ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags21l13
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY539961.1| Takifugu rubripes clone COS8 Mid1 (mid1) gene, pa... 40 0.27
2gb|AC084163.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 38 1.1
3gb|AC117509.9| Homo sapiens 3 BAC RP11-31B16 (Roswell Park Cance... 38 1.1
4emb|Z82195.2|HS274L7 Human DNA sequence from clone RP1-274L7 on ... 36 4.2
5emb|AL356318.7| Human DNA sequence from clone RP11-161E22 on chr... 36 4.2
6emb|AL831774.17| Mouse DNA sequence from clone RP23-301P13 on ch... 36 4.2

>gb|AY539961.1| Takifugu rubripes clone COS8 Mid1 (mid1) gene, partial sequence
          Length = 22155

 Score = 40.1 bits (20), Expect = 0.27
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 17   ttccacataacacaacagct 36
            ||||||||||||||||||||
Sbjct: 6353 ttccacataacacaacagct 6334



to top

>gb|AC084163.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-287D23, complete
              sequence
          Length = 214292

 Score = 38.2 bits (19), Expect = 1.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 15     ggttccacataacacaaca 33
              |||||||||||||||||||
Sbjct: 183104 ggttccacataacacaaca 183086



to top

>gb|AC117509.9| Homo sapiens 3 BAC RP11-31B16 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 113201

 Score = 38.2 bits (19), Expect = 1.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 15    ggttccacataacacaacagctc 37
             |||||||||||||| ||||||||
Sbjct: 71739 ggttccacataacaaaacagctc 71717



to top

>emb|Z82195.2|HS274L7 Human DNA sequence from clone RP1-274L7 on chromosome X Contains a
             novel gene and a novel gene similar to uncharacterized
             hypothalamus protein HT011, complete sequence
          Length = 119566

 Score = 36.2 bits (18), Expect = 4.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 18    tccacataacacaacagctcaa 39
             ||||||||||||||||| ||||
Sbjct: 26182 tccacataacacaacaggtcaa 26161



to top

>emb|AL356318.7| Human DNA sequence from clone RP11-161E22 on chromosome 9 Contains part
              of the TRPM3 gene for transient receptor potential cation
              channel subfamily M, member 3 (MLSN2, LTRPC3, FLJ11726) and
              a pseudogene similar to part of CDC91 cell division cycle
              91-like 1 (S. cerevisiae) (CDC91L1), complete sequence
          Length = 141339

 Score = 36.2 bits (18), Expect = 4.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 11     gacaggttccacataaca 28
              ||||||||||||||||||
Sbjct: 105444 gacaggttccacataaca 105461



to top

>emb|AL831774.17| Mouse DNA sequence from clone RP23-301P13 on chromosome 4, complete
            sequence
          Length = 163802

 Score = 36.2 bits (18), Expect = 4.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 20   cacataacacaacagctc 37
            ||||||||||||||||||
Sbjct: 4699 cacataacacaacagctc 4682


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 164,305
Number of Sequences: 3902068
Number of extensions: 164305
Number of successful extensions: 38934
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 38928
Number of HSP's gapped (non-prelim): 6
length of query: 39
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 19
effective length of database: 17,155,003,908
effective search space: 325945074252
effective search space used: 325945074252
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top