccagcc 386
             ||||| ||   | ||||  ||||||||||| |   |||||||||||| || || ||||||
Sbjct: 76109 ccacgtacaacaggccaacagttcctcttcgctttgtacttgtggtatgcatttccagcc 76168

                                                               
Query: 387   ttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatcat 436
             || || | ||||||||| || || || ||||| ||||| || ||||||||
Sbjct: 76169 ttgagaaatggcttctctgttcttcctccacctgcaacttgcccaatcat 76218

---

>gb|DQ056619.1| Arabidopsis thaliana 60S ribosomal protein L8 (At3g51190) mRNA,
           complete cds
          Length = 783

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 139/170 (81%)
 Strand = Plus / Minus

                                                                       
Query: 267 tgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccaca 326
           |||||||| ||||||||||| ||||||||||||||||| || || |||||||| || |||
Sbjct: 665 tgaccaatgtgctggtggtttcctcctccgtggggatgttccactgggttcatcgcaaca 606

                                                                       
Query: 327 ccacgcaccttangccaggagttcctcttcacacggtacttgtggtaggcgttaccagcc 386
           ||||| ||   | ||||  ||||||||||| |   |||||||||||| || || ||||||
Sbjct: 605 ccacgtacaacaggccaacagttcctcttcgctttgtacttgtggtatgcatttccagcc 546

                                                             
Query: 387 ttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatcat 436
           || || | ||||||||| || || || ||||| ||||| || ||||||||
Sbjct: 545 ttgagaagtggcttctctgttcttcctccacctgcaacttgcccaatcat 496

---

>dbj|AU066544.1| Chlamydomonas sp. HS-5 mRNA for 60S ribosomal protein L2,
           NaCl+paraquat inducible, complete cds, clone:M30
          Length = 987

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 130/158 (82%)
 Strand = Plus / Minus

                                                                       
Query: 270 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 329
           ||||| |||||||||||||| || |||||||| ||||| || ||||||||||||||||||
Sbjct: 672 ccaatgtgctggtggttaccaccaccgtgggggtgctccacggggttcatggccacacca 613

                                                                       
Query: 330 cgcaccttangccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttc 389
           ||||||||  |||||  ||| | |||  |   |||||||||||| | |   |||||||||
Sbjct: 612 cgcaccttcggccagctgttacgcttggccttgtacttgtggtacgagcggccagccttc 553

                                                 
Query: 390 agcattggcttctcagtcctgccaccaccagcaacctg 427
           ||||| ||||||||||| | ||| || ||||| |||||
Sbjct: 552 agcatcggcttctcagtacggccgccgccagcgacctg 515

---

>gb|AY432072.1| Aedes aegypti ASAP ID: 34485 cytosolic large ribosomal subunit L8
           mRNA sequence
          Length = 1079

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 89/104 (85%)
 Strand = Plus / Minus

                                                                       
Query: 273 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 332
           |||||||| |||||||| || ||||||||||||||||| |||||||| || |||||||| 
Sbjct: 748 atatgctgatggttaccaccaccgtggggatgctcaacggggttcatagcaacaccacgt 689

                                                       
Query: 333 accttangccaggagttcctcttcacacggtacttgtggtaggc 376
           |||||  ||||| |||| | ||||||   |||||||||||||||
Sbjct: 688 acctttggccagcagttacgcttcaccttgtacttgtggtaggc 645

---

>emb|AM049012.1| Timarcha balearica partial mRNA for ribosomal protein L8e (rpL8e
           gene)
          Length = 755

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 83/96 (86%)
 Strand = Plus / Minus

                                                                       
Query: 254 aacagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagg 313
           |||||| ||||| | ||| ||||| || |||||||| |||||||| |||||||| |||||
Sbjct: 675 aacagtagaagctttaccgatatgttgatggttaccacctccgtgaggatgctctacagg 616

                                               
Query: 314 gttcatggccacaccacgcaccttangccaggagtt 349
           ||||||||| |||||||| |||||| ||||| ||||
Sbjct: 615 gttcatggcaacaccacgtaccttaggccagcagtt 580

---

>gb|AY128671.1| Drosophila virilis daughter of sevenless (dos) gene, complete cds
          Length = 8311

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 63/69 (91%)
 Strand = Plus / Minus

                                                                       
Query: 269 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
           ||||||||| || |||||||| || |||||||||||||| |||||||||||||| |||||
Sbjct: 298 accaatatgttgatggttaccaccaccgtggggatgctccacagggttcatggcaacacc 239

                    
Query: 329 acgcacctt 337
           |||||||||
Sbjct: 238 acgcacctt 230

---

>gb|AF526214.1| Argopecten irradians isolate iolsaicl63ct83cn90 ribosomal protein L
           mRNA, complete cds
          Length = 866

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 128/156 (82%)
 Strand = Plus / Minus

                                                                       
Query: 269 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
           |||||||||||| |||||||| || || || ||||| ||||| |||||||| ||||||||
Sbjct: 694 accaatatgctgatggttaccaccaccatgaggatgttcaactgggttcatagccacacc 635

                                                                       
Query: 329 acgcaccttangccaggagttcctcttcacacggtacttgtggtaggcgttaccagcctt 388
           ||| || ||| ||||| |||||||||| ||   |||||||  ||| ||   |||||||||
Sbjct: 634 acgaactttaggccagcagttcctcttgaccttgtacttgaagtaagcacgaccagcctt 575

                                               
Query: 389 cagcattggcttctcagtcctgccaccaccagcaac 424
           |||||| ||||| ||  |||| ||||| ||||||||
Sbjct: 574 cagcatgggcttgtctatccttccacctccagcaac 539

---

>emb|CR937938.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YP16AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 816

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                       
Query: 273 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 332
           |||||||| |||||||| || ||||||||||||||||| |||||||| || || ||||| 
Sbjct: 740 atatgctgatggttaccaccaccgtggggatgctcaacggggttcatagcaacgccacgt 681

                                                                       
Query: 333 accttangccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagc 392
           |||||  ||||| |||| | ||||||   |||||||||||||||   |||||||||||| 
Sbjct: 680 acctttggccagcagttacgcttcaccttgtacttgtggtaggcacgaccagccttcagg 621

                   
Query: 393 attggctt 400
           || |||||
Sbjct: 620 ataggctt 613

---

>dbj|AK060350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-008-F06, full
           insert sequence
          Length = 864

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 267 tgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccaca 326
           |||||||| |||||||||||||| || |||||||| ||||| || |||||||||||||||
Sbjct: 682 tgaccaatgtgctggtggttaccaccaccgtgggggtgctccacggggttcatggccaca 623

                   
Query: 327 ccacgcac 334
           ||||||||
Sbjct: 622 ccacgcac 615

---

>emb|CT032253.1| Platynereis dumerilii EST IB0AAA42BC10FM1
          Length = 778

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 82/95 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 314
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 173 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 232

                                              
Query: 315 ttcatggccacaccacgcaccttangccaggagtt 349
           |||||  ||||||||||||||||  ||||| ||||
Sbjct: 233 ttcataaccacaccacgcaccttgggccagcagtt 267

---

>gb|AF429973.1| Spodoptera frugiperda ribosomal protein L8 mRNA, complete cds
          Length = 915

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 269 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
           ||||||||| ||||||||||| |||||||| ||||||||||| |||||||| ||||||||
Sbjct: 702 accaatatgttggtggttaccacctccgtgaggatgctcaacggggttcatagccacacc 643

              
Query: 329 acg 331
           |||
Sbjct: 642 acg 640

---

>ref|XM_962890.1| PREDICTED: Tribolium castaneum similar to CG1263-PA, isoform A
           (LOC656352), mRNA
          Length = 886

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 269 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
           |||||| |||||||| ||||| || ||||||||||||||||| ||||||||||| |||||
Sbjct: 685 accaatgtgctggtgattaccaccaccgtggggatgctcaactgggttcatggcaacacc 626

                                
Query: 329 acgcaccttangccaggagtt 349
           ||| || ||| ||||| ||||
Sbjct: 625 acgtactttaggccagcagtt 605

---

>gb|AY957563.1| Oncorhynchus mykiss ribosomal protein L8 mRNA, partial cds
          Length = 672

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 270 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 329
           |||||||||||||||||||| || |||  ||||||||||||||||| |||||||||||||
Sbjct: 625 ccaatatgctggtggttaccaccaccgaagggatgctcaacagggtccatggccacacca 566

             
Query: 330 cg 331
           ||
Sbjct: 565 cg 564

---

>emb|CR938631.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YD12AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 724

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 98/117 (83%)
 Strand = Plus / Minus

                                                                       
Query: 284 gttacctcctccgtggggatgctcaacagggttcatggccacaccacgcaccttangcca 343
           |||||| || ||||||||||||||||| |||||||| || |||||||| |||||  ||||
Sbjct: 724 gttaccaccaccgtggggatgctcaacggggttcatagcaacaccacgtacctttggcca 665

                                                                    
Query: 344 ggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattggctt 400
           | |||| | ||||||   |||||||||||||||   |||||||||||| || |||||
Sbjct: 664 gcagttacgcttcaccttgtacttgtggtaggcacgaccagccttcaggataggctt 608

---

>gb|M99055.1|MQSRPL8X Mosquito ribosomal protein L8 (rpL8) gene exons 1-3, complete cds
          Length = 2231

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 104/125 (83%)
 Strand = Plus / Minus

                                                                        
Query: 276  tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
            ||||| |||||||| || || |||||||||||||| |||||||| ||||||||||| |||
Sbjct: 1937 tgctgatggttaccaccaccatggggatgctcaacggggttcatagccacaccacgtacc 1878

                                                                        
Query: 336  ttangccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcatt 395
            ||  ||||| |||| | ||||||   ||||||| |||||||   ||| |||||||| |||
Sbjct: 1877 tttggccagcagttacgcttcaccttgtacttgcggtaggcacgaccggccttcaggatt 1818

                 
Query: 396  ggctt 400
            |||||
Sbjct: 1817 ggctt 1813

---

>gb|AY943311.1| Wyeomyia smithii ribosomal protein L8 mRNA, partial cds
          Length = 331

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 106/128 (82%)
 Strand = Plus / Minus

                                                                       
Query: 273 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 332
           ||||||||||| ||||| || || |||||||||||||| |||||||| || |||||||||
Sbjct: 168 atatgctggtgattaccaccaccatggggatgctcaacggggttcatagcaacaccacgc 109

                                                                       
Query: 333 accttangccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagc 392
           || ||  ||||| |||| | ||||||   |||||||||||| ||   ||||||| |||| 
Sbjct: 108 actttcggccagcagttacgcttcaccttgtacttgtggtatgcacgaccagccctcaga 49

                   
Query: 393 attggctt 400
           ||||||||
Sbjct: 48  attggctt 41

---

>gb|DQ213524.1| Taeniopygia guttata clone 0058P0020H02 ribosomal protein L8-like
           mRNA, complete sequence
          Length = 903

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                   
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacg 331
           ||||||||||| |||||||||  ||||||||| |||||||||||||||||||||||
Sbjct: 725 tgctggtggttgcctcctccgaagggatgctccacagggttcatggccacaccacg 670

---

>gb|DQ213521.1| Taeniopygia guttata clone 0058P0051G10 ribosomal protein L8-like
           mRNA, complete sequence
          Length = 854

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                   
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacg 331
           ||||||||||| |||||||||  ||||||||| |||||||||||||||||||||||
Sbjct: 677 tgctggtggttgcctcctccgaagggatgctccacagggttcatggccacaccacg 622

---

>ref|XM_447807.1| Candida glabrata CBS138, CAGL0J02354g partial mRNA
          Length = 765

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 126/155 (81%)
 Strand = Plus / Minus

                                                                       
Query: 269 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
           ||||||||| || |||||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 660 accaatatgttgatggttaccaccaccgtgagggtgatcaacagggttcatggcaacacc 601

                                                                       
Query: 329 acgcaccttangccaggagttcctcttcacacggtacttgtggtaggcgttaccagcctt 388
           |||   |||  |||| ||||| |||||||    |||||||||| | ||   |||||||||
Sbjct: 600 acgggtctttggccaagagtttctcttcaacttgtacttgtggaaagcacgaccagcctt 541

                                              
Query: 389 cagcattggcttctcagtcctgccaccaccagcaa 423
           || || |||||| ||||| || |||||||||||||
Sbjct: 540 caacaatggcttgtcagttctaccaccaccagcaa 506

---

>emb|CR380956.1| Candida glabrata strain CBS138 chromosome J complete sequence
          Length = 1192501

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 126/155 (81%)
 Strand = Plus / Plus

                                                                          
Query: 269    accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
              ||||||||| || |||||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 227764 accaatatgttgatggttaccaccaccgtgagggtgatcaacagggttcatggcaacacc 227823

                                                                          
Query: 329    acgcaccttangccaggagttcctcttcacacggtacttgtggtaggcgttaccagcctt 388
              |||   |||  |||| ||||| |||||||    |||||||||| | ||   |||||||||
Sbjct: 227824 acgggtctttggccaagagtttctcttcaacttgtacttgtggaaagcacgaccagcctt 227883

                                                 
Query: 389    cagcattggcttctcagtcctgccaccaccagcaa 423
              || || |||||| ||||| || |||||||||||||
Sbjct: 227884 caacaatggcttgtcagttctaccaccaccagcaa 227918

---

>gb|DQ213522.1| Taeniopygia guttata clone 0061P0021C08 ribosomal protein L8-like
           mRNA, complete sequence
          Length = 878

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 51/55 (92%)
 Strand = Plus / Minus

                                                                  
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccac 330
           ||||||||||| |||||||||  ||||||||| ||||||||||||||||||||||
Sbjct: 702 tgctggtggttgcctcctccgaagggatgctccacagggttcatggccacaccac 648

---

>ref|XM_582676.2| PREDICTED: Bos taurus similar to 60S ribosomal protein L8
           (LOC506251), mRNA
          Length = 833

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 119/146 (81%)
 Strand = Plus / Minus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||||||||| || ||||||  ||||||||| |||||||||||||||||||| ||||||
Sbjct: 682 tgctggtggttgccacctccgaagggatgctcgacagggttcatggccacaccccgcacc 623

                                                                       
Query: 336 ttangccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcatt 395
               ||||| ||||||||||  |    |||||||||||||| |  ||||||||||| || 
Sbjct: 622 agtggccagcagttcctctttgccttatacttgtggtaggcatggccagccttcagaatg 563

                                     
Query: 396 ggcttctcagtcctgccaccaccagc 421
           ||||| ||| | | |||||| |||||
Sbjct: 562 ggcttgtcaatgcagccacctccagc 537

---

>gb|AY919670.1| Pimephales promelas 60S ribosomal protein L8 mRNA, partial cds
          Length = 709

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 270 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 329
           ||||||||||| |||||||| || |||  ||||||||||||||||||||| |||||||||
Sbjct: 621 ccaatatgctgatggttaccaccaccgaagggatgctcaacagggttcatagccacacca 562

                                     
Query: 330 cgcaccttangccaggagttcctctt 355
           || ||   | ||||| ||||||||||
Sbjct: 561 cggacacgaggccagcagttcctctt 536

---

>dbj|AB242299.1| Asterias amurensis PKA-R mRNA for protein kinase A regulatory
            subunit, complete cds
          Length = 2300

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                        
Query: 269  accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
            ||||||||||||||| ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 1999 accaatatgctggtgattaccaccaccgtggggatggtccacagggttcattgccacacc 1940

               
Query: 329  acg 331
            |||
Sbjct: 1939 acg 1937

---

>emb|AL116103.1|CNS01CXB Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 269 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
           ||||||||| || |||||||| |||||||| ||||| ||||||||||||||||| |||||
Sbjct: 652 accaatatgttgatggttaccacctccgtgaggatggtcaacagggttcatggcaacacc 593

              
Query: 329 acg 331
           |||
Sbjct: 592 acg 590

---

>emb|AL114960.1|CNS01C1K Botrytis cinerea strain T4 cDNA library
          Length = 480

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 269 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
           ||||||||| || |||||||| |||||||| ||||| ||||||||||||||||| |||||
Sbjct: 214 accaatatgttgatggttaccacctccgtgaggatggtcaacagggttcatggcaacacc 155

              
Query: 329 acg 331
           |||
Sbjct: 154 acg 152

---

>emb|AL112851.1|CNS01AEZ Botrytis cinerea strain T4 cDNA library
          Length = 600

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 269 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
           ||||||||| || |||||||| |||||||| ||||| ||||||||||||||||| |||||
Sbjct: 416 accaatatgttgatggttaccacctccgtgaggatggtcaacagggttcatggcaacacc 357

              
Query: 329 acg 331
           |||
Sbjct: 356 acg 354

---

>emb|AL112838.1|CNS01AEM Botrytis cinerea strain T4 cDNA library
          Length = 360

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 269 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
           ||||||||| || |||||||| |||||||| ||||| ||||||||||||||||| |||||
Sbjct: 163 accaatatgttgatggttaccacctccgtgaggatggtcaacagggttcatggcaacacc 104

              
Query: 329 acg 331
           |||
Sbjct: 103 acg 101

---

>emb|AL112486.1|CNS01A4U Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 269 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
           ||||||||| || |||||||| |||||||| ||||| ||||||||||||||||| |||||
Sbjct: 587 accaatatgttgatggttaccacctccgtgaggatggtcaacagggttcatggcaacacc 528

              
Query: 329 acg 331
           |||
Sbjct: 527 acg 525

---

>gb|AF164152.1|AF164152 Anopheles gambiae strain M2 ribosomal protein L8 (rpL8) mRNA,
           complete cds
          Length = 937

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||||||||||
Sbjct: 712 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccacgcacc 653

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 652 ttcggccagcagttacgcttcaccttgtacttgtggta 615

---

>gb|AY190734.1| Pagrus major ribosomal protein L8 mRNA, partial cds
          Length = 688

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                       
Query: 270 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 329
           ||||||||||| |||||||| || |||  ||||||||||||||||||||| |||||||||
Sbjct: 686 ccaatatgctgatggttaccaccaccgaagggatgctcaacagggttcatagccacacca 627

             
Query: 330 cg 331
           ||
Sbjct: 626 cg 625

---

>emb|AM049010.1| Meladema coriacea partial mRNA for ribosomal protein L8e (rpL8e
           gene)
          Length = 711

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                       
Query: 273 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 332
           ||||| || |||||||| || ||||||||||||||||| |||||||| |||||||| |||
Sbjct: 656 atatgttgatggttaccaccaccgtggggatgctcaacggggttcatagccacaccgcgc 597

                            
Query: 333 accttangccaggagtt 349
           |||||  ||||| ||||
Sbjct: 596 acctttggccagcagtt 580

---

>emb|AL112254.1|CNS019YE Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                       
Query: 270 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 329
           |||||||| || |||||||| |||||||| ||||| ||||||||||||||||| ||||||
Sbjct: 462 ccaatatgttgatggttaccacctccgtgaggatggtcaacagggttcatggcaacacca 403

             
Query: 330 cg 331
           ||
Sbjct: 402 cg 401

---

>emb|AJ563478.1|CGI563478 Crassostrea gigas partial mRNA for ribosomal protein L8 (rpll gene)
          Length = 305

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 50/54 (92%)
 Strand = Plus / Minus

                                                                 
Query: 269 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggc 322
           ||||||||| || |||||||||||||| ||||||||||||||||| ||||||||
Sbjct: 188 accaatatgttgatggttacctcctccatggggatgctcaacaggattcatggc 135

---

>gb|AY769276.1| Bombyx mori ribosomal protein L8 (RpL8) mRNA, complete cds
          Length = 862

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                       
Query: 255 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 314
           ||||||||||| | ||| ||||| || |||||||| || ||||| |||||||| ||||||
Sbjct: 713 acagtggaagccttacctatatgttgatggttaccaccaccgtgaggatgctctacaggg 654

                            
Query: 315 ttcatggccacaccacg 331
           |||||||| ||||||||
Sbjct: 653 ttcatggcaacaccacg 637

---

>emb|AM049009.1| Georissus sp. APV-2005 mRNA for ribosomal protein L8e (rpL8e gene)
          Length = 774

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           |||||||| ||||| || ||||| ||||| || || ||||||||||| ||||||||||||
Sbjct: 653 tgctggtgattaccaccaccgtgaggatgytcsactgggttcatggcgacaccacgcacc 594

                         
Query: 336 ttangccaggagtt 349
           ||| ||||| ||||
Sbjct: 593 ttaggccagcagtt 580

---

>gb|BC102277.1| Bos taurus similar to 60S ribosomal protein L8, mRNA (cDNA clone
           MGC:127227 IMAGE:7945641), complete cds
          Length = 932

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||||||||| || ||||||  ||||||||| |||||||||||||||||||| ||||||
Sbjct: 688 tgctggtggttgccacctccgaagggatgctcgacagggttcatggccacaccccgcacc 629

                               
Query: 336 ttangccaggagttcctctt 355
               ||||| ||||||||||
Sbjct: 628 cgtggccagcagttcctctt 609

---

>ref|NM_001034625.1| Bos taurus similar to 60S ribosomal protein L8 (MGC127227), mRNA
          Length = 932

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||||||||| || ||||||  ||||||||| |||||||||||||||||||| ||||||
Sbjct: 688 tgctggtggttgccacctccgaagggatgctcgacagggttcatggccacaccccgcacc 629

                               
Query: 336 ttangccaggagttcctctt 355
               ||||| ||||||||||
Sbjct: 628 cgtggccagcagttcctctt 609

---

>gb|DQ213525.1| Taeniopygia guttata clone 0058P0034B06 ribosomal protein L8-like
           mRNA, complete sequence
          Length = 881

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                   
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacg 331
           ||||||||||  |||||||||  ||||||||| |||||||||||||||||||||||
Sbjct: 703 tgctggtggtcgcctcctccgaagggatgctccacagggttcatggccacaccacg 648

---

>gb|DQ213523.1| Taeniopygia guttata clone 0058P0011G02 ribosomal protein L8-like
           mRNA, complete sequence
          Length = 882

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                   
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacg 331
           ||||||||||  |||||||||  ||||||||| |||||||||||||||||||||||
Sbjct: 703 tgctggtggtcgcctcctccgaagggatgctccacagggttcatggccacaccacg 648

---

>emb|AM049011.1| Mycetophagus quadripustulatus mRNA for ribosomal protein L8e (rpL8e
           gene)
          Length = 774

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 59/67 (88%)
 Strand = Plus / Minus

                                                                       
Query: 283 ggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcaccttangcc 342
           ||||||| || ||||| ||||||||||| ||||||||||| ||||||||||||||  |||
Sbjct: 646 ggttaccaccaccgtgaggatgctcaacggggttcatggcaacaccacgcacctttggcc 587

                  
Query: 343 aggagtt 349
           || ||||
Sbjct: 586 agcagtt 580

---

>emb|CR938453.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YN07AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 735

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 294 ccgtggggatgctcaacagggttcatggccacaccacgcaccttangccaggagttcctc 353
           ||||||||||||||||| |||||||| || |||||||| |||||  ||||| |||| | |
Sbjct: 728 ccgtggggatgctcaacggggttcatagcaacaccacgtacctttggccagcagttacgc 669

                                  
Query: 354 ttcacacggtacttgtggtaggc 376
           |||||   |||||||||||||||
Sbjct: 668 ttcaccttgtacttgtggtaggc 646

---

>ref|XM_393671.2| PREDICTED: Apis mellifera similar to ribosomal protein L8
           (LOC410188), mRNA
          Length = 843

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 74/87 (85%)
 Strand = Plus / Minus

                                                                       
Query: 269 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
           ||||||||| || || ||||| || ||||| ||||| |||||||||||||| || |||||
Sbjct: 691 accaatatgttgatgattaccaccaccgtgtggatgttcaacagggttcatagcaacacc 632

                                      
Query: 329 acgcaccttangccaggagttcctctt 355
           ||| |||||| ||||  ||||||||||
Sbjct: 631 acgaaccttaggccaacagttcctctt 605

---

>gb|BC059473.1| Danio rerio ribosomal protein L8, mRNA (cDNA clone MGC:73105
           IMAGE:4786513), complete cds
          Length = 841

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 269 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
           |||||| ||||| |||||||| || |||  ||||||||||||||||||||| ||||||||
Sbjct: 675 accaatgtgctgatggttaccaccaccgaagggatgctcaacagggttcatagccacacc 616

              
Query: 329 acg 331
           |||
Sbjct: 615 acg 613

---

>ref|NM_200713.1| Danio rerio ribosomal protein L8 (rpl8), mRNA
          Length = 841

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 269 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
           |||||| ||||| |||||||| || |||  ||||||||||||||||||||| ||||||||
Sbjct: 675 accaatgtgctgatggttaccaccaccgaagggatgctcaacagggttcatagccacacc 616

              
Query: 329 acg 331
           |||
Sbjct: 615 acg 613

---

>gb|AY533227.1| Chinchilla lanigera ribosomal protein L8 mRNA, partial cds
          Length = 513

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 118/146 (80%)
 Strand = Plus / Minus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           |||||||||||||| |||||   ||||||||| ||||| ||||||||||||||||| || 
Sbjct: 335 tgctggtggttaccacctccaaagggatgctccacaggattcatggccacaccacgtaca 276

                                                                       
Query: 336 ttangccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcatt 395
               ||||| ||||||||||  |   |||||||||||||||  | ||||||||||  || 
Sbjct: 275 cgtggccagcagttcctctttgccttgtacttgtggtaggctctgccagccttcaagata 216

                                     
Query: 396 ggcttctcagtcctgccaccaccagc 421
           || || ||| | ||||||||||||||
Sbjct: 215 ggtttatcaattctgccaccaccagc 190

---

>emb|BX071470.1|CNS09RB6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9AB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1020

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 356 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 415

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 416 ttcggccagcagttgcgcttcaccttgtacttgtggta 453

---

>emb|BX071012.1|CNS09QYG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 357 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 416

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 417 ttcggccagcagttgcgcttcaccttgtacttgtggta 454

---

>emb|BX070207.1|CNS09QC3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 469

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438

---

>emb|BX061050.1|CNS09J9Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41CF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 775

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 330 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 389

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 390 ttcggccagcagttgcgcttcaccttgtacttgtggta 427

---

>emb|BX068769.1|CNS09P85 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 360 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 419

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 420 ttcggccagcagttgcgcttcaccttgtacttgtggta 457

---

>emb|BX067648.1|CNS09OD0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 346 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 405

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 406 ttcggccagcagttgcgcttcaccttgtacttgtggta 443

---

>emb|BX067520.1|CNS09O9G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 525

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 348 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 407

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 408 ttcggccagcagttgcgcttcaccttgtacttgtggta 445

---

>emb|BX066574.1|CNS09NJ6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 349 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 408

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 409 ttcggccagcagttgcgcttcaccttgtacttgtggta 446

---

>emb|BX066544.1|CNS09NIC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 350 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 409

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 410 ttcggccagcagttgcgcttcaccttgtacttgtggta 447

---

>emb|BX065896.1|CNS09N0C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 352 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 411

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 412 ttcggccagcagttgcgcttcaccttgtacttgtggta 449

---

>emb|BX064864.1|CNS09M7O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48CA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1015

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 337 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 396

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 397 ttcggccagcagttgcgcttcaccttgtacttgtggta 434

---

>emb|BX064747.1|CNS09M4F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48BB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 536

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 342 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 401

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 402 ttcggccagcagttgcgcttcaccttgtacttgtggta 439

---

>emb|BX064211.1|CNS09LPJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 610

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 349 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 408

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 409 ttcggccagcagttgcgcttcaccttgtacttgtggta 446

---

>emb|BX063827.1|CNS09LEV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 360 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 419

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 420 ttcggccagcagttgcgcttcaccttgtacttgtggta 457

---

>emb|BX063245.1|CNS09KYP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44DH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 875

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 340 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 399

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 400 ttcggccagtagttgcgcttcaccttgtacttgtggta 437

---

>emb|BX063171.1|CNS09KWN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44DD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 356 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 415

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 416 ttcggccagcagttgcgcttcaccttgtacttgtggta 453

---

>emb|BX062318.1|CNS09K8Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43CC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 998

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 338 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 397

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 398 ttcggccagtagttgcgcttcaccttgtacttgtggta 435

---

>emb|BX062038.1|CNS09K16 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43AE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 626

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 281 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 340

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 341 ttcggccagcagttgcgcttcaccttgtacttgtggta 378

---

>emb|BX061861.1|CNS09JW9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 346 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 405

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 406 ttcggccagcagttgcgcttcaccttgtacttgtggta 443

---

>emb|BX061503.1|CNS09JMB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 354 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 413

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 414 ttcggccagcagttgcgcttcaccttgtacttgtggta 451

---

>emb|BX061238.1|CNS09JEY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 308 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 367

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 368 ttcggccagcagttgcgcttcaccttgtacttgtggta 405

---

>emb|BX060724.1|CNS09J0O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41AH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 838

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 346 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 405

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 406 ttcggccagcagttgcgcttcaccttgtacttgtggta 443

---

>emb|BX059267.1|CNS09HW7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4AB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 903

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 362 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 421

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 422 ttcggccagcagttgcgcttcaccttgtacttgtggta 459

---

>emb|BX059235.1|CNS09HVB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438

---

>emb|BX057044.1|CNS09G6G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36DC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 783

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 352 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 411

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 412 ttcggccagcagttgcgcttcaccttgtacttgtggta 449

---

>emb|BX056961.1|CNS09G45 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 831

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 362 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 421

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 422 ttcggccagcagttgcgcttcaccttgtacttgtggta 459

---

>emb|BX055189.1|CNS09EQX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33CH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 845

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 350 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 409

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 410 ttcggccagcagttgcgcttcaccttgtacttgtggta 447

---

>emb|BX054843.1|CNS09EHB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33AG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 346 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 405

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 406 ttcggccagcagttgcgcttcaccttgtacttgtggta 443

---

>emb|BX054769.1|CNS09EF9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33AC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 604

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 336 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 395

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 396 ttcggccagcagttgcgcttcaccttgtacttgtggta 433

---

>emb|BX054768.1|CNS09EF8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33AC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 715 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 656

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 655 ttcggccagcagttgcgcttcaccttgtacttgtggta 618

---

>emb|BX053031.1|CNS09D2Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30BG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 521

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 274 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 333

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 334 ttcggccagcagttgcgcttcaccttgtacttgtggta 371

---

>emb|BX054430.1|CNS09E5U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 722

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 248 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 307

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 308 ttcggccagcagttgcgcttcaccttgtacttgtggta 345

---

>emb|BX054417.1|CNS09E5H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 744 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 685

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 684 ttcggccagcagttgcgcttcaccttgtacttgtggta 647

---

>emb|BX054379.1|CNS09E4F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32CA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 787

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 349 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 408

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 409 ttcggccagcagttgcgcttcaccttgtacttgtggta 446

---

>emb|BX053844.1|CNS09DPK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 362 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 421

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 422 ttcggccagcagttgcgcttcaccttgtacttgtggta 459

---

>emb|BX053555.1|CNS09DHJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31BB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 877

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 362 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 421

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 422 ttcggccagcagttgcgcttcaccttgtacttgtggta 459

---

>emb|BX052540.1|CNS09CPC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 357 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 416

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 417 ttcggccagcagttgcgcttcaccttgtacttgtggta 454

---

>emb|BX052387.1|CNS09CL3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3BG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 521

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 358 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 417

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 418 ttcggccagcagttgcgcttcaccttgtacttgtggta 455

---

>emb|BX051644.1|CNS09C0G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC29AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 536

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 365 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 424

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 425 ttcggccagcagttgcgcttcaccttgtacttgtggta 462

---

>emb|BX051423.1|CNS09BUB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC28DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 873

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 354 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 413

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 414 ttcggccagcagttgcgcttcaccttgtacttgtggta 451

---

>emb|BX050118.1|CNS09AU2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC26BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 536

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 344 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 403

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 404 ttcggccagcagttgcgcttcaccttgtacttgtggta 441

---

>emb|BX050810.1|CNS09BDA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC27CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 352 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 411

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 412 ttcggccagcagttgcgcttcaccttgtacttgtggta 449

---

>emb|BX050569.1|CNS09B6L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC27AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 598

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 334 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 393

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 394 ttcggccagcagttgcgcttcaccttgtacttgtggta 431

---

>emb|BX049265.1|CNS09A6D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC25AC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 833

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 360 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 419

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 420 ttcggccagcagttgcgcttcaccttgtacttgtggta 457

---

>emb|BX048973.1|CNS099Y9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC24CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 511

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 345 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 404

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 405 ttcggccagcagttgcgcttcaccttgtacttgtggta 442

---

>emb|BX046434.1|CNS097ZQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC20AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 344 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 403

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 404 ttcggccagcagttgcgcttcaccttgtacttgtggta 441

---

>emb|BX047425.1|CNS098R9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC21CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 366 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 425

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 426 ttcggccagcagttgcgcttcaccttgtacttgtggta 463

---

>emb|BX047145.1|CNS098JH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC21AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 364 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 423

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 424 ttcggccagcagttgcgcttcaccttgtacttgtggta 461

---

>emb|BX045582.1|CNS097C2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC19DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 567

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 356 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 415

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 416 ttcggccagcagttgcgcttcaccttgtacttgtggta 453

---

>emb|BX045137.1|CNS096ZP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC19AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 344 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 403

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 404 ttcggccagcagttgcgcttcaccttgtacttgtggta 441

---

>emb|BX043850.1|CNS095ZY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC16CH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 333 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatagccacaccgcgcacc 392

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 393 ttcggccagcagttgcgcttcaccttgtacttgtggta 430

---

>emb|BX043551.1|CNS095RN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC16BA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 840

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 340 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 399

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 400 ttcggccagcagttgcgcttcaccttgtacttgtggta 437

---

>emb|BX041268.1|CNS09408 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12CB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 365 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 424

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 425 ttcggccagcagttgcgcttcaccttgtacttgtggta 462

---

>emb|BX041134.1|CNS093WI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438

---

>emb|BX041072.1|CNS093US Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 338 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 397

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 398 ttcggccagcagttgcgcttcaccttgtacttgtggta 435

---

>emb|BX040787.1|CNS093MV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC11DC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 364 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 423

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 424 ttcggccagcagttgcgcttcaccttgtacttgtggta 461

---

>emb|BX040786.1|CNS093MU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11DC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 716 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 657

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 656 ttcggccagcagttgcgcttcaccttgtacttgtggta 619

---

>emb|BX039654.1|CNS092RE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC10AC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 333 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 392

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 393 ttcggccagcagttgcgcttcaccttgtacttgtggta 430

---

>emb|BX036687.1|CNS090GZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA8DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 793

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438

---

>emb|BX037078.1|CNS090RU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 810

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 726 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 667

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 666 ttcggccagcagttgcgcttcaccttgtacttgtggta 629

---

>emb|BX035978.1|CNS08ZXA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 356 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 415

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 416 ttcggccagcagttgcgcttcaccttgtacttgtggta 453

---

>emb|BX034653.1|CNS08YWH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA50CF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 338 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 397

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 398 ttcggccagcagttgcgcttcaccttgtacttgtggta 435

---

>emb|BX033967.1|CNS08YDF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5CF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 751

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 348 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 407

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 408 ttcggccagcagttgcgcttcaccttgtacttgtggta 445

---

>emb|BX033761.1|CNS08Y7P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5BE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 358 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 417

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 418 ttcggccagcagttgcgcttcaccttgtacttgtggta 455

---

>emb|BX033234.1|CNS08XT2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 338 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 397

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 398 ttcggccagcagttgcgcttcaccttgtacttgtggta 435

---

>emb|BX033107.1|CNS08XPJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 859

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 345 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 404

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 405 ttcggccagcagttgcgcttcaccttgtacttgtggta 442

---

>emb|BX032954.1|CNS08XLA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 950

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 353 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 412

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 413 ttcggccagcagttgcgcttcaccttgtacttgtggta 450

---

>emb|BX032912.1|CNS08XK4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49AD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1012

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 352 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 411

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 412 ttcggccagcagttgcgcttcaccttgtacttgtggta 449

---

>emb|BX032378.1|CNS08X5A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA48BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 640

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 340 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 399

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 400 ttcggccagcagttgcgcttcaccttgtacttgtggta 437

---

>emb|BX031877.1|CNS08WRD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47CA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 340 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 399

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 400 ttcggccagcagttgcgcttcaccttgtacttgtggta 437

---

>emb|BX031828.1|CNS08WQ0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 917

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438

---

>emb|BX031537.1|CNS08WHX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 827

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 336 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 395

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 396 ttcggccagcagttgcgcttcaccttgtacttgtggta 433

---

>emb|BX030749.1|CNS08VW1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA45DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 342 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 401

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 402 ttcggccagcagttgcgcttcaccttgtacttgtggta 439

---

>emb|BX031289.1|CNS08WB1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA46CF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 336 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 395

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 396 ttcggccagcagttgcgcttcaccttgtacttgtggta 433

---

>emb|BX030002.1|CNS08VBA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1023

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 360 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 419

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 420 ttcggccagcagttgcgcttcaccttgtacttgtggta 457

---

>emb|BX029262.1|CNS08UQQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA43DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 811

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 342 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 401

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 402 ttcggccagcagttgcgcttcaccttgtacttgtggta 439

---

>emb|BX029602.1|CNS08V06 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44BA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 872

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 349 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 408

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 409 ttcggccagcagttgcgcttcaccttgtacttgtggta 446

---

>emb|BX028637.1|CNS08U9D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA42DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 882

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 348 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 407

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 408 ttcggccagcagttgcgcttcaccttgtacttgtggta 445

---

>emb|BX022357.1|CNS08PEX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA34BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 838

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 345 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 404

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 405 ttcggccagcagttgcgcttcaccttgtacttgtggta 442

---

>emb|BX026844.1|CNS08SVK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA40BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 356 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 415

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 416 ttcggccagcagttgcgcttcaccttgtacttgtggta 453

---

>emb|BX026789.1|CNS08SU1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA40AH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 348 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 407

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 408 ttcggccagcagttgcgcttcaccttgtacttgtggta 445

---

>emb|BX025698.1|CNS08RZQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA39BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 988

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 353 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 412

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 413 ttcggccagcagttgcgcttcaccttgtacttgtggta 450

---

>emb|BX025349.1|CNS08RQ1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 354 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 413

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 414 ttcggccagcagttgcgcttcaccttgtacttgtggta 451

---

>emb|BX025079.1|CNS08RIJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38BG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 967

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 340 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 399

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 400 ttcggccagcagttgcgcttcaccttgtacttgtggta 437

---

>emb|BX025073.1|CNS08RID Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 337 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 396

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 397 ttcggccagcagttgcgcttcaccttgtacttgtggta 434

---

>emb|BX025038.1|CNS08RHE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 967

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 348 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 407

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 408 ttcggccagcagttgcgcttcaccttgtacttgtggta 445

---

>emb|BX025033.1|CNS08RH9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 340 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 399

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 400 ttcggccagcagttgcgcttcaccttgtacttgtggta 437

---

>emb|BX024670.1|CNS08R76 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA37DA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 797

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438

---

>emb|BX024145.1|CNS08QSL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA36DD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 881

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 329 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 388

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 389 ttcggccagcagttgcgcttcaccttgtacttgtggta 426

---

>emb|BX023815.1|CNS08QJF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA36BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 366 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 425

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 426 ttcggccagcagttgcgcttcaccttgtacttgtggta 463

---

>emb|BX022223.1|CNS08PB7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA34AB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 376 tgctgatggttaccaccaccgtgcggatgctcgacggggttcattgccacaccgcgcacc 435

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 436 ttcggccagcagttgcgcttcaccttgtacttgtggta 473

---

>emb|BX021031.1|CNS08OE3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA31AE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 885

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 348 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 407

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 408 ttcggccagcagttgcgcttcaccttgtacttgtggta 445

---

>emb|BX020305.1|CNS08NTX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3DF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 337 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 396

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 397 ttcggccagcagttgcgcttcaccttgtacttgtggta 434

---

>emb|BX018974.1|CNS08MSY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA28DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 859

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 342 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 401

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 402 ttcggccagcagttgcgcttcaccttgtacttgtggta 439

---

>emb|BX018003.1|CNS08M1Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 961

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 345 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 404

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 405 ttcggccagcagttgcgcttcaccttgtacttgtggta 442

---

>emb|BX017981.1|CNS08M1D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27AF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1003

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438

---

>emb|BX018524.1|CNS08MGG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA28AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 354 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 413

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 414 ttcggccagcagttgcgcttcaccttgtacttgtggta 451

---

>emb|BX018377.1|CNS08MCD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1034

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 360 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 419

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 420 ttcggccagcagttgcgcttcaccttgtacttgtggta 457

---

>emb|BX017737.1|CNS08LUL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA26DC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 364 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 423

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 424 ttcggccagcagttgcgcttcaccttgtacttgtggta 461

---

>emb|BX017331.1|CNS08LJB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA26AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 850

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 337 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 396

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 397 ttcggccagcagttgcgcttcaccttgtacttgtggta 434

---

>emb|BX016524.1|CNS08KWW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24DD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 801

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 627 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 568

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 567 ttcggccagcagttgcgcttcaccttgtacttgtggta 530

---

>emb|BX016411.1|CNS08KTR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24CE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 885

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 368 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 427

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 428 ttcggccagcagttgcgcttcaccttgtacttgtggta 465

---

>emb|BX015958.1|CNS08KH6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA23DG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438

---

>emb|BX014218.1|CNS08J4U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA21BD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 795

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 356 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 415

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 416 ttcggccagcagttgcgcttcaccttgtacttgtggta 453

---

>emb|BX013506.1|CNS08IL2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA20BC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 336 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 395

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 396 ttcggccagcagttgcgcttcaccttgtacttgtggta 433

---

>emb|BX013505.1|CNS08IL1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20BC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 719 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 660

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 659 ttcggccagcagttgcgcttcaccttgtacttgtggta 622

---

>emb|BX013494.1|CNS08IKQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA20BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 345 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 404

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 405 ttcggccagcagttgcgcttcaccttgtacttgtggta 442

---

>emb|BX012299.1|CNS08HNJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 765

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 353 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 412

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 413 ttcggccagcagttgcgcttcaccttgtacttgtggta 450

---

>emb|BX010378.1|CNS08G66 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 857

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 342 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 401

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 402 ttcggccagcagttgcgcttcaccttgtacttgtggta 439

---

>emb|BX009864.1|CNS08FRW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15DF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 854

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 344 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 403

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 404 ttcggccagcagttgcgcttcaccttgtacttgtggta 441

---

>emb|BX009834.1|CNS08FR2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 935

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 352 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 411

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 412 ttcggccagcagttgcgcttcaccttgtacttgtggta 449

---

>emb|BX008448.1|CNS08EOK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 510

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 365 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 424

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 425 ttcggccagcagttgcgcttcaccttgtacttgtggta 462

---

>emb|BX008129.1|CNS08EFP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 840

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 330 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 389

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 390 ttcggccagcagttgcgcttcaccttgtacttgtggta 427

---

>emb|BX008128.1|CNS08EFO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 701 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 642

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 641 ttcggccagcagttgcgcttcaccttgtacttgtggta 604

---

>emb|BX007575.1|CNS08E0B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA12CE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 348 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 407

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 408 ttcggccagcagttgcgcttcaccttgtacttgtggta 445

---

>emb|BX006812.1|CNS08DF4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 483

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 189 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 248

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 249 ttcggccagcagttgcgcttcaccttgtacttgtggta 286

---

>emb|BX005817.1|CNS08CNH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA10AA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 872

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 352 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 411

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 412 ttcggccagcagttgcgcttcaccttgtacttgtggta 449

---

>gb|BC065432.1| Danio rerio ribosomal protein L8, mRNA (cDNA clone MGC:77641
           IMAGE:6996953), complete cds
          Length = 892

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 269 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
           |||||| ||||| |||||||| || |||  ||||||||||||||||||||| ||||||||
Sbjct: 672 accaatgtgctgatggttaccaccaccgaagggatgctcaacagggttcatagccacacc 613

              
Query: 329 acg 331
           |||
Sbjct: 612 acg 610

---

>emb|AL111256.1|CNS0196O Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 273 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacg 331
           ||||| || |||||||| |||||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 680 atatgttgatggttaccacctccgtgaggatggtcaacagggttcatggcaacaccacg 622

---

>gb|AF401561.1| Ictalurus punctatus ribosomal protein L8 mRNA, complete cds
          Length = 821

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 73/86 (84%)
 Strand = Plus / Minus

                                                                       
Query: 270 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 329
           ||||| ||||| |||||||| || |||  ||||||||||||||||||||| |||||||||
Sbjct: 675 ccaatgtgctgatggttaccaccaccgaagggatgctcaacagggttcatagccacacca 616

                                     
Query: 330 cgcaccttangccaggagttcctctt 355
           || ||   | ||||| ||||||||||
Sbjct: 615 cggacacgaggccagcagttcctctt 590

---

>gb|AY168762.1| Branchiostoma belcheri tsingtaunese ribosomal protein L8 mRNA,
           complete cds
          Length = 477

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 273 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacg 331
           ||||| || |||||||| || || ||||||||||||||||||||||| |||||||||||
Sbjct: 272 atatgttgatggttaccaccaccatggggatgctcaacagggttcatagccacaccacg 214

---

>dbj|AB180407.1| Plutella xylostella mRNA for Ribosomal protein L8, complete cds
          Length = 824

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                          
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggc 322
           |||||||||||||| |||||||| |||||||| ||||||||||||||
Sbjct: 667 tgctggtggttaccacctccgtgaggatgctccacagggttcatggc 621

---

>ref|XM_315817.2| Anopheles gambiae str. PEST ENSANGP00000010416
           (ENSANGG00000007927), mRNA
          Length = 1093

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 751 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 692

                                                 
Query: 336 ttangccaggagttcctcttcacacggtacttgtggta 373
           ||  ||||| |||| | ||||||   ||||||||||||
Sbjct: 691 ttcggccagcagttgcgcttcaccttgtacttgtggta 654

---

>dbj|AK108964.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-153-D06, full
           insert sequence
          Length = 946

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 269 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
           ||||||||| ||||||||||| || ||||||||||| || || ||||||||||| |||||
Sbjct: 699 accaatatgttggtggttaccaccaccgtggggatggtcgacggggttcatggcaacacc 640

              
Query: 329 acg 331
           |||
Sbjct: 639 acg 637

---

>dbj|AK108169.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-139-H09, full
           insert sequence
          Length = 1017

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 273 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacg 331
           ||||||||||||||||| || ||||||||||| || || ||||||||||| ||||||||
Sbjct: 675 atatgctggtggttaccaccaccgtggggatggtcgacggggttcatggcaacaccacg 617

---

>emb|BX046386.1|CNS097YE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC20AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 81/97 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 335
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 336 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 395

                                                
Query: 336 ttangccaggagttcctcttcacacggtacttgtggt 372
           ||  ||||| |||| | ||||||   |||||||||||
Sbjct: 396 ttcggccagcagttgcgcttcaccttgtacttgtggt 432

---

>emb|AJ414568.1| Paracentrotus mRNA for ribosomal protein L8 (suL8 gene)
          Length = 839

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 269 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
           ||||||||| || |||||||| || ||||||||||| || || ||||||||||| |||||
Sbjct: 668 accaatatgttgatggttaccaccaccgtggggatggtcgacggggttcatggcaacacc 609

                 
Query: 329 acgcac 334
           ||||||
Sbjct: 608 acgcac 603

---

>emb|AL115964.1|CNS01CTG Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 282 tggttacctcctccgtggggatgctcaacagggttcatggccacaccacg 331
           |||||||| |||||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 654 tggttaccacctccgtgaggatggtcaacagggttcatggcaacaccacg 605

---

>gb|BC043017.1| Mus musculus ribosomal protein L8, mRNA (cDNA clone MGC:57885
           IMAGE:5684024), complete cds
          Length = 861

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 270 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 329
           ||||| |||||||||||||| |||||   ||||||||| ||||| |||||||||||||| 
Sbjct: 676 ccaatgtgctggtggttaccacctccaaagggatgctccacaggattcatggccacaccc 617

                
Query: 330 cgcac 334
           |||||
Sbjct: 616 cgcac 612

---

>ref|NM_012053.1| Mus musculus ribosomal protein L8 (Rpl8), mRNA
          Length = 842

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 270 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 329
           ||||| |||||||||||||| |||||   ||||||||| ||||| |||||||||||||| 
Sbjct: 680 ccaatgtgctggtggttaccacctccaaagggatgctccacaggattcatggccacaccc 621

                
Query: 330 cgcac 334
           |||||
Sbjct: 620 cgcac 616

---

>ref|XM_453766.1| Kluyveromyces lactis NRRL Y-1140, KLLA0D16027g predicted mRNA
          Length = 765

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 107/132 (81%)
 Strand = Plus / Minus

                                                                       
Query: 269 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 328
           ||||||||| || |||||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 660 accaatatgttgatggttaccaccaccgtgagggtgatcaacagggttcatggcaacacc 601

                                                                       
Query: 329 acgcaccttangccaggagttcctcttcacacggtacttgtggtaggcgttaccagcctt 388
           |||   |||  |||| ||||| ||||| || | |||||||||| | ||   |||||||||
Sbjct: 600 acgagtctttggccaagagtttctcttgactctgtacttgtggaaagcacgaccagcctt 541

                       
Query: 389 cagcattggctt 400
           || || ||||||
Sbjct: 540 caacaatggctt 529

---

>emb|BX054108.1|CNS09DWW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 466

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 77/92 (83%)
 Strand = Plus / Plus

                                                                       
Query: 282 tggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcaccttangc 341
           |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||||  ||
Sbjct: 360 tggttaccgccaccgtgcggatgctcgacggggttcatcgccacaccgcgcaccttcggc 419

                                           
Query: 342 caggagttcctcttcacacggtacttgtggta 373
           ||| |||| | ||||||   ||||||||||||
Sbjct: 420 cagcagttgcgcttcaccttgtacttgtggta 451

---

>emb|BX007182.1|CNS08DPE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA12AB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 749

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 77/92 (83%)
 Strand = Plus / Plus

                                                                       
Query: 282 tggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcaccttangc 341
           |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||||  ||
Sbjct: 228 tggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcaccttcggc 287

                                           
Query: 342 caggagttcctcttcacacggtacttgtggta 373
           ||| |||| | ||||||   ||||||||||||
Sbjct: 288 cagcagttgcgcttcaccttgtacttgtggta 319


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,177,103
Number of Sequences: 3902068
Number of extensions: 3177103
Number of successful extensions: 55968
Number of sequences better than 10.0: 477
Number of HSP's better than 10.0 without gapping: 474
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 54943
Number of HSP's gapped (non-prelim): 998
length of query: 453
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 431
effective length of database: 17,147,199,772
effective search space: 7390443101732
effective search space used: 7390443101732
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---