ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags22a05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds 452 e-124
2emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putat... 438 e-119
3gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein g... 400 e-108
4gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding p... 392 e-106
5gb|AY100470.1| Oryza sativa (indica cultivar-group) putative sol... 391 e-105
6dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 391 e-105
7dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic D... 391 e-105
8dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic D... 391 e-105
9dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clon... 391 e-105
10dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clon... 391 e-105
11dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clon... 391 e-105
12dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clon... 391 e-105
13dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clon... 391 e-105
14ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predic... 389 e-105
15dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 389 e-105
16dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic D... 389 e-105
17dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic D... 389 e-105
18dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clon... 389 e-105
19dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 389 e-105
20dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clon... 389 e-105
21dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clon... 389 e-105
22dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clon... 389 e-105
23ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predic... 385 e-103
24emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll ... 385 e-103
25dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clon... 383 e-103
26emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chloro... 375 e-100
27emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding... 375 e-100
28dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRN... 375 e-100
29emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chl... 369 8e-99
30emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chloro... 365 1e-97
31emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlo... 355 1e-94
32gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b bi... 345 1e-91
33emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein 337 3e-89
34gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence 331 2e-87
35gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene ... 329 7e-87
36gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protei... 327 3e-86
37gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b ... 323 4e-85
38gb|M14443.1|TOMCBPA Tomato chlorophyll a/b-binding protein gene ... 315 1e-82
39gb|U21113.1|STU21113 Solanum tuberosum chlorophyll a/b binding p... 307 2e-80
40gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding p... 307 2e-80
41gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding p... 297 2e-77
42gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding p... 297 2e-77
43emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/... 293 4e-76
44dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clon... 291 1e-75
45gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding p... 289 6e-75
46gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast c... 289 6e-75
47emb|X52743.1|NTCAB21 Tabacco Cab21 mRNA for major chlorophyll a/... 287 2e-74
48gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab... 285 9e-74
49dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue... 281 1e-72
50emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b bin... 280 6e-72
51emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding pr... 278 2e-71
52dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for ... 278 2e-71
53dbj|AB012636.1| Nicotiana sylvestris Lhcb1*1 gene for light harv... 274 3e-70
54dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harv... 270 5e-69
55dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 g... 266 8e-68
56gb|AY109324.1| Zea mays CL187_1 mRNA sequence 260 5e-66
57emb|AJ843976.1| Plantago major partial mRNA for light harvesting... 254 3e-64
58emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding p... 254 3e-64
59emb|Z13987.1|STCABPSII S.tuberosum gene for chlorophyll a/b-bind... 248 2e-62
60gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b... 244 3e-61
61gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-... 242 1e-60
62gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab... 238 2e-59
63emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-t... 236 7e-59
64emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll... 234 3e-58
65emb|AJ234428.1|HVU234428 Hordeum vulgare partial mRNA; clone cMW... 232 1e-57
66gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding p... 232 1e-57
67emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/... 230 5e-57
68gb|DQ018375.1| Pinus gerardiana chloroplast putative light harve... 228 2e-56
69gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll... 226 7e-56
70gb|M30616.1|TOMCBPC2 Tomato chlorophyll a/b-binding protein Cab-... 226 7e-56
71emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding pr... 224 3e-55
72dbj|AB013728.1| Cryptomeria japonica mRNA for light-harvesting c... 222 1e-54
73gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll... 218 2e-53
74emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chloro... 216 7e-53
75gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 214 3e-52
76emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll... 212 1e-51
77gb|AY617091.1| Pinus strobus chloroplast light harvesting chloro... 210 4e-51
78emb|X02360.1|PECAB22R Petunia gene for chlorophyll a/b binding p... 210 4e-51
79gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein... 210 4e-51
80gb|M30618.1|TOMCBPD2 Tomato chlorophyll a/b-binding protein Cab-... 210 4e-51
81gb|AY617090.1| Pinus monticola chloroplast light harvesting chlo... 206 7e-50
82emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b bind... 204 3e-49
83gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlor... 202 1e-48
84gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlor... 202 1e-48
85gb|AY617092.1| Pinus monophylla chloroplast light harvesting chl... 202 1e-48
86gb|AY617089.1| Pinus lambertiana chloroplast light harvesting ch... 202 1e-48
87gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlor... 202 1e-48
88gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlor... 202 1e-48
89gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-... 202 1e-48
90gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I ... 200 4e-48
91gb|AY389573.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 198 2e-47
92gb|DQ018376.1| Pinus krempfii chloroplast putative light harvest... 198 2e-47
93gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chl... 198 2e-47
94emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for lig... 198 2e-47
95emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for ligh... 198 2e-47
96emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab bindin... 196 6e-47
97gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protei... 196 6e-47
98gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding pro... 196 6e-47
99gb|AY617093.1| Pinus remota chloroplast light harvesting chlorop... 194 3e-46
100gb|AY617083.1| Pinus radiata chloroplast light harvesting chloro... 194 3e-46
101gb|AY617096.1| Picea sitchensis chloroplast light harvesting chl... 192 1e-45
102gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (L... 192 1e-45
103emb|X02359.1|PECAB22L Petunia gene for chlorophyll a/b binding p... 192 1e-45
104emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting... 188 2e-44
105gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chl... 186 6e-44
106dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 186 6e-44
107gb|AY617081.1| Pinus echinata chloroplast light harvesting chlor... 182 1e-42
108emb|X68333.1|HHLHC H.helix mRNA for light harvesting chlorophyll... 182 1e-42
109gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene... 182 1e-42
110gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosyste... 182 1e-42
111dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harv... 182 1e-42
112emb|X16535.1|GMCAB4 G.max DNA for Cab4 180 4e-42
113gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlo... 178 1e-41
114emb|X56538.1|PSCABIIC P.sativum Cab-8 gene for photosystemm II c... 176 6e-41
115dbj|D14002.1|LAUCAB Lettuce mRNA for light-harvesting chlorophyl... 176 6e-41
116gb|AY617084.1| Pinus contorta chloroplast light harvesting chlor... 174 2e-40
117gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/... 174 2e-40
118emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b bindin... 174 2e-40
119emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/... 174 2e-40
120gb|DQ471302.1| Carya cathayensis putative chloroplast chlorophyl... 172 9e-40
121emb|Z75663.1|AGCHLABBP A.graveolens mRNA for chlorophyll a/b bin... 172 9e-40
122gb|K00972.1|PETCAB146 Petunia major chlorophyll a/b binding prot... 172 9e-40
123gb|M14449.1|TOMCBPG Tomato chlorophyll a/b-binding protein gene ... 172 9e-40
124emb|AJ538464.1|NTA538464 Nicotiana tabacum cDNA-AFLP-fragment BC... 170 4e-39
125emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll ... 170 4e-39
126gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll... 168 1e-38
127gb|M64619.1|PEACAB66 Pea cab gene, complete cds 168 1e-38
128gb|K02067.1|PEACAB80 Pea (P.sativum) gene AB80 encoding major li... 168 1e-38
129gb|K00975.1|PETCAB10 Petunia major chlorophyll a/b binding prote... 167 6e-38
130emb|AJ538931.1|NTA538931 Nicotiana tabacum cDNA-AFLP-fragment BT... 165 2e-37
131emb|X16536.1|GMCAB5 G.max DNA for Cab5 165 2e-37
132gb|M16057.1|CUSLHCPA Cucumber LHCP mRNA encoding chlorophyll a/b... 165 2e-37
133gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/... 163 9e-37
134emb|X74731.1|AHLHCB A.hypochondriacus Lhcb1*Ah1 mRNA 163 9e-37
135gb|AF162200.1|AF162200 Lactuca sativa light-harvesting chlorophy... 163 9e-37
136dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone... 163 9e-37
137dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding p... 163 9e-37
138gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genom... 161 4e-36
139gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 161 4e-36
140dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 161 4e-36
141dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clon... 161 4e-36
142dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clon... 161 4e-36
143gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding prot... 161 4e-36
144gb|DQ124219.1| Fagus sylvatica putative chlorophyll a/b-binding ... 159 1e-35
145emb|X12980.1|GMCAB2 Soybean Cab2 gene for minor PSII LHCII chlor... 157 5e-35
146gb|K00974.1|PETCAB4 Petunia major chlorophyll a/b binding protei... 157 5e-35
147gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete se... 155 2e-34
148emb|AJ538493.1|NTA538493 Nicotiana tabacum cDNA-AFLP-fragment BC... 155 2e-34
149emb|AJ538840.1|NTA538840 Nicotiana tabacum cDNA-AFLP-fragment BT... 149 1e-32
150dbj|AB050123.1| Amaranthus tricolor cab1a mRNA for type I chloro... 147 5e-32
151ref|XM_478729.1| Oryza sativa (japonica cultivar-group), mRNA 145 2e-31
152ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group... 145 2e-31
153ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group... 145 2e-31
154ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group... 145 2e-31
155ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group... 145 2e-31
156ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group... 145 2e-31
157ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group... 145 2e-31
158ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group... 145 2e-31
159gb|AY389553.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 145 2e-31
160dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 145 2e-31
161dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic D... 145 2e-31
162dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clon... 145 2e-31
163dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clon... 145 2e-31
164dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clon... 145 2e-31
165dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clon... 145 2e-31
166dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clon... 145 2e-31
167dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clon... 145 2e-31
168dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clon... 145 2e-31
169dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clon... 145 2e-31
170gb|AY112240.1| Zea mays CL187_6 mRNA sequence 143 8e-31
171gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 141 3e-30
172dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRN... 141 3e-30
173dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clon... 137 5e-29
174emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chl... 137 5e-29
175dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clon... 137 5e-29
176ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BIND... 135 2e-28
177ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding ... 135 2e-28
178gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472)... 135 2e-28
179gb|AY128345.1| Arabidopsis thaliana photosystem II type I chloro... 135 2e-28
180gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 135 2e-28
181gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 135 2e-28
182gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 135 2e-28
183gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 135 2e-28
184gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 135 2e-28
185gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 135 2e-28
186gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N... 135 2e-28
187gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete s... 135 2e-28
188emb|AJ538874.1|NTA538874 Nicotiana tabacum cDNA-AFLP-fragment BT... 135 2e-28
189emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophy... 135 2e-28
190gb|AY845253.1| Pisum sativum light-harvesting chlorophyll-a/b bi... 133 8e-28
191gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence 133 8e-28
192gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 133 8e-28
193gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II ch... 133 8e-28
194gb|M21396.1|SOYCBPA Soybean light-harvesting chlorophyll a/b-bin... 133 8e-28
195gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid... 133 8e-28
196gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/... 131 3e-27
197gb|K00973.1|PETCAB3 Petunia major chlorophyll a/b binding protei... 131 3e-27
198gb|M16058.1|CUSLHCPB Cucumber LHCP mRNA encoding chlorophyll a/b... 131 3e-27
199ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BIND... 127 5e-26
200gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-bin... 127 5e-26
201gb|AY050935.1| Arabidopsis thaliana putative photosystem II type... 127 5e-26
202gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 127 5e-26
203gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 m... 127 5e-26
204gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 127 5e-26
205emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Co... 127 5e-26
206gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P... 127 5e-26
207emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophy... 127 5e-26
208emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophy... 127 5e-26
209emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB p... 125 2e-25
210emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-h... 123 8e-25
211gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chl... 123 8e-25
212dbj|AB012639.1| Nicotiana sylvestris Lhcb1*7 gene for light harv... 123 8e-25
213gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding... 121 3e-24
214emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/... 121 3e-24
215gb|M34396.1|PMJCABF3 Polystichum munitum chlorophyll a/b-binding... 121 3e-24
216emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Co... 119 1e-23
217emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b bindi... 119 1e-23
218emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chl... 119 1e-23
219gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding prot... 119 1e-23
220dbj|AB050125.1| Amaranthus tricolor cab1b mRNA for type I chloro... 117 5e-23
221gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding p... 115 2e-22
222gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b bin... 115 2e-22
223gb|M15214.1|TOMCBPH Tomato chlorophyll a/b-binding protein gene ... 113 7e-22
224emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putativ... 109 1e-20
225gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chl... 109 1e-20
226gb|M86906.1|PEACHLROPH Pea (subclone AB9) Cab9 gene, 3' end 109 1e-20
227gb|AF104631.3| Chlamydomonas reinhardtii light harvesting comple... 107 5e-20
228gb|DQ418483.1| Zingiber officinale chloroplast chlorophyll a/b-b... 107 5e-20
229dbj|AB236867.1| Panax ginseng cab mRNA for chlorophyll a/b bindi... 107 5e-20
230gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-bindi... 107 5e-20
231gb|K00976.1|PETCAB102 Petunia major chlorophyll a/b binding prot... 105 2e-19
232gb|M16887.1|SIPCAB White campion chlorophyll a/b-binding protein... 105 2e-19
233gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein... 105 2e-19
234gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence 103 7e-19
235gb|AF295639.1| Beta vulgaris chlorophyll a/b binding protein (ca... 101 3e-18
236gb|AY219853.1| Nicotiana tabacum chlorophyll a/b binding protein... 101 3e-18
237gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting comple... 100 1e-17
238gb|AF495473.1| Chlamydomonas reinhardtii major light-harvesting ... 100 1e-17
239gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting ... 100 1e-17
240gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting ... 100 1e-17
241gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvestin... 100 1e-17
242emb|BX814964.1|CNS0AE8Q Arabidopsis thaliana Full-length cDNA Co... 100 1e-17
243dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvest... 100 1e-17
244dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvest... 100 1e-17
245dbj|AB051206.1| Chlamydomonas reinhardtii gene for light-harvest... 100 1e-17
246dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvest... 100 1e-17
247gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative c... 96 2e-16
248ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll bindin... 94 7e-16
249ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2... 94 7e-16
250ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2... 94 7e-16
251ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll bindin... 94 7e-16
252ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) ... 94 7e-16
253gb|AY142513.1| Arabidopsis thaliana putative photosystem II type... 94 7e-16
254gb|AY045806.1| Arabidopsis thaliana putative photosystem II type... 94 7e-16
255gb|AF339687.1| Arabidopsis thaliana putative photosystem II type... 94 7e-16
256gb|AF326864.1| Arabidopsis thaliana putative photosystem II type... 94 7e-16
257gb|AY120776.1| Arabidopsis thaliana putative photosystem II type... 94 7e-16
258gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 ma... 94 7e-16
259gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 ma... 94 7e-16
260gb|AY081587.1| Arabidopsis thaliana photosystem II type I chloro... 94 7e-16
261gb|AY065125.1| Arabidopsis thaliana photosystem II type I chloro... 94 7e-16
262gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 ... 94 7e-16
263gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 ... 94 7e-16
264gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 ... 94 7e-16
265gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 94 7e-16
266gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 ... 94 7e-16
267gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430... 94 7e-16
268emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Co... 94 7e-16
269emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Co... 94 7e-16
270emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Co... 94 7e-16
271emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Co... 94 7e-16
272gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete s... 94 7e-16
273emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II ... 94 7e-16
274emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II c... 94 7e-16
275gb|BT002103.1| Arabidopsis thaliana putative photosystem II type... 94 7e-16
276gb|L36064.1|PRULHP Prunus persica (clone pAB19) light harvesting... 94 7e-16
277dbj|AB051209.1| Chlamydomonas reinhardtii mRNA for light-harvest... 94 7e-16
278dbj|AB051205.1| Chlamydomonas reinhardtii gene for light-harvest... 94 7e-16
279emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding ... 92 3e-15
280gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein... 92 3e-15
281gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 92 3e-15
282gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 92 3e-15
283dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light... 92 3e-15
284gb|AF330793.1|AF330793 Chlamydomonas reinhardtii light-harvestin... 92 3e-15
285gb|AY198376.1| Citrus limon chlorophyll a/b-binding protein prec... 92 3e-15
286emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b... 92 3e-15
287gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence 90 1e-14
288gb|AY433957.1| Pyrus communis chlorophyll a/b-binding protein mR... 90 1e-14
289dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chloro... 90 1e-14
290emb|X61915.1|PTCABP P.thunbergii cab gene 88 4e-14
291emb|X13407.1|PTCAB Pinus thunbergii cab mRNA for light-harvestin... 88 4e-14
292emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Co... 86 2e-13
293emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding pr... 86 2e-13
294emb|X57082.1|PSCABII P.sativum Cab II gene for chlorophyll a/b-b... 86 2e-13
295gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvestin... 86 2e-13
296gb|AF039598.1| Prunus persica light harvesting chlorophyll A/B b... 84 7e-13
297emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chloro... 84 7e-13
298gb|AF022738.1|AF022738 Oryza sativa chlorophyll a-b binding prot... 84 7e-13
299gb|AY845254.1| Pisum sativum light-harvesting chlorophyll-a/b bi... 82 3e-12
300gb|M97171.1|SOYCAB6A Glycine max chlorophyll a/b binding protein... 82 3e-12
301gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding p... 82 3e-12
302emb|X61361.1|EGLHCAB E.gracilis gene for light harvesting chloro... 80 1e-11
303emb|BX817619.1|CNS0AAVV Arabidopsis thaliana Full-length cDNA Co... 80 1e-11
304emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Co... 80 1e-11
305dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene... 80 1e-11
306gb|DQ226725.1| Boechera divaricarpa isolate SLW-A-F06 mRNA sequence 78 4e-11
307emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Co... 78 4e-11
308emb|AJ539048.1|NTA539048 Nicotiana tabacum cDNA-AFLP-fragment BT... 78 4e-11
309emb|X74732.1|AHLHAH A.hypochondriacus Lhcb2*Ah1 mRNA 78 4e-11
310dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-b... 78 4e-11
311gb|DQ185425.1| Rosa roxburghii clone C40 defense-related mRNA, p... 76 2e-10
312gb|AF495472.1| Chlamydomonas reinhardtii major light-harvesting ... 76 2e-10
313gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting ... 76 2e-10
314gb|M24072.1|CRECABA C.reinhardtii encoding chlorophyll a/b-bindi... 76 2e-10
315gb|AY646197.1| Chlorella pyrenoidosa chloroplast light-harvestin... 74 6e-10
316gb|BT012757.1| Lycopersicon esculentum clone 113701F, mRNA sequence 74 6e-10
317gb|M60049.1|DUNCAB D.tertiolecta 28.5-kDa LHCII apoprotein mRNA,... 74 6e-10
318gb|DQ460158.1| Nicotiana tabacum cDNA-AFLP fragment H-N_BC4M24-1... 72 3e-09
319gb|AF195221.1|AF195221 Pyrus pyrifolia strain Whangkeumbae chlor... 70 1e-08
320dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene... 70 1e-08
321emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-bi... 70 1e-08
322gb|M23532.1|PCPCBP P.patens major chlorophyll binding protein ge... 70 1e-08
323emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Co... 68 4e-08
324gb|AF312227.1|AF312227 Citrus reticulata light-harvesting chloro... 68 4e-08
325dbj|AP008949.1| Lotus japonicus genomic DNA, chromosome 2, clone... 68 4e-08
326gb|U21115.1|STU21115 Solanum tuberosum chlorophyll a/b binding p... 68 4e-08
327gb|AY786530.1| Haematococcus pluvialis chloroplast major light-h... 66 2e-07
328emb|AJ538488.1|NTA538488 Nicotiana tabacum cDNA-AFLP-fragment BC... 66 2e-07
329gb|M37489.1|PINCABII2 Pinus sylvestris chlorophyll a/b-binding p... 64 6e-07
330gb|M30395.1|PMJCABF6 Polystichum munitum chlorophyll a/b-binding... 64 6e-07
331ref|NM_113685.3| Arabidopsis thaliana LHCB2:4; chlorophyll bindi... 62 2e-06
332gb|BT006298.1| Arabidopsis thaliana At3g27700 mRNA, complete cds 62 2e-06
333gb|AF370557.1|AF370557 Arabidopsis thaliana light harvesting chl... 62 2e-06
334gb|AY088541.1| Arabidopsis thaliana clone 7700 mRNA, complete se... 62 2e-06
335gb|AF134125.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2:4) mRNA... 62 2e-06
336emb|AJ538915.1|NTA538915 Nicotiana tabacum cDNA-AFLP-fragment BT... 62 2e-06
337dbj|AB018114.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 62 2e-06
338emb|Z29965.1|TRLHCABBP T.repens (Huia) mRNA for light-harvesting... 62 2e-06
339emb|CT571263.1| Medicago truncatula chromosome 5 clone mte1-7c20... 62 2e-06
340gb|AC135460.3| Oryza sativa (japonica cultivar-group) chromosome... 60 1e-05
341dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 60 1e-05
342emb|X63052.1|HVCP29 Hordeum vulgare gene for CP29 precursor for ... 60 1e-05
343emb|X17697.1|MDCHBP Apple light-harvesting chlorophyll a/b bindi... 60 1e-05
344dbj|AK104824.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 1e-05
345dbj|AK098872.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 1e-05
346dbj|AK061295.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 1e-05
347gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 60 1e-05
348gb|M17558.1|TOMCAB4A Tomato Cab-4 gene encoding chlorophyll a/b-... 60 1e-05
349ref|NM_126537.2| Arabidopsis thaliana LHCB2.2; chlorophyll bindi... 58 4e-05
350ref|NM_001036246.1| Arabidopsis thaliana ATP binding / kinase/ p... 58 4e-05
351gb|BT013404.1| Lycopersicon esculentum clone 135718R, mRNA sequence 58 4e-05
352gb|AY093372.1| Arabidopsis thaliana putative chlorophyll a/b bin... 58 4e-05
353gb|AC007211.6| Arabidopsis thaliana chromosome 2 BAC F1O13 genom... 58 4e-05
354gb|AY066036.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, com... 58 4e-05
355gb|AY062563.1| Arabidopsis thaliana putative chlorophyll a/b bin... 58 4e-05
356gb|AY054218.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, com... 58 4e-05
357emb|BX819347.1|CNS0A9RX Arabidopsis thaliana Full-length cDNA Co... 58 4e-05
358emb|BX820206.1|CNS0A9D7 Arabidopsis thaliana Full-length cDNA Co... 58 4e-05
359emb|BX820202.1|CNS0A9FS Arabidopsis thaliana Full-length cDNA Co... 58 4e-05
360emb|BX819668.1|CNS0A9CZ Arabidopsis thaliana Full-length cDNA Co... 58 4e-05
361emb|BX819509.1|CNS0A82Q Arabidopsis thaliana Full-length cDNA Co... 58 4e-05
362gb|AF134123.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.2) mRNA... 58 4e-05
363gb|AF134122.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.1) mRNA... 58 4e-05
364emb|X60275.1|LELHBC1G L.esculentum lhbC1 gene for LHCII type III 58 4e-05
365gb|AF207690.1|AF207690 Daucus carota cultivar Kurodagosun chloro... 58 4e-05
366gb|AY554168.1| Nicotiana tabacum chloroplast chlorophyll a-b bin... 58 4e-05
367gb|AY105650.1| Zea mays PCO135935 mRNA sequence 58 4e-05
368gb|U51634.1|PPU51634 Pinus palustris type 2 light-harvesting chl... 58 4e-05
369dbj|AP006706.1| Lotus japonicus genomic DNA, chromosome 3, clone... 58 4e-05
370gb|U23188.1|ZMU23188 Zea mays chlorophyll a/b-binding apoprotein... 58 4e-05
371dbj|D85512.1| Oryza sativa (japonica cultivar-group) CP26 mRNA, ... 58 4e-05
372gb|AY171231.1| Chlamydomonas reinhardtii light-harvesting comple... 56 1e-04
373emb|X61610.1|BNLHCB3C B.napus gene for LHCII Type III chlorophyl... 54 6e-04
374gb|AF279248.1|AF279248 Vigna radiata LHCII type II chlorophyll a... 54 6e-04
375emb|X69434.1|CSCAB1 C.stellata cab1 mRNA for chlorophyll a/b bin... 54 6e-04
376emb|X04966.1|PHCAB37 Petunia Cab gene for chlorophyll a/b bindin... 54 6e-04
377gb|M30397.1|PMJCABF8 Polystichum munitum chlorophyll a/b-binding... 54 6e-04
378emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Co... 52 0.002
379gb|AF139465.2|AF139465 Vigna radiata LHCII type III chlorophyll ... 52 0.002
380emb|X06822.1|PSLHCP3R Pisum sativum LHCPII mRNA 3'region 52 0.002
381ref|NM_126540.2| Arabidopsis thaliana LHCB2.1; chlorophyll bindi... 50 0.009
382gb|AY818400.1| Manihot esculenta chloroplast chlorophyll A/B bin... 50 0.009
383gb|AY045787.1| Arabidopsis thaliana At2g05100 mRNA sequence 50 0.009
384gb|AC007443.5| Arabidopsis thaliana chromosome 2 clone F15L11 ma... 50 0.009
385gb|AY052348.1| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, com... 50 0.009
386gb|AY052275.1| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, com... 50 0.009
387emb|BX819843.1|CNS0A9GW Arabidopsis thaliana Full-length cDNA Co... 50 0.009
388emb|BX819702.1|CNS0A9H1 Arabidopsis thaliana Full-length cDNA Co... 50 0.009
389emb|BX819270.1|CNS0A9RF Arabidopsis thaliana Full-length cDNA Co... 50 0.009
390emb|BX821844.1|CNS0A936 Arabidopsis thaliana Full-length cDNA Co... 50 0.009
391emb|BX821132.1|CNS0A9BI Arabidopsis thaliana Full-length cDNA Co... 50 0.009
392emb|BX819861.1|CNS0A9DS Arabidopsis thaliana Full-length cDNA Co... 50 0.009
393emb|BX819751.1|CNS0A9F6 Arabidopsis thaliana Full-length cDNA Co... 50 0.009
394emb|BX819688.1|CNS0A9G4 Arabidopsis thaliana Full-length cDNA Co... 50 0.009
395emb|BX819687.1|CNS0A9G3 Arabidopsis thaliana Full-length cDNA Co... 50 0.009
396emb|BX819683.1|CNS0A80L Arabidopsis thaliana Full-length cDNA Co... 50 0.009
397emb|BX842010.1|CNS09YA7 Arabidopsis thaliana Full-length cDNA Co... 50 0.009
398gb|AF134124.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.3) mRNA... 50 0.009
399gb|BT001933.1| Arabidopsis thaliana clone C105385 putative chlor... 50 0.009
400gb|M95068.1|MZEORFI Zea mays putative light-harvesting chlorophy... 50 0.009
401gb|M23531.1|DUNCBP D.salina major chlorophyll binding protein mR... 48 0.036
402gb|L07120.1|COTIIABINB Gossypium hirsutum chloroplast photosyste... 48 0.036
403emb|BX814757.1|CNS0AEAM Arabidopsis thaliana Full-length cDNA Co... 46 0.14
404emb|X61609.1|BNLHCB3B B.napus gene for LHC II Type III chlorophy... 46 0.14
405dbj|AB122120.1| Chlamydomonas reinhardtii LhcI-7 gene for light-... 46 0.14
406dbj|AU066541.1| Chlamydomonas sp. HS-5 mRNA for hypothetical pro... 46 0.14
407gb|DQ460104.1| Nicotiana tabacum cDNA-AFLP fragment H-N_BC2M41-3... 44 0.57
408gb|DQ226990.1| Boechera divaricarpa isolate AD-150.1 mRNA sequence 44 0.57
409gb|DQ355993.1| Brassica napus chlorophyll a/b binding protein (L... 44 0.57
410emb|X58230.1|NTCAB36 Tobacco CAB36 gene for chlorophyll a/b bind... 44 0.57
411emb|X12979.1|GMCAB1P Soybean Cab1 pseudogene for chlorophyll a/b... 44 0.57
412gb|M30396.1|PMJCABF7 Polystichum munitum chlorophyll a/b-binding... 44 0.57
413gb|AY954742.1| Ostreococcus tauri chloroplast prasinophyte chlor... 42 2.2
414gb|AY954741.1| Ostreococcus tauri chloroplast prasinophyte chlor... 42 2.2
415gb|AY954730.1| Ostreococcus tauri chloroplast prasinophyte chlor... 42 2.2
416gb|DQ226800.1| Boechera divaricarpa isolate SLW-B-D01 mRNA sequence 42 2.2
417emb|CR954257.1| Anopheles gambiae Pen-1 region; BAC clone 32F02 ... 42 2.2
418emb|AJ000765.1|CRAJ765 Chlamydomonas reinhardtii mRNA for calret... 42 2.2
419gb|AC027449.6| Homo sapiens chromosome 18, clone RP11-535A5, com... 42 2.2
420gb|AC073369.5| Homo sapiens chromosome 10 clone RP11-466H6, comp... 42 2.2
421ref|XM_321363.2| Anopheles gambiae str. PEST ENSANGP00000012206 ... 42 2.2
422gb|U23189.1|ZMU23189 Zea mays chlorophyll a/b-binding apoprotein... 42 2.2
423gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence 40 8.9
424gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome 40 8.9
425ref|XM_592463.2| PREDICTED: Bos taurus similar to 1-phosphatidyl... 40 8.9
426gb|AC153007.4| Mus musculus BAC clone RP24-266E2 from chromosome... 40 8.9
427gb|AC124485.3| Mus musculus BAC clone RP23-450J12 from chromosom... 40 8.9
428emb|CR383660.9| Zebrafish DNA sequence from clone DKEY-1H22 in l... 40 8.9
429gb|AC158972.4| Mus musculus chromosome 15, clone RP24-225M16, co... 40 8.9
430emb|BX842574.1| Mycobacterium tuberculosis H37Rv complete genome... 40 8.9
431emb|BX248336.1| Mycobacterium bovis subsp. bovis AF2122/97 compl... 40 8.9
432gb|AC138177.12| Mus musculus chromosome 15, clone RP23-32P19, co... 40 8.9
433gb|AC104081.2| Homo sapiens BAC clone RP11-559A1 from 2, complet... 40 8.9
434emb|AL929322.6| Zebrafish DNA sequence from clone DKEY-10H23, co... 40 8.9
435gb|AY855171.1| Eleusine coracana subsp. coracana clone 1 light h... 40 8.9
436dbj|AP001877.5| Homo sapiens genomic DNA, chromosome 11 clone:CT... 40 8.9
437dbj|AP000627.4| Homo sapiens genomic DNA, chromosome 11q clone:C... 40 8.9
438emb|CT025692.15| Mouse DNA sequence from clone RP23-312G18 on ch... 40 8.9
439gb|AF093617.1|AF093617 Acetabularia acetabulum clone JO-10 chlor... 40 8.9
440gb|U66108.1|MTU66108 Mycobacterium tuberculosis methoxy mycolic ... 40 8.9
441gb|U22329.1|VCU22329 Volvox carteri light harvesting complex a m... 40 8.9

>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds
          Length = 1044

 Score =  452 bits (228), Expect = e-124
 Identities = 458/532 (86%), Gaps = 2/532 (0%)
 Strand = Plus / Minus

                                                                       
Query: 118 acttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcga 177
           |||||||||| || ||||| ||||| || ||||| |||||||||||||| || |||| ||
Sbjct: 862 acttgccgggcacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcggaga 803

                                                                       
Query: 178 gatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagc 237
           | ||||| || ||||||||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 802 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctgcacgaagaagc 743

                                                                       
Query: 238 caaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcga 297
           | ||||||||||||||||| ||||| || ||||||| ||| || ||||||||||||||||
Sbjct: 742 cgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcga 683

                                                                       
Query: 298 atgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggat 357
           | ||||| ||||| ||||| ||||| || |||||||||||||| || |||||||| || |
Sbjct: 682 acgcctcagggtcgtcggcaaggcccagggggtcgaagctgccgccggggtagagcgggt 623

                                                                       
Query: 358 caaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagca 417
           | || | ||| ||||| ||||| || || | ||||||||| || ||||||||||||||||
Sbjct: 622 cgacgatctcgccgagcgggccgccggcgacgcggtacccctcgacggcgcccatgagca 563

                                                                       
Query: 418 cgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccga 477
           |||| || || |||||||| || |||||||| || || || || ||||| ||||||||||
Sbjct: 562 cgacctggcaggcccagatggcgaggatgctctgcgcgtggaccaggctggggttgccga 503

                                                                       
Query: 478 ggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcac 537
           ||||||||||||| || ||||||||||| |||||||| ||||||||||| || ||||| |
Sbjct: 502 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccacacggcctcgc 443

                                                                       
Query: 538 cgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagca 597
           |||||||||| || ||||| || || ||||||||||||||||| |||||||| || ||||
Sbjct: 442 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgcccagca 383

                                                               
Query: 598 tggcccaccttgcagtggatcacctcaagcttcccggttctttgcaaaggtc 649
           |||||||||  ||||||||||||||| ||| ||||||||||| || ||||||
Sbjct: 382 tggcccacc-ggcagtggatcacctccagc-tcccggttcttggcgaaggtc 333



to top

>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b
           binding protein (cab gene)
          Length = 760

 Score =  438 bits (221), Expect = e-119
 Identities = 430/497 (86%), Gaps = 2/497 (0%)
 Strand = Plus / Minus

                                                                       
Query: 153 gcgttgttgttgacaggatcggcgagatggtcagcaaggttctcgagggggcccttgccg 212
           ||||||||||||||||| ||||| |  ||||| ||||||||||| |  ||||||||||||
Sbjct: 759 gcgttgttgttgacagggtcggcaatgtggtcggcaaggttctccaatgggcccttgccg 700

                                                                       
Query: 213 gtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgcccattcttg 272
           |||||||| |||||||| |||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 699 gtgacaatggcctgcacaaagaagccaaacatggagaacatggcgaggcggccattcttg 640

                                                                       
Query: 273 acctcttttaccttgagctccgcgaatgcctctgggtcatcggctaggccgagcgggtcg 332
           | ||| || |||||||||||||| |||||||| ||||| ||||| ||||| || ||||| 
Sbjct: 639 atctccttaaccttgagctccgcaaatgcctcggggtcgtcggccaggccaagtgggtca 580

                                                                       
Query: 333 aagctgccaccagggtagagtggatcaaccacctcaccgagtgggccaccagcaatgcgg 392
           ||||||||||||||||||||||| || || | ||| ||||| || |||||||||||||||
Sbjct: 579 aagctgccaccagggtagagtgggtcgacgatctcgccgagcggaccaccagcaatgcgg 520

                                                                       
Query: 393 tacccttcaacggcgcccatgagcacgacttgacatgcccagatagcaaggatgctttgt 452
           ||||| |||||||| ||||||||||| |||||||| ||||| || || |||||||| || 
Sbjct: 519 tacccctcaacggcccccatgagcacaacttgacaagcccatatggcgaggatgctctgg 460

                                                                       
Query: 453 gcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggag 512
           || || |||||||| |||||||| ||||||||||||||||| |||||||| || || |||
Sbjct: 459 gcgtggacgaggctggggttgccaaggtagtcgaggccaccctcgctgaaaatctgagag 400

                                                                       
Query: 513 cctgccttgaaccatacagcctcaccgaacttgactccattgcgcgcaagaagctcgggg 572
           || ||| ||||||| || ||||| |||||||| || |||||||| ||||| | |||||| 
Sbjct: 399 ccagccatgaaccagacggcctcgccgaacttcacaccattgcgggcaagcaactcggga 340

                                                                       
Query: 573 aagacgcatccgagcgcaccgagcatggcccaccttgcagtggatcacctcaagcttccc 632
           ||||| || || |||||||||||||||||||| |  ||||||||||||||| ||| ||||
Sbjct: 339 aagacacaaccaagcgcaccgagcatggcccatc-ggcagtggatcacctcgagc-tccc 282

                            
Query: 633 ggttctttgcaaaggtc 649
           ||||||| || ||||||
Sbjct: 281 ggttcttggcgaaggtc 265



to top

>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds
          Length = 1191

 Score =  400 bits (202), Expect = e-108
 Identities = 428/498 (85%), Gaps = 4/498 (0%)
 Strand = Plus / Minus

                                                                       
Query: 153 gcgttgttgttgacaggatcggcgagatggtcagcaaggttctcgagggggcccttgccg 212
           ||||||||||||||||| ||||| |  ||||| ||||||| ||| |  ||||||||||||
Sbjct: 964 gcgttgttgttgacagggtcggcaatgtggtcggcaaggtcctccaatgggcccttgccg 905

                                                                       
Query: 213 gtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgcccattcttg 272
           |||||||| |||||||| |||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 904 gtgacaatggcctgcacaaagaagccaaacatggagaacatggcgaggcggccattcttg 845

                                                                       
Query: 273 acctcttttaccttgagctccgcgaatgcctctgggtca-tcggctaggccgagcgggtc 331
           | ||| || |||||||||||||| |||||||  |||||  ||||| ||||| || |||||
Sbjct: 844 atctccttaaccttgagctccgcaaatgcctg-gggtcgctcggccaggccaagtgggtc 786

                                                                       
Query: 332 gaagctgccaccagggtagagtggatcaaccacctcaccgagtgggccaccagcaatgcg 391
            ||||||||||||||||||||||| || || | ||| ||||| || ||||||||||||||
Sbjct: 785 aaagctgccaccagggtagagtgggtcgacgatctcgccgagcggaccaccagcaatgcg 726

                                                                       
Query: 392 gtacccttcaacggcgcccatgagcacgacttgacatgcccagatagcaaggatgctttg 451
           |||||| |||||||| ||||||||||| |||||||| ||||| || || |||| ||| ||
Sbjct: 725 gtacccctcaacggcccccatgagcacaacttgacaagcccatatggcgaggaggctctg 666

                                                                       
Query: 452 tgcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctgaagatttggga 511
            || || |||||||| |||||||| ||||||||||||||||| ||||||||||| || ||
Sbjct: 665 ggcgtggacgaggctggggttgccaaggtagtcgaggccaccatcgctgaagatctgaga 606

                                                                       
Query: 512 gcctgccttgaaccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggg 571
           ||| |||||||||||  | ||||| |||||||| || |||||||| ||||| | ||||||
Sbjct: 605 gccagccttgaaccaaccggcctcgccgaacttcacaccattgcgggcaagcaactcggg 546

                                                                       
Query: 572 gaagacgcatccgagcgcaccgagcatggcccaccttgcagtggatcacctcaagcttcc 631
            ||||| || || |||||||||||||||||||| |  ||||||||||||||| ||| |||
Sbjct: 545 aaagacacaaccaagcgcaccgagcatggcccatc-ggcagtggatcacctcgagc-tcc 488

                             
Query: 632 cggttctttgcaaaggtc 649
           |||||||| || ||||||
Sbjct: 487 cggttcttggcgaaggtc 470



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 58/64 (90%), Gaps = 2/64 (3%)
 Strand = Plus / Plus

                                                                        
Query: 210  ccggtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgcccattc 269
            ||||||||||| |||||||| |||||||||| ||||||||||||||| ||||| ||||| 
Sbjct: 1108 ccggtgacaatggcctgcac-aagaagccaa-catggagaacatggcgaggcggccatta 1165

                
Query: 270  ttga 273
            ||||
Sbjct: 1166 ttga 1169



to top

>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor
           (Wcab) mRNA, complete cds
          Length = 918

 Score =  392 bits (198), Expect = e-106
 Identities = 443/522 (84%), Gaps = 2/522 (0%)
 Strand = Plus / Minus

                                                                       
Query: 118 acttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcga 177
           |||||||||| |||||||| ||||| || |||||||| ||||||||||| || |||||||
Sbjct: 808 acttgccggggacaaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 749

                                                                       
Query: 178 gatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagc 237
             |||||||| |||||||| || ||||||||||| ||||| ||||| || || |||||||
Sbjct: 748 tgtggtcagcgaggttctcaagtgggcccttgcccgtgacgatagcttggacaaagaagc 689

                                                                       
Query: 238 caaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcga 297
           ||||||| ||||||||||||||||| || ||||||| ||| || ||||||||||| ||||
Sbjct: 688 caaacattgagaacatggcaaggcgaccgttcttgatctccttcaccttgagctcggcga 629

                                                                       
Query: 298 atgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggat 357
           ||||||| ||||| ||||| | ||| || ||||||||||| || || ||||||||||| |
Sbjct: 628 atgcctcagggtcttcggccaagccaagagggtcgaagctaccgcctgggtagagtgggt 569

                                                                       
Query: 358 caaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagca 417
           |||| | ||||||||||||||| || ||||  |||||||| || ||||| ||||||||||
Sbjct: 568 caacgatctcaccgagtgggccgccggcaacacggtacccctcgacggcacccatgagca 509

                                                                       
Query: 418 cgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccga 477
           |||| || |||||||| ||||| |||||||||||||| ||||| ||||| ||||||||||
Sbjct: 508 cgacctggcatgcccaaatagctaggatgctttgtgcgtgcactaggctggggttgccga 449

                                                                       
Query: 478 ggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcac 537
           |||||||||| ||||| || || ||||| |||||||| ||||||||||| || ||||| |
Sbjct: 448 ggtagtcgagaccaccctcactaaagatctgggagccggccttgaaccaaacggcctcgc 389

                                                                       
Query: 538 cgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagca 597
           | |||||||| || ||||| || || | ||| |||||||| || || || || || ||||
Sbjct: 388 caaacttgacgccgttgcgggcgagcaactcagggaagacacaaccaagtgccccaagca 329

                                                     
Query: 598 tggcccaccttgcagtggatcacctcaagcttcccggttctt 639
           ||||||| |   |||||||||||||| ||| |||||||||||
Sbjct: 328 tggcccagc-gacagtggatcacctccagc-tcccggttctt 289



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 15  cttgtaatttacatcatgat 34
           ||||||||||||||||||||
Sbjct: 887 cttgtaatttacatcatgat 868



to top

>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase
             IV-1 gene, complete cds
          Length = 15000

 Score =  391 bits (197), Expect = e-105
 Identities = 445/525 (84%), Gaps = 2/525 (0%)
 Strand = Plus / Plus

                                                                         
Query: 115   ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
             ||||||||||||| || ||||| |||||  | |||||||||||||||||||| || ||||
Sbjct: 13875 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 13934

                                                                         
Query: 175   cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
             |||| ||||| || |||||||| || || |||||||||||||| || ||||| |||||||
Sbjct: 13935 cgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctggacgaaga 13994

                                                                         
Query: 235   agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
             | || ||||||||||||||||| ||||| || ||||||| ||| || ||||||||||| |
Sbjct: 13995 acccgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcgg 14054

                                                                         
Query: 295   cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
             |||| ||||| ||||| ||||| ||||||||||||||||||||||| || |||||||| |
Sbjct: 14055 cgaacgcctcggggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcg 14114

                                                                         
Query: 355   gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
             | || || ||||| ||||| ||||| || || | ||||||||| || |||||||||||||
Sbjct: 14115 ggtcgacgacctcgccgagcgggccgccggcgacgcggtacccctcgacggcgcccatga 14174

                                                                         
Query: 415   gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
             ||||||| || ||  ||||||| || |||||||| || || || |  ||||| |||||||
Sbjct: 14175 gcacgacctggcaaccccagatcgccaggatgctctgcgcgtggatcaggctggggttgc 14234

                                                                         
Query: 475   cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
             ||||||||||||| || || ||||||||||| ||||| || ||||||||||| || ||||
Sbjct: 14235 cgaggtagtcgagccccccctcgctgaagatctgggaccccgccttgaaccacacggcct 14294

                                                                         
Query: 535   caccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccga 594
             | |||||||| || || ||||| || || ||||| ||||||||||| |||||||| || |
Sbjct: 14295 cgccgaacttcacgccgttgcgggcgaggagctccgggaagacgcagccgagcgcgccca 14354

                                                          
Query: 595   gcatggcccaccttgcagtggatcacctcaagcttcccggttctt 639
             ||||||||||||  ||||||||||||||| ||| |||||||||||
Sbjct: 14355 gcatggcccacc-ggcagtggatcacctccagc-tcccggttctt 14397



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  391 bits (197), Expect = e-105
 Identities = 445/525 (84%), Gaps = 2/525 (0%)
 Strand = Plus / Minus

                                                                            
Query: 115      ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
                ||||||||||||| || ||||| |||||  | |||||||||||||||||||| || ||||
Sbjct: 30025136 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 30025077

                                                                            
Query: 175      cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
                |||| ||||| || |||||||| || || |||||||||||||| || ||||| |||||||
Sbjct: 30025076 cgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctggacgaaga 30025017

                                                                            
Query: 235      agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
                | || ||||||||||||||||| ||||| || ||||||| ||| || ||||||||||| |
Sbjct: 30025016 acccgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcgg 30024957

                                                                            
Query: 295      cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
                |||| ||||| ||||| ||||| ||||||||||||||||||||||| || |||||||| |
Sbjct: 30024956 cgaacgcctcggggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcg 30024897

                                                                            
Query: 355      gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
                | || || ||||| ||||| ||||| || || | ||||||||| || |||||||||||||
Sbjct: 30024896 ggtcgacgacctcgccgagcgggccgccggcgacgcggtacccctcgacggcgcccatga 30024837

                                                                            
Query: 415      gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
                ||||||| || ||  ||||||| || |||||||| || || || |  ||||| |||||||
Sbjct: 30024836 gcacgacctggcaaccccagatcgccaggatgctctgcgcgtggatcaggctggggttgc 30024777

                                                                            
Query: 475      cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
                ||||||||||||| || || ||||||||||| ||||| || ||||||||||| || ||||
Sbjct: 30024776 cgaggtagtcgagccccccctcgctgaagatctgggaccccgccttgaaccacacggcct 30024717

                                                                            
Query: 535      caccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccga 594
                | |||||||| || || ||||| || || ||||| ||||||||||| |||||||| || |
Sbjct: 30024716 cgccgaacttcacgccgttgcgggcgaggagctccgggaagacgcagccgagcgcgccca 30024657

                                                             
Query: 595      gcatggcccaccttgcagtggatcacctcaagcttcccggttctt 639
                ||||||||||||  ||||||||||||||| ||| |||||||||||
Sbjct: 30024656 gcatggcccacc-ggcagtggatcacctccagc-tcccggttctt 30024614



 Score =  391 bits (197), Expect = e-105
 Identities = 445/525 (84%), Gaps = 2/525 (0%)
 Strand = Plus / Minus

                                                                            
Query: 115      ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
                ||||||||||||| || ||||| |||||  | ||||| |||||||||||||| || ||||
Sbjct: 23604330 ctcacttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcgg 23604271

                                                                            
Query: 175      cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
                |||| ||||| || ||||||||||||||||||||||||||||| || ||||| |||||||
Sbjct: 23604270 cgaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaaga 23604211

                                                                            
Query: 235      agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
                |||| ||||||||||||||||| ||||| || ||||||| ||| || |||||||||||||
Sbjct: 23604210 agccgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccg 23604151

                                                                            
Query: 295      cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
                |||| ||||| ||||| ||||| ||||||||||||||||||||||| || |||||||| |
Sbjct: 23604150 cgaaggcctccgggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcg 23604091

                                                                            
Query: 355      gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
                | || || ||||| ||||| || || || || ||||||||||| || |||||||||||||
Sbjct: 23604090 ggtcgacgacctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatga 23604031

                                                                            
Query: 415      gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
                |||| || ||    |||||||| || |||||||| || || || |  ||||| |||||||
Sbjct: 23604030 gcaccacctggaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgc 23603971

                                                                            
Query: 475      cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
                ||||||||||||| || || ||||||||||| || || || ||||||||||| || ||||
Sbjct: 23603970 cgaggtagtcgagcccgccctcgctgaagatctgcgaccccgccttgaaccacaccgcct 23603911

                                                                            
Query: 535      caccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccga 594
                | ||||||||||| || ||||| || || ||||| ||||| ||||| || ||||| ||||
Sbjct: 23603910 cgccgaacttgacgccgttgcgggcgaggagctccgggaacacgcagcccagcgcgccga 23603851

                                                             
Query: 595      gcatggcccaccttgcagtggatcacctcaagcttcccggttctt 639
                |||| ||||||| || ||||||||||||| ||| |||||||||||
Sbjct: 23603850 gcatcgcccacc-tggagtggatcacctccagc-tcccggttctt 23603808



to top

>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0690B02
          Length = 153116

 Score =  391 bits (197), Expect = e-105
 Identities = 445/525 (84%), Gaps = 2/525 (0%)
 Strand = Plus / Minus

                                                                         
Query: 115   ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
             ||||||||||||| || ||||| |||||  | |||||||||||||||||||| || ||||
Sbjct: 21126 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 21067

                                                                         
Query: 175   cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
             |||| ||||| || |||||||| || || |||||||||||||| || ||||| |||||||
Sbjct: 21066 cgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctggacgaaga 21007

                                                                         
Query: 235   agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
             | || ||||||||||||||||| ||||| || ||||||| ||| || ||||||||||| |
Sbjct: 21006 acccgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcgg 20947

                                                                         
Query: 295   cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
             |||| ||||| ||||| ||||| ||||||||||||||||||||||| || |||||||| |
Sbjct: 20946 cgaacgcctcggggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcg 20887

                                                                         
Query: 355   gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
             | || || ||||| ||||| ||||| || || | ||||||||| || |||||||||||||
Sbjct: 20886 ggtcgacgacctcgccgagcgggccgccggcgacgcggtacccctcgacggcgcccatga 20827

                                                                         
Query: 415   gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
             ||||||| || ||  ||||||| || |||||||| || || || |  ||||| |||||||
Sbjct: 20826 gcacgacctggcaaccccagatcgccaggatgctctgcgcgtggatcaggctggggttgc 20767

                                                                         
Query: 475   cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
             ||||||||||||| || || ||||||||||| ||||| || ||||||||||| || ||||
Sbjct: 20766 cgaggtagtcgagccccccctcgctgaagatctgggaccccgccttgaaccacacggcct 20707

                                                                         
Query: 535   caccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccga 594
             | |||||||| || || ||||| || || ||||| ||||||||||| |||||||| || |
Sbjct: 20706 cgccgaacttcacgccgttgcgggcgaggagctccgggaagacgcagccgagcgcgccca 20647

                                                          
Query: 595   gcatggcccaccttgcagtggatcacctcaagcttcccggttctt 639
             ||||||||||||  ||||||||||||||| ||| |||||||||||
Sbjct: 20646 gcatggcccacc-ggcagtggatcacctccagc-tcccggttctt 20604



to top

>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0518F01
          Length = 154541

 Score =  391 bits (197), Expect = e-105
 Identities = 445/525 (84%), Gaps = 2/525 (0%)
 Strand = Plus / Minus

                                                                         
Query: 115   ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
             ||||||||||||| || ||||| |||||  | ||||| |||||||||||||| || ||||
Sbjct: 67029 ctcacttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcgg 66970

                                                                         
Query: 175   cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
             |||| ||||| || ||||||||||||||||||||||||||||| || ||||| |||||||
Sbjct: 66969 cgaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaaga 66910

                                                                         
Query: 235   agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
             |||| ||||||||||||||||| ||||| || ||||||| ||| || |||||||||||||
Sbjct: 66909 agccgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccg 66850

                                                                         
Query: 295   cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
             |||| ||||| ||||| ||||| ||||||||||||||||||||||| || |||||||| |
Sbjct: 66849 cgaaggcctccgggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcg 66790

                                                                         
Query: 355   gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
             | || || ||||| ||||| || || || || ||||||||||| || |||||||||||||
Sbjct: 66789 ggtcgacgacctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatga 66730

                                                                         
Query: 415   gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
             |||| || ||    |||||||| || |||||||| || || || |  ||||| |||||||
Sbjct: 66729 gcaccacctggaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgc 66670

                                                                         
Query: 475   cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
             ||||||||||||| || || ||||||||||| || || || ||||||||||| || ||||
Sbjct: 66669 cgaggtagtcgagcccgccctcgctgaagatctgcgaccccgccttgaaccacaccgcct 66610

                                                                         
Query: 535   caccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccga 594
             | ||||||||||| || ||||| || || ||||| ||||| ||||| || ||||| ||||
Sbjct: 66609 cgccgaacttgacgccgttgcgggcgaggagctccgggaacacgcagcccagcgcgccga 66550

                                                          
Query: 595   gcatggcccaccttgcagtggatcacctcaagcttcccggttctt 639
             |||| ||||||| || ||||||||||||| ||| |||||||||||
Sbjct: 66549 gcatcgcccacc-tggagtggatcacctccagc-tcccggttctt 66507



to top

>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full
           insert sequence
          Length = 1180

 Score =  391 bits (197), Expect = e-105
 Identities = 445/525 (84%), Gaps = 2/525 (0%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||||||||| || ||||| |||||  | ||||| |||||||||||||| || ||||
Sbjct: 858 ctcacttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcgg 799

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           |||| ||||| || ||||||||||||||||||||||||||||| || ||||| |||||||
Sbjct: 798 cgaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaaga 739

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           |||| ||||||||||||||||| ||||| || ||||||| ||| || |||||||||||||
Sbjct: 738 agccgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccg 679

                                                                       
Query: 295 cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
           |||| ||||| ||||| ||||| ||||||||||||||||||||||| || |||||||| |
Sbjct: 678 cgaaggcctccgggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcg 619

                                                                       
Query: 355 gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
           | || || ||||| ||||| || || || || ||||||||||| || |||||||||||||
Sbjct: 618 ggtcgacgacctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatga 559

                                                                       
Query: 415 gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
           |||| || ||    |||||||| || |||||||| || || || |  ||||| |||||||
Sbjct: 558 gcaccacctggaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgc 499

                                                                       
Query: 475 cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
           ||||||||||||| || || ||||||||||| || || || ||||||||||| || ||||
Sbjct: 498 cgaggtagtcgagcccgccctcgctgaagatctgcgaccccgccttgaaccacaccgcct 439

                                                                       
Query: 535 caccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccga 594
           | ||||||||||| || ||||| || || ||||| ||||| ||||| || ||||| ||||
Sbjct: 438 cgccgaacttgacgccgttgcgggcgaggagctccgggaacacgcagcccagcgcgccga 379

                                                        
Query: 595 gcatggcccaccttgcagtggatcacctcaagcttcccggttctt 639
           |||| ||||||| || ||||||||||||| ||| |||||||||||
Sbjct: 378 gcatcgcccacc-tggagtggatcacctccagc-tcccggttctt 336



to top

>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full
           insert sequence
          Length = 1126

 Score =  391 bits (197), Expect = e-105
 Identities = 445/525 (84%), Gaps = 2/525 (0%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||||||||| || ||||| |||||  | ||||| |||||||||||||| || ||||
Sbjct: 857 ctcacttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcgg 798

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           |||| ||||| || ||||||||||||||||||||||||||||| || ||||| |||||||
Sbjct: 797 cgaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaaga 738

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           |||| ||||||||||||||||| ||||| || ||||||| ||| || |||||||||||||
Sbjct: 737 agccgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccg 678

                                                                       
Query: 295 cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
           |||| ||||| ||||| ||||| ||||||||||||||||||||||| || |||||||| |
Sbjct: 677 cgaaggcctccgggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcg 618

                                                                       
Query: 355 gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
           | || || ||||| ||||| || || || || ||||||||||| || |||||||||||||
Sbjct: 617 ggtcgacgacctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatga 558

                                                                       
Query: 415 gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
           |||| || ||    |||||||| || |||||||| || || || |  ||||| |||||||
Sbjct: 557 gcaccacctggaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgc 498

                                                                       
Query: 475 cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
           ||||||||||||| || || ||||||||||| || || || ||||||||||| || ||||
Sbjct: 497 cgaggtagtcgagcccgccctcgctgaagatctgcgaccccgccttgaaccacaccgcct 438

                                                                       
Query: 535 caccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccga 594
           | ||||||||||| || ||||| || || ||||| ||||| ||||| || ||||| ||||
Sbjct: 437 cgccgaacttgacgccgttgcgggcgaggagctccgggaacacgcagcccagcgcgccga 378

                                                        
Query: 595 gcatggcccaccttgcagtggatcacctcaagcttcccggttctt 639
           |||| ||||||| || ||||||||||||| ||| |||||||||||
Sbjct: 377 gcatcgcccacc-tggagtggatcacctccagc-tcccggttctt 335



to top

>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full
           insert sequence
          Length = 1055

 Score =  391 bits (197), Expect = e-105
 Identities = 445/525 (84%), Gaps = 2/525 (0%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||||||||| || ||||| |||||  | |||||||||||||||||||| || ||||
Sbjct: 880 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 821

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           |||| ||||| || |||||||| || || |||||||||||||| || ||||| |||||||
Sbjct: 820 cgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctggacgaaga 761

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | || ||||||||||||||||| ||||| || ||||||| ||| || ||||||||||| |
Sbjct: 760 acccgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcgg 701

                                                                       
Query: 295 cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
           |||| ||||| ||||| ||||| ||||||||||||||||||||||| || |||||||| |
Sbjct: 700 cgaacgcctcggggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcg 641

                                                                       
Query: 355 gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
           | || || ||||| ||||| ||||| || || | ||||||||| || |||||||||||||
Sbjct: 640 ggtcgacgacctcgccgagcgggccgccggcgacgcggtacccctcgacggcgcccatga 581

                                                                       
Query: 415 gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
           ||||||| || ||  ||||||| || |||||||| || || || |  ||||| |||||||
Sbjct: 580 gcacgacctggcaaccccagatcgccaggatgctctgcgcgtggatcaggctggggttgc 521

                                                                       
Query: 475 cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
           ||||||||||||| || || ||||||||||| ||||| || ||||||||||| || ||||
Sbjct: 520 cgaggtagtcgagccccccctcgctgaagatctgggaccccgccttgaaccacacggcct 461

                                                                       
Query: 535 caccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccga 594
           | |||||||| || || ||||| || || ||||| ||||||||||| |||||||| || |
Sbjct: 460 cgccgaacttcacgccgttgcgggcgaggagctccgggaagacgcagccgagcgcgccca 401

                                                        
Query: 595 gcatggcccaccttgcagtggatcacctcaagcttcccggttctt 639
           ||||||||||||  ||||||||||||||| ||| |||||||||||
Sbjct: 400 gcatggcccacc-ggcagtggatcacctccagc-tcccggttctt 358



to top

>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full
           insert sequence
          Length = 1055

 Score =  391 bits (197), Expect = e-105
 Identities = 445/525 (84%), Gaps = 2/525 (0%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||||||||| || ||||| |||||  | |||||||||||||||||||| || ||||
Sbjct: 880 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 821

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           |||| ||||| || |||||||| || || |||||||||||||| || ||||| |||||||
Sbjct: 820 cgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctggacgaaga 761

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | || ||||||||||||||||| ||||| || ||||||| ||| || ||||||||||| |
Sbjct: 760 acccgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcgg 701

                                                                       
Query: 295 cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
           |||| ||||| ||||| ||||| ||||||||||||||||||||||| || |||||||| |
Sbjct: 700 cgaacgcctcggggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcg 641

                                                                       
Query: 355 gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
           | || || ||||| ||||| ||||| || || | ||||||||| || |||||||||||||
Sbjct: 640 ggtcgacgacctcgccgagcgggccgccggcgacgcggtacccctcgacggcgcccatga 581

                                                                       
Query: 415 gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
           ||||||| || ||  ||||||| || |||||||| || || || |  ||||| |||||||
Sbjct: 580 gcacgacctggcaaccccagatcgccaggatgctctgcgcgtggatcaggctggggttgc 521

                                                                       
Query: 475 cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
           ||||||||||||| || || ||||||||||| ||||| || ||||||||||| || ||||
Sbjct: 520 cgaggtagtcgagccccccctcgctgaagatctgggaccccgccttgaaccacacggcct 461

                                                                       
Query: 535 caccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccga 594
           | |||||||| || || ||||| || || ||||| ||||||||||| |||||||| || |
Sbjct: 460 cgccgaacttcacgccgttgcgggcgaggagctccgggaagacgcagccgagcgcgccca 401

                                                        
Query: 595 gcatggcccaccttgcagtggatcacctcaagcttcccggttctt 639
           ||||||||||||  ||||||||||||||| ||| |||||||||||
Sbjct: 400 gcatggcccacc-ggcagtggatcacctccagc-tcccggttctt 358



to top

>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full
           insert sequence
          Length = 1057

 Score =  391 bits (197), Expect = e-105
 Identities = 445/525 (84%), Gaps = 2/525 (0%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||||||||| || ||||| |||||  | |||||||||||||||||||| || ||||
Sbjct: 882 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 823

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           |||| ||||| || |||||||| || || |||||||||||||| || ||||| |||||||
Sbjct: 822 cgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctggacgaaga 763

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | || ||||||||||||||||| ||||| || ||||||| ||| || ||||||||||| |
Sbjct: 762 acccgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcgg 703

                                                                       
Query: 295 cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
           |||| ||||| ||||| ||||| ||||||||||||||||||||||| || |||||||| |
Sbjct: 702 cgaacgcctcggggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcg 643

                                                                       
Query: 355 gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
           | || || ||||| ||||| ||||| || || | ||||||||| || |||||||||||||
Sbjct: 642 ggtcgacgacctcgccgagcgggccgccggcgacgcggtacccctcgacggcgcccatga 583

                                                                       
Query: 415 gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
           ||||||| || ||  ||||||| || |||||||| || || || |  ||||| |||||||
Sbjct: 582 gcacgacctggcaaccccagatcgccaggatgctctgcgcgtggatcaggctggggttgc 523

                                                                       
Query: 475 cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
           ||||||||||||| || || ||||||||||| ||||| || ||||||||||| || ||||
Sbjct: 522 cgaggtagtcgagccccccctcgctgaagatctgggaccccgccttgaaccacacggcct 463

                                                                       
Query: 535 caccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccga 594
           | |||||||| || || ||||| || || ||||| ||||||||||| |||||||| || |
Sbjct: 462 cgccgaacttcacgccgttgcgggcgaggagctccgggaagacgcagccgagcgcgccca 403

                                                        
Query: 595 gcatggcccaccttgcagtggatcacctcaagcttcccggttctt 639
           ||||||||||||  ||||||||||||||| ||| |||||||||||
Sbjct: 402 gcatggcccacc-ggcagtggatcacctccagc-tcccggttctt 360



to top

>ref|NM_191799.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score =  389 bits (196), Expect = e-105
 Identities = 444/524 (84%), Gaps = 2/524 (0%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||||||||| || ||||| |||||  | |||||||||||||||||||| || |||||
Sbjct: 798 tcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggc 739

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
           ||| ||||| || |||||||| || || |||||||||||||| || ||||| ||||||||
Sbjct: 738 gaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaa 679

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
            || ||||||||||||||||| ||||| || ||||||| ||| || ||||||||||| ||
Sbjct: 678 cccgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcggc 619

                                                                       
Query: 296 gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
           ||| ||||| ||||| ||||| ||||||||||||||||||||||| || |||||||| ||
Sbjct: 618 gaacgcctcggggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcgg 559

                                                                       
Query: 356 atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
            || || ||||| ||||| ||||| || || | ||||||||| || ||||||||||||||
Sbjct: 558 gtcgacgacctcgccgagcgggccgccggcgacgcggtacccctcgacggcgcccatgag 499

                                                                       
Query: 416 cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
           |||||| || ||  ||||||| || |||||||| || || || |  ||||| ||||||||
Sbjct: 498 cacgacctggcaaccccagatcgccaggatgctctgcgcgtggatcaggctggggttgcc 439

                                                                       
Query: 476 gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
           |||||||||||| || || ||||||||||| ||||| || ||||||||||| || |||||
Sbjct: 438 gaggtagtcgagccccccctcgctgaagatctgggaccccgccttgaaccacacggcctc 379

                                                                       
Query: 536 accgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgag 595
            |||||||| || || ||||| || || ||||| ||||||||||| |||||||| || ||
Sbjct: 378 gccgaacttcacgccgttgcgggcgaggagctccgggaagacgcagccgagcgcgcccag 319

                                                       
Query: 596 catggcccaccttgcagtggatcacctcaagcttcccggttctt 639
           |||||||||||  ||||||||||||||| ||| |||||||||||
Sbjct: 318 catggcccacc-ggcagtggatcacctccagc-tcccggttctt 277



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  389 bits (196), Expect = e-105
 Identities = 444/524 (84%), Gaps = 2/524 (0%)
 Strand = Plus / Minus

                                                                            
Query: 116      tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
                |||||||||||| || ||||| |||||  ||||||| |||||||||||||| || |||||
Sbjct: 10793782 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 10793723

                                                                            
Query: 176      gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
                ||| ||||| || ||||||||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 10793722 gaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaa 10793663

                                                                            
Query: 236      gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
                ||| ||||||||||||||||| ||||| || ||||||| ||| || ||||||||||||||
Sbjct: 10793662 gccgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgc 10793603

                                                                            
Query: 296      gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
                ||| ||||| ||||||||||| ||||||||||||||||||  ||| || |||||||| ||
Sbjct: 10793602 gaacgcctcggggtcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagcgg 10793543

                                                                            
Query: 356      atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
                 || || ||||| ||||| || || || || ||||||||||| || ||||||||||||||
Sbjct: 10793542 gtcgacgacctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgag 10793483

                                                                            
Query: 416      cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
                ||| || ||    |||||||| || |||||||| || || || |  ||||| ||||||||
Sbjct: 10793482 caccacctgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgcc 10793423

                                                                            
Query: 476      gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
                |||||||||||| || || ||||||||||| || ||||| ||||||||||| || |||||
Sbjct: 10793422 gaggtagtcgagcccgccctcgctgaagatctgcgagcccgccttgaaccacacggcctc 10793363

                                                                            
Query: 536      accgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgag 595
                 ||||||||||| || || || || || ||||| ||||||||||| |||||||| || ||
Sbjct: 10793362 gccgaacttgacgccgttccgggcgaggagctccgggaagacgcagccgagcgcgcccag 10793303

                                                            
Query: 596      catggcccaccttgcagtggatcacctcaagcttcccggttctt 639
                ||| |||||||  | ||||||||||||| ||| |||||||||||
Sbjct: 10793302 catcgcccacc-gggagtggatcacctccagc-tcccggttctt 10793261



to top

>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0512H04
          Length = 151049

 Score =  389 bits (196), Expect = e-105
 Identities = 444/524 (84%), Gaps = 2/524 (0%)
 Strand = Plus / Minus

                                                                         
Query: 116   tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
             |||||||||||| || ||||| |||||  ||||||| |||||||||||||| || |||||
Sbjct: 17505 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 17446

                                                                         
Query: 176   gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
             ||| ||||| || ||||||||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 17445 gaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaa 17386

                                                                         
Query: 236   gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
             ||| ||||||||||||||||| ||||| || ||||||| ||| || ||||||||||||||
Sbjct: 17385 gccgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgc 17326

                                                                         
Query: 296   gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
             ||| ||||| ||||||||||| ||||||||||||||||||  ||| || |||||||| ||
Sbjct: 17325 gaacgcctcggggtcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagcgg 17266

                                                                         
Query: 356   atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
              || || ||||| ||||| || || || || ||||||||||| || ||||||||||||||
Sbjct: 17265 gtcgacgacctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgag 17206

                                                                         
Query: 416   cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
             ||| || ||    |||||||| || |||||||| || || || |  ||||| ||||||||
Sbjct: 17205 caccacctgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgcc 17146

                                                                         
Query: 476   gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
             |||||||||||| || || ||||||||||| || ||||| ||||||||||| || |||||
Sbjct: 17145 gaggtagtcgagcccgccctcgctgaagatctgcgagcccgccttgaaccacacggcctc 17086

                                                                         
Query: 536   accgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgag 595
              ||||||||||| || || || || || ||||| ||||||||||| |||||||| || ||
Sbjct: 17085 gccgaacttgacgccgttccgggcgaggagctccgggaagacgcagccgagcgcgcccag 17026

                                                         
Query: 596   catggcccaccttgcagtggatcacctcaagcttcccggttctt 639
             ||| |||||||  | ||||||||||||| ||| |||||||||||
Sbjct: 17025 catcgcccacc-gggagtggatcacctccagc-tcccggttctt 16984



to top

>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBb0085I16
          Length = 141701

 Score =  389 bits (196), Expect = e-105
 Identities = 444/524 (84%), Gaps = 2/524 (0%)
 Strand = Plus / Minus

                                                                          
Query: 116    tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
              |||||||||||| || ||||| |||||  ||||||| |||||||||||||| || |||||
Sbjct: 130400 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 130341

                                                                          
Query: 176    gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
              ||| ||||| || ||||||||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 130340 gaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaa 130281

                                                                          
Query: 236    gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
              ||| ||||||||||||||||| ||||| || ||||||| ||| || ||||||||||||||
Sbjct: 130280 gccgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgc 130221

                                                                          
Query: 296    gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
              ||| ||||| ||||||||||| ||||||||||||||||||  ||| || |||||||| ||
Sbjct: 130220 gaacgcctcggggtcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagcgg 130161

                                                                          
Query: 356    atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
               || || ||||| ||||| || || || || ||||||||||| || ||||||||||||||
Sbjct: 130160 gtcgacgacctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgag 130101

                                                                          
Query: 416    cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
              ||| || ||    |||||||| || |||||||| || || || |  ||||| ||||||||
Sbjct: 130100 caccacctgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgcc 130041

                                                                          
Query: 476    gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
              |||||||||||| || || ||||||||||| || ||||| ||||||||||| || |||||
Sbjct: 130040 gaggtagtcgagcccgccctcgctgaagatctgcgagcccgccttgaaccacacggcctc 129981

                                                                          
Query: 536    accgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgag 595
               ||||||||||| || || || || || ||||| ||||||||||| |||||||| || ||
Sbjct: 129980 gccgaacttgacgccgttccgggcgaggagctccgggaagacgcagccgagcgcgcccag 129921

                                                          
Query: 596    catggcccaccttgcagtggatcacctcaagcttcccggttctt 639
              ||| |||||||  | ||||||||||||| ||| |||||||||||
Sbjct: 129920 catcgcccacc-gggagtggatcacctccagc-tcccggttctt 129879



to top

>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full
           insert sequence
          Length = 1013

 Score =  389 bits (196), Expect = e-105
 Identities = 444/524 (84%), Gaps = 2/524 (0%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||||||||| || ||||| |||||  ||||||| |||||||||||||| || |||||
Sbjct: 850 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 791

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
           ||| ||||| || ||||||||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 790 gaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaa 731

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
           ||| ||||||||||||||||| ||||| || ||||||| ||| || ||||||||||||||
Sbjct: 730 gccgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgc 671

                                                                       
Query: 296 gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
           ||| ||||| ||||||||||| ||||||||||||||||||  ||| || |||||||| ||
Sbjct: 670 gaacgcctcggggtcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagcgg 611

                                                                       
Query: 356 atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
            || || ||||| ||||| || || || || ||||||||||| || ||||||||||||||
Sbjct: 610 gtcgacgacctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgag 551

                                                                       
Query: 416 cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
           ||| || ||    |||||||| || |||||||| || || || |  ||||| ||||||||
Sbjct: 550 caccacctgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgcc 491

                                                                       
Query: 476 gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
           |||||||||||| || || ||||||||||| || ||||| ||||||||||| || |||||
Sbjct: 490 gaggtagtcgagcccgccctcgctgaagatctgcgagcccgccttgaaccacacggcctc 431

                                                                       
Query: 536 accgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgag 595
            ||||||||||| || || || || || ||||| ||||||||||| |||||||| || ||
Sbjct: 430 gccgaacttgacgccgttccgggcgaggagctccgggaagacgcagccgagcgcgcccag 371

                                                       
Query: 596 catggcccaccttgcagtggatcacctcaagcttcccggttctt 639
           ||| |||||||  | ||||||||||||| ||| |||||||||||
Sbjct: 370 catcgcccacc-gggagtggatcacctccagc-tcccggttctt 329



to top

>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full
           insert sequence
          Length = 1021

 Score =  389 bits (196), Expect = e-105
 Identities = 444/524 (84%), Gaps = 2/524 (0%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||||||||| || ||||| |||||  ||||||| |||||||||||||| || |||||
Sbjct: 855 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 796

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
           ||| ||||| || ||||||||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 795 gaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaa 736

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
           ||| ||||||||||||||||| ||||| || ||||||| ||| || ||||||||||||||
Sbjct: 735 gccgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgc 676

                                                                       
Query: 296 gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
           ||| ||||| ||||||||||| ||||||||||||||||||  ||| || |||||||| ||
Sbjct: 675 gaacgcctcggggtcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagcgg 616

                                                                       
Query: 356 atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
            || || ||||| ||||| || || || || ||||||||||| || ||||||||||||||
Sbjct: 615 gtcgacgacctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgag 556

                                                                       
Query: 416 cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
           ||| || ||    |||||||| || |||||||| || || || |  ||||| ||||||||
Sbjct: 555 caccacctgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgcc 496

                                                                       
Query: 476 gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
           |||||||||||| || || ||||||||||| || ||||| ||||||||||| || |||||
Sbjct: 495 gaggtagtcgagcccgccctcgctgaagatctgcgagcccgccttgaaccacacggcctc 436

                                                                       
Query: 536 accgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgag 595
            ||||||||||| || || || || || ||||| ||||||||||| |||||||| || ||
Sbjct: 435 gccgaacttgacgccgttccgggcgaggagctccgggaagacgcagccgagcgcgcccag 376

                                                       
Query: 596 catggcccaccttgcagtggatcacctcaagcttcccggttctt 639
           ||| |||||||  | ||||||||||||| ||| |||||||||||
Sbjct: 375 catcgcccacc-gggagtggatcacctccagc-tcccggttctt 334



to top

>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full
           insert sequence
          Length = 1056

 Score =  389 bits (196), Expect = e-105
 Identities = 444/524 (84%), Gaps = 2/524 (0%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||||||||| || ||||| |||||  ||||||| |||||||||||||| || |||||
Sbjct: 857 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 798

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
           ||| ||||| || ||||||||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 797 gaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaa 738

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
           ||| ||||||||||||||||| ||||| || ||||||| ||| || ||||||||||||||
Sbjct: 737 gccgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgc 678

                                                                       
Query: 296 gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
           ||| ||||| ||||||||||| ||||||||||||||||||  ||| || |||||||| ||
Sbjct: 677 gaacgcctcggggtcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagcgg 618

                                                                       
Query: 356 atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
            || || ||||| ||||| || || || || ||||||||||| || ||||||||||||||
Sbjct: 617 gtcgacgacctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgag 558

                                                                       
Query: 416 cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
           ||| || ||    |||||||| || |||||||| || || || |  ||||| ||||||||
Sbjct: 557 caccacctgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgcc 498

                                                                       
Query: 476 gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
           |||||||||||| || || ||||||||||| || ||||| ||||||||||| || |||||
Sbjct: 497 gaggtagtcgagcccgccctcgctgaagatctgcgagcccgccttgaaccacacggcctc 438

                                                                       
Query: 536 accgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgag 595
            ||||||||||| || || || || || ||||| ||||||||||| |||||||| || ||
Sbjct: 437 gccgaacttgacgccgttccgggcgaggagctccgggaagacgcagccgagcgcgcccag 378

                                                       
Query: 596 catggcccaccttgcagtggatcacctcaagcttcccggttctt 639
           ||| |||||||  | ||||||||||||| ||| |||||||||||
Sbjct: 377 catcgcccacc-gggagtggatcacctccagc-tcccggttctt 336



to top

>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full
           insert sequence
          Length = 1235

 Score =  389 bits (196), Expect = e-105
 Identities = 444/524 (84%), Gaps = 2/524 (0%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||||||||| || ||||| |||||  ||||||| |||||||||||||| || |||||
Sbjct: 855 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 796

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
           ||| ||||| || ||||||||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 795 gaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaa 736

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
           ||| ||||||||||||||||| ||||| || ||||||| ||| || ||||||||||||||
Sbjct: 735 gccgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgc 676

                                                                       
Query: 296 gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
           ||| ||||| ||||||||||| ||||||||||||||||||  ||| || |||||||| ||
Sbjct: 675 gaacgcctcggggtcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagcgg 616

                                                                       
Query: 356 atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
            || || ||||| ||||| || || || || ||||||||||| || ||||||||||||||
Sbjct: 615 gtcgacgacctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgag 556

                                                                       
Query: 416 cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
           ||| || ||    |||||||| || |||||||| || || || |  ||||| ||||||||
Sbjct: 555 caccacctgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgcc 496

                                                                       
Query: 476 gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
           |||||||||||| || || ||||||||||| || ||||| ||||||||||| || |||||
Sbjct: 495 gaggtagtcgagcccgccctcgctgaagatctgcgagcccgccttgaaccacacggcctc 436

                                                                       
Query: 536 accgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgag 595
            ||||||||||| || || || || || ||||| ||||||||||| |||||||| || ||
Sbjct: 435 gccgaacttgacgccgttccgggcgaggagctccgggaagacgcagccgagcgcgcccag 376

                                                       
Query: 596 catggcccaccttgcagtggatcacctcaagcttcccggttctt 639
           ||| |||||||  | ||||||||||||| ||| |||||||||||
Sbjct: 375 catcgcccacc-gggagtggatcacctccagc-tcccggttctt 334



to top

>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full
           insert sequence
          Length = 1045

 Score =  389 bits (196), Expect = e-105
 Identities = 444/524 (84%), Gaps = 2/524 (0%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||||||||| || ||||| |||||  ||||||| |||||||||||||| || |||||
Sbjct: 855 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 796

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
           ||| ||||| || ||||||||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 795 gaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaa 736

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
           ||| ||||||||||||||||| ||||| || ||||||| ||| || ||||||||||||||
Sbjct: 735 gccgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgc 676

                                                                       
Query: 296 gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
           ||| ||||| ||||||||||| ||||||||||||||||||  ||| || |||||||| ||
Sbjct: 675 gaacgcctcggggtcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagcgg 616

                                                                       
Query: 356 atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
            || || ||||| ||||| || || || || ||||||||||| || ||||||||||||||
Sbjct: 615 gtcgacgacctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgag 556

                                                                       
Query: 416 cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
           ||| || ||    |||||||| || |||||||| || || || |  ||||| ||||||||
Sbjct: 555 caccacctgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgcc 496

                                                                       
Query: 476 gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
           |||||||||||| || || ||||||||||| || ||||| ||||||||||| || |||||
Sbjct: 495 gaggtagtcgagcccgccctcgctgaagatctgcgagcccgccttgaaccacacggcctc 436

                                                                       
Query: 536 accgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgag 595
            ||||||||||| || || || || || ||||| ||||||||||| |||||||| || ||
Sbjct: 435 gccgaacttgacgccgttccgggcgaggagctccgggaagacgcagccgagcgcgcccag 376

                                                       
Query: 596 catggcccaccttgcagtggatcacctcaagcttcccggttctt 639
           ||| |||||||  | ||||||||||||| ||| |||||||||||
Sbjct: 375 catcgcccacc-gggagtggatcacctccagc-tcccggttctt 334



to top

>ref|NM_192636.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 789

 Score =  385 bits (194), Expect = e-103
 Identities = 442/522 (84%), Gaps = 2/522 (0%)
 Strand = Plus / Minus

                                                                       
Query: 118 acttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcga 177
           |||||||||| || ||||| |||||  | ||||| |||||||||||||| || |||||||
Sbjct: 784 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 725

                                                                       
Query: 178 gatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagc 237
           | ||||| || ||||||||||||||||||||||||||||| || ||||| ||||||||||
Sbjct: 724 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagc 665

                                                                       
Query: 238 caaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcga 297
           | ||||||||||||||||| ||||| || ||||||| ||| || ||||||||||||||||
Sbjct: 664 cgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcga 605

                                                                       
Query: 298 atgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggat 357
           | ||||| ||||| ||||| ||||||||||||||||||||||| || |||||||| || |
Sbjct: 604 aggcctccgggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcgggt 545

                                                                       
Query: 358 caaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagca 417
           | || ||||| ||||| || || || || ||||||||||| || ||||||||||||||||
Sbjct: 544 cgacgacctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagca 485

                                                                       
Query: 418 cgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccga 477
           | || ||    |||||||| || |||||||| || || || |  ||||| ||||||||||
Sbjct: 484 ccacctggaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccga 425

                                                                       
Query: 478 ggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcac 537
           |||||||||| || || ||||||||||| || || || ||||||||||| || ||||| |
Sbjct: 424 ggtagtcgagcccgccctcgctgaagatctgcgaccccgccttgaaccacaccgcctcgc 365

                                                                       
Query: 538 cgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagca 597
           |||||||||| || ||||| || || ||||| ||||| ||||| || ||||| |||||||
Sbjct: 364 cgaacttgacgccgttgcgggcgaggagctccgggaacacgcagcccagcgcgccgagca 305

                                                     
Query: 598 tggcccaccttgcagtggatcacctcaagcttcccggttctt 639
           | ||||||| || ||||||||||||| ||| |||||||||||
Sbjct: 304 tcgcccacc-tggagtggatcacctccagc-tcccggttctt 265



to top

>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein
           LHCP
          Length = 967

 Score =  385 bits (194), Expect = e-103
 Identities = 445/526 (84%), Gaps = 2/526 (0%)
 Strand = Plus / Minus

                                                                       
Query: 114 cctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcg 173
           |||||||||||||| || ||||| |||||  | ||||| |||||||||||||| || |||
Sbjct: 864 cctcacttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcg 805

                                                                       
Query: 174 gcgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaag 233
           || |  |||||||| ||||||||||| |||||||| |||||||| || ||||| ||||||
Sbjct: 804 gcaatgtggtcagcgaggttctcgagcgggcccttcccggtgacgatggcctggacgaag 745

                                                                       
Query: 234 aagccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctcc 293
           || || |||||||| |||||||| ||||| || ||||||| ||| || ||||||||||| 
Sbjct: 744 aatccgaacatggacaacatggcgaggcggcccttcttgagctccttgaccttgagctcg 685

                                                                       
Query: 294 gcgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagt 353
            |||| ||||| ||||| ||||| ||||| ||||||||||||||||| || |||||||| 
Sbjct: 684 ccgaaggcctcggggtcgtcggcgaggcccagcgggtcgaagctgccgccggggtagagc 625

                                                                       
Query: 354 ggatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatg 413
           || || || ||||| ||||| ||||| || || |||||||| || || ||||||||||||
Sbjct: 624 gggtcgacgacctcgccgagcgggccgccggcgatgcggtagccctcgacggcgcccatg 565

                                                                       
Query: 414 agcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttg 473
           |||||||| || || |||||||| ||||||||||| || || || | |||||| ||||| 
Sbjct: 564 agcacgacctggcaggcccagatggcaaggatgctctgcgcgtggatgaggctcgggttc 505

                                                                       
Query: 474 ccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcc 533
           ||||||||||| || || || ||||||||||| |||||||| ||||||||||| || |||
Sbjct: 504 ccgaggtagtccagcccgccctcgctgaagatctgggagccggccttgaaccacacggcc 445

                                                                       
Query: 534 tcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccg 593
           || ||||||||||| || ||||| || |||||||| ||||||||||| |||||||| || 
Sbjct: 444 tcgccgaacttgacgccgttgcgggcgagaagctccgggaagacgcaaccgagcgcgccc 385

                                                         
Query: 594 agcatggcccaccttgcagtggatcacctcaagcttcccggttctt 639
           ||||||||||| |  ||||||||||||||| ||| |||||||||||
Sbjct: 384 agcatggcccagc-ggcagtggatcacctccagc-tcccggttctt 341



to top

>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full
           insert sequence
          Length = 1057

 Score =  383 bits (193), Expect = e-103
 Identities = 444/525 (84%), Gaps = 2/525 (0%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||||||||| || ||||| |||||  | |||||||||||||||||||| || ||||
Sbjct: 882 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 823

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           |||| ||||| || |||||||| || || |||||||||||||| || ||||| |||||||
Sbjct: 822 cgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctggacgaaga 763

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | || ||||||||||||||||| ||||| || ||||||| ||| || ||||||||||| |
Sbjct: 762 acccgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcgg 703

                                                                       
Query: 295 cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
           |||| ||||| ||||| ||||| |||||||||| |||||||||||| || |||||||| |
Sbjct: 702 cgaacgcctcggggtcgtcggcgaggccgagcgagtcgaagctgccgccggggtagagcg 643

                                                                       
Query: 355 gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
           | || || ||||| ||||| ||||| || || | ||||||||| || |||||||||||||
Sbjct: 642 ggtcgacgacctcgccgagcgggccgccggcgacgcggtacccctcgacggcgcccatga 583

                                                                       
Query: 415 gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
           ||||||| || ||  ||||||| || |||||||| || || || |  ||||| |||||||
Sbjct: 582 gcacgacctggcaaccccagatcgccaggatgctctgcgcgtggatcaggctggggttgc 523

                                                                       
Query: 475 cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
           ||||||||||||| || || ||||||||||| ||||| || ||||||||||| || ||||
Sbjct: 522 cgaggtagtcgagccccccctcgctgaagatctgggaccccgccttgaaccacacggcct 463

                                                                       
Query: 535 caccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccga 594
           | |||||||| || || ||||| || || ||||| ||||||||||| |||||||| || |
Sbjct: 462 cgccgaacttcacgccgttgcgggcgaggagctccgggaagacgcagccgagcgcgccca 403

                                                        
Query: 595 gcatggcccaccttgcagtggatcacctcaagcttcccggttctt 639
           ||||||||||||  ||||||||||||||| ||| |||||||||||
Sbjct: 402 gcatggcccacc-ggcagtggatcacctccagc-tcccggttctt 360



to top

>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1442

 Score =  375 bits (189), Expect = e-100
 Identities = 443/525 (84%), Gaps = 2/525 (0%)
 Strand = Plus / Minus

                                                                        
Query: 115  ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
            ||||||||||||| || ||||| |||||  | ||||| |||||||||||||| || ||||
Sbjct: 1287 ctcacttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcgg 1228

                                                                        
Query: 175  cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
            |||| ||||| || ||||||||||||||||||||||||||||| || ||||| |||||||
Sbjct: 1227 cgaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaaga 1168

                                                                        
Query: 235  agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
            |||| ||||||||||||||||| ||||| || ||||||| ||| || |||||||||||||
Sbjct: 1167 agccgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccg 1108

                                                                        
Query: 295  cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
            |||| ||||| ||||||||||| ||||||||||||||||||  ||| || |||||||| |
Sbjct: 1107 cgaaggcctccgggtcatcggcgaggccgagcgggtcgaaggcgccgcccgggtagagcg 1048

                                                                        
Query: 355  gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
            | || || ||||| ||||| || || || ||||| |||||||| || |||||||||||||
Sbjct: 1047 ggtcgacgacctcgccgagcggcccgccggcaatccggtacccctcgacggcgcccatga 988

                                                                        
Query: 415  gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
            |||| || ||    |||||||| || |||||||| || || || |  ||||| |||||||
Sbjct: 987  gcaccacctgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgc 928

                                                                        
Query: 475  cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
            ||||||||||||| || || ||||||||||| || || || ||||||||||| || ||||
Sbjct: 927  cgaggtagtcgagcccgccctcgctgaagatctgcgaccccgccttgaaccacaccgcct 868

                                                                        
Query: 535  caccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccga 594
            | ||||||||||| || ||||| || || ||||| ||||| ||||| || ||| | ||||
Sbjct: 867  ccccgaacttgacgccgttgcgggcgaggagctccgggaacacgcagcccagcccgccga 808

                                                         
Query: 595  gcatggcccaccttgcagtggatcacctcaagcttcccggttctt 639
            |||| ||||||| || ||||||||||||| ||| |||||||||||
Sbjct: 807  gcatcgcccacc-tggagtggatcacctccagc-tcccggttctt 765



to top

>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein
          Length = 2100

 Score =  375 bits (189), Expect = e-100
 Identities = 430/509 (84%), Gaps = 1/509 (0%)
 Strand = Plus / Minus

                                                                        
Query: 120  ttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgaga 179
            |||||||| || ||||| |||||  | |||||||||||||||||||| || || ||||  
Sbjct: 1676 ttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgactgggtcagcgatg 1617

                                                                        
Query: 180  tggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagcca 239
            |||||||| ||||||||||| ||||||||||||||||| || ||||| ||||||||||| 
Sbjct: 1616 tggtcagcgaggttctcgagcgggcccttgccggtgacgatggcctggacgaagaagccg 1557

                                                                        
Query: 240  aacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaat 299
            |||||||| |||||||| ||||| || ||||||| ||| || ||||||||||| ||||| 
Sbjct: 1556 aacatggaaaacatggcgaggcggccgttcttgagctccttcaccttgagctcggcgaag 1497

                                                                        
Query: 300  gcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatca 359
            ||||| ||||| ||||| |||||||| |||||||||||||| |||||||| || || || 
Sbjct: 1496 gcctcggggtcgtcggccaggccgagggggtcgaagctgccgccagggtacagcgggtcg 1437

                                                                        
Query: 360  accacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacg 419
            || ||||| ||||| || || || ||||||||||| || || ||||| ||||||||||||
Sbjct: 1436 acgacctcgccgagcggcccgccggcaatgcggtagccctcgacggcacccatgagcacg 1377

                                                                        
Query: 420  acttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgagg 479
            || || || |||||||| || |||||||| || || || |  ||||| ||||||||||||
Sbjct: 1376 acctggcaggcccagatggcgaggatgctctgcgcgtggatcaggctggggttgccgagg 1317

                                                                        
Query: 480  tagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccg 539
            ||||| || || || ||||||||||| |||||||| ||||||||||| || ||||| |||
Sbjct: 1316 tagtccagcccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccg 1257

                                                                        
Query: 540  aacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatg 599
            |||||||| || ||||| |  || ||||||||||||||||| |||||||| |||||||||
Sbjct: 1256 aacttgacgccgttgcgggagagcagctcggggaagacgcagccgagcgcgccgagcatg 1197

                                         
Query: 600  gcccaccttgcagtggatcacctcaagct 628
            ||||| |  | ||||||||||||| ||||
Sbjct: 1196 gcccagcggg-agtggatcacctccagct 1169



to top

>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 1022

 Score =  375 bits (189), Expect = e-100
 Identities = 414/489 (84%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||||||||| || ||||| |||||  ||||||| |||||||||||||| || |||||
Sbjct: 836 tcacttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 777

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
           ||| ||||| || ||||||||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 776 gaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaa 717

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
           ||| ||||||||||||||||| ||||| || ||||||| ||| || ||||||||||||||
Sbjct: 716 gccgaacatggagaacatggcgaggcggcctttcttgatctccttcaccttgagctccgc 657

                                                                       
Query: 296 gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
           ||| ||||| ||||||||||| ||||||||||||||||||  ||| || |||||||| ||
Sbjct: 656 gaacgcctcggggtcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagcgg 597

                                                                       
Query: 356 atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
            || || ||||| ||||| || || || || ||||||||||| || ||||||||||||||
Sbjct: 596 gtcgacgacctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgag 537

                                                                       
Query: 416 cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
           ||| || ||    |||||||| || |||||||| || || || |  ||||| ||||||||
Sbjct: 536 caccacctgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgcc 477

                                                                       
Query: 476 gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
           |||||||||||| || || ||||||||||| || ||||| ||||||||||| || |||||
Sbjct: 476 gaggtagtcgagcccgccctcgctgaagatctgcgagcccgccttgaaccacacggcctc 417

                                                                       
Query: 536 accgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgag 595
            ||||||||||| || || || || || ||||| ||||||||||| |||||||| || ||
Sbjct: 416 gccgaacttgacgccgttccgggcgaggagctccgggaagacgcagccgagcgcgcccag 357

                    
Query: 596 catggccca 604
           ||| |||||
Sbjct: 356 catcgccca 348



to top

>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding
            protein
          Length = 2261

 Score =  369 bits (186), Expect = 8e-99
 Identities = 443/526 (84%), Gaps = 2/526 (0%)
 Strand = Plus / Minus

                                                                        
Query: 114  cctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcg 173
            |||||||||||||| || ||||| |||||  | ||||| |||||||||||||| || |||
Sbjct: 1812 cctcacttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcg 1753

                                                                        
Query: 174  gcgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaag 233
            || |  |||||||| ||||||||||| |||||||| |||||||| || ||||| ||||||
Sbjct: 1752 gcaatgtggtcagcgaggttctcgagcgggcccttcccggtgacgatggcctggacgaag 1693

                                                                        
Query: 234  aagccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctcc 293
            || || ||||||||||||||||| ||||| || ||||||| ||| || ||||||||||| 
Sbjct: 1692 aatccgaacatggagaacatggcgaggcggcccttcttgagctccttcaccttgagctca 1633

                                                                        
Query: 294  gcgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagt 353
            ||||| ||||| ||||| ||||| ||||| ||||||||||||||||| || || ||||| 
Sbjct: 1632 gcgaaggcctcggggtcgtcggcgaggcccagcgggtcgaagctgccgccgggatagagc 1573

                                                                        
Query: 354  ggatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatg 413
            || || || ||||| ||||| ||||| || || |||||||| || || ||||||||||||
Sbjct: 1572 gggtcgacgacctcgccgagcgggccgccggcgatgcggtagccctcgacggcgcccatg 1513

                                                                        
Query: 414  agcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttg 473
            |||||||| || || |||||||| || |||||||| || || || | |||||| ||||| 
Sbjct: 1512 agcacgacctggcaggcccagatggcgaggatgctctgcgcgtggatgaggctcgggttc 1453

                                                                        
Query: 474  ccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcc 533
            ||||||||||| || ||||| ||||||||||| |||||||| ||||||||||  || |||
Sbjct: 1452 ccgaggtagtccagtccaccctcgctgaagatctgggagccggccttgaacccaacggcc 1393

                                                                        
Query: 534  tcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccg 593
            || ||||||||||| || ||||| || || ||||| ||||||||||| |||||||| || 
Sbjct: 1392 tcgccgaacttgacgccgttgcgggcgagcagctccgggaagacgcaaccgagcgcgccc 1333

                                                          
Query: 594  agcatggcccaccttgcagtggatcacctcaagcttcccggttctt 639
            ||||||||||| |  | ||||||||||||| ||| |||||||||||
Sbjct: 1332 agcatggcccagc-gggagtggatcacctccagc-tcccggttctt 1289



to top

>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1664

 Score =  365 bits (184), Expect = 1e-97
 Identities = 441/524 (84%), Gaps = 2/524 (0%)
 Strand = Plus / Minus

                                                                        
Query: 116  tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
            |||||||||||| || ||||| |||||  | ||||| |||||||||||||| || |||||
Sbjct: 1247 tcacttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggc 1188

                                                                        
Query: 176  gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            ||| ||||| || ||||||||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 1187 gaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaa 1128

                                                                        
Query: 236  gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
            ||| ||||||||||||||||| ||||| || ||||||| ||  || ||||||||||||||
Sbjct: 1127 gccgaacatggagaacatggcgaggcggccgttcttgatcttcttcaccttgagctccgc 1068

                                                                        
Query: 296  gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
            | | ||||| ||||||||||| ||||||||||||||||||  ||| || ||||| || ||
Sbjct: 1067 gcacgcctcggggtcatcggcgaggccgagcgggtcgaaggcgccgccggggtacagcgg 1008

                                                                        
Query: 356  atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
             || || ||||| ||||| || || |||||||| |||||||| || ||||||||||||||
Sbjct: 1007 gtcgacgacctcgccgagcggcccgccagcaatccggtacccctcgacggcgcccatgag 948

                                                                        
Query: 416  cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
            ||| || ||    |||||||| || |||||||| || || || |  ||||| ||||||||
Sbjct: 947  caccacctgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgcc 888

                                                                        
Query: 476  gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
            |||||||||||| || || ||||||||||| || ||||| ||||||||||| || |||||
Sbjct: 887  gaggtagtcgagcccgccctcgctgaagatctgcgagcccgccttgaaccacacggcctc 828

                                                                        
Query: 536  accgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgag 595
             ||||||||||| || || || || || ||||| ||||||||||| |||||||| || ||
Sbjct: 827  gccgaacttgacgccgttccgggcgaggagctccgggaagacgcagccgagcgcgcccag 768

                                                        
Query: 596  catggcccaccttgcagtggatcacctcaagcttcccggttctt 639
            ||| |||||||  | ||||||||||||| ||| |||||||||||
Sbjct: 767  catcgcccacc-gggagtggatcacctccagc-tcccggttctt 726



to top

>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding
           protein
          Length = 869

 Score =  355 bits (179), Expect = 1e-94
 Identities = 413/491 (84%)
 Strand = Plus / Minus

                                                                       
Query: 114 cctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcg 173
           |||||||||||||| |||||||| |||||| | |||||||||||||||||||| || |||
Sbjct: 812 cctcacttgccgggcacaaagttggtggcataggcccatgcgttgttgttgacggggtcg 753

                                                                       
Query: 174 gcgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaag 233
           ||||| ||||| || ||||||||||| ||||||||||||||||| || ||||| ||||||
Sbjct: 752 gcgaggtggtcggcgaggttctcgagcgggcccttgccggtgacgatggcctggacgaag 693

                                                                       
Query: 234 aagccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctcc 293
           || || ||||||||||||||||| ||||| || ||||||| ||| || |||||||  |||
Sbjct: 692 aacccgaacatggagaacatggcgaggcggccgttcttgagctccttcaccttgacgtcc 633

                                                                       
Query: 294 gcgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagt 353
           ||||| ||||| ||||| ||||| |||||||||||||||||  |||| || |||||||| 
Sbjct: 632 gcgaaggcctcagggtcgtcggcgaggccgagcgggtcgaacgtgccgccggggtagagc 573

                                                                       
Query: 354 ggatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatg 413
           || || || ||||| ||||| ||||| || || | ||||||||| || | ||||||||||
Sbjct: 572 gggtcgacgacctctccgagcgggccgccggcgacgcggtacccctcgatggcgcccatg 513

                                                                       
Query: 414 agcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttg 473
           |||||||| || || |||||||| || |||||||| || || || |  ||||| ||||||
Sbjct: 512 agcacgacctggcaggcccagatggcgaggatgctctgcgcgtggatcaggctcgggttg 453

                                                                       
Query: 474 ccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcc 533
           ||||||||||| || ||||| ||||||||||| || || || ||||||||||| || |||
Sbjct: 452 ccgaggtagtccagcccaccctcgctgaagatctgcgacccggccttgaaccacacggcc 393

                                                                       
Query: 534 tcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccg 593
           || ||||||||||| || ||||| || || ||||| ||||| ||||| || | ||| || 
Sbjct: 392 tcgccgaacttgacgccgttgcgggcgagcagctccgggaacacgcagcccaacgcgccc 333

                      
Query: 594 agcatggccca 604
           |||||||||||
Sbjct: 332 agcatggccca 322



to top

>gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b binding protein
           3C-like mRNA, complete cds
          Length = 1055

 Score =  345 bits (174), Expect = 1e-91
 Identities = 430/514 (83%), Gaps = 1/514 (0%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| |||||||||||||| |||||||| ||||| ||||||||||| || || || |
Sbjct: 840 ctcactttccgggaacaaagtttgtggcaaaggcccaagcgttgttgttaactgggtcag 781

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | || ||||| ||||||||||| |  || ||||| |||||||||||||| || || ||||
Sbjct: 780 caaggtggtcggcaaggttctccaatggaccctttccggtgacaatagcttggacaaaga 721

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | |||||||| |||||||| ||||| |  ||||||||||  || || ||||||||||| |
Sbjct: 720 atccaaacatagagaacatagcaagtctgccattcttgatttccttaaccttgagctcag 661

                                                                       
Query: 295 cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
           | || |||||||||||||| || ||||| |  ||||| ||||| ||||||||||| ||||
Sbjct: 660 caaaagcctctgggtcatcagcaaggcccaatgggtcaaagctaccaccagggtaaagtg 601

                                                                       
Query: 355 gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
           | ||||| |||||||| || || ||||||||||| ||||| || |||||||| ||||| |
Sbjct: 600 ggtcaacaacctcaccaagaggcccaccagcaatacggtaaccctcaacggctcccatca 541

                                                                       
Query: 415 gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
            ||| ||||| || ||||||||||| | ||||||||||||||| || |  || |||||||
Sbjct: 540 acacaacttggcaagcccagatagccaagatgctttgtgcatggaccaaacttgggttgc 481

                                                                       
Query: 475 cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
           | | |||||| || ||||| |||||||| |||||||| || ||||||||||||||||| |
Sbjct: 480 ccaagtagtcaagtccaccctcgctgaaaatttgggatccagccttgaaccatacagctt 421

                                                                       
Query: 535 caccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccga 594
           | || |||||||| ||||| || || | |||||| |||||||| ||||| || ||||| |
Sbjct: 420 cgccaaacttgacaccattacgggccaaaagctcagggaagacacatccaagagcaccaa 361

                                             
Query: 595 gcatggcccaccttgcagtggatcacctcaagct 628
           |||||||||| | |||||||||||||||||||||
Sbjct: 360 gcatggcccatc-tgcagtggatcacctcaagct 328



to top

>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein
          Length = 934

 Score =  337 bits (170), Expect = 3e-89
 Identities = 409/486 (84%), Gaps = 2/486 (0%)
 Strand = Plus / Minus

                                                                       
Query: 120 ttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgaga 179
           |||||||| || ||||| |||||||| ||||| |||||||||||||| || |||||||  
Sbjct: 815 ttgccggggacgaagtttgtggcaaatgcccaagcgttgttgttgacggggtcggcgatg 756

                                                                       
Query: 180 tggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagcca 239
           |||||||| |||||||| || ||||||||||||||||| || ||||| || |  ||||||
Sbjct: 755 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaagaaagcca 696

                                                                       
Query: 240 aacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaat 299
           ||||| ||||||||||||||||| || ||||||| ||| || ||||||||| |  |||||
Sbjct: 695 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagcgcgtcgaat 636

                                                                       
Query: 300 gcctctgggtca-tcggctaggccgagcgggtcgaagctgccaccagggtagagtggatc 358
           || |  |||||  ||||| ||||| || ||||| || || ||||| |||||||| || ||
Sbjct: 635 gcttg-gggtcgctcggccaggccaagtgggtcaaaccttccacccgggtagagagggtc 577

                                                                       
Query: 359 aaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcac 418
            || | ||| ||||||||||| |||||||  |||||||| ||||| ||||||||||||||
Sbjct: 576 gacgatctcgccgagtgggccgccagcaacacggtacccctcaacagcgcccatgagcac 517

                                                                       
Query: 419 gacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgag 478
            || || || ||||| || ||||||||||| || ||||| |||||||| |||||||||||
Sbjct: 516 aacctggcaagcccaaatggcaaggatgctctgagcatggacgaggcttgggttgccgag 457

                                                                       
Query: 479 gtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcacc 538
           ||||||||||||||| |||||||||||||| ||||| ||||||||||| |||||||| ||
Sbjct: 456 gtagtcgaggccaccctcgctgaagatttgcgagccggccttgaaccagacagcctcgcc 397

                                                                       
Query: 539 gaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcat 598
           |||||| || |||||||| ||||| | ||| ||||| ||||| || || ||||| |||||
Sbjct: 396 gaacttcacgccattgcgggcaagcaactcagggaacacgcaacccagtgcaccaagcat 337

                 
Query: 599 ggccca 604
            |||||
Sbjct: 336 agccca 331



to top

>gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence
          Length = 958

 Score =  331 bits (167), Expect = 2e-87
 Identities = 436/523 (83%), Gaps = 2/523 (0%)
 Strand = Plus / Minus

                                                                       
Query: 123 ccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgagatgg 182
           ||||| |||||||| ||||| || ||||| || |||||||| || || || || || |||
Sbjct: 835 ccggggacaaagtttgtggcgaaagcccaggcattgttgtttacggggtctgcaaggtgg 776

                                                                       
Query: 183 tcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaac 242
           |||||||||||||| |  || ||||| |||||||||||||| || || ||||| ||||||
Sbjct: 775 tcagcaaggttctccaatggaccctttccggtgacaatagcttgaacaaagaatccaaac 716

                                                                       
Query: 243 atggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcc 302
           || |||||||| ||||| |  || ||||||| ||| |||||||||||||| || ||||||
Sbjct: 715 atagagaacatagcaagtctaccgttcttgatctcctttaccttgagctcagcaaatgcc 656

                                                                       
Query: 303 tctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaacc 362
           |||||||| || || ||||| |  ||||||||||||||||||||||||||||| || || 
Sbjct: 655 tctgggtcttcagcaaggcctaatgggtcgaagctgccaccagggtagagtgggtcgaca 596

                                                                       
Query: 363 acctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgact 422
           |||||||| || || ||||||||||| ||||| || ||||| || ||||| | ||| |||
Sbjct: 595 acctcaccaagaggtccaccagcaatacggtatccctcaacagctcccatcaacacaact 536

                                                                       
Query: 423 tgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtag 482
           || || |||||||| || | ||||||||||||||| || | ||| |||||||| | ||||
Sbjct: 535 tggcaagcccagatggccaagatgctttgtgcatggaccaagcttgggttgcccaagtag 476

                                                                       
Query: 483 tcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaac 542
           || || ||||| || |||||||| ||||| || ||||||||||| |||||||||||||||
Sbjct: 475 tcaagtccaccttcactgaagatctgggatccggccttgaaccacacagcctcaccgaac 416

                                                                       
Query: 543 ttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggcc 602
           ||||| ||||| || || |  ||||| |||||||| ||||| || ||||| ||||| |||
Sbjct: 415 ttgacaccattacgggccaagagctcagggaagacacatccaagagcaccaagcatagcc 356

                                                      
Query: 603 caccttgcagtggatcacctcaagcttcccggttctttgcaaa 645
           || | ||||||||||||||||||| ||| |||||||| |||||
Sbjct: 355 catc-tgcagtggatcacctcaag-ttcacggttcttggcaaa 315



to top

>gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene Cab-3C, complete cds
          Length = 1135

 Score =  329 bits (166), Expect = 7e-87
 Identities = 403/482 (83%)
 Strand = Plus / Minus

                                                                       
Query: 123 ccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgagatgg 182
           ||||| |||||||| ||||| || ||||| || ||||| ||||| || || |||||||||
Sbjct: 999 ccggggacaaagtttgtggcgaaggcccaagcattgttattgactgggtcagcgagatgg 940

                                                                       
Query: 183 tcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaac 242
           |||||||||||||| |  || ||||| |||||||| ||||| || || |||||||| |||
Sbjct: 939 tcagcaaggttctccaatggaccctttccggtgacgatagcttgaacaaagaagccgaac 880

                                                                       
Query: 243 atggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcc 302
           ||||||||||| ||||| |  |||||||| | |||||| ||||||||||| ||||| |||
Sbjct: 879 atggagaacatagcaagtctaccattcttaatctctttcaccttgagctcagcgaaagcc 820

                                                                       
Query: 303 tctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaacc 362
           ||||||||||| ||  |||| || ||||| ||||| ||||||||||||||||| ||||| 
Sbjct: 819 tctgggtcatcagcagggcccagtgggtcaaagctaccaccagggtagagtgggtcaaca 760

                                                                       
Query: 363 acctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgact 422
           |||||||| || || ||||||||||| ||||| || |||||||| ||||| | ||| |||
Sbjct: 759 acctcaccaagaggcccaccagcaatacggtaaccctcaacggctcccatcaacacaact 700

                                                                       
Query: 423 tgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtag 482
           || || ||||||||||| |  |||||||||||||| || | ||| ||||| || | ||||
Sbjct: 699 tggcaagcccagatagccaaaatgctttgtgcatggaccaagcttgggtttcccaagtag 640

                                                                       
Query: 483 tcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaac 542
           || || ||||| |||||||| ||||| || || ||||||||||||||||| |||||||||
Sbjct: 639 tcaagtccaccctcgctgaaaatttgtgatccagccttgaaccatacagcttcaccgaac 580

                                                                       
Query: 543 ttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggcc 602
           || || ||||| || || | |||||||||||| || ||||| || ||||| |||||||||
Sbjct: 579 ttaacaccattacgggccaaaagctcggggaatacacatccaagagcaccaagcatggcc 520

             
Query: 603 ca 604
           ||
Sbjct: 519 ca 518



to top

>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA,
           complete cds
          Length = 1022

 Score =  327 bits (165), Expect = 3e-86
 Identities = 437/525 (83%), Gaps = 2/525 (0%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||||||||| |||||||| |||||  | |||||||||||||||||||| || ||||
Sbjct: 841 ctcacttgccggggacaaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 782

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           |||| ||||| |  | |||||| || || |||||||||||||| || ||||| || || |
Sbjct: 781 cgaggtggtctgtgatgttctccagtggccccttgccggtgacgatggcctggacaaaaa 722

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | || |||||||| |||||||| ||||| || ||||||| ||| || ||||||||||| |
Sbjct: 721 acccgaacatggataacatggcgaggcggccgttcttgatctccttcaccttgagctcgg 662

                                                                       
Query: 295 cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
           |||| ||||| ||||| ||||| |||||||||||||| || ||||| || |||||||| |
Sbjct: 661 cgaacgcctcggggtcgtcggcgaggccgagcgggtctaaactgccgccggggtagagcg 602

                                                                       
Query: 355 gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
           | || || ||||| ||||| ||||| || || | ||||||||| || |||||||||||||
Sbjct: 601 ggtcgacaacctccccgagcgggccgccggcgacgcggtacccctcgacggcgcccatga 542

                                                                       
Query: 415 gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
            |||||| || ||  |||| || || |||||||| || || || |  ||||| |||||||
Sbjct: 541 acacgacctggcaaccccaaatcgccaggatgctctgcgcgtggatcaggctggggttgc 482

                                                                       
Query: 475 cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
           ||||||||||||| || || ||||||||||| ||||| || ||||||||||| || ||||
Sbjct: 481 cgaggtagtcgagccccccctcgctgaagatctgggaccccgccttgaaccacacggcct 422

                                                                       
Query: 535 caccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccga 594
           | |||||||| || || ||||| || || ||||| ||||||||||| |||||||| || |
Sbjct: 421 cgccgaacttcacgccgttgcgggcgaggagctccgggaagacgcagccgagcgcgccca 362

                                                        
Query: 595 gcatggcccaccttgcagtggatcacctcaagcttcccggttctt 639
           ||||||||||||  ||||||||||||||| ||| |||||||||||
Sbjct: 361 gcatggcccacc-ggcagtggatcacctccagc-tcccggttctt 319



to top

>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds
          Length = 1633

 Score =  323 bits (163), Expect = 4e-85
 Identities = 444/535 (82%), Gaps = 2/535 (0%)
 Strand = Plus / Minus

                                                                        
Query: 115  ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
            ||||||||||||| || ||||| ||||| || ||||| |||||||||||||| || ||||
Sbjct: 1196 ctcacttgccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcgg 1137

                                                                        
Query: 175  cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
            |||||||||| || | |||||||||||||||||| |||||||| || |||||||||||||
Sbjct: 1136 cgagatggtccgccaagttctcgagggggcccttcccggtgacgatggcctgcacgaaga 1077

                                                                        
Query: 235  agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
            | || ||||||||||||||||| ||||| || ||||||| ||| || ||||| |||||||
Sbjct: 1076 acccgaacatggagaacatggccaggcgtccgttcttgatctccttcaccttcagctccg 1017

                                                                        
Query: 295  cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
            | || ||||| ||||| ||||| || || ||||||||||||||||| || ||||| || |
Sbjct: 1016 caaaggcctcggggtcgtcggccagccccagcgggtcgaagctgccgccggggtacagcg 957

                                                                        
Query: 355  gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
            | || || ||||| || || || || || || | |||||| ||||| |||||||||||||
Sbjct: 956  ggtcgacgacctcgcccagaggcccgccggccacgcggtagccttcgacggcgcccatga 897

                                                                        
Query: 415  gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
            | || || ||    |||||||| || |||||||| || || ||||| ||||| |||||||
Sbjct: 896  ggaccacctgcgtggcccagatggccaggatgctctgcgcgtgcaccaggctggggttgc 837

                                                                        
Query: 475  cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
            | |||||||| || || || ||||||||||| || || || ||||||||||| || ||||
Sbjct: 836  ccaggtagtccagccccccctcgctgaagatctgcgaacccgccttgaaccacacggcct 777

                                                                        
Query: 535  caccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccga 594
            | || ||||| || || |||||||| || ||||| ||||| ||||| || ||||| ||||
Sbjct: 776  cgccaaacttcacgccgttgcgcgccagcagctccgggaacacgcagcccagcgcgccga 717

                                                                   
Query: 595  gcatggcccaccttgcagtggatcacctcaagcttcccggttctttgcaaaggtc 649
            ||||||||||||  || |||||||||||| ||| ||||||||||| || ||||||
Sbjct: 716  gcatggcccaccgcgc-gtggatcacctccagc-tcccggttcttggcgaaggtc 664



to top

>gb|M14443.1|TOMCBPA Tomato chlorophyll a/b-binding protein gene Cab-1B, complete cds
          Length = 1253

 Score =  315 bits (159), Expect = 1e-82
 Identities = 434/523 (82%), Gaps = 2/523 (0%)
 Strand = Plus / Minus

                                                                       
Query: 123 ccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgagatgg 182
           ||||| |||||||| ||||| || ||||| || |||||||| || || || || || || 
Sbjct: 981 ccggggacaaagtttgtggcgaaagcccaggcattgttgtttacggggtctgcaaggtga 922

                                                                       
Query: 183 tcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaac 242
           |||||||||||||| |  || ||||| |||||||||||||| || || ||||| ||||||
Sbjct: 921 tcagcaaggttctccaatggaccctttccggtgacaatagcttgaacaaagaatccaaac 862

                                                                       
Query: 243 atggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcc 302
           || |||||||| ||||| |  || ||||||| ||| |||||||||||||| || ||||||
Sbjct: 861 atagagaacatagcaagtctaccgttcttgatctcctttaccttgagctcagcaaatgcc 802

                                                                       
Query: 303 tctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaacc 362
           |||||||| || || ||||| |  ||||||||||||||||||||||||||||| || || 
Sbjct: 801 tctgggtcttcagcaaggcctaatgggtcgaagctgccaccagggtagagtgggtcgaca 742

                                                                       
Query: 363 acctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgact 422
           |||||||| || || ||||||||||| ||||| || ||||| || ||||| | ||| |||
Sbjct: 741 acctcaccaagaggtccaccagcaatacggtaaccctcaacagctcccatcaacacaact 682

                                                                       
Query: 423 tgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtag 482
           || || |||||||| || | ||||||||||||||| || | ||| |||||||| | ||||
Sbjct: 681 tggcaagcccagatggccaagatgctttgtgcatggaccaagcttgggttgcccaagtag 622

                                                                       
Query: 483 tcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaac 542
           || || ||||| || |||||||| ||||| || ||||||||||| |||||||||||||||
Sbjct: 621 tcaagtccaccttcactgaagatctgggatccggccttgaaccacacagcctcaccgaac 562

                                                                       
Query: 543 ttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggcc 602
           ||||| ||||| || || |  ||||| |||||||| ||||| || ||||| ||||| |||
Sbjct: 561 ttgacaccattacgggccaagagctcagggaagacacatccaagagcaccaagcatagcc 502

                                                      
Query: 603 caccttgcagtggatcacctcaagcttcccggttctttgcaaa 645
           || | ||||||||||||| ||||| ||| |||||||| |||||
Sbjct: 501 catc-tgcagtggatcacttcaag-ttcacggttcttggcaaa 461



to top

>gb|U21113.1|STU21113 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-4) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  307 bits (155), Expect = 2e-80
 Identities = 433/523 (82%), Gaps = 2/523 (0%)
 Strand = Plus / Minus

                                                                       
Query: 126 ggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgagatggtca 185
           ||||||||||| |||||  | ||||| || |||||||| || || || || || ||||||
Sbjct: 788 ggaacaaagtttgtggcgtaggcccaggcattgttgttaacggggtctgcaaggtggtca 729

                                                                       
Query: 186 gcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaacatg 245
           ||||||||||| |  || ||||| ||||| ||||| ||||| || ||||| |||||||| 
Sbjct: 728 gcaaggttctccaatggaccctttccggtaacaatggcctgaacaaagaatccaaacata 669

                                                                       
Query: 246 gagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcctct 305
           |||||||| ||||| |  || ||||||| ||| |||||||||||||| || |||||||||
Sbjct: 668 gagaacatagcaagtctaccgttcttgatctcctttaccttgagctcagcaaatgcctct 609

                                                                       
Query: 306 gggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaaccacc 365
           |||||||| || ||||| | |||||| ||||||||||| ||||||||||| || |  |||
Sbjct: 608 gggtcatcagcaaggcctaacgggtcaaagctgccaccggggtagagtgggtcgataacc 549

                                                                       
Query: 366 tcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgacttga 425
           ||||| || || ||||||||||| ||||| || |||||||| ||||| | ||| ||||| 
Sbjct: 548 tcaccaagaggtccaccagcaatacggtatccctcaacggctcccatcaacacaacttgg 489

                                                                       
Query: 426 catgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtagtcg 485
           || ||||| || || ||||||||||||||||| || | ||| ||||| || | |||||| 
Sbjct: 488 caagcccaaatggccaggatgctttgtgcatggaccaagcttgggttccccaagtagtca 429

                                                                       
Query: 486 aggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaacttg 545
           || ||||| ||||||||||| ||||| || ||||||||||| ||||||||||| ||||||
Sbjct: 428 agtccaccctcgctgaagatctgggatccggccttgaaccacacagcctcaccaaacttg 369

                                                                       
Query: 546 actccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggcccac 605
           || || || || || |  ||||| |||||||| ||||| || ||||| ||||| ||||||
Sbjct: 368 acaccgttacgggccaagagctcagggaagacacatccaagagcaccaagcatagcccac 309

                                                      
Query: 606 cttgcagtggatcacctcaagcttcccggttctttgcaaaggt 648
           | |||||||||||||||| || ||| |||||||| ||||||||
Sbjct: 308 c-tgcagtggatcacctctag-ttcacggttcttggcaaaggt 268



to top

>gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-2) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  307 bits (155), Expect = 2e-80
 Identities = 436/527 (82%), Gaps = 2/527 (0%)
 Strand = Plus / Minus

                                                                       
Query: 123 ccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgagatgg 182
           |||||||||||||| |||||||| |||||||| ||||||||||| ||||| || || |||
Sbjct: 791 ccgggaacaaagtttgtggcaaaggcccatgcattgttgttgactggatctgcaaggtgg 732

                                                                       
Query: 183 tcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaac 242
           |||||||| ||||| |  || ||||| ||||| ||||| || || |||||||| ||||||
Sbjct: 731 tcagcaagattctccaatggaccctttccggtaacaatggcttgaacgaagaatccaaac 672

                                                                       
Query: 243 atggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcc 302
           || |||||||| ||||| |  || ||||| | ||| ||||| |||||||| || ||||||
Sbjct: 671 atagagaacatagcaagtctgccgttcttaatctcctttactttgagctcagcaaatgcc 612

                                                                       
Query: 303 tctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaacc 362
           ||||| ||||| || || || |  ||||| || |||||||||||||||||||| || || 
Sbjct: 611 tctggatcatcagcaagacctaatgggtcaaaactgccaccagggtagagtgggtcgacg 552

                                                                       
Query: 363 acctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgact 422
           |||||||| || || ||||| ||||| ||||| || ||||| || ||||| | ||| |||
Sbjct: 551 acctcaccaagaggtccacctgcaatacggtatccctcaacagctcccattaacacaact 492

                                                                       
Query: 423 tgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtag 482
           || || ||||| || || | ||||||||||||||| || | ||| |||||||| | ||||
Sbjct: 491 tggcaagcccaaatggccaagatgctttgtgcatggaccaagcttgggttgcccaagtag 432

                                                                       
Query: 483 tcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaac 542
           || || ||||| ||||||||||| ||||| || ||||||||||| |||||||||||||||
Sbjct: 431 tcaagtccaccctcgctgaagatctgggatccggccttgaaccacacagcctcaccgaac 372

                                                                       
Query: 543 ttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggcc 602
           ||||| || || || || |  ||||| |||||||| ||||| || ||||| ||||| |||
Sbjct: 371 ttgacaccgttacgggccaagagctcagggaagacacatccaagagcaccaagcatagcc 312

                                                          
Query: 603 caccttgcagtggatcacctcaagcttcccggttctttgcaaaggtc 649
           || | ||||||||||||||||||| ||| |||||||| |||||||||
Sbjct: 311 catc-tgcagtggatcacctcaag-ttcacggttcttggcaaaggtc 267



to top

>gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-3 gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  297 bits (150), Expect = 2e-77
 Identities = 434/526 (82%), Gaps = 2/526 (0%)
 Strand = Plus / Minus

                                                                       
Query: 123 ccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgagatgg 182
           ||||| |||||||| |||||| | | ||| ||||||||||| || || || || || |||
Sbjct: 791 ccggggacaaagtttgtggcataagaccaggcgttgttgttaacggggtctgcaaggtgg 732

                                                                       
Query: 183 tcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaac 242
           |||||||||||||| |  || ||||| ||||| ||||| || || |||||||| ||||||
Sbjct: 731 tcagcaaggttctccaatggaccctttccggtaacaatggcttgaacgaagaatccaaac 672

                                                                       
Query: 243 atggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcc 302
           || |||||||| ||||| |  |||||||||| ||| |||||||||||||| || ||||||
Sbjct: 671 atagagaacatagcaagtctaccattcttgatctcctttaccttgagctcagcaaatgcc 612

                                                                       
Query: 303 tctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaacc 362
           ||||||||||| || || || |  ||||||||||||||||| ||||||||||| |  || 
Sbjct: 611 tctgggtcatcagcaagacccaatgggtcgaagctgccaccggggtagagtgggttgaca 552

                                                                       
Query: 363 acctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgact 422
           |||||||| || || ||||||||||| ||||| ||||||||||| ||||| | ||| |||
Sbjct: 551 acctcaccaagaggtccaccagcaatacggtaaccttcaacggctcccatcaacacaact 492

                                                                       
Query: 423 tgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtag 482
           || || |||||||| || | ||||||||||||||| || |  || ||||| || | ||||
Sbjct: 491 tggcaagcccagatggccaagatgctttgtgcatggaccaaacttgggtttcccaagtag 432

                                                                       
Query: 483 tcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaac 542
           || || ||||| || | |||||||||||| || || |||||||| |||||||||||||||
Sbjct: 431 tcaagtccaccctcacggaagatttgggatccagctttgaaccacacagcctcaccgaac 372

                                                                       
Query: 543 ttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggcc 602
           ||||| || || || || |  ||||| |||||||| ||||| || ||||| ||||| |||
Sbjct: 371 ttgacaccgttacgggccaagagctcagggaagacacatccaagagcaccaagcatagcc 312

                                                         
Query: 603 caccttgcagtggatcacctcaagcttcccggttctttgcaaaggt 648
           || | |||||||||||||||| || ||| |||||||| ||||||||
Sbjct: 311 catc-tgcagtggatcacctcgag-ttcacggttcttggcaaaggt 268



to top

>gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-1) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  297 bits (150), Expect = 2e-77
 Identities = 434/526 (82%), Gaps = 2/526 (0%)
 Strand = Plus / Minus

                                                                       
Query: 123 ccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgagatgg 182
           ||||| |||||||| ||||| || ||||| ||||||||||| || || || || || |||
Sbjct: 791 ccggggacaaagtttgtggcgaaagcccaagcgttgttgttaacggggtctgcaaggtgg 732

                                                                       
Query: 183 tcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaac 242
           |||||||||||||| |  || ||||| ||||| ||||| ||||| |||||||| ||||||
Sbjct: 731 tcagcaaggttctccaatggaccctttccggtaacaatggcctgaacgaagaatccaaac 672

                                                                       
Query: 243 atggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcc 302
           || |||||||| ||||| |  || ||||| | ||| |||||||||||||| || ||||||
Sbjct: 671 atagagaacatagcaagtctgccgttcttaatctcctttaccttgagctcagcaaatgcc 612

                                                                       
Query: 303 tctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaacc 362
           || ||||| || || ||||| |  ||||| ||||||||||||||||||||||| || || 
Sbjct: 611 tccgggtcttcagcaaggcctaatgggtcaaagctgccaccagggtagagtgggtcgaca 552

                                                                       
Query: 363 acctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgact 422
           |||||||| || || ||||||||||| ||||| ||||||||||| ||||| |  || |||
Sbjct: 551 acctcaccaagaggtccaccagcaatacggtaaccttcaacggctcccatcaagacaact 492

                                                                       
Query: 423 tgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtag 482
           || || |||||||| || | |||||| |||||||| || | ||| |||||||| | ||||
Sbjct: 491 tggcaagcccagatggccaagatgctctgtgcatggaccaagcttgggttgcccaagtag 432

                                                                       
Query: 483 tcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaac 542
           || || || || ||||||||||| ||||| || ||||||||||| |||||||||||||||
Sbjct: 431 tcaagtcctccctcgctgaagatctgggatccggccttgaaccacacagcctcaccgaac 372

                                                                       
Query: 543 ttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggcc 602
           ||||| || || || |  |  ||||| |||||||| ||||| || ||||| ||||| |||
Sbjct: 371 ttgacaccgttacgggacaatagctcagggaagacacatccaagagcaccaagcattgcc 312

                                                         
Query: 603 caccttgcagtggatcacctcaagcttcccggttctttgcaaaggt 648
           || | |||||||||||||||| || ||| |||||||| ||||||||
Sbjct: 311 catc-tgcagtggatcacctcgag-ttcacggttcttggcaaaggt 268



to top

>emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/b binding protein
          Length = 1025

 Score =  293 bits (148), Expect = 4e-76
 Identities = 419/508 (82%), Gaps = 1/508 (0%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||| ||||||||||||||||||||| | | ||| ||||||||||| || || || ||
Sbjct: 859 tcactttccgggaacaaagttagtggcataagaccaggcgttgttgttaaccgggtcagc 800

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            || ||||||||||||||||| |  || ||||| |||||||| |||||||| || |||||
Sbjct: 799 aaggtggtcagcaaggttctccaatggaccctttccggtgacgatagcctgaacaaagaa 740

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
            ||||||||||||||||| ||||| |  ||||||||||  || |||||||||||||| ||
Sbjct: 739 tccaaacatggagaacatagcaagtctaccattcttgatttcctttaccttgagctcagc 680

                                                                       
Query: 296 gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
           ||| |||||||| || || || ||||| |  ||||||||||||||||| ||||| |||||
Sbjct: 679 gaaagcctctggatcttcagcaaggcccaatgggtcgaagctgccaccggggtaaagtgg 620

                                                                       
Query: 356 atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
            ||||| ||||||||||| || ||||||||||  ||||| || || || || ||||| | 
Sbjct: 619 gtcaacaacctcaccgagaggtccaccagcaacacggtaaccctcgacagctcccatcaa 560

                                                                       
Query: 416 cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
           ||| ||||| || ||||| || || | |||||||||||| || || |  || ||||||||
Sbjct: 559 cacaacttggcaagcccaaatggccaagatgctttgtgcgtggaccaaacttgggttgcc 500

                                                                       
Query: 476 gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
            | |||||| || ||||| ||||| || |||||||| || ||||||||||||||||| ||
Sbjct: 499 caagtagtcaagtccaccctcgctaaaaatttgggatccagccttgaaccatacagcttc 440

                                                                       
Query: 536 accgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgag 595
           |||||||||||| ||||| || || |  || ||||||||||| || || || || || ||
Sbjct: 439 accgaacttgacaccattacgtgccaagagttcggggaagacacaaccaagagctccaag 380

                                       
Query: 596 catggcccaccttgcagtggatcacctc 623
           ||||||||| | ||||||||||||||||
Sbjct: 379 catggcccatc-tgcagtggatcacctc 353



to top

>dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-E02, full
           insert sequence
          Length = 650

 Score =  291 bits (147), Expect = 1e-75
 Identities = 327/387 (84%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||||||||| || ||||| |||||  | ||||| |||||||||||||| || ||||
Sbjct: 387 ctcacttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcgg 328

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           |||| ||||| || ||||||||||||||||||||||||||||| || ||||| |||||| 
Sbjct: 327 cgaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagc 268

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           |||| ||| ||||||||||||| ||||| || ||||||| ||| || |||||||||||||
Sbjct: 267 agccgaacctggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccg 208

                                                                       
Query: 295 cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
           |||| ||||| ||||| ||||| ||||||||||||||||||||||| || |||||||| |
Sbjct: 207 cgaaggcctccgggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcg 148

                                                                       
Query: 355 gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
           | || || ||||| ||||| || || || || ||||||||||| || |||||||||||||
Sbjct: 147 ggtcgacgacctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatga 88

                                                                       
Query: 415 gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
           |||| || ||    |||||||| || |||||||| || || || |  ||||| |||||||
Sbjct: 87  gcaccacctggaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgc 28

                                      
Query: 475 cgaggtagtcgaggccaccgtcgctga 501
           ||||||||||||| || || |||||||
Sbjct: 27  cgaggtagtcgagcccgccctcgctga 1



to top

>gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-5) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  289 bits (146), Expect = 6e-75
 Identities = 433/526 (82%), Gaps = 2/526 (0%)
 Strand = Plus / Minus

                                                                       
Query: 123 ccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgagatgg 182
           |||||||||||||| |||||| | | ||| ||||||||||| || || || || || |||
Sbjct: 791 ccgggaacaaagtttgtggcataagaccaggcgttgttgttaacggggtctgcaaggtgg 732

                                                                       
Query: 183 tcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaac 242
           || ||||||||||| |  || ||||| ||||| ||||| ||||| |||||||| ||||||
Sbjct: 731 tctgcaaggttctccaatggaccctttccggtaacaattgcctgaacgaagaatccaaac 672

                                                                       
Query: 243 atggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcc 302
           || |||||||| ||||| |  || ||||| | ||| |||||||||||||| || ||||||
Sbjct: 671 atagagaacatagcaagtctgccgttcttaatctcctttaccttgagctcagcaaatgcc 612

                                                                       
Query: 303 tctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaacc 362
           || ||||| || || ||||| |  ||||||||||||||||||||||||||||| || || 
Sbjct: 611 tccgggtcttcagcaaggcctaatgggtcgaagctgccaccagggtagagtgggtcgaca 552

                                                                       
Query: 363 acctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgact 422
           |||||||| || || ||||||||||| ||||| |||||||| || ||||| |  || |||
Sbjct: 551 acctcaccaagaggtccaccagcaatacggtaaccttcaacagctcccatcaagacaact 492

                                                                       
Query: 423 tgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtag 482
           || || |||||||| || | |||||| |||||||| || | ||| |||||||| | ||||
Sbjct: 491 tggcaagcccagatggccaagatgctctgtgcatggaccaagcttgggttgcccaagtag 432

                                                                       
Query: 483 tcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaac 542
           || || ||||| ||||||||||| ||||| || ||||||||||| ||  |||||||||||
Sbjct: 431 tcaagtccaccctcgctgaagatctgggatccggccttgaaccacacgacctcaccgaac 372

                                                                       
Query: 543 ttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggcc 602
           ||||| || || || || |  ||||| |||||||| ||||| || ||||| ||||| |||
Sbjct: 371 ttgacaccgttacgggccaatagctcagggaagacacatccaagagcaccaagcattgcc 312

                                                         
Query: 603 caccttgcagtggatcacctcaagcttcccggttctttgcaaaggt 648
           || | |||||||||||||||| || ||| |||||||| ||||||||
Sbjct: 311 catc-tgcagtggatcacctcgag-ttcacggttcttggcaaaggt 268



to top

>gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast chlorophyll a/b binding
           protein mRNA, complete cds
          Length = 997

 Score =  289 bits (146), Expect = 6e-75
 Identities = 423/514 (82%), Gaps = 1/514 (0%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           |||| |||||||| || ||||| ||||| || ||||| |||||||||||||| || ||||
Sbjct: 872 ctcatttgccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcgg 813

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           |||| ||||| || |||||||||| |||||| ||||||||||| || ||||| |||||||
Sbjct: 812 cgaggtggtcggcgaggttctcgatggggcctttgccggtgacgatggcctggacgaaga 753

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | || ||||||||||||||||| ||||| || ||||||| ||| || ||||| || || |
Sbjct: 752 aaccgaacatggagaacatggccaggcggccgttcttgagctccttaaccttcagttcgg 693

                                                                       
Query: 295 cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
           |||| || || ||||| ||||| ||||| |  ||||||||||||||||| || ||||  |
Sbjct: 692 cgaaggcatcggggtcgtcggccaggcccaaggggtcgaagctgccacctggatagatgg 633

                                                                       
Query: 355 gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
           | ||    | ||| ||||||||||| |||||||||||||| || || ||||| |||||||
Sbjct: 632 ggtcggtaatctcgccgagtgggccgccagcaatgcggtagccctcgacggctcccatga 573

                                                                       
Query: 415 gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
           | | ||| || || |||||||| || || ||||| || || || | |||||| |||||||
Sbjct: 572 ggatgacctggcaggcccagatggcgagaatgctctgggcgtggatgaggcttgggttgc 513

                                                                       
Query: 475 cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
           | |||||||||||||| |||||||||||||| || ||||| ||||||||||| |||||||
Sbjct: 512 ccaggtagtcgaggccgccgtcgctgaagatctgagagcccgccttgaaccagacagcct 453

                                                                       
Query: 535 caccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccga 594
           | ||||||||||| || ||||| |  || ||||| ||||||||||| || || || || |
Sbjct: 452 cgccgaacttgacgccgttgcgggagagcagctccgggaagacgcagcccagggctccca 393

                                             
Query: 595 gcatggcccaccttgcagtggatcacctcaagct 628
            ||| |||||||  | ||||||||||||| ||||
Sbjct: 392 acatcgcccaccgcg-agtggatcacctccagct 360



to top

>emb|X52743.1|NTCAB21 Tabacco Cab21 mRNA for major chlorophyll a/b binding protein
          Length = 953

 Score =  287 bits (145), Expect = 2e-74
 Identities = 438/533 (82%), Gaps = 2/533 (0%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||| ||||| |||||||| |||||  | ||||| || |||||||| || || || ||
Sbjct: 860 tcactttccggggacaaagtttgtggcgtatgcccaagcattgttgttaactgggtctgc 801

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            |||||||||||||||||||| |  || || || || || ||||| ||||| || |||||
Sbjct: 800 aagatggtcagcaaggttctccaatggaccttttccagtaacaatggcctgaacaaagaa 741

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
            || ||||| |||||||||||||| |  || ||||| | ||| |||||||||||||| ||
Sbjct: 740 tccgaacatagagaacatggcaagtcttccgttcttaatctcctttaccttgagctcagc 681

                                                                       
Query: 296 gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
            |||||||||||||| || || ||||| || ||||| |||||||||||||||||||||||
Sbjct: 680 aaatgcctctgggtcctcagcgaggcccagtgggtcaaagctgccaccagggtagagtgg 621

                                                                       
Query: 356 atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
            || || |||||||| || || ||||||||||  ||||| || |||||||| ||||| | 
Sbjct: 620 gtcgacaacctcaccaagaggcccaccagcaacacggtaaccctcaacggctcccatcaa 561

                                                                       
Query: 416 cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
            |  ||||| || |||||||| || | ||||||||||||||| || | ||| ||||||||
Sbjct: 560 gataacttggcaagcccagatggccaagatgctttgtgcatggaccaagcttgggttgcc 501

                                                                       
Query: 476 gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
            | |||||| || ||||| ||||| ||||||||||| || ||||||||||| ||||||||
Sbjct: 500 caagtagtcaagtccaccctcgctaaagatttgggatccagccttgaaccacacagcctc 441

                                                                       
Query: 536 accgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgag 595
            || |||||||| ||||| || || |  |||||||||||||| ||||| || ||||| ||
Sbjct: 440 gccaaacttgacaccattacgggccaagagctcggggaagacacatccaagagcaccaag 381

                                                                
Query: 596 catggcccaccttgcagtggatcacctcaagcttcccggttctttgcaaaggt 648
           ||| ||||| | |||||||||||||||| || ||| |||||||| ||||||||
Sbjct: 380 catagcccatc-tgcagtggatcacctcgag-ttcacggttcttggcaaaggt 330



to top

>gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab-E) gene, complete cds
          Length = 1815

 Score =  285 bits (144), Expect = 9e-74
 Identities = 418/508 (82%), Gaps = 1/508 (0%)
 Strand = Plus / Minus

                                                                        
Query: 116  tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
            |||||| ||||||||||||||||||||| | | ||| ||||||||||| || || || ||
Sbjct: 1779 tcactttccgggaacaaagttagtggcataagaccaggcgttgttgttaaccgggtcagc 1720

                                                                        
Query: 176  gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
             || ||||||||||||||||| |  || ||||| |||||||| | |||||| || |||||
Sbjct: 1719 aaggtggtcagcaaggttctccaatggaccctttccggtgacgagagcctgaacaaagaa 1660

                                                                        
Query: 236  gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
             ||||||||||||||||| ||||| |  ||||||||||  || |||||||||||||| ||
Sbjct: 1659 tccaaacatggagaacatagcaagtctaccattcttgatttcctttaccttgagctcagc 1600

                                                                        
Query: 296  gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
            ||| |||||||| || || || ||||| |  ||||||||||||||||| ||||| |||||
Sbjct: 1599 gaaagcctctggatcttcagcaaggcccaatgggtcgaagctgccaccggggtaaagtgg 1540

                                                                        
Query: 356  atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
             ||||| ||||||||||| ||  |||||||||  ||||| ||||| || || ||||| | 
Sbjct: 1539 gtcaacaacctcaccgagaggttcaccagcaacacggtaaccttcgacagctcccatcaa 1480

                                                                        
Query: 416  cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
            ||| ||||| || ||||| || || | |||||||||||| || || |  || ||||||||
Sbjct: 1479 cacaacttggcaagcccaaatggccaagatgctttgtgcgtggaccaaacttgggttgcc 1420

                                                                        
Query: 476  gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
             | |||||| || ||||| ||||| || |||||||| || ||||||||||||||||| ||
Sbjct: 1419 caagtagtcaagtccaccctcgctaaaaatttgggatccagccttgaaccatacagcttc 1360

                                                                        
Query: 536  accgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgag 595
            |||||||||||| ||||| || || |  || ||||||||||| || || || || || ||
Sbjct: 1359 accgaacttgacaccattacgtgccaagagttcggggaagacacaaccaagagctccaag 1300

                                        
Query: 596  catggcccaccttgcagtggatcacctc 623
            ||||||||| | ||||||||||||||||
Sbjct: 1299 catggcccatc-tgcagtggatcacctc 1273



to top

>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds
          Length = 695

 Score =  281 bits (142), Expect = 1e-72
 Identities = 426/518 (82%), Gaps = 2/518 (0%)
 Strand = Plus / Minus

                                                                       
Query: 132 aagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgagatggtcagcaagg 191
           ||||| ||||| || ||||| |||||||||||||| || || ||||| ||||| || | |
Sbjct: 693 aagttggtggcgaaggcccaggcgttgttgttgacggggtcagcgaggtggtcggccaag 634

                                                                       
Query: 192 ttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaacatggagaac 251
           ||||||||||| ||||||||||| || || ||||| |||||||| || ||||||||||||
Sbjct: 633 ttctcgaggggtcccttgccggtcacgatggcctggacgaagaatccgaacatggagaac 574

                                                                       
Query: 252 atggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcctctgggtca 311
           || || || || || ||||||| ||| || ||||| ||||||||||| || || ||||| 
Sbjct: 573 atcgccagccgtccgttcttgatctccttcaccttcagctccgcgaaggcttccgggtcg 514

                                                                       
Query: 312 tcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaaccacctcaccg 371
           || || || || |||||||||||||| || || ||||| || || || || ||||| |||
Sbjct: 513 tccgccagccccagcgggtcgaagctcccgcccgggtacagcgggtcgacgacctctccg 454

                                                                       
Query: 372 agtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgacttgacatgcc 431
           || || || || || |  | ||| || || |||||||||||||| | ||| ||    |||
Sbjct: 453 agcggcccgcccgccactctgtagccctcgacggcgcccatgaggatgacctgggtggcc 394

                                                                       
Query: 432 cagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgaggcca 491
           ||||| || |||||||| || || ||||| ||||| ||||| |||||||||||||| || 
Sbjct: 393 cagatggcgaggatgctctgcgcgtgcaccaggctggggttcccgaggtagtcgagcccg 334

                                                                       
Query: 492 ccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaacttgactcca 551
           || ||||||||||| |||||||| ||||||||||| || ||||| ||||||||||| || 
Sbjct: 333 ccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacgccg 274

                                                                       
Query: 552 ttgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggcccaccttgca 611
           ||||| || || ||||||||||||||||| |||||||| ||||||||||||||||| || 
Sbjct: 273 ttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccacctcgc- 215

                                                 
Query: 612 gtggatcacctcaagcttcccggttctttgcaaaggtc 649
           |||||||||||| ||| || |||||||| || ||||||
Sbjct: 214 gtggatcacctccagc-tcgcggttcttggcgaaggtc 178



to top

>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor
          Length = 2780

 Score =  280 bits (141), Expect = 6e-72
 Identities = 390/473 (82%)
 Strand = Plus / Minus

                                                                        
Query: 115  ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
            ||||||||||||| || ||||| |||||  | ||||| |||||||||||||| || ||||
Sbjct: 2722 ctcacttgccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcgg 2663

                                                                        
Query: 175  cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
             ||| ||||| || |||||||||| |||||||||||||||||| ||||||||||||||||
Sbjct: 2662 tgaggtggtcggcgaggttctcgatggggcccttgccggtgacgatagcctgcacgaaga 2603

                                                                        
Query: 235  agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
            |||| ||||||||||||||||| ||||| || ||||||| ||| || ||||||||||| |
Sbjct: 2602 agccgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcgg 2543

                                                                        
Query: 295  cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
            ||||   ||| ||||| ||| | || |||||||||||||||||||| ||  |||| || |
Sbjct: 2542 cgaaccgctccgggtcgtcgccgagcccgagcgggtcgaagctgccgcccaggtacagcg 2483

                                                                        
Query: 355  gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
            | || |||||||| |||||  |||| || || |   ||||||| || |||||||||||||
Sbjct: 2482 ggtcgaccacctccccgagccggccgccggcgacatggtacccctcgacggcgcccatga 2423

                                                                        
Query: 415  gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
            |||| || || || ||||||||||| |||||||| || || || || ||||| |||||||
Sbjct: 2422 gcaccacctggcacgcccagatagccaggatgctctgcgcgtggacaaggctcgggttgc 2363

                                                                        
Query: 475  cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
            || | |    ||| || || ||||||||||| |||||||| ||||||||||| ||  |||
Sbjct: 2362 cgggatgactgagcccgccctcgctgaagatctgggagcccgccttgaaccacaccccct 2303

                                                                 
Query: 535  caccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagc 587
            | ||||||||||| || ||||| || || ||||| ||||| ||||| ||||||
Sbjct: 2302 cgccgaacttgacgccgttgcgggcgagcagctccgggaacacgcacccgagc 2250



to top

>emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding protein cab 25
          Length = 1184

 Score =  278 bits (140), Expect = 2e-71
 Identities = 417/508 (82%), Gaps = 1/508 (0%)
 Strand = Plus / Minus

                                                                        
Query: 116  tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
            |||||| |||||||||||||| |||||||| ||||| || |||||||| || || || ||
Sbjct: 1031 tcactttccgggaacaaagtttgtggcaaaggcccacgcattgttgttaacggggtcagc 972

                                                                        
Query: 176  gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
             || || ||||| |||||||| |  || || || || ||||||||||| || || |||||
Sbjct: 971  aaggtgatcagcgaggttctccaatggaccttttccagtgacaatagcttgtacaaagaa 912

                                                                        
Query: 236  gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
             ||||||||||||||||| ||||| |  |||||||||| ||| || ||||||||||| ||
Sbjct: 911  tccaaacatggagaacatagcaagtctgccattcttgatctccttcaccttgagctcggc 852

                                                                        
Query: 296  gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
             || || ||||||||||| || || || |  ||||||||||| ||||||||||| |||||
Sbjct: 851  aaaagcttctgggtcatcagcaagccctaatgggtcgaagctaccaccagggtatagtgg 792

                                                                        
Query: 356  atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
            |||||  ||||||||||| || ||||| ||||  ||||| || |||||||| ||||| | 
Sbjct: 791  atcaataacctcaccgagaggaccaccggcaacacggtaaccctcaacggctcccatcaa 732

                                                                        
Query: 416  cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
            ||| ||||| || ||||| || || | ||||||||||||||| || |  || ||||||||
Sbjct: 731  cacaacttggcaagcccaaatggctaagatgctttgtgcatgaaccaaacttgggttgcc 672

                                                                        
Query: 476  gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
             | |||||| || ||||| || ||||| ||||| || || ||||||||||||||||| ||
Sbjct: 671  caagtagtcaagtccaccttcactgaaaatttgagatccagccttgaaccatacagcttc 612

                                                                        
Query: 536  accgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgag 595
            |||||||||||| ||||| || ||||  ||||| ||||||||||| || || || || ||
Sbjct: 611  accgaacttgacaccattacgggcaaagagctcagggaagacgcaaccaagagctccaag 552

                                        
Query: 596  catggcccaccttgcagtggatcacctc 623
            ||||||||| | ||||||||||||||||
Sbjct: 551  catggcccatc-tgcagtggatcacctc 525



to top

>dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting
            chlorophyll a/b-binding protein, complete cds
          Length = 7299

 Score =  278 bits (140), Expect = 2e-71
 Identities = 417/508 (82%), Gaps = 1/508 (0%)
 Strand = Plus / Plus

                                                                        
Query: 116  tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
            |||||| |||||||||||||| |||||| | ||||| ||||||||||| || || || ||
Sbjct: 1870 tcactttccgggaacaaagtttgtggcataggcccaagcgttgttgttaactgggtcagc 1929

                                                                        
Query: 176  gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
             |||||||| ||||||||||| |  || ||||| |||||||| ||||| || ||||||||
Sbjct: 1930 aagatggtcggcaaggttctccaatggaccctttccggtgacgatagcttgaacgaagaa 1989

                                                                        
Query: 236  gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
             ||||||||||||||||| ||||| |  |||||||||| ||| |||||||||||||| ||
Sbjct: 1990 accaaacatggagaacatagcaagtctaccattcttgatctcctttaccttgagctcagc 2049

                                                                        
Query: 296  gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
            ||| ||||||||||| || || || || |  || ||||| || ||||| ||||| |||||
Sbjct: 2050 gaaagcctctgggtcttcagcaagacccaatggatcgaaactaccaccggggtaaagtgg 2109

                                                                        
Query: 356  atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
             ||||| |||||||| || || ||||||||||  ||||| || ||||| || ||||| | 
Sbjct: 2110 gtcaacaacctcaccaagaggcccaccagcaacacggtaaccctcaacagctcccatcaa 2169

                                                                        
Query: 416  cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
             |||||||| || ||||| ||||| | |||||||||||| || || |  || ||||||||
Sbjct: 2170 tacgacttggcaagcccaaatagccaagatgctttgtgcgtgaaccaaacttgggttgcc 2229

                                                                        
Query: 476  gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
             | |||||| || ||||| |||||||| || ||||| || ||||||||||||||||| ||
Sbjct: 2230 caagtagtcaagaccaccctcgctgaaaatctgggaaccagccttgaaccatacagcttc 2289

                                                                        
Query: 536  accgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgag 595
             ||||||||||| || || || || |  |||||||||||||| || || || || || ||
Sbjct: 2290 tccgaacttgacaccgttacgtgccaagagctcggggaagacacaaccaagagctccaag 2349

                                        
Query: 596  catggcccaccttgcagtggatcacctc 623
            ||||||||| | ||||||||||||||||
Sbjct: 2350 catggcccatc-tgcagtggatcacctc 2376



 Score =  230 bits (116), Expect = 5e-57
 Identities = 411/508 (80%), Gaps = 1/508 (0%)
 Strand = Plus / Minus

                                                                        
Query: 116  tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
            |||||| ||||||||||||||||||||| | ||||| || |||||||| || || || ||
Sbjct: 5163 tcactttccgggaacaaagttagtggcatatgcccaggcattgttgttaactgggtcagc 5104

                                                                        
Query: 176  gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
             || ||||| ||||||||||| |  || || || |||||||| |||||||| || |||||
Sbjct: 5103 aaggtggtcggcaaggttctccaatggaccttttccggtgacgatagcctgaacaaagaa 5044

                                                                        
Query: 236  gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
             ||||||||||||||||||||||| |  |||||||||| ||| |||||||||||||| ||
Sbjct: 5043 tccaaacatggagaacatggcaagtctgccattcttgatctcctttaccttgagctcagc 4984

                                                                        
Query: 296  gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
             || ||||| || || || || ||||| |  || |||||||||||||| ||||| |||||
Sbjct: 4983 aaaagcctcaggatcttcagcaaggcccaatggatcgaagctgccaccggggtaaagtgg 4924

                                                                        
Query: 356  atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
             ||||| |||||||| || || ||||||||||  ||||| || |||||||| ||||| | 
Sbjct: 4923 gtcaacaacctcaccaagaggcccaccagcaacacggtaaccctcaacggctcccatcaa 4864

                                                                        
Query: 416  cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
             |  ||||| || |||||||| || |  ||||||||||| || || |  || ||||||||
Sbjct: 4863 tataacttggcaagcccagatggctaaaatgctttgtgcgtggaccaaacttgggttgcc 4804

                                                                        
Query: 476  gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
             | |||||| || ||||| || ||||| ||||| || || |||||||||||||| |||||
Sbjct: 4803 caagtagtcaagtccaccttcactgaaaatttgagatccagccttgaaccatacggcctc 4744

                                                                        
Query: 536  accgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgag 595
             || ||||| || ||||| || || |  |||||||||||||| || || || || || ||
Sbjct: 4743 gccaaacttaacaccattacgggccaagagctcggggaagacacaaccaagagctccaag 4684

                                        
Query: 596  catggcccaccttgcagtggatcacctc 623
            ||| ||||| | ||||||||||||||||
Sbjct: 4683 cattgcccatc-tgcagtggatcacctc 4657



to top

>dbj|AB012636.1| Nicotiana sylvestris Lhcb1*1 gene for light harvesting chlorophyll
           a/b-binding protein, complete cds
          Length = 3659

 Score =  274 bits (138), Expect = 3e-70
 Identities = 431/526 (81%), Gaps = 2/526 (0%)
 Strand = Plus / Minus

                                                                       
Query: 123 ccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgagatgg 182
           ||||| |||||||| |||||  ||||||| || |||||||| || || || || || |||
Sbjct: 927 ccggggacaaagtttgtggcgtacgcccaagcattgttgttaactgggtctgcaaggtgg 868

                                                                       
Query: 183 tcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaac 242
           |||||||||||||| |  |||||||| ||||| ||||| || || || ||||| || |||
Sbjct: 867 tcagcaaggttctctaatgggccctttccggtaacaatggcttgaacaaagaatccgaac 808

                                                                       
Query: 243 atggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcc 302
           || ||||||||||| || |  || ||||| | |||||||||||||||||| |||||||||
Sbjct: 807 atagagaacatggcgagtcttccgttcttaatctcttttaccttgagctcggcgaatgcc 748

                                                                       
Query: 303 tctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaacc 362
           ||||| || || || ||||| || ||||| ||||||||||||||||||||||| || || 
Sbjct: 747 tctggatcctcagcaaggcccagtgggtcaaagctgccaccagggtagagtgggtcgaca 688

                                                                       
Query: 363 acctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgact 422
           |||||||| || || ||||||||||  ||||| || |||||||| ||||| |  |  |||
Sbjct: 687 acctcaccaagaggcccaccagcaacacggtaaccctcaacggctcccatcaagataact 628

                                                                       
Query: 423 tgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtag 482
           || || |||||||| || | ||||||||||||||| || | ||| |||||||| | ||||
Sbjct: 627 tggcaagcccagatggccaagatgctttgtgcatggaccaagcttgggttgcccaagtag 568

                                                                       
Query: 483 tcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaac 542
           || || ||||| ||||| ||||||||||| || ||||||||||| ||||| || || |||
Sbjct: 567 tcaagtccaccctcgctaaagatttgggatccagccttgaaccagacagcttcgccaaac 508

                                                                       
Query: 543 ttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggcc 602
           ||||| || || || || |  ||||| |||||||| ||||| || ||||| ||||| |||
Sbjct: 507 ttgacaccgttacgagccaagagctcagggaagacacatccaagagcaccaagcatagcc 448

                                                         
Query: 603 caccttgcagtggatcacctcaagcttcccggttctttgcaaaggt 648
           || | |||||||||||||||| || ||| |||||||| ||||||||
Sbjct: 447 catc-tgcagtggatcacctcgag-ttcacggttcttggcaaaggt 404



to top

>dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3386

 Score =  270 bits (136), Expect = 5e-69
 Identities = 416/508 (81%), Gaps = 1/508 (0%)
 Strand = Plus / Minus

                                                                        
Query: 116  tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
            |||||| || |||||||| || |||||| | ||||| ||||||||||| || || |||||
Sbjct: 2254 tcactttccaggaacaaaatttgtggcataggcccaagcgttgttgttaactgggtcggc 2195

                                                                        
Query: 176  gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
             || ||||||||||||||||| |  || ||||| |||||||| ||||| |||||||||||
Sbjct: 2194 aaggtggtcagcaaggttctctaatggaccctttccggtgactatagcttgcacgaagaa 2135

                                                                        
Query: 236  gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
             |||||||| |||||||||||||| |  ||||||||||  || || ||||||||||| ||
Sbjct: 2134 tccaaacatagagaacatggcaagtctaccattcttgatttccttcaccttgagctcagc 2075

                                                                        
Query: 296  gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
            ||| ||||||||||| || || || || |  |||||||| || ||||||||||| |||||
Sbjct: 2074 gaaagcctctgggtcttcagcaagacccaatgggtcgaaactaccaccagggtaaagtgg 2015

                                                                        
Query: 356  atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
             ||||| ||||| ||||| || || || ||||  ||||| ||||||||||| ||||| | 
Sbjct: 2014 gtcaacaacctcgccgagaggcccgcctgcaacacggtaaccttcaacggctcccatcaa 1955

                                                                        
Query: 416  cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
             || ||||| || ||||| || || |  |||||||||||||| || |  || ||||||||
Sbjct: 1954 gacaacttggcaagcccaaatggccaaaatgctttgtgcatggaccaaacttgggttgcc 1895

                                                                        
Query: 476  gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
             | |||||| || ||||| |||||||| || ||||| || ||||||||||||||||||||
Sbjct: 1894 caagtagtcaagtccaccttcgctgaaaatctgggatccagccttgaaccatacagcctc 1835

                                                                        
Query: 536  accgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgag 595
            ||||||||||||||| || || || |  || ||||||||||| || || || || || ||
Sbjct: 1834 accgaacttgactccgttacgagccaagagttcggggaagacacaaccaagagctccaag 1775

                                        
Query: 596  catggcccaccttgcagtggatcacctc 623
            ||||||||| | |||| |||||||||||
Sbjct: 1774 catggcccatc-tgcaatggatcacctc 1748



to top

>dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 genes for light
            harvesting chlorophyll a/b-binding protein, complete cds
          Length = 7965

 Score =  266 bits (134), Expect = 8e-68
 Identities = 430/526 (81%), Gaps = 2/526 (0%)
 Strand = Plus / Minus

                                                                        
Query: 123  ccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgagatgg 182
            ||||| |||||||| |||||  | ||||| || |||||||| || || || || || |||
Sbjct: 7665 ccggggacaaagtttgtggcgtaggcccaagcattgttgttaactgggtctgcaaggtgg 7606

                                                                        
Query: 183  tcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaac 242
            |||||||||||||| |  |||||||| || || ||||| || || || ||||| || |||
Sbjct: 7605 tcagcaaggttctctaatgggccctttccagtaacaatggcttgaacaaagaatccgaac 7546

                                                                        
Query: 243  atggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcc 302
            || ||||||||||| || |  || ||||| | |||||||||||||||||| |||||||||
Sbjct: 7545 atagagaacatggcgagtcttccgttcttaatctcttttaccttgagctcggcgaatgcc 7486

                                                                        
Query: 303  tctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaacc 362
            ||||| || || || ||||| || ||||| ||||||||||||||||||||||| || || 
Sbjct: 7485 tctggatcctcagcaaggcccagtgggtcaaagctgccaccagggtagagtgggtcgaca 7426

                                                                        
Query: 363  acctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgact 422
            |||||||| || || ||||||||||  ||||| || |||||||| ||||| |  |  |||
Sbjct: 7425 acctcaccaagaggcccaccagcaacacggtaaccctcaacggctcccatcaagataact 7366

                                                                        
Query: 423  tgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtag 482
            || || |||||||| || | |||||||||||||||||| | ||| |||||||| | ||||
Sbjct: 7365 tggcaagcccagatggccaagatgctttgtgcatgcaccaagcttgggttgcccaagtag 7306

                                                                        
Query: 483  tcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaac 542
            || || ||||| ||||| ||||||||||| || ||||||||||| ||||| || || |||
Sbjct: 7305 tcaagtccaccctcgctaaagatttgggatccagccttgaaccagacagcttcgccaaac 7246

                                                                        
Query: 543  ttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggcc 602
            ||||| || || || || |  ||||| |||||||| ||||| || ||||| ||||| |||
Sbjct: 7245 ttgacaccgttacgagccaagagctcagggaagacacatccaagagcaccaagcatagcc 7186

                                                          
Query: 603  caccttgcagtggatcacctcaagcttcccggttctttgcaaaggt 648
            || | |||||||||||||||| || ||| |||||||| ||||||||
Sbjct: 7185 catc-tgcagtggatcacctcgag-ttcacggttcttggcaaaggt 7142



 Score =  264 bits (133), Expect = 3e-67
 Identities = 405/493 (82%), Gaps = 2/493 (0%)
 Strand = Plus / Minus

                                                                        
Query: 153  gcgttgttgttgacaggatcggcgagatggtcagcaaggttctcgagggggcccttgccg 212
            ||||||||||| || || || || |||||||||||||||||||| |  || || || || 
Sbjct: 2642 gcgttgttgttaactgggtcagcaagatggtcagcaaggttctccaatggaccttttcca 2583

                                                                        
Query: 213  gtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgcccattcttg 272
            || ||||| ||||| || ||||| || ||||| |||||||||||||| |  |||||||||
Sbjct: 2582 gtaacaatggcctgaacaaagaatccgaacatagagaacatggcaagcctgccattcttg 2523

                                                                        
Query: 273  acctcttttaccttgagctccgcgaatgcctctgggtcatcggctaggccgagcgggtcg 332
            | ||| ||||| |||||||| ||||||||||||||||| || || ||||| || ||||| 
Sbjct: 2522 atctcctttactttgagctcagcgaatgcctctgggtcctcagcaaggcctagtgggtca 2463

                                                                        
Query: 333  aagctgccaccagggtagagtggatcaaccacctcaccgagtgggccaccagcaatgcgg 392
            ||||||||||||||||||||||| || || |||||||| || || ||||||||||  |||
Sbjct: 2462 aagctgccaccagggtagagtgggtcgacaacctcaccaagaggcccaccagcaacacgg 2403

                                                                        
Query: 393  tacccttcaacggcgcccatgagcacgacttgacatgcccagatagcaaggatgctttgt 452
            || || |||||||| ||||| |  |  ||||| || ||||||||||| | ||||||||||
Sbjct: 2402 taaccctcaacggctcccatcaagataacttggcaagcccagatagccaagatgctttgt 2343

                                                                        
Query: 453  gcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggag 512
            || || |  | ||| || ||||| | |||||| || ||||| ||||| |||||||| || 
Sbjct: 2342 gcgtggatcaagcttggattgcccaagtagtcaagtccaccctcgctaaagatttgtgat 2283

                                                                        
Query: 513  cctgccttgaaccatacagcctcaccgaacttgactccattgcgcgcaagaagctcgggg 572
            || ||||||||||||||||||||||| |||||||| ||||| || || |  |||||||||
Sbjct: 2282 ccagccttgaaccatacagcctcaccaaacttgacgccattacgggccaagagctcgggg 2223

                                                                        
Query: 573  aagacgcatccgagcgcaccgagcatggcccaccttgcagtggatcacctcaagcttccc 632
            || || ||||| || ||||| ||||| ||||| | ||||||| |||||||| || ||| |
Sbjct: 2222 aaaacacatccaagagcaccaagcatagcccatc-tgcagtgaatcacctcgag-ttcac 2165

                         
Query: 633  ggttctttgcaaa 645
            ||||||| |||||
Sbjct: 2164 ggttcttggcaaa 2152



 Score =  258 bits (130), Expect = 2e-65
 Identities = 429/526 (81%), Gaps = 2/526 (0%)
 Strand = Plus / Minus

                                                                        
Query: 123  ccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgagatgg 182
            ||||| |||||||| |||||| | | ||| ||||||||||| ||||| || || || |||
Sbjct: 5125 ccggggacaaagtttgtggcataggaccaggcgttgttgttaacagggtctgcaaggtgg 5066

                                                                        
Query: 183  tcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaac 242
            |||||||||||||| |  |||||||| ||||| ||||| ||||| || ||||| || |||
Sbjct: 5065 tcagcaaggttctccaatgggccctttccggtaacaatggcctgaacaaagaatccgaac 5006

                                                                        
Query: 243  atggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcc 302
            || |||||||||||||| | ||||||||||| ||| ||||| |||||||| || ||||||
Sbjct: 5005 atagagaacatggcaagtctcccattcttgatctcctttactttgagctcagcaaatgcc 4946

                                                                        
Query: 303  tctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaacc 362
            ||||||||||| || || || |  ||||| ||||| ||||||||||||||||| || || 
Sbjct: 4945 tctgggtcatcagcaagccccaatgggtcaaagctaccaccagggtagagtgggtcgaca 4886

                                                                        
Query: 363  acctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgact 422
            |||||||| || || |||||||| |  ||||| || |||||||| ||||| |  |  || 
Sbjct: 4885 acctcaccaagaggtccaccagctacacggtatccctcaacggctcccatcaagataacc 4826

                                                                        
Query: 423  tgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtag 482
            || || ||||| || || | |||||||||||| || |  | ||| |||||||| |  |||
Sbjct: 4825 tggcaagcccatattgccaagatgctttgtgcgtggatcaagcttgggttgcccaaatag 4766

                                                                        
Query: 483  tcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaac 542
            || || ||||| ||||||||||||||||| || ||||||||||| |||||||| || |||
Sbjct: 4765 tcaagtccaccatcgctgaagatttgggatccggccttgaaccacacagcctcgccaaac 4706

                                                                        
Query: 543  ttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggcc 602
            || || || || || || |  |||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 4705 ttaacaccgttacgggccaagagctcggggaagacacatccaagagcaccaagcatagcc 4646

                                                          
Query: 603  caccttgcagtggatcacctcaagcttcccggttctttgcaaaggt 648
            || | |||||||||||||||| ||| || |||||||| ||||||||
Sbjct: 4645 catc-tgcagtggatcacctcgagc-tcacggttcttggcaaaggt 4602



to top

>gb|AY109324.1| Zea mays CL187_1 mRNA sequence
          Length = 2262

 Score =  260 bits (131), Expect = 5e-66
 Identities = 311/371 (83%)
 Strand = Plus / Minus

                                                                        
Query: 114  cctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcg 173
            |||||||||||||| || ||||| |||||  | ||||| |||||||||||||| || |||
Sbjct: 1812 cctcacttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcg 1753

                                                                        
Query: 174  gcgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaag 233
            || |  |||||||| ||||||||||| |||||||| |||||||| || ||||| ||||||
Sbjct: 1752 gcaatgtggtcagcgaggttctcgagcgggcccttcccggtgacgatggcctggacgaag 1693

                                                                        
Query: 234  aagccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctcc 293
            || || ||||||||||||||||| ||||| || ||||||| ||| || ||||||||||| 
Sbjct: 1692 aatccgaacatggagaacatggcgaggcggcccttcttgagctccttcaccttgagctca 1633

                                                                        
Query: 294  gcgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagt 353
            ||||| ||||| ||||| ||||| ||||| ||||||||||||||||| || || ||||| 
Sbjct: 1632 gcgaaggcctcggggtcgtcggcgaggcccagcgggtcgaagctgccgccgggatagagc 1573

                                                                        
Query: 354  ggatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatg 413
            || || || ||||| ||||| || || || || |||||||| || || ||||||||||||
Sbjct: 1572 gggtcgacgacctcgccgagcggtccgccggcgatgcggtagccctcgacggcgcccatg 1513

                                                                        
Query: 414  agcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttg 473
            |||||||| || || |||||||| || |||||||| || || || | |||||| ||||||
Sbjct: 1512 agcacgacctggcaggcccagatggcgaggatgctctgcgcgtggatgaggctcgggttg 1453

                       
Query: 474  ccgaggtagtc 484
             ||||||||||
Sbjct: 1452 acgaggtagtc 1442



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 105/124 (84%), Gaps = 2/124 (1%)
 Strand = Plus / Minus

                                                                        
Query: 516  gccttgaaccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaag 575
            ||||||||||  || ||||| ||||||||||| || ||||| || || ||||| ||||||
Sbjct: 1410 gccttgaacccaacggcctcgccgaacttgacgccgttgcgggcgagcagctccgggaag 1351

                                                                        
Query: 576  acgcatccgagcgcaccgagcatggcccaccttgcagtggatcacctcaagcttcccggt 635
            ||||| |||||||| || ||||||||||| |  | ||||||||||||| ||| |||||||
Sbjct: 1350 acgcagccgagcgcgcccagcatggcccagc-gggagtggatcacctccagc-tcccggt 1293

                
Query: 636  tctt 639
            ||||
Sbjct: 1292 tctt 1289



to top

>emb|AJ843976.1| Plantago major partial mRNA for light harvesting protein 1 (lhc1
           gene)
          Length = 688

 Score =  254 bits (128), Expect = 3e-64
 Identities = 431/528 (81%), Gaps = 3/528 (0%)
 Strand = Plus / Minus

                                                                       
Query: 123 ccgggaacaaagttagtggcaaacg-cccatgcgttgttgttgacaggatcggcgagatg 181
           |||||||| ||||| |||||||| | |||| ||||||||||| || || || || || ||
Sbjct: 684 ccgggaacgaagtttgtggcaaaaggcccaagcgttgttgttaacggggtctgctaggtg 625

                                                                       
Query: 182 gtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaa 241
           ||||||||||||||| |  |||||||| |||||||| |||||||| |||||||| || ||
Sbjct: 624 gtcagcaaggttctccaacgggccctttccggtgacgatagcctggacgaagaatccgaa 565

                                                                       
Query: 242 catggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgc 301
           |||||||||||||||||| |  || ||||||| ||| || ||||||||||| || || ||
Sbjct: 564 catggagaacatggcaagcctgccgttcttgagctccttaaccttgagctcagcaaaggc 505

                                                                       
Query: 302 ctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaac 361
           |||||| || || || ||||| |  |||||||||||||| || ||||||||||| |||||
Sbjct: 504 ctctggatcttcagcaaggcccaatgggtcgaagctgcctcctgggtagagtgggtcaac 445

                                                                       
Query: 362 cacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgac 421
           |||||| || ||||| ||||| ||||  ||||| || ||||| || ||||| |  |  ||
Sbjct: 444 cacctctccaagtggcccaccggcaacacggtagccctcaacagctcccatcaaaataac 385

                                                                       
Query: 422 ttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggta 481
           ||| || |||||||| || | |||||| || || || || | ||| ||||| || | |||
Sbjct: 384 ttggcaagcccagattgccaagatgctctgagcgtggaccaagcttgggtttcccaagta 325

                                                                       
Query: 482 gtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaa 541
           ||| |  ||||| ||||| ||||| || || || ||||||||||| |||||||| |||||
Sbjct: 324 gtccaaaccaccctcgctaaagatctgtgatccagccttgaaccaaacagcctcgccgaa 265

                                                                       
Query: 542 cttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggc 601
           |||||| || || || || |  ||||||||||| ||||||||||| || || ||||||||
Sbjct: 264 cttgacaccgttacgggccaagagctcggggaatacgcatccgagtgctccaagcatggc 205

                                                           
Query: 602 ccaccttgcagtggatcacctcaagcttcccggttctttgcaaaggtc 649
           ||| |||| ||||||||||||||||| || |||||||| || ||||||
Sbjct: 204 ccatcttg-agtggatcacctcaagc-tcacggttcttggcgaaggtc 159



to top

>emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding protein cab 91R
          Length = 1173

 Score =  254 bits (128), Expect = 3e-64
 Identities = 414/508 (81%), Gaps = 1/508 (0%)
 Strand = Plus / Minus

                                                                        
Query: 116  tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
            |||||| ||||| ||||||||||| ||  | | ||||||||||||||| || || |||||
Sbjct: 1034 tcactttccggggacaaagttagttgcgtaagaccatgcgttgttgttaactgggtcggc 975

                                                                        
Query: 176  gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
             || || |||||||||||||| |  || ||||| || || || || ||||| || || ||
Sbjct: 974  aaggtgatcagcaaggttctccaaaggaccctttccagtaacgatggcctgaacaaaaaa 915

                                                                        
Query: 236  gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
             ||||||||||| ||||| ||||| |  |||||||||| ||| || ||||||||||| ||
Sbjct: 914  tccaaacatggaaaacatagcaagtctaccattcttgatctccttcaccttgagctcagc 855

                                                                        
Query: 296  gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
             ||||||||||||||||| || || || |  |||||||| || ||||| ||||| |||||
Sbjct: 854  aaatgcctctgggtcatctgcaagacccaatgggtcgaaactaccaccggggtaaagtgg 795

                                                                        
Query: 356  atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
             ||||| |||||||| || || ||||||||||  ||||| || |||||||| ||||| | 
Sbjct: 794  gtcaacaacctcaccaagaggcccaccagcaacacggtaaccctcaacggctcccatcaa 735

                                                                        
Query: 416  cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
            ||| ||||| || ||||| || || | |||||||||||| || || |  || ||||||||
Sbjct: 734  cacaacttggcaagcccaaatggccaagatgctttgtgcgtggaccaaacttgggttgcc 675

                                                                        
Query: 476  gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
             | |||||| || ||||| |||||||| |||||||| || ||||| ||||||||||||||
Sbjct: 674  caagtagtcaagtccaccctcgctgaatatttgggatccagccttaaaccatacagcctc 615

                                                                        
Query: 536  accgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgag 595
            |||||||||||| ||||| || ||||| || || |||||||| || || || || || ||
Sbjct: 614  accgaacttgacaccattacgggcaaggagttcagggaagacacaaccaagagctccaag 555

                                        
Query: 596  catggcccaccttgcagtggatcacctc 623
            ||||||||| | ||||||||||||||||
Sbjct: 554  catggcccatc-tgcagtggatcacctc 528



to top

>emb|Z13987.1|STCABPSII S.tuberosum gene for chlorophyll a/b-binding protein PS II type I
          Length = 2432

 Score =  248 bits (125), Expect = 2e-62
 Identities = 353/429 (82%)
 Strand = Plus / Minus

                                                                        
Query: 116  tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
            |||||| |||||||||||||| |||||||| ||||||||||||||||| || ||||| ||
Sbjct: 1704 tcactttccgggaacaaagtttgtggcaaaagcccatgcgttgttgttaactggatcagc 1645

                                                                        
Query: 176  gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
             || ||||| ||||| || || |  ||||| || |||||||||||||| || ||||||||
Sbjct: 1644 aaggtggtctgcaagattttccaatgggccttttccggtgacaatagcttgaacgaagaa 1585

                                                                        
Query: 236  gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
             ||||||||||||||||| ||||| |  ||||||||||  |||||||| ||||| |||||
Sbjct: 1584 tccaaacatggagaacatagcaagtctaccattcttgatttcttttactttgagttccgc 1525

                                                                        
Query: 296  gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
             || |||||||| ||||| || ||||| |  ||||||||||| |||||||| || |||||
Sbjct: 1524 aaaagcctctggatcatcagcaaggcccaatgggtcgaagctaccaccaggataaagtgg 1465

                                                                        
Query: 356  atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
             ||||| |||||||| || || ||||||||||| ||||| || |||||||| ||||| | 
Sbjct: 1464 gtcaacaacctcaccaagaggcccaccagcaatacggtaaccctcaacggctcccatcaa 1405

                                                                        
Query: 416  cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
            ||| |||||||| ||||| || || | ||| ||||||||||| || |  || ||||| ||
Sbjct: 1404 cacaacttgacaagcccaaatggccaagatactttgtgcatggaccaaacttgggtttcc 1345

                                                                        
Query: 476  gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
             | ||| || || ||||| || ||||| |||||||| ||  | |||||||| ||||||||
Sbjct: 1344 caagtaatcaagtccaccttcactgaaaatttgggatccaactttgaaccaaacagcctc 1285

                     
Query: 536  accgaactt 544
            ||| |||||
Sbjct: 1284 accaaactt 1276



to top

>gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b-binding protein
           mRNA, partial cds
          Length = 575

 Score =  244 bits (123), Expect = 3e-61
 Identities = 384/471 (81%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||||||||| |||||||| |||||||| ||||| || ||||||||||| || |||||
Sbjct: 472 tcacttgccggggacaaagttggtggcaaaagcccaggcattgttgttgacggggtcggc 413

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
           ||| || || || | |||||| |  || ||||||||||| || || ||||| ||||||||
Sbjct: 412 gaggtgatcggccaagttctccaatggccccttgccggtcacgatcgcctggacgaagaa 353

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
           ||| |||||||| |||||||| || |  |||||||||| ||| || ||||| ||||| ||
Sbjct: 352 gccgaacatggataacatggccagcctgccattcttgatctccttcaccttcagctcggc 293

                                                                       
Query: 296 gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
           ||| ||||| ||||| ||||| ||||| ||||||||||||||||| || ||||| || ||
Sbjct: 292 gaaggcctcggggtcgtcggcgaggccaagcgggtcgaagctgccgccggggtaaagggg 233

                                                                       
Query: 356 atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
            || |||||||| ||||| || ||||| ||||  | ||| || || ||||| ||||||||
Sbjct: 232 gtcgaccacctcgccgaggggcccaccggcaaccctgtatccctcgacggcccccatgag 173

                                                                       
Query: 416 cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
            | ||| ||    |||||||| || |||||||| || || || |||||||| ||||||||
Sbjct: 172 aaggacctgggtggcccagatggccaggatgctctgcgcgtggacgaggctggggttgcc 113

                                                                       
Query: 476 gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
            |||||||| |  || || ||||||||||| ||||  || ||||||||||| || |||||
Sbjct: 112 caggtagtccaatccgccctcgctgaagatctgggctccggccttgaaccagaccgcctc 53

                                                              
Query: 536 accgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgag 586
            |||||||| || || ||||| || || ||||||||||||||||| |||||
Sbjct: 52  gccgaacttcacgccgttgcgggcgaggagctcggggaagacgcagccgag 2



to top

>gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-3A gene, 3' end
          Length = 351

 Score =  242 bits (122), Expect = 1e-60
 Identities = 287/342 (83%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||| |||||||||||||| |||||||| ||||| ||||||||||| || || |||||
Sbjct: 351 tcactttccgggaacaaagtttgtggcaaaggcccaggcgttgttgttaactgggtcggc 292

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            |  ||||| ||||||||||| |  || ||||| |||||||||||||| || || |||||
Sbjct: 291 aatgtggtcggcaaggttctccaatggaccctttccggtgacaatagcttgaacaaagaa 232

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
            ||||||||||||||||| ||||| |  || ||||||| ||| |||||||||||||| ||
Sbjct: 231 tccaaacatggagaacatagcaagtctgccgttcttgatctcctttaccttgagctcagc 172

                                                                       
Query: 296 gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
           ||| ||||||||||| || || ||||| |  ||||| ||||| ||||||||||| |||||
Sbjct: 171 gaaagcctctgggtcttcagcaaggcccaatgggtcaaagctaccaccagggtaaagtgg 112

                                                                       
Query: 356 atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
           |||||| |||||||| || || ||||||||||| ||||| || |||||||| ||||| | 
Sbjct: 111 atcaacaacctcaccaagaggcccaccagcaatacggtaaccctcaacggctcccatcaa 52

                                                     
Query: 416 cacgacttgacatgcccagatagcaaggatgctttgtgcatg 457
           ||| ||||| || ||||| ||||| |  ||||||||||||||
Sbjct: 51  cacaacttggcaagcccaaatagccaaaatgctttgtgcatg 10



to top

>gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab-C) gene, complete cds
          Length = 1240

 Score =  238 bits (120), Expect = 2e-59
 Identities = 412/508 (81%), Gaps = 1/508 (0%)
 Strand = Plus / Minus

                                                                        
Query: 116  tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
            |||||| || || |||||||| |||||  | |||||||||||||| || || || || ||
Sbjct: 1240 tcactttccagggacaaagtttgtggcgtaggcccatgcgttgttattaactgggtctgc 1181

                                                                        
Query: 176  gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
             ||||| || |||||||| || |  || ||||| |||||||| |||||||| ||||||||
Sbjct: 1180 aagatgatcggcaaggttttccaatggaccctttccggtgacgatagcctgaacgaagaa 1121

                                                                        
Query: 236  gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
             ||||||||||||||||||||||| |  || ||||||| ||| |||||||||||||| ||
Sbjct: 1120 tccaaacatggagaacatggcaagtctgccgttcttgatctcctttaccttgagctcagc 1061

                                                                        
Query: 296  gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
             || || |||||||| || || || || |  ||||||||||| ||||||||||| |||||
Sbjct: 1060 aaaagcttctgggtcttcagcaagacccaatgggtcgaagctaccaccagggtaaagtgg 1001

                                                                        
Query: 356  atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
             ||||| ||||||||||| ||  |||||||||  || || || |||||||| ||||| | 
Sbjct: 1000 gtcaacaacctcaccgagaggttcaccagcaacacgataaccctcaacggctcccatcaa 941

                                                                        
Query: 416  cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
            ||| |||||||| ||||| || || |  |||||||| ||||| || |  || ||||||||
Sbjct: 940  cacaacttgacaagcccaaatggccaatatgctttgagcatggaccaaacttgggttgcc 881

                                                                        
Query: 476  gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
             | |||||| || ||||| | |||||| |||||||| ||  |||||||||||||||||||
Sbjct: 880  caagtagtcaagtccaccctggctgaaaatttgggatccacccttgaaccatacagcctc 821

                                                                        
Query: 536  accgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgag 595
            ||||||||| || ||||| || || |  |||||||| ||||| || || || || || ||
Sbjct: 820  accgaacttaacaccattacgggccaagagctcgggaaagacacaaccaagagctccaag 761

                                        
Query: 596  catggcccaccttgcagtggatcacctc 623
            ||||||||| | | ||||||||||||||
Sbjct: 760  catggcccatc-tacagtggatcacctc 734



to top

>emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-thioredoxin-reductase
           catalytic subunit B (ftrbpot gene)
          Length = 701

 Score =  236 bits (119), Expect = 7e-59
 Identities = 429/526 (81%), Gaps = 6/526 (1%)
 Strand = Plus / Plus

                                                                       
Query: 123 ccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgagatgg 182
           ||||| |||||||| ||||| || ||| | ||||||||||| || || || || || |||
Sbjct: 6   ccggggacaaagtttgtggcgaaagccaa-gcgttgttgttaacggggtctgcaaggtgg 64

                                                                       
Query: 183 tcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaac 242
           |||||||||||||| |  || ||||| ||||| ||||| ||||| |||||||| ||||||
Sbjct: 65  tcagcaaggttctccaatggaccctttccggtaacaatggcctgaacgaagaatccaaac 124

                                                                       
Query: 243 atggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcc 302
           || |||||||| ||||| |  || ||||| | ||| ||||| |||||||| || ||||||
Sbjct: 125 atagagaacatagcaagtctgccgttcttaatctcctttactttgagctcagcaaatgcc 184

                                                                       
Query: 303 tctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaacc 362
           |||||||| || || ||||| |  ||||| ||||||||||||||||||||||| || || 
Sbjct: 185 tctgggtcttcagcaaggcctaatgggtcaaagctgccaccagggtagagtgggtcgaca 244

                                                                       
Query: 363 acctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgact 422
           |||||||| ||  || |||||||||| ||||| ||||||||||| ||    |  || |||
Sbjct: 245 acctcaccaag-aggtcaccagcaatacggtaaccttcaacggctccatcaatgacaact 303

                                                                       
Query: 423 tgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtag 482
           || || |||||||| || | |||||| |||||||| || | ||| |||||||| | ||||
Sbjct: 304 tggcaagcccagatggccaagatgctctgtgcatggaccaagcttgggttgcccaagtag 363

                                                                       
Query: 483 tcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaac 542
           || || ||||| ||||||||||| ||||| || ||||||||||| |||||||||||||||
Sbjct: 364 tcaagtccaccctcgctgaagatgtgggatccggccttgaaccacacagcctcaccgaac 423

                                                                       
Query: 543 ttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggcc 602
           ||||| ||||| || || |  ||||| |||||||| ||| | || ||||| ||||| |||
Sbjct: 424 ttgacaccattacgggccaatagctcagggaagacacat-caagagcaccaagcatagcc 482

                                                         
Query: 603 caccttgcagtggatcacctcaagcttcccggttctttgcaaaggt 648
             |  |||||||||||||||| || ||| |||||||| ||||||||
Sbjct: 483 atc--tgcagtggatcacctcgag-ttcacggttcttggcaaaggt 525



to top

>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein
          Length = 1361

 Score =  234 bits (118), Expect = 3e-58
 Identities = 410/506 (81%), Gaps = 1/506 (0%)
 Strand = Plus / Minus

                                                                        
Query: 115  ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
            ||||||| ||||| || ||||| |||||| | ||||| |||||||||||||||||  | |
Sbjct: 1043 ctcactttccggggacgaagttggtggcataggcccaggcgttgttgttgacaggtccag 984

                                                                        
Query: 175  cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
            | || || || || |||||||| |  || ||||| ||||||||||| ||||| || ||||
Sbjct: 983  caaggtgatcggcgaggttctccaatggaccctttccggtgacaatggcctgaacaaaga 924

                                                                        
Query: 235  agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
            |||||||||| ||||||||||| |  || || |||||||  || || ||||| ||||| |
Sbjct: 923  agccaaacatagagaacatggccaatcgtccgttcttgagttccttcaccttaagctcag 864

                                                                        
Query: 295  cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
            | || |||||||||||||| || ||||| |  ||||||||||||||||| ||||||| ||
Sbjct: 863  caaaagcctctgggtcatcagcaaggcccaatgggtcgaagctgccacctgggtagattg 804

                                                                        
Query: 355  gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
            | |||   ||||||||||| |||||||||||||| ||||| ||||||||||| ||||| |
Sbjct: 803  ggtcagtgacctcaccgagggggccaccagcaatacggtaaccttcaacggcacccatta 744

                                                                        
Query: 415  gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
            | |  |||||    |||||||| || |||||||| || || || |  ||||| |||||||
Sbjct: 743  ggataacttgtgtggcccagatggcgaggatgctctgggcgtggatcaggcttgggttgc 684

                                                                        
Query: 475  cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
            | | ||||||||| ||||| ||||||||||| ||||| || ||||||||||| || || |
Sbjct: 683  ccaagtagtcgagcccaccctcgctgaagatctgggacccggccttgaaccacacggctt 624

                                                                        
Query: 535  caccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccga 594
            | |||||||| || || ||||| |  || | ||| ||||||||||| || |  || ||||
Sbjct: 623  ctccgaacttcaccccgttgcgggacagcaactccgggaagacgcagcccaaggctccga 564

                                      
Query: 595  gcatggcccaccttgcagtggatcac 620
            |||||||||||| || ||||||||||
Sbjct: 563  gcatggcccacc-tggagtggatcac 539



to top

>emb|AJ234428.1|HVU234428 Hordeum vulgare partial mRNA; clone cMWG0701.rev
          Length = 326

 Score =  232 bits (117), Expect = 1e-57
 Identities = 270/321 (84%)
 Strand = Plus / Plus

                                                                       
Query: 173 ggcgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaa 232
           |||||| |||||||| ||||||||||| |||||||| || ||||| || || ||||| ||
Sbjct: 3   ggcgaggtggtcagcgaggttctcgagcgggcccttaccagtgacgatggcttgcacaaa 62

                                                                       
Query: 233 gaagccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctc 292
           | | ||||||||||| ||||| ||||| || || ||||||| ||| || |||||||||||
Sbjct: 63  gtatccaaacatggaaaacattgcaagacgaccgttcttgatctccttcaccttgagctc 122

                                                                       
Query: 293 cgcgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagag 352
            || || ||||| ||||| || || ||||| || ||||||||||||||||| ||||| ||
Sbjct: 123 ggcaaacgcctcggggtcgtctgcaaggccaagggggtcgaagctgccaccggggtatag 182

                                                                       
Query: 353 tggatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccat 412
           ||| || || | ||| ||||||||||||||||||| ||||||||| || || ||||||||
Sbjct: 183 tgggtcgacgatctctccgagtgggccaccagcaacgcggtacccctcgacagcgcccat 242

                                                                       
Query: 413 gagcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggtt 472
           ||||||||| || || |||||||| ||||||||||| |  || || || | |||||| ||
Sbjct: 243 gagcacgacctggcaagcccagatggcaaggatgctctccgcgtggaccaagctaggatt 302

                                
Query: 473 gccgaggtagtcgaggccacc 493
           |||||||||||||||||||||
Sbjct: 303 gccgaggtagtcgaggccacc 323



to top

>gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding protein (CARCAB1) mRNA,
           complete cds
          Length = 983

 Score =  232 bits (117), Expect = 1e-57
 Identities = 360/441 (81%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||| |||||||||||||| |||||| | |||||||||||||||||||| || |||||
Sbjct: 852 tcactttccgggaacaaagttggtggcataggcccatgcgttgttgttgactgggtcggc 793

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            ||||| |||||||||||||| |  || ||||| ||||| ||||||||||| || |||||
Sbjct: 792 aagatgatcagcaaggttctccaaaggtccctttccggtcacaatagcctgaacaaagaa 733

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
            || ||||| ||||||||||| |  |  || |||||||  || || ||||| | ||| ||
Sbjct: 732 tccgaacatagagaacatggctaatctgccgttcttgagttccttaaccttcaactctgc 673

                                                                       
Query: 296 gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
           ||| ||||||||||| || |||||||| |  ||||| |||||||| || ||||| |||||
Sbjct: 672 gaaagcctctgggtcgtcagctaggcccaatgggtcaaagctgcctcctgggtatagtgg 613

                                                                       
Query: 356 atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
            ||||| |||||||| || || ||||||||||| ||||| ||||||||||| ||||| | 
Sbjct: 612 gtcaacaacctcaccaagaggtccaccagcaatacggtaaccttcaacggctcccatcaa 553

                                                                       
Query: 416 cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
            |  ||||||   |||||||| ||||| ||||| || ||||| || |  || ||||| ||
Sbjct: 552 gataacttgagtggcccagatggcaagaatgctctgagcatggaccaaacttgggttacc 493

                                                                       
Query: 476 gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
            | |||||| || ||||| ||||| ||||| ||||| || ||||||||||||||||| ||
Sbjct: 492 caagtagtcaagtccaccctcgctaaagatctgggatccggccttgaaccatacagcttc 433

                                
Query: 536 accgaacttgactccattgcg 556
           |||||| || || ||||||||
Sbjct: 432 accgaatttaacaccattgcg 412



to top

>emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/b binding protein
          Length = 1080

 Score =  230 bits (116), Expect = 5e-57
 Identities = 411/508 (80%), Gaps = 1/508 (0%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||| |||||||||||||| |||||| | ||||| || |||||||| || || || ||
Sbjct: 867 tcactttccgggaacaaagtttgtggcataggcccaggcattgttgttaactgggtctgc 808

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            || ||||| ||||||||||| |  || ||||| || ||||| |||||||| || |||||
Sbjct: 807 aaggtggtcggcaaggttctccaatggaccctttccagtgacgatagcctgaacaaagaa 748

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
            ||||||||||| ||||| ||||| |  |||||||||| ||| |||||||||||||| ||
Sbjct: 747 tccaaacatggaaaacatagcaagtctaccattcttgatctcctttaccttgagctcagc 688

                                                                       
Query: 296 gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
            || ||||||||||| || || || || |  |||||||| |||||||||||||| |||||
Sbjct: 687 aaaagcctctgggtcttcagcaagtcccaatgggtcgaaactgccaccagggtaaagtgg 628

                                                                       
Query: 356 atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
            ||||| || |||||||| || ||||||||||  ||||| || ||||| || ||||| | 
Sbjct: 627 gtcaacaacttcaccgagaggtccaccagcaacacggtaaccctcaactgctcccatcaa 568

                                                                       
Query: 416 cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
           ||| ||||| || ||||| || || | |||||||||||| || || |  || ||||||||
Sbjct: 567 cacaacttggcaagcccaaatggccaagatgctttgtgcgtggaccaaacttgggttgcc 508

                                                                       
Query: 476 gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
            |  ||||| || ||||| ||||| || ||||| || || ||||||||||||||||||||
Sbjct: 507 caaatagtcaagtccaccctcgctaaaaatttgagatccagccttgaaccatacagcctc 448

                                                                       
Query: 536 accgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgag 595
            || |||||||| || || || || |  ||||| |||||||| || || || || || ||
Sbjct: 447 gccaaacttgacaccgttacgtgccaagagctcagggaagacacaaccaagagctccaag 388

                                       
Query: 596 catggcccaccttgcagtggatcacctc 623
           ||||||||| | ||||||||||||||||
Sbjct: 387 catggcccatc-tgcagtggatcacctc 361



to top

>gb|DQ018375.1| Pinus gerardiana chloroplast putative light harvesting chlorophyll
           a/b binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 760

 Score =  228 bits (115), Expect = 2e-56
 Identities = 365/447 (81%), Gaps = 1/447 (0%)
 Strand = Plus / Minus

                                                                       
Query: 174 gcgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaag 233
           ||||| || ||||| |||||||||| ||| ||||| ||||||||||| ||||||||||||
Sbjct: 760 gcgaggtgatcagcgaggttctcgatgggtccctttccggtgacaatggcctgcacgaag 701

                                                                       
Query: 234 aagccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctcc 293
           || || |||||||| |||||||| | |||||| ||||||| ||| || ||||| ||||||
Sbjct: 700 aatccgaacatggaaaacatggccaagcgcccgttcttgatctccttcaccttcagctcc 641

                                                                       
Query: 294 gcgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagt 353
           ||||| || |||||||| || || || || |  ||||||||||||||||| |||||||  
Sbjct: 640 gcgaaagcgtctgggtcgtctgcaagtcccaaggggtcgaagctgccaccggggtagatg 581

                                                                       
Query: 354 ggatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatg 413
           || ||   |||||| || || ||||| |||||||| ||||| || || ||||||||||||
Sbjct: 580 gggtcggtcacctctcccagagggccgccagcaatacggtaaccctccacggcgcccatg 521

                                                                       
Query: 414 agcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttg 473
           || | ||| || ||||||||||| ||||| ||||| || || || |  ||||||||||| 
Sbjct: 520 aggatgacctggcatgcccagattgcaagaatgctctgcgcgtggataaggctagggttt 461

                                                                       
Query: 474 ccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcc 533
           || |||||||| || || || |||||||| || || |  || ||||||||||| || |||
Sbjct: 460 cccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaaccacactgcc 401

                                                                       
Query: 534 tcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccg 593
           || |||||||| |||||||| | ||| |||||||| ||||| ||||| || || || || 
Sbjct: 400 tccccgaactttactccatttctcgccagaagctccgggaaaacgcaacccagagcgccc 341

                                      
Query: 594 agcatggcccaccttgcagtggatcac 620
           ||||| |||||||  ||||||||||||
Sbjct: 340 agcattgcccacc-ggcagtggatcac 315



to top

>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB)
           mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1042

 Score =  226 bits (114), Expect = 7e-56
 Identities = 431/534 (80%), Gaps = 2/534 (0%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           ||||||||||||||| ||||| ||||| || ||||| || ||||||||||| || || ||
Sbjct: 828 tcacttgccgggaacgaagttggtggcgaaggcccaagcattgttgttgactgggtcagc 769

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            || ||||| || |||||||| |  |||||||| || || ||||| || || || |||||
Sbjct: 768 aaggtggtctgcgaggttctccaatgggccctttccagtcacaatggcttggacaaagaa 709

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
            || |||||||||||||| || |  |  || ||||||| ||| || ||||| | ||| ||
Sbjct: 708 tccgaacatggagaacatagccaatctaccgttcttgatctccttgaccttcaactcagc 649

                                                                       
Query: 296 gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
           ||| || |||||||| || |||||||| |  ||||||||||| ||||| |||||||||||
Sbjct: 648 gaaggcttctgggtcttcagctaggcccaatgggtcgaagctaccaccggggtagagtgg 589

                                                                       
Query: 356 atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
            ||    ||||||||||| || ||||||||||  || || |||||||  |||||||| | 
Sbjct: 588 gtcggttacctcaccgagaggcccaccagcaacacgatagccttcaatagcgcccatcaa 529

                                                                       
Query: 416 cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
            || || || || |||||||| || |||||||| || ||||| || | ||| ||||||||
Sbjct: 528 gacaacctggcaagcccagatggctaggatgctctgagcatggaccaagcttgggttgcc 469

                                                                       
Query: 476 gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
            | |||||| |||||||| || ||||||||||| |  || |||||||||||||| |||||
Sbjct: 468 caagtagtcaaggccaccctcactgaagatttgtgcaccggccttgaaccatacggcctc 409

                                                                       
Query: 536 accgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgag 595
           |||||||||||| || ||||| || |  ||||| |||||||| ||||| || ||||| | 
Sbjct: 408 accgaacttgacaccgttgcgagccaagagctctgggaagacacatcccagagcacccaa 349

                                                                 
Query: 596 catggcccaccttgcagtggatcacctcaagcttcccggttctttgcaaaggtc 649
           ||| ||||| | ||||||||||||||||||| ||| |||||||| |||||||||
Sbjct: 348 catagcccatc-tgcagtggatcacctcaag-ttcgcggttcttagcaaaggtc 297



to top

>gb|M30616.1|TOMCBPC2 Tomato chlorophyll a/b-binding protein Cab-1A gene , 3' end
          Length = 351

 Score =  226 bits (114), Expect = 7e-56
 Identities = 285/342 (83%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||| |||||||||||||| |||||||| ||||| ||||||||||| ||||| || ||
Sbjct: 351 tcactttccgggaacaaagtttgtggcaaatgcccaggcgttgttgtttacagggtctgc 292

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            || || |||||||||||||| |  || ||||| ||||| ||||| ||||| || |||||
Sbjct: 291 aaggtgatcagcaaggttctccaatggaccctttccggtaacaatggcctgaacaaagaa 232

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
            |||||||| |||||||| ||||| |  || ||||||| ||| || ||||| ||||| ||
Sbjct: 231 cccaaacatagagaacatagcaagtctgccgttcttgatctccttaaccttaagctcagc 172

                                                                       
Query: 296 gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
            |||||||| ||||| || || ||||| |  ||||||||||||||||| |||||||||||
Sbjct: 171 aaatgcctccgggtcttcagcaaggcctaatgggtcgaagctgccaccggggtagagtgg 112

                                                                       
Query: 356 atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
            || || |||||||| || || ||||||||||||||||| || |||||||| ||||| | 
Sbjct: 111 gtcgacaacctcaccaagaggtccaccagcaatgcggtatccctcaacggctcccatcaa 52

                                                     
Query: 416 cacgacttgacatgcccagatagcaaggatgctttgtgcatg 457
           ||| ||||| || |||||||| || | |||||||||||||||
Sbjct: 51  cacaacttggcaagcccagatggccaagatgctttgtgcatg 10



to top

>emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding protein cab 13
          Length = 1019

 Score =  224 bits (113), Expect = 3e-55
 Identities = 377/465 (81%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||| || |||||||| || |||||||| ||||| || |||||||| || || || ||
Sbjct: 922 tcactttcccggaacaaaatttgtggcaaaggcccacgcattgttgttaacggggtcagc 863

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            || || ||||| |||||||| |  || || || |||||||||||||| || || |||||
Sbjct: 862 aaggtgatcagcgaggttctccaatggaccttttccggtgacaatagcttgtacaaagaa 803

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
            ||||||||||||||||| ||||| |  |||||||||| ||| || |||| |||||| ||
Sbjct: 802 tccaaacatggagaacatagcaagtctaccattcttgatctccttcacctcgagctcggc 743

                                                                       
Query: 296 gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
            || || ||||||||||| || ||||| |  ||||||||||| ||||||||||| |||||
Sbjct: 742 aaaagcttctgggtcatcagcaaggcctaatgggtcgaagctaccaccagggtatagtgg 683

                                                                       
Query: 356 atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
           ||| |  ||||||||||| || ||||||||||  ||||| || ||||| || ||||| | 
Sbjct: 682 atcgataacctcaccgagaggaccaccagcaacacggtaaccctcaacagctcccatcaa 623

                                                                       
Query: 416 cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
           ||| ||||| || |||||||| || | |||||||||||| || || |  || ||||||||
Sbjct: 622 cacaacttggcaagcccagatggccaagatgctttgtgcgtgaaccaaacttgggttgcc 563

                                                                       
Query: 476 gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
            | |||||| || ||||| ||  |||| ||||| || || ||||||||||||||||| ||
Sbjct: 562 caagtagtcaagtccaccctctttgaatatttgagatccagccttgaaccatacagcttc 503

                                                        
Query: 536 accgaacttgactccattgcgcgcaagaagctcggggaagacgca 580
           ||| |||||||| ||||| || ||||  ||||| |||||||||||
Sbjct: 502 accaaacttgacaccattacgggcaaagagctcagggaagacgca 458



to top

>dbj|AB013728.1| Cryptomeria japonica mRNA for light-harvesting chlorophyll
           a/b-binding protein of photosystem II, complete cds
          Length = 935

 Score =  222 bits (112), Expect = 1e-54
 Identities = 382/472 (80%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| ||||||||||||||||||||| | ||||| ||||||||||||||||| || |
Sbjct: 813 ctcacttcccgggaacaaagttagtggcataagcccaggcgttgttgttgacagggtctg 754

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | |||||||| || | |||||| ||||| || || ||||| || |||||||||||| |||
Sbjct: 753 ccagatggtcggccaagttctccaggggaccttttccggtaacgatagcctgcacgtaga 694

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | |||||||| || ||||| ||||| || |||||||||| ||| || ||||| ||||| |
Sbjct: 693 acccaaacatagaaaacatagcaagccggccattcttgatctccttaaccttaagctctg 634

                                                                       
Query: 295 cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
           | || ||||| |||||||| || | |||||| || || ||||| ||||| || || || |
Sbjct: 633 caaaagcctcagggtcatcagccaagccgaggggatcaaagctcccaccgggataaagcg 574

                                                                       
Query: 355 gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
           | |||   | ||| ||||| || |||||||| |  ||||| || |||||||| |||||||
Sbjct: 573 ggtcagtgatctccccgagcggtccaccagccacacggtagccctcaacggcacccatga 514

                                                                       
Query: 415 gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
           | | ||| || ||||||||||| ||||||||||| ||||| ||||| |||||||||||||
Sbjct: 513 ggatgacctggcatgcccagatggcaaggatgctctgtgcgtgcaccaggctagggttgc 454

                                                                       
Query: 475 cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
           | |  ||||| |  || || || |||||||| || ||||| ||||||||||| || || |
Sbjct: 453 ccaaatagtccaaaccgccctcactgaagatctgtgagcccgccttgaaccaaaccgctt 394

                                                               
Query: 535 caccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgag 586
           | |||||||| || ||||| ||    |||||||| ||||| ||||| |||||
Sbjct: 393 ccccgaacttcacaccatttcggctcagaagctccgggaaaacgcacccgag 342



to top

>gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB3) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1011

 Score =  218 bits (110), Expect = 2e-53
 Identities = 427/530 (80%), Gaps = 2/530 (0%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           ||||||||||||| ||||||| || || || ||||| || |||||||| || || || ||
Sbjct: 860 tcacttgccgggagcaaagtttgtagcgaaggcccaagcattgttgttaactgggtctgc 801

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            ||||| ||||| |||||||| |  || ||||| ||||| ||||| || || || |||||
Sbjct: 800 aagatgatcagcgaggttctccaatggaccctttccggtcacaatggcttggacaaagaa 741

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
            || ||||| |||||||| || |  |  |||||||||| ||| || ||||| | ||| ||
Sbjct: 740 cccgaacattgagaacatagctaatctaccattcttgatctccttcaccttcaactcggc 681

                                                                       
Query: 296 gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
            || ||||||||||| ||||||||||| |  ||||| ||||| ||||| |||||||||||
Sbjct: 680 aaaggcctctgggtcctcggctaggcccaatgggtcaaagctaccaccggggtagagtgg 621

                                                                       
Query: 356 atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
            || | ||||||||| ||||| ||||| ||||  ||||| || |||| ||||||||| | 
Sbjct: 620 gtcgatcacctcaccaagtggcccaccggcaacacggtagccctcaatggcgcccatcaa 561

                                                                       
Query: 416 cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
            |  |||||||||||||| || || ||||||||||| || || || |  || ||||||||
Sbjct: 560 gataacttgacatgcccaaatggcgaggatgctttgagcgtggaccaaacttgggttgcc 501

                                                                       
Query: 476 gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
            | ||||||||| ||||| || || ||||||||||  || ||||||||||| ||||||||
Sbjct: 500 caagtagtcgagtccaccctcactaaagatttgggctccagccttgaaccaaacagcctc 441

                                                                       
Query: 536 accgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgag 595
           |||||| ||||| || ||||| || |  ||||| |||||||| ||||| || || || | 
Sbjct: 440 accgaatttgacaccgttgcgggccaagagctctgggaagacacatcctagagctcctaa 381

                                                             
Query: 596 catggcccaccttgcagtggatcacctcaagcttcccggttctttgcaaa 645
           ||||||||||| | |||||||||||||||||| || |||||||| |||||
Sbjct: 380 catggcccacc-tacagtggatcacctcaagc-tcacggttcttagcaaa 333



to top

>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein
          Length = 1006

 Score =  216 bits (109), Expect = 7e-53
 Identities = 404/501 (80%), Gaps = 1/501 (0%)
 Strand = Plus / Minus

                                                                       
Query: 120 ttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgaga 179
           |||||||| || ||||| |||||  | ||||| ||||||||||| || || || || || 
Sbjct: 869 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtcagccagg 810

                                                                       
Query: 180 tggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagcca 239
           || ||||| |||||||||| ||| || || ||||||||||| |||||||||||||| || 
Sbjct: 809 tgatcagcgaggttctcgatgggtcctttcccggtgacaatggcctgcacgaagaatccg 750

                                                                       
Query: 240 aacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaat 299
           |||||||| |||||||| |  ||||| ||||||| ||| || ||||| ||||||||||| 
Sbjct: 749 aacatggaaaacatggccaaccgcccgttcttgatctccttcaccttcagctccgcgaaa 690

                                                                       
Query: 300 gcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatca 359
           ||||| ||||| || || || || ||||||||||||||||| || |||||||  || || 
Sbjct: 689 gcctcagggtcttccgcaagtcccagcgggtcgaagctgccccctgggtagatggggtcg 630

                                                                       
Query: 360 accacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacg 419
             |||||| || || || || || ||||| ||||| || || |||||||||||||| |  
Sbjct: 629 gtcacctctcccagaggaccgcccgcaatacggtatccctccacggcgcccatgaggata 570

                                                                       
Query: 420 acttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgagg 479
           || || ||||||||||| ||||| ||||| || || || || | ||||||||| || |||
Sbjct: 569 acctggcatgcccagattgcaagaatgctctgcgcgtgaaccaagctagggtttcccagg 510

                                                                       
Query: 480 tagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccg 539
           ||||| || || || |||||||| || || |  || ||||||||||| || |||||||||
Sbjct: 509 tagtcaagccctccctcgctgaaaatctgagctcccgccttgaaccagacggcctcaccg 450

                                                                       
Query: 540 aacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatg 599
           ||||| |||||||| | ||| |||||||| ||||| ||||| || || || || ||||| 
Sbjct: 449 aactttactccatttctcgccagaagctccgggaaaacgcaacccagagcgcccagcatt 390

                                
Query: 600 gcccaccttgcagtggatcac 620
           |||||||  ||||||||||||
Sbjct: 389 gcccacc-ggcagtggatcac 370



to top

>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           3C (LHCP) mRNA, partial cds
          Length = 661

 Score =  214 bits (108), Expect = 3e-52
 Identities = 410/508 (80%), Gaps = 2/508 (0%)
 Strand = Plus / Minus

                                                                       
Query: 132 aagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgagatggtcagcaagg 191
           ||||| |||||||||||||| || ||||||||||| |||||||| || || || || | |
Sbjct: 658 aagttggtggcaaacgcccaggcattgttgttgacgggatcggcaaggtgatcggccaag 599

                                                                       
Query: 192 ttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaacatggagaac 251
           ||||| || || |||||||| || || || ||||| || ||||| || ||||| ||||||
Sbjct: 598 ttctccagtggccccttgcccgtcacgatcgcctgaacaaagaacccgaacatcgagaac 539

                                                                       
Query: 252 atggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcctctgggtca 311
           || || || |  |||||||||| ||| || ||||| ||||| || || |||||||| || 
Sbjct: 538 atagccagcctgccattcttgatctccttcaccttcagctcggcaaaggcctctggatcg 479

                                                                       
Query: 312 tcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaaccacctcaccg 371
           ||||| ||||| |  |||||||||||||| || ||||| ||||| || || ||||| |||
Sbjct: 478 tcggcgaggcccaaggggtcgaagctgccgccggggtacagtgggtcgacgacctcgccg 419

                                                                       
Query: 372 agtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgacttgacatgcc 431
           || || || || ||||  | ||| || || ||||| |||||||| | ||| |||   |||
Sbjct: 418 agcggcccgccggcaactctgtatccctcgacggcccccatgagaaggacctgagtcgcc 359

                                                                       
Query: 432 cagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgaggcca 491
           || || || || ||||| ||||| || || |||||||||||||| |||||||| |  || 
Sbjct: 358 catatggccagaatgctctgtgcgtggaccaggctagggttgcccaggtagtccaatccg 299

                                                                       
Query: 492 ccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaacttgactcca 551
           || ||||||||||| |||| ||| ||||||||||| || ||||| |||||||| || || 
Sbjct: 298 ccctcgctgaagatctgggcgccggccttgaaccagaccgcctcgccgaacttcacgccg 239

                                                                       
Query: 552 ttgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggcccaccttgca 611
           ||||| || || ||||||||||||||||| ||||| || || ||||| ||||||| ||||
Sbjct: 238 ttgcgggcgaggagctcggggaagacgcagccgagagcgcccagcattgcccacc-tgca 180

                                       
Query: 612 gtggatcacctcaagcttcccggttctt 639
           |||||||||||| ||| |||||||||||
Sbjct: 179 gtggatcacctcgagc-tcccggttctt 153



to top

>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein
          Length = 1197

 Score =  212 bits (107), Expect = 1e-51
 Identities = 392/487 (80%)
 Strand = Plus / Minus

                                                                       
Query: 120 ttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgaga 179
           |||||||| || ||||| |||||| | ||||| ||||||||| | || || ||||| || 
Sbjct: 884 ttgccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggccagg 825

                                                                       
Query: 180 tggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagcca 239
           || ||||| |||||||||| ||| || || |||||||| || |||||||||||||| || 
Sbjct: 824 tgatcagcgaggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccg 765

                                                                       
Query: 240 aacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaat 299
           |||||||| |||||||| |  ||||| ||||||| ||| || ||||| ||||||||||| 
Sbjct: 764 aacatggaaaacatggccaaccgcccgttcttgatctccttcaccttcagctccgcgaaa 705

                                                                       
Query: 300 gcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatca 359
           || || ||||| || || || || ||||||||||||||||| || |||||||  || || 
Sbjct: 704 gcgtcggggtcgtcagcaagtcccagcgggtcgaagctgcccccggggtagatggggtcg 645

                                                                       
Query: 360 accacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacg 419
             |||||| || || || || || ||||| ||||| || || |||||||||||||| | |
Sbjct: 644 gtcacctctcccagaggaccgcccgcaatacggtagccctccacggcgcccatgaggatg 585

                                                                       
Query: 420 acttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgagg 479
           || || ||||||||||| ||||| ||||| || || || || | ||||||||| || |||
Sbjct: 584 acctggcatgcccagattgcaagaatgctctgcgcgtgaaccaagctagggtttcccagg 525

                                                                       
Query: 480 tagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccg 539
           ||||| || || || |||||||| || || |  || ||||||||||| || |||||||||
Sbjct: 524 tagtcaagccctccctcgctgaaaatctgagctcccgccttgaaccacacggcctcaccg 465

                                                                       
Query: 540 aacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatg 599
           ||||| |||||||| | ||| |||||||| ||||| ||||| || || || || ||||| 
Sbjct: 464 aactttactccatttctcgccagaagctccgggaaaacgcaacccagagcgcccagcatt 405

                  
Query: 600 gcccacc 606
           |||||||
Sbjct: 404 gcccacc 398



to top

>gb|AY617091.1| Pinus strobus chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score =  210 bits (106), Expect = 4e-51
 Identities = 353/436 (80%)
 Strand = Plus / Minus

                                                                       
Query: 171 tcggcgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacg 230
           |||||||| || ||||| |||||||||| ||| ||||| |||||||| || |||||||||
Sbjct: 763 tcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacgatggcctgcacg 704

                                                                       
Query: 231 aagaagccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagc 290
           ||||| || |||||||| |||||||| | |||||| ||||||| ||| || ||||| |||
Sbjct: 703 aagaatccgaacatggaaaacatggccaagcgcccgttcttgagctccttcaccttcagc 644

                                                                       
Query: 291 tccgcgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtag 350
           |||||||| || || ||||| || || || || |  ||||||||||||||||| ||||||
Sbjct: 643 tccgcgaaagcgtcggggtcgtctgcaagtcccaaggggtcgaagctgccaccggggtag 584

                                                                       
Query: 351 agtggatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgccc 410
           |  || ||   |||||| || || ||||| |||||||| ||||| || || |||||||||
Sbjct: 583 atggggtcrgtcacctctcccagagggccgccagcaatacggtaaccctccacggcgccc 524

                                                                       
Query: 411 atgagcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctaggg 470
           ||||| | ||| || ||||||||||| ||||| ||||| || || || |  |||||||||
Sbjct: 523 atgaggatgacctggcatgcccagattgcaagaatgctctgcgcgtggataaggctaggg 464

                                                                       
Query: 471 ttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccataca 530
           || || |||||||| || || || |||||||| || || |  || ||||||||||| || 
Sbjct: 463 tttcccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaaccacact 404

                                                                       
Query: 531 gcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgca 590
           ||||| |||||||| ||||||||   ||| |||||||| ||||| ||||| || || || 
Sbjct: 403 gcctckccgaactttactccatttttcgccagaagctccgggaaaacgcaacccagagcg 344

                           
Query: 591 ccgagcatggcccacc 606
           || ||||| |||||||
Sbjct: 343 cccagcattgcccacc 328



to top

>emb|X02360.1|PECAB22R Petunia gene for chlorophyll a/b binding protein cab 22R
          Length = 1187

 Score =  210 bits (106), Expect = 4e-51
 Identities = 426/530 (80%), Gaps = 2/530 (0%)
 Strand = Plus / Minus

                                                                        
Query: 116  tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
            |||||| |||||||||||||| || ||| | | |||||| |||||||| || ||||| ||
Sbjct: 1034 tcactttccgggaacaaagtttgtagcataggaccatgcattgttgttaactggatcagc 975

                                                                        
Query: 176  gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
             || || || ||||||||||| |  || ||||| |||||||| ||||||||||| |||||
Sbjct: 974  aaggtgatcggcaaggttctccaatggaccctttccggtgacgatagcctgcacaaagaa 915

                                                                        
Query: 236  gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
             |||||||| |||||||| ||||| |  |||||||| | ||| || ||||||||||| ||
Sbjct: 914  tccaaacatagagaacatagcaagtctaccattcttaatctccttcaccttgagctcagc 855

                                                                        
Query: 296  gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
             || || || ||||| || |||||||| |  || |||||||| |||||||| || |||||
Sbjct: 854  aaaagcttcggggtcttcagctaggcccaatggatcgaagctaccaccaggataaagtgg 795

                                                                        
Query: 356  atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
             ||||  ||||||||||| || ||||||||||  ||||| || ||||| || ||||| | 
Sbjct: 794  gtcaataacctcaccgagaggtccaccagcaacacggtaaccctcaacagctcccatcaa 735

                                                                        
Query: 416  cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
            ||||||||| || ||||| || || | |||||||||||| || || |  || ||||||||
Sbjct: 734  cacgacttggcaagcccaaatggccaagatgctttgtgcgtgaaccaaacttgggttgcc 675

                                                                        
Query: 476  gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
             | |||||| || ||||| || ||||| ||||| |  || ||||||||||||||||||||
Sbjct: 674  caagtagtcaagtccaccctcactgaaaatttgagctccagccttgaaccatacagcctc 615

                                                                        
Query: 536  accgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgag 595
            |||||| ||||  ||||| || ||||  || || |||||||| || || || || || ||
Sbjct: 614  accgaatttgataccattacgggcaaagagttcagggaagacacaaccaagagctccaag 555

                                                              
Query: 596  catggcccaccttgcagtggatcacctcaagcttcccggttctttgcaaa 645
            ||||||||| | | |||||||| ||||| ||| || |||||||| |||||
Sbjct: 554  catggcccatc-tacagtggatgacctccagc-tcacggttcttggcaaa 507



to top

>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear
           gene encoding chloroplast protein, complete cds
          Length = 977

 Score =  210 bits (106), Expect = 4e-51
 Identities = 407/506 (80%), Gaps = 1/506 (0%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||||||||| || ||||| |||||  | ||||| || ||||||||||| || || |
Sbjct: 824 ctcacttgccggggacgaagttggtggcgtaggcccaggcattgttgttgactgggtccg 765

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | || || |||||||||||||| |  || ||||| ||||||||||| ||||| || ||||
Sbjct: 764 caaggtgatcagcaaggttctccaatggacccttaccggtgacaatggcctgaacaaaga 705

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | |||||||| ||||||||||| |  | ||| |||||||  || || ||||| ||||| |
Sbjct: 704 acccaaacatagagaacatggccaatctcccgttcttgagttccttcaccttaagctcag 645

                                                                       
Query: 295 cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
           | || |||||||||||||| || ||||| |  ||||| ||||||||||||||||||| ||
Sbjct: 644 caaaagcctctgggtcatcagcaaggcccaatgggtcaaagctgccaccagggtagattg 585

                                                                       
Query: 355 gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
           | |||   ||||||||||| || ||||||||||| || || || ||||| || ||||| |
Sbjct: 584 ggtcagtgacctcaccgaggggcccaccagcaatacgataaccctcaacagcacccatta 525

                                                                       
Query: 415 gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
           | |  |||||    |||||||| || |||||||| || || || || ||||| |||||||
Sbjct: 524 ggataacttgggtggcccagatggcgaggatgctctgggcgtggacaaggcttgggttgc 465

                                                                       
Query: 475 cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
           | | |||||| || ||||| ||||||||||| ||||| || ||||||||||| ||||| |
Sbjct: 464 ccaagtagtccagcccaccctcgctgaagatctgggacccggccttgaaccacacagctt 405

                                                                       
Query: 535 caccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccga 594
           | || |||||||| || ||||| |  |  || |||||||||||||| || |  || ||||
Sbjct: 404 ctccaaacttgaccccgttgcgggacaatagttcggggaagacgcagcccaaggccccga 345

                                     
Query: 595 gcatggcccaccttgcagtggatcac 620
           |||||||||||| || ||||||||||
Sbjct: 344 gcatggcccacc-tggagtggatcac 320



to top

>gb|M30618.1|TOMCBPD2 Tomato chlorophyll a/b-binding protein Cab-1C gene, 3' end
          Length = 351

 Score =  210 bits (106), Expect = 4e-51
 Identities = 283/342 (82%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||| |||||||||||||| |||||||| ||||| ||||||||||| || || || ||
Sbjct: 351 tcactttccgggaacaaagtttgtggcaaaagcccaggcgttgttgtttactgggtctgc 292

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            || || |||||||||||||| |  || ||||| ||||| ||||| || || || |||||
Sbjct: 291 aaggtgatcagcaaggttctccaatggaccctttccggtaacaatggcttgaacaaagaa 232

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
            |||||||| |||||||| ||||| |  || ||||||| ||| |||||||||||||| ||
Sbjct: 231 tccaaacatagagaacatagcaagtctaccgttcttgatctcctttaccttgagctcagc 172

                                                                       
Query: 296 gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
            |||||||||||||| || || ||||| |  ||||||||||| ||||| |||||||||||
Sbjct: 171 aaatgcctctgggtcttcagcaaggcctaatgggtcgaagcttccacctgggtagagtgg 112

                                                                       
Query: 356 atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
            || || |||||||| || || ||||||||||| ||||| |||||||| || ||||| | 
Sbjct: 111 gtcgacaacctcaccaagaggtccaccagcaatacggtaaccttcaacagctcccatcaa 52

                                                     
Query: 416 cacgacttgacatgcccagatagcaaggatgctttgtgcatg 457
           ||| ||||| || ||||| || || | |||||||||||||||
Sbjct: 51  cacaacttggcaagcccaaatggccaagatgctttgtgcatg 10



to top

>gb|AY617090.1| Pinus monticola chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score =  206 bits (104), Expect = 7e-50
 Identities = 353/436 (80%)
 Strand = Plus / Minus

                                                                       
Query: 171 tcggcgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacg 230
           |||||||| || ||||| |||||||||| ||| ||||| |||||||| || |||||||||
Sbjct: 763 tcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacgatggcctgcacg 704

                                                                       
Query: 231 aagaagccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagc 290
           ||||| || |||||||| |||||||| | |||||| ||||||| ||| || ||||| |||
Sbjct: 703 aagaatccgaacatggaaaacatggccaagcgcccgttcttgagctccttcaccttcagc 644

                                                                       
Query: 291 tccgcgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtag 350
           |||||||| || || ||||| || || || || |  ||||||||||||||||| ||||||
Sbjct: 643 tccgcgaaagcgtcggggtcgtctgcaagtcccaaggggtcgaagctgccaccggggtag 584

                                                                       
Query: 351 agtggatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgccc 410
           |  || ||   |||||| || || ||||| |||||||| ||||| || || |||||||||
Sbjct: 583 atggggtcggtcacctctcccagagggccgccagcaatacggtaaccctccacggcgccc 524

                                                                       
Query: 411 atgagcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctaggg 470
           ||||| | ||| || ||||||||||| ||||| ||||| || || || |  |||||||||
Sbjct: 523 atgaggatgacctggcatgcccagattgcaagaatgctctgcgcgtggataaggctaggg 464

                                                                       
Query: 471 ttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccataca 530
           || || |||||||| || || || |||||||| || || |  || ||||||||||| || 
Sbjct: 463 tttccaaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaaccacact 404

                                                                       
Query: 531 gcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgca 590
           ||||| |||||||| ||||||||   ||| |||||||| ||||| ||||| || || || 
Sbjct: 403 gcctccccgaactttactccatttttcgccagaagctccgggaaaacgcaacccagagcg 344

                           
Query: 591 ccgagcatggcccacc 606
           || ||||| |||||||
Sbjct: 343 cccagcattgcccacc 328



to top

>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein
          Length = 2574

 Score =  204 bits (103), Expect = 3e-49
 Identities = 391/487 (80%)
 Strand = Plus / Minus

                                                                        
Query: 120  ttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgaga 179
            |||||||| || ||||| |||||| | ||||| ||||||||| | || || ||||| || 
Sbjct: 1962 ttgccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggccagg 1903

                                                                        
Query: 180  tggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagcca 239
            || ||||| |||||||||| ||| || || |||||||| || |||||||||||||| || 
Sbjct: 1902 tgatcagcgaggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccg 1843

                                                                        
Query: 240  aacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaat 299
            |||||||| |||||||| |  ||||| ||||||| ||| || ||||| ||||| ||||| 
Sbjct: 1842 aacatggaaaacatggccaaccgcccgttcttgatctccttcaccttcagctctgcgaaa 1783

                                                                        
Query: 300  gcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatca 359
            || || ||||| || || || || ||||||||||||||||| || |||||||  || || 
Sbjct: 1782 gcgtcggggtcgtccgcaagtcccagcgggtcgaagctgcccccggggtagatggggtcg 1723

                                                                        
Query: 360  accacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacg 419
              |||||| || || || || || ||||| ||||| || || |||||||||||||| | |
Sbjct: 1722 gtcacctctcccagaggaccgcccgcaatacggtagccctccacggcgcccatgaggatg 1663

                                                                        
Query: 420  acttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgagg 479
            || || ||||||||||| ||||| ||||| || || || || | ||||||||| || |||
Sbjct: 1662 acctggcatgcccagattgcaagaatgctctgcgcgtgaaccaagctagggtttcccagg 1603

                                                                        
Query: 480  tagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccg 539
            ||||| || || || |||||||| || || |  || ||||||||||| || |||||||||
Sbjct: 1602 tagtcaagccctccctcgctgaaaatctgagctcccgccttgaaccacacggcctcaccg 1543

                                                                        
Query: 540  aacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatg 599
            ||||| |||||||| | ||| |||||||| ||||| ||||| || || || || ||||| 
Sbjct: 1542 aactttactccatttctcgccagaagctccgggaaaacgcaacccagagcgcccagcatt 1483

                   
Query: 600  gcccacc 606
            |||||||
Sbjct: 1482 gcccacc 1476



to top

>gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score =  202 bits (102), Expect = 1e-48
 Identities = 364/450 (80%), Gaps = 1/450 (0%)
 Strand = Plus / Minus

                                                                       
Query: 171 tcggcgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacg 230
           |||||||| || ||||| |||||||||| ||| ||||| |||||||| || ||||| |||
Sbjct: 763 tcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacgatggcctgaacg 704

                                                                       
Query: 231 aagaagccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagc 290
           ||||| || |||||||| |||||||| | |||||| ||||||| ||| || ||||| |||
Sbjct: 703 aagaatccgaacatggaaaacatggccaagcgcccgttcttgatctccttcaccttcagc 644

                                                                       
Query: 291 tccgcgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtag 350
           |||||||| || || ||||| || || || || |  ||||||||||||||||| ||||||
Sbjct: 643 tccgcgaaagcgtcggggtcgtctgcaagtcccaaggggtcgaagctgccaccggggtag 584

                                                                       
Query: 351 agtggatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgccc 410
           |  || ||   |||||| || || ||||| || ||||| ||||| || || |||||||||
Sbjct: 583 atggggtcggtcacctctcccagagggccgccggcaatacggtaaccctccacggcgccc 524

                                                                       
Query: 411 atgagcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctaggg 470
           ||||| | ||| || ||||||||||| ||||| || || || || || |  |||||||||
Sbjct: 523 atgaggatgacctggcatgcccagattgcaagaatactctgcgcgtggataaggctaggg 464

                                                                       
Query: 471 ttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccataca 530
           || || |||||||| || || || |||||||| || || |  || ||||||||||| || 
Sbjct: 463 tttcccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaaccagact 404

                                                                       
Query: 531 gcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgca 590
           ||||| |||||||| |||||||| | |||||||||||| ||||| ||||| || || || 
Sbjct: 403 gcctccccgaactttactccatttctcgcaagaagctccgggaaaacgcaacccagagcg 344

                                         
Query: 591 ccgagcatggcccaccttgcagtggatcac 620
           || ||||| |||||||  ||||||||||||
Sbjct: 343 cccagcattgcccacc-ggcagtggatcac 315



to top

>gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 759

 Score =  202 bits (102), Expect = 1e-48
 Identities = 364/450 (80%), Gaps = 1/450 (0%)
 Strand = Plus / Minus

                                                                       
Query: 171 tcggcgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacg 230
           |||||||| || ||||| |||||||||| ||| ||||| ||||||||||| ||||| |||
Sbjct: 752 tcggcgaggtgatcagcgaggttctcgatgggtcccttcccggtgacaatggcctgaacg 693

                                                                       
Query: 231 aagaagccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagc 290
           ||||| || |||||||| |||||||| | |||||| ||||||| ||| || ||||| |||
Sbjct: 692 aagaatccgaacatggaaaacatggccaagcgcccgttcttgatctccttcaccttcagc 633

                                                                       
Query: 291 tccgcgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtag 350
           |||||||| || || ||||| || || || || |  ||||||||||||||||| ||||||
Sbjct: 632 tccgcgaaagcgtcggggtcgtctgcaagtcccaaggggtcgaagctgccaccggggtag 573

                                                                       
Query: 351 agtggatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgccc 410
           |  || ||   |||||| || || ||||| || ||||| ||||| || || |||||||||
Sbjct: 572 atggggtcggtcacctctcccagagggccgccggcaatacggtaaccctccacggcgccc 513

                                                                       
Query: 411 atgagcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctaggg 470
           ||||| | ||| || ||||||||||| ||||| ||||| || || || |  |||||||||
Sbjct: 512 atgaggatgacctggcatgcccagattgcaagaatgctctgcgcgtggataaggctaggg 453

                                                                       
Query: 471 ttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccataca 530
           || || |||||||| || || || |||||||| || || |  || ||||||||||| |||
Sbjct: 452 tttcccaggtagtcaagycctccctcgctgaaaatctgagctcccgccttgaaccacaca 393

                                                                       
Query: 531 gcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgca 590
           || || |||||||| |||||||| |  || |||||||| ||||| ||||| || || || 
Sbjct: 392 gcttccccgaactttactccatttctggccagaagctccgggaaaacgcaacccagagcg 333

                                         
Query: 591 ccgagcatggcccaccttgcagtggatcac 620
           || ||||| |||||||  ||||||||||||
Sbjct: 332 cccagcattgcccacc-ggcagtggatcac 304



to top

>gb|AY617092.1| Pinus monophylla chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score =  202 bits (102), Expect = 1e-48
 Identities = 364/450 (80%), Gaps = 1/450 (0%)
 Strand = Plus / Minus

                                                                       
Query: 171 tcggcgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacg 230
           |||||||| || ||||| |||||||||| ||| ||||| |||||||| || ||||| |||
Sbjct: 763 tcggcgaggtgatcagcgaggttctcgatgggtcccttcccggtgacgatggcctgkacg 704

                                                                       
Query: 231 aagaagccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagc 290
           ||||| || |||||||| |||||||| | |||||| ||||||| ||| || ||||| |||
Sbjct: 703 aagaatccgaacatggaaaacatggccaagcgcccgttcttgatctccttcaccttcagc 644

                                                                       
Query: 291 tccgcgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtag 350
           |||||||| || || ||||| || || || || |  ||||||||||||||||| ||||||
Sbjct: 643 tccgcgaaagcgtcggggtcgtctgcaagtcccaaggggtcgaagctgccaccggggtag 584

                                                                       
Query: 351 agtggatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgccc 410
           |  || ||   |||||| || || ||||| || ||||| ||||| || || |||||||||
Sbjct: 583 atagggtctgtcacctctcccagagggccgccggcaatacggtaaccctccacggcgccc 524

                                                                       
Query: 411 atgagcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctaggg 470
           ||||| | ||| || ||||||||||| ||||| ||||| || || || |  |||||||||
Sbjct: 523 atgaggatgacctggcatgcccagattgcaagaatgctctgcgcgtggataaggctaggg 464

                                                                       
Query: 471 ttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccataca 530
           || || |||||||| || || || |||||||| || || |  || ||||||||||| |||
Sbjct: 463 tttcccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaaccacaca 404

                                                                       
Query: 531 gcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgca 590
           || || |||||||| |||||||| | ||| |||||||| ||||| ||||| || || || 
Sbjct: 403 gcttccccgaactttactccatttctcgccagaagctcygggaaaacgcaacccagagcg 344

                                         
Query: 591 ccgagcatggcccaccttgcagtggatcac 620
           || ||||| |||||||  ||||||||||||
Sbjct: 343 cccagcattgcccacc-ggcagtggatcac 315



to top

>gb|AY617089.1| Pinus lambertiana chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score =  202 bits (102), Expect = 1e-48
 Identities = 352/436 (80%)
 Strand = Plus / Minus

                                                                       
Query: 171 tcggcgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacg 230
           |||||||| || ||||| |||||||||| ||| ||||| |||||||| || |||||||||
Sbjct: 763 tcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacgatggcctgcacg 704

                                                                       
Query: 231 aagaagccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagc 290
           ||||| || |||||||| |||||||| | |||||| ||||||| ||| || ||||| |||
Sbjct: 703 aagaatccgaacatggaaaacatggccaagcgcccgttcttgagctccttcaccttcagc 644

                                                                       
Query: 291 tccgcgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtag 350
           |||||||| || || || || || || || || |  ||||||||||||||||| ||||||
Sbjct: 643 tccgcgaaagcgtcrggrtcgtctgcaagtcccaaggggtcgaagctgccaccggggtag 584

                                                                       
Query: 351 agtggatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgccc 410
           |  || ||   |||||| || || ||||| |||||||| ||||| || || |||||||||
Sbjct: 583 atggggtcggtcacctctcccagagggccgccagcaatacggtaaccctccacggcgccc 524

                                                                       
Query: 411 atgagcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctaggg 470
           ||||| | ||| || ||||||||||| ||||| ||||| || || || |  |||||||||
Sbjct: 523 atgaggatgacctggcatgcccagattgcaagaatgctctgcgcgtggataaggctaggg 464

                                                                       
Query: 471 ttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccataca 530
           || || |||||||| || || || |||||||| || || |  || ||||||||||| || 
Sbjct: 463 tttccaaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaaccacact 404

                                                                       
Query: 531 gcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgca 590
           ||||| |||||||| ||||||||   ||| |||||||| ||||| ||||| || || || 
Sbjct: 403 gcctccccgaactttactccatttttcgccagaagctccgggaaaacgcaacccagrgcg 344

                           
Query: 591 ccgagcatggcccacc 606
           || ||||| |||||||
Sbjct: 343 cccagcattgcccacc 328



to top

>gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score =  202 bits (102), Expect = 1e-48
 Identities = 352/436 (80%)
 Strand = Plus / Minus

                                                                       
Query: 171 tcggcgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacg 230
           |||||||| || ||||| |||||||||| ||| ||||| |||||||| || |||||||||
Sbjct: 763 tcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacgatggcctgcacg 704

                                                                       
Query: 231 aagaagccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagc 290
           ||||| || |||||||| |||||||| | ||| || ||||||| ||| || ||||| |||
Sbjct: 703 aagaatccgaacatggaaaacatggccaagcgyccgttcttgagctccttcaccttcagc 644

                                                                       
Query: 291 tccgcgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtag 350
           |||||||| || || ||||| || || || || |  ||||||||||||||||| ||||||
Sbjct: 643 tccgcgaaagcgtcggggtcgtctgcaagtcccaaggggtcgaagctgccaccggggtag 584

                                                                       
Query: 351 agtggatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgccc 410
           |  || ||   |||||| || || ||||| |||||||| ||||| || || |||||||||
Sbjct: 583 atggggtcggtcacctctcccagagggccgccagcaatacggtaaccctccacggcgccc 524

                                                                       
Query: 411 atgagcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctaggg 470
           ||||| | ||| || ||||||||||| ||||| ||||| || || || |  |||||||||
Sbjct: 523 atgaggatgacctggcatgcccagattgcaagaatgctctgcgcgtggataaggctaggg 464

                                                                       
Query: 471 ttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccataca 530
           || || |||||||| || || || |||||||| || || |  || ||||||||||| || 
Sbjct: 463 tttccaaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaaccacact 404

                                                                       
Query: 531 gcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgca 590
           ||||| |||||||| ||||||||   ||| |||||||| ||||| ||||| || || || 
Sbjct: 403 gcctccccgaactttactccatttttcgccagaagctccgggaaaacgcaacccagagcg 344

                           
Query: 591 ccgagcatggcccacc 606
           || ||||| |||||||
Sbjct: 343 cccagcattgcccacc 328



to top

>gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score =  202 bits (102), Expect = 1e-48
 Identities = 355/438 (81%), Gaps = 1/438 (0%)
 Strand = Plus / Minus

                                                                       
Query: 183 tcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaac 242
           ||||| |||||||||| ||| || || ||||||||||| |||||||||||||| || |||
Sbjct: 751 tcagcgaggttctcgatgggtcctttcccggtgacaatggcctgcacgaagaatccgaac 692

                                                                       
Query: 243 atggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcc 302
           ||||| |||||||| |  ||||| ||||||| ||| || ||||| ||||||||||| || 
Sbjct: 691 atggaaaacatggccaaccgcccgttcttgatctccttcaccttcagctccgcgaaagcg 632

                                                                       
Query: 303 tctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaacc 362
           || ||||| || || || || ||||||||||||||||| || |||||||  || ||   |
Sbjct: 631 tcagggtcgtccgcaagtcccagcgggtcgaagctgcccccggggtagatggggtcggtc 572

                                                                       
Query: 363 acctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgact 422
           ||||| || || || || || ||||| ||||| || || |||||||||||||| | ||| 
Sbjct: 571 acctctcccagaggaccgcccgcaatacggtatccctccacggcgcccatgaggatgacc 512

                                                                       
Query: 423 tgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtag 482
           || ||||||||||| ||||| ||||| || || || || | ||||||||| || ||||||
Sbjct: 511 tggcatgcccagattgcaagaatgctctgcgcgtgaaccaagctagggtttcctaggtag 452

                                                                       
Query: 483 tcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaac 542
           || || || || |||||||| || || |  || ||||||||||| || ||||||||||||
Sbjct: 451 tcaagccctccctcgctgaaaatctgagctcccgccttgaaccacacggcctcaccgaac 392

                                                                       
Query: 543 ttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggcc 602
           || |||||||| | ||| |||||||| ||||| ||||| || || || || ||||| |||
Sbjct: 391 ttaactccatttctcgccagaagctccgggaaaacgcaacccagagcgcccagcattgcc 332

                             
Query: 603 caccttgcagtggatcac 620
           ||||  ||||||||||||
Sbjct: 331 cacc-ggcagtggatcac 315



to top

>gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-3B gene, 3' end
          Length = 351

 Score =  202 bits (102), Expect = 1e-48
 Identities = 282/342 (82%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||| |||||||||||||| |||||||| ||||| ||||||||||| || || || ||
Sbjct: 351 tcactttccgggaacaaagtttgtggcaaaggcccaggcgttgttgttaactgggtcagc 292

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            |  ||||| ||||| ||||| |  || ||||| || ||||||||||| || || |||||
Sbjct: 291 aatgtggtcggcaagattctccaatggaccctttccagtgacaatagcttgaacaaagaa 232

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
           |||||||||||||||||| ||||| |  || ||||||| ||| || || |||||||| ||
Sbjct: 231 gccaaacatggagaacatagcaagtctgccgttcttgatctccttcactttgagctcagc 172

                                                                       
Query: 296 gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
            || ||||||||||| || || ||||| |  ||||| ||||| ||||||||||| |||||
Sbjct: 171 aaaagcctctgggtcttcagcaaggcccaatgggtcaaagctaccaccagggtaaagtgg 112

                                                                       
Query: 356 atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
           |||||| |||||||| || || ||||||||||| ||||| || |||||||| ||||| | 
Sbjct: 111 atcaacaacctcaccaagaggcccaccagcaatacggtaaccctcaacggctcccatcaa 52

                                                     
Query: 416 cacgacttgacatgcccagatagcaaggatgctttgtgcatg 457
           ||| ||||| || ||||| ||||| |  ||||||||||||||
Sbjct: 51  cacaacttggcaagcccaaatagccaaaatgctttgtgcatg 10



to top

>gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I chlorophyll a/b-binding
            protein (lhcb1*7) gene, complete cds
          Length = 1882

 Score =  200 bits (101), Expect = 4e-48
 Identities = 356/441 (80%)
 Strand = Plus / Minus

                                                                        
Query: 116  tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
            |||||| |||||||||||||| |||||| | ||||| || ||||||||||| || || ||
Sbjct: 1552 tcactttccgggaacaaagtttgtggcataagcccaagcattgttgttgactgggtcagc 1493

                                                                        
Query: 176  gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
             || || ||||||||||| || | ||| ||||| || || ||||| ||||| || |||||
Sbjct: 1492 aaggtgatcagcaaggttttccaagggtccctttcctgtcacaattgcctgaacaaagaa 1433

                                                                        
Query: 236  gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
             |||||||||||||||||||| |  |  |||||||||| |||||| ||||| | ||| ||
Sbjct: 1432 accaaacatggagaacatggccaacctaccattcttgagctctttcaccttcaactcagc 1373

                                                                        
Query: 296  gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
             || |||||||||||||| || ||||| |  ||||| ||||||||||| || |||| |||
Sbjct: 1372 aaaagcctctgggtcatcagcaaggcccaatgggtcaaagctgccacctggatagattgg 1313

                                                                        
Query: 356  atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
             |||  ||||||||| || || ||||||||||| ||||| || |||||||| ||||| | 
Sbjct: 1312 gtcagtcacctcaccaagaggcccaccagcaatacggtaaccctcaacggcacccatcaa 1253

                                                                        
Query: 416  cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
             |  |||||    |||||||| ||||| |||||||||||||| |  ||||| ||||||||
Sbjct: 1252 gataacttgggtggcccagatggcaagaatgctttgtgcatggatcaggcttgggttgcc 1193

                                                                        
Query: 476  gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
             | |||||| || ||||| || ||||| || || || || ||||||||||| || |||||
Sbjct: 1192 caagtagtcaagcccaccctcactgaatatctgagacccggccttgaaccacacggcctc 1133

                                 
Query: 536  accgaacttgactccattgcg 556
             || ||||||||||| |||||
Sbjct: 1132 gccaaacttgactccgttgcg 1112



to top

>gb|AY389573.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           40 (LHCP) mRNA, partial cds
          Length = 712

 Score =  198 bits (100), Expect = 2e-47
 Identities = 300/364 (82%), Gaps = 2/364 (0%)
 Strand = Plus / Minus

                                                                       
Query: 282 accttgagctccgcgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgcca 341
           ||||| ||||| || || |||| ||| || || |||||||| ||||||||||||||||| 
Sbjct: 593 accttcagctcggcaaaagcctttggatcgtcagctaggcccagcgggtcgaagctgccg 534

                                                                       
Query: 342 ccagggtagagtggatcaaccacctcaccgagtgggccaccagcaatgcggtacccttca 401
           || ||||| || || || || ||||| ||||| |||||||| ||||  | ||| || |||
Sbjct: 533 ccggggtacagggggtcgacaacctcgccgagggggccaccggcaactctgtatccctca 474

                                                                       
Query: 402 acggcgcccatgagcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacg 461
           || || |||||||| || || |||  ||||||||| || || ||||| ||||| || || 
Sbjct: 473 acagctcccatgagaacaacctgagttgcccagatggccagaatgctctgtgcgtggaca 414

                                                                       
Query: 462 aggctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttg 521
           ||||||||||| || |||||||| || || || ||||||||||| || || || ||||||
Sbjct: 413 aggctagggtttcccaggtagtccagcccgccctcgctgaagatctgagatccggccttg 354

                                                                       
Query: 522 aaccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcat 581
           |||||||| ||||| |||||||| || || ||||| ||||| ||||||||||||||||| 
Sbjct: 353 aaccataccgcctcgccgaacttcacaccgttgcgggcaaggagctcggggaagacgcag 294

                                                                       
Query: 582 ccgagcgcaccgagcatggcccaccttgcagtggatcacctcaagcttcccggttctttg 641
           ||||| ||||| ||||| |||||||  ||||||||||||||| ||| ||||||||||| |
Sbjct: 293 ccgagagcacccagcattgcccacc-ggcagtggatcacctcgagc-tcccggttcttgg 236

               
Query: 642 caaa 645
           ||||
Sbjct: 235 caaa 232



to top

>gb|DQ018376.1| Pinus krempfii chloroplast putative light harvesting chlorophyll
           a/b binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 752

 Score =  198 bits (100), Expect = 2e-47
 Identities = 343/424 (80%)
 Strand = Plus / Minus

                                                                       
Query: 183 tcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaac 242
           ||||| |||||||||| ||| |||||||||||||| || |||||||||||||| || |||
Sbjct: 748 tcagcgaggttctcgatgggtcccttgccggtgacgatggcctgcacgaagaatccgaac 689

                                                                       
Query: 243 atggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcc 302
           ||||| |||||||| | |||||| ||||||| ||| || ||||| ||||||||||| || 
Sbjct: 688 atggaaaacatggccaagcgcccgttcttgagctccttcaccttcagctccgcgaacgcg 629

                                                                       
Query: 303 tctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaacc 362
           || ||||| || || || || |  ||||||||||||||||| |||||||  || |||  |
Sbjct: 628 tcggggtcgtctgcaagtcccaaggggtcgaagctgccaccggggtagatggggtcagtc 569

                                                                       
Query: 363 acctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgact 422
           ||||| || |  ||||| |||||||| || || || || |||||||||||||| | ||| 
Sbjct: 568 acctctcccaaagggccgccagcaatacgataaccctccacggcgcccatgaggatgacc 509

                                                                       
Query: 423 tgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtag 482
           || | ||||||||| ||||| ||||| || || || |  ||||||||||| || ||||||
Sbjct: 508 tggcttgcccagattgcaagaatgctctgcgcgtggataaggctagggtttcccaggtag 449

                                                                       
Query: 483 tcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaac 542
           || || || || |||||||| || || |  || ||||||||||| || ||||| ||||||
Sbjct: 448 tcaagccctccctcgctgaaaatctgagctcccgccttgaaccacactgcctctccgaac 389

                                                                       
Query: 543 ttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggcc 602
           || |||||||| | ||| |||||||| ||||| ||||| || || || || ||||| |||
Sbjct: 388 tttactccatttctcgccagaagctccgggaaaacgcaacccagggcgcccagcattgcc 329

               
Query: 603 cacc 606
           ||||
Sbjct: 328 cacc 325



to top

>gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score =  198 bits (100), Expect = 2e-47
 Identities = 352/436 (80%)
 Strand = Plus / Minus

                                                                       
Query: 171 tcggcgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacg 230
           |||||||| || ||||| |||||||||| ||| ||||| |||||||| || |||||||||
Sbjct: 763 tcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacgattgcctgcacg 704

                                                                       
Query: 231 aagaagccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagc 290
           ||||| || |||||||| |||||||| | |||||| ||||||| ||| || ||||| |||
Sbjct: 703 aagaatccgaacatggaaaacatggccaagcgcccgttcttgagctccttcaccttcagc 644

                                                                       
Query: 291 tccgcgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtag 350
           |||||||| || || ||||| || || || || |  ||||||||||||||||| ||||||
Sbjct: 643 tccgcgaaagcgtcggggtcgtctgcaagtcccaaggggtcgaagctgccaccggggtag 584

                                                                       
Query: 351 agtggatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgccc 410
           |  || ||   |||||| || || ||||| |||||||| ||||| || || |||||||||
Sbjct: 583 atggggtcggtcacctctcccagagggccgccagcaatacggtaaccctccacggcgccc 524

                                                                       
Query: 411 atgagcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctaggg 470
           ||||| | ||| || ||||||||||| ||||| ||||| || || || |  |||||||||
Sbjct: 523 atgaggatgacctggcatgcccagattgcaagaatgctctgcgcgtggataaggctaggg 464

                                                                       
Query: 471 ttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccataca 530
           || || |||| ||| || || || |||||||| || || |  || ||||||||||| || 
Sbjct: 463 tttccaaggtggtcaagccctccctcgctgaaaatctgagctcccgccttgaaccacact 404

                                                                       
Query: 531 gcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgca 590
           ||||| |||||||| ||||||||   ||| |||||||| ||||| ||||| || || || 
Sbjct: 403 gcctccccgaactttactccatttttcgccagaagctccgggaaaacgcaacccagagcg 344

                           
Query: 591 ccgagcatggcccacc 606
           || ||||| |||||||
Sbjct: 343 cccagcattgcccacc 328



to top

>emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1050

 Score =  198 bits (100), Expect = 2e-47
 Identities = 328/404 (81%)
 Strand = Plus / Minus

                                                                       
Query: 147 gcccatgcgttgttgttgacaggatcggcgagatggtcagcaaggttctcgagggggccc 206
           ||||| ||||||||| | || || ||||| || || ||||| || ||||||| ||| || 
Sbjct: 821 gcccaggcgttgttggtaaccgggtcggccaggtgatcagcgagattctcgatgggtcct 762

                                                                       
Query: 207 ttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgccca 266
           || |||||||| || ||||| |||||||| || ||||| || |||||||| |  ||||| 
Sbjct: 761 ttaccggtgacgatggcctggacgaagaatccgaacatagaaaacatggccaaccgcccg 702

                                                                       
Query: 267 ttcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggctaggccgagc 326
           ||||||| ||| || ||||| ||||||||||| || || ||||| || || |||||||||
Sbjct: 701 ttcttgagctccttcaccttcagctccgcgaaagcgtccgggtcgtcagcaaggccgagc 642

                                                                       
Query: 327 gggtcgaagctgccaccagggtagagtggatcaaccacctcaccgagtgggccaccagca 386
           |||||||||||||| || |||||||  || |||   | ||| ||||| |||||||| |||
Sbjct: 641 gggtcgaagctgcccccggggtagatggggtcagtgatctctccgagagggccacctgca 582

                                                                       
Query: 387 atgcggtacccttcaacggcgcccatgagcacgacttgacatgcccagatagcaaggatg 446
           || ||||| || || |||||||||||||| | ||| || ||||||||||| |||||||||
Sbjct: 581 atacggtagccctccacggcgcccatgagaatgacctggcatgcccagattgcaaggatg 522

                                                                       
Query: 447 ctttgtgcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctgaagatt 506
           || || || || |  | ||||||||| || |||||||| ||||| || ||||||||||| 
Sbjct: 521 ctctgggcgtgaatcaagctagggtttcccaggtagtcaaggcctccctcgctgaagatc 462

                                                       
Query: 507 tgggagcctgccttgaaccatacagcctcaccgaacttgactcc 550
           || |  || ||||||||||| || ||||| ||||||||||||||
Sbjct: 461 tgagctcccgccttgaaccacaccgcctccccgaacttgactcc 418



to top

>emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1062

 Score =  198 bits (100), Expect = 2e-47
 Identities = 328/404 (81%)
 Strand = Plus / Minus

                                                                       
Query: 147 gcccatgcgttgttgttgacaggatcggcgagatggtcagcaaggttctcgagggggccc 206
           ||||| ||||||||| | || || ||||| || || ||||| || ||||||| ||| || 
Sbjct: 818 gcccaggcgttgttggtaaccgggtcggccaggtgatcagcgagattctcgatgggtcct 759

                                                                       
Query: 207 ttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgccca 266
           || |||||||| || ||||| |||||||| || ||||| || |||||||| |  ||||| 
Sbjct: 758 ttaccggtgacgatggcctggacgaagaatccgaacatagaaaacatggccaaccgcccg 699

                                                                       
Query: 267 ttcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggctaggccgagc 326
           ||||||| ||| || ||||| ||||||||||| || || ||||| || || |||||||||
Sbjct: 698 ttcttgagctccttcaccttcagctccgcgaaagcgtccgggtcgtcagcaaggccgagc 639

                                                                       
Query: 327 gggtcgaagctgccaccagggtagagtggatcaaccacctcaccgagtgggccaccagca 386
           |||||||||||||| || |||||||  || |||   | ||| ||||| |||||||| |||
Sbjct: 638 gggtcgaagctgcccccggggtagatggggtcagtgatctctccgagagggccacctgca 579

                                                                       
Query: 387 atgcggtacccttcaacggcgcccatgagcacgacttgacatgcccagatagcaaggatg 446
           || ||||| || || |||||||||||||| | ||| || ||||||||||| |||||||||
Sbjct: 578 atacggtagccctccacggcgcccatgagaatgacctggcatgcccagattgcaaggatg 519

                                                                       
Query: 447 ctttgtgcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctgaagatt 506
           || || || || |  | ||||||||| || |||||||| ||||| || ||||||||||| 
Sbjct: 518 ctctgggcgtgaatcaagctagggtttcccaggtagtcaaggcctccctcgctgaagatc 459

                                                       
Query: 507 tgggagcctgccttgaaccatacagcctcaccgaacttgactcc 550
           || |  || ||||||||||| || ||||| ||||||||||||||
Sbjct: 458 tgagctcccgccttgaaccacaccgcctccccgaacttgactcc 415



to top

>emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab binding protein
          Length = 1746

 Score =  196 bits (99), Expect = 6e-47
 Identities = 419/523 (80%), Gaps = 2/523 (0%)
 Strand = Plus / Minus

                                                                        
Query: 123  ccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgagatgg 182
            ||||| ||||||||||||||| | ||||| || ||||||   || ||||| || || |||
Sbjct: 1334 ccggggacaaagttagtggcataagcccaagcattgttggccaccggatcagcaaggtgg 1275

                                                                        
Query: 183  tcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaac 242
            ||   ||||||||||| ||| ||||| || |||||||||||||| |||||||| ||||||
Sbjct: 1274 tcgaaaaggttctcgatgggaccctttccagtgacaatagcctggacgaagaacccaaac 1215

                                                                        
Query: 243  atggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcc 302
            ||||||||||| || ||||| || ||||||| ||| || ||||| |  |||||||| || 
Sbjct: 1214 atggagaacattgccaggcggccgttcttgatctccttaaccttcaattccgcgaaggca 1155

                                                                        
Query: 303  tctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaacc 362
            || |||||||| || |  || |||||||| ||    ||||| ||||| | ||| || |  
Sbjct: 1154 tcagggtcatcagccaatccaagcgggtcaaaagcaccacctgggtaaattgggtcgagt 1095

                                                                        
Query: 363  acctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgact 422
             | ||||||||||| |||||| |||  | ||||||||||||    ||||||||||| |||
Sbjct: 1094 ccttcaccgagtggtccaccaccaactctgtacccttcaacaaatcccatgagcacaact 1035

                                                                        
Query: 423  tgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtag 482
            || || |||||||||||||| || || || ||||| | |||| | ||||||||||| |||
Sbjct: 1034 tggcaagcccagatagcaagaatactctgagcatggatgaggtttgggttgccgagatag 975

                                                                        
Query: 483  tcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaac 542
            || |||||||| |||  |||||||||||| || ||||||||||| || ||||| ||||||
Sbjct: 974  tcaaggccaccctcggagaagatttgggaaccagccttgaaccaaaccgcctctccgaac 915

                                                                        
Query: 543  ttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggcc 602
            ||||| |||||    | |||||  || ||||| || || || || ||||| ||||| |||
Sbjct: 914  ttgacaccattctttgaaagaatttcagggaaaacacagccaagggcaccaagcatagcc 855

                                                       
Query: 603  caccttgcagtggatcacctcaagcttcccggttctttgcaaa 645
            |||| | |||||||||||||||||| || |||||||| |||||
Sbjct: 854  cacc-tacagtggatcacctcaagc-tcacggttcttggcaaa 814



to top

>gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 987

 Score =  196 bits (99), Expect = 6e-47
 Identities = 345/427 (80%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| |||||||||||||| |||||||| ||||| |||||||||||||| || || |
Sbjct: 854 ctcactttccgggaacaaagttggtggcaaaagcccaggcgttgttgttgactgggtcag 795

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | |||||||||||||||||||| |  || ||||| ||||| ||||||||||| || ||||
Sbjct: 794 caagatggtcagcaaggttctccaaaggaccctttccggtcacaatagcctggacaaaga 735

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | |||||||| |||||||| || |  |  || || ||||  || || ||||| |  || |
Sbjct: 734 atccaaacatagagaacatagctaacctaccgtttttgagttccttaacctttaattctg 675

                                                                       
Query: 295 cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
           |||| || |||||||| || |||||||| |  ||||| ||||||||||| ||||| ||||
Sbjct: 674 cgaaagcttctgggtcgtcagctaggcctaatgggtcaaagctgccacctgggtaaagtg 615

                                                                       
Query: 355 gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
           | ||||| || ||||| || || ||||| ||||| ||||| |||||||| |||||||| |
Sbjct: 614 ggtcaactacttcaccaagaggcccacctgcaatacggtatccttcaactgcgcccatca 555

                                                                       
Query: 415 gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
             |  ||||||   |||||||| |||||||| ||||| || || || |  || |||||||
Sbjct: 554 agataacttgagtggcccagatggcaaggatactttgagcgtggaccaaacttgggttgc 495

                                                                       
Query: 475 cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
           | | |||||| || ||||| ||||| |||||||| || || ||||||||||| |||||||
Sbjct: 494 ccaagtagtcaagtccaccctcgctaaagatttgagatccggccttgaaccaaacagcct 435

                  
Query: 535 caccgaa 541
           | |||||
Sbjct: 434 cgccgaa 428



to top

>gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding protein of LHCII type I
           precursor (CAB) mRNA, nuclear gene encoding chloroplast
           protein, complete cds
          Length = 1015

 Score =  196 bits (99), Expect = 6e-47
 Identities = 409/511 (80%), Gaps = 1/511 (0%)
 Strand = Plus / Minus

                                                                       
Query: 118 acttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcga 177
           |||| ||||| |||||||| |||||| | |||||||| |||||||| || ||||| || |
Sbjct: 822 actttccggggacaaagttggtggcataggcccatgcattgttgttcactggatcagcaa 763

                                                                       
Query: 178 gatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagc 237
           |  |||| || |||||||| |  |||||||| || || ||||| ||||| || ||||| |
Sbjct: 762 gggggtcggctaggttctccaatgggccctttcctgtaacaatggcctgaacaaagaaac 703

                                                                       
Query: 238 caaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcga 297
           ||||||||||||||||||| || |  ||||||||||  || || ||||| ||||| || |
Sbjct: 702 caaacatggagaacatggcgagccttccattcttgagttccttaaccttaagctcagcaa 643

                                                                       
Query: 298 atgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggat 357
           | || |||||||| || || ||||| |  ||||||||||| || || || || ||||| |
Sbjct: 642 aggcttctgggtcttcagcaaggcccaaggggtcgaagcttcctccgggataaagtgggt 583

                                                                       
Query: 358 caaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagca 417
           |||| |||||||| ||||| ||||| |||||||| || || |||||||| ||||| |  |
Sbjct: 582 caacaacctcacctagtggcccacctgcaatgcgataaccctcaacggcacccattaaga 523

                                                                       
Query: 418 cgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccga 477
             |||||    ||||| || || | |||||| || ||||| || | ||| |||||||| |
Sbjct: 522 taacttgggtagcccatatggccaagatgctctgggcatggaccaagcttgggttgccca 463

                                                                       
Query: 478 ggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcac 537
            |||||| || ||||| ||||||||||||||||| || ||||||||||| || |||||||
Sbjct: 462 agtagtcaagcccaccttcgctgaagatttgggatccggccttgaaccacacggcctcac 403

                                                                       
Query: 538 cgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagca 597
           |||| ||||| || || || || |  |||||||||||||| ||||| || || || ||||
Sbjct: 402 cgaatttgacaccgttacgagccaagagctcggggaagacacatccaagggctccaagca 343

                                          
Query: 598 tggcccaccttgcagtggatcacctcaagct 628
           ||||||| | ||| ||| |||||||||||||
Sbjct: 342 tggcccatc-tgctgtgaatcacctcaagct 313



to top

>gb|AY617093.1| Pinus remota chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score =  194 bits (98), Expect = 3e-46
 Identities = 363/450 (80%), Gaps = 1/450 (0%)
 Strand = Plus / Minus

                                                                       
Query: 171 tcggcgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacg 230
           |||||||| || ||||| |||||||||| ||| ||||| |||||||| || ||||| |||
Sbjct: 763 tcggcgaggtgatcagcgaggttctcgatgggtcccttcccggtgacgatggcctgaacg 704

                                                                       
Query: 231 aagaagccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagc 290
           ||||| || |||||||| |||||||| | |||||| ||||||| ||| || ||||| |||
Sbjct: 703 aagaatccgaacatggaaaacatggccaagcgcccgttcttgatctccttcaccttcagc 644

                                                                       
Query: 291 tccgcgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtag 350
           |||||||| || || ||||| || || || || |  ||||||||||||||||| ||||||
Sbjct: 643 tccgcgaaagcgtcggggtcgtctgcaagtcccaaggggtcgaagctgccaccggggtag 584

                                                                       
Query: 351 agtggatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgccc 410
           |  || ||   |||||| || || ||||| || ||||| ||||| || || |||||||||
Sbjct: 583 atagggtctgtcacctctcccagagggccgccggcaatacggtaaccctccacggcgccc 524

                                                                       
Query: 411 atgagcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctaggg 470
           ||||| | ||| || ||||||||||| ||||| || || || || || |  |||||||||
Sbjct: 523 atgaggatgacctggcatgcccagattgcaagaatactctgcgcgtggataaggctaggg 464

                                                                       
Query: 471 ttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccataca 530
           || || |||||||| || || || |||||||| || || |  || ||||||||||| |||
Sbjct: 463 tttcccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaaccacaca 404

                                                                       
Query: 531 gcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgca 590
           || || |||||||| |||||||| | ||| |||||||| ||||| ||||| || || || 
Sbjct: 403 gcttccccgaactttactccatttctcgccagaagctccgggaaaacgcaacccagagcg 344

                                         
Query: 591 ccgagcatggcccaccttgcagtggatcac 620
           || ||||| |||||||  ||||||||||||
Sbjct: 343 cccagcattgcccacc-ggcagtggatcac 315



to top

>gb|AY617083.1| Pinus radiata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score =  194 bits (98), Expect = 3e-46
 Identities = 354/438 (80%), Gaps = 1/438 (0%)
 Strand = Plus / Minus

                                                                       
Query: 183 tcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaac 242
           ||||| |||||||||| ||| || || |||||||| || |||||||||||||| || |||
Sbjct: 751 tcagcgaggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaac 692

                                                                       
Query: 243 atggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcc 302
           ||||| |||||||| |  ||||| ||||||| ||| || ||||| ||||||||||| || 
Sbjct: 691 atggaaaacatggccaaccgcccgttcttgatctccttcaccttcagctccgcgaaagcg 632

                                                                       
Query: 303 tctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaacc 362
           || ||||| || || || || ||||||||||||||||| || |||||||  || ||   |
Sbjct: 631 tcggggtcgtccgcaagtcccagcgggtcgaagctgcccccggggtagatggggtcggtc 572

                                                                       
Query: 363 acctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgact 422
           ||||| || || || || || ||||| ||||| || || |||||||||||||| | ||| 
Sbjct: 571 acctctcccagaggaccgcccgcaatacggtagccctccacggcgcccatgaggatgacc 512

                                                                       
Query: 423 tgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtag 482
           || ||||||||||| ||||| ||||| || || || || | ||||||||| || ||||||
Sbjct: 511 tggcatgcccagattgcaagaatgctctgcgcgtgaaccaagctagggtttcccaggtag 452

                                                                       
Query: 483 tcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaac 542
           || || || || |||||||| || || |  || ||||||||||| || ||||||||||||
Sbjct: 451 tcaagccctccctcgctgaaaatctgagctcccgccttgaaccacactgcctcaccgaac 392

                                                                       
Query: 543 ttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggcc 602
           || |||||||| | ||| |||||||| ||||| ||||| || || || || ||||| |||
Sbjct: 391 tttactccatttctcgccagaagctccgggaaaacgcaacccagagcgcccagcattgcc 332

                             
Query: 603 caccttgcagtggatcac 620
           ||||  ||||||||||||
Sbjct: 331 cacc-ggcagtggatcac 315



to top

>gb|AY617096.1| Picea sitchensis chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 763

 Score =  192 bits (97), Expect = 1e-45
 Identities = 300/368 (81%)
 Strand = Plus / Minus

                                                                       
Query: 183 tcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaac 242
           ||||| || ||||||| ||| || || |||||||| || |||||  ||||||| || |||
Sbjct: 751 tcagcgagattctcgatgggtcctttaccggtgacgatggcctggncgaagaatccgaac 692

                                                                       
Query: 243 atggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcc 302
           || || |||||||| |  ||||| ||||||| ||| || ||||| ||||||||||| || 
Sbjct: 691 atagaaaacatggccaaccgcccgttcttgagctccttcaccttcagctccgcgaaagcg 632

                                                                       
Query: 303 tctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaacc 362
           || ||||| || || ||||||||||||||||||||||| || |||||||  || |||   
Sbjct: 631 tccgggtcgtcagcaaggccgagcgggtcgaagctgcccccggggtagatggggtcagtg 572

                                                                       
Query: 363 acctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgact 422
           | ||| ||||| |||||||| ||||| ||||| || || |||||||||||||| | ||| 
Sbjct: 571 atctctccgagagggccacctgcaatacggtagccctccacggcgcccatgagaatgacc 512

                                                                       
Query: 423 tgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtag 482
           || ||||||||||| ||||||||||| || || || || | ||||||||| || ||||||
Sbjct: 511 tggcatgcccagattgcaaggatgctctgggcgtgaaccaagctagggtttcccaggtag 452

                                                                       
Query: 483 tcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaac 542
           || ||||| || ||||||||||| || |  || ||||||||||| || ||||| ||||||
Sbjct: 451 tcaaggcctccctcgctgaagatctgagctcccgccttgaaccacaccgcctccccgaac 392

                   
Query: 543 ttgactcc 550
           ||||||||
Sbjct: 391 ttgactcc 384



to top

>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA,
           complete cds
          Length = 998

 Score =  192 bits (97), Expect = 1e-45
 Identities = 401/501 (80%), Gaps = 1/501 (0%)
 Strand = Plus / Minus

                                                                       
Query: 120 ttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgaga 179
           |||||||| || ||||| |||||  | ||||| ||||||||||| || || || || || 
Sbjct: 860 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtcagccagg 801

                                                                       
Query: 180 tggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagcca 239
           || ||||  |||||||||| ||| || || ||||||||||| |||||||||||||| || 
Sbjct: 800 tgatcagtgaggttctcgatgggtcctttcccggtgacaatggcctgcacgaagaatccg 741

                                                                       
Query: 240 aacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaat 299
           |||||||| |||||||| |  ||||| ||||||| ||| || ||||| ||||||||||| 
Sbjct: 740 aacatggaaaacatggccaaccgcccgttcttgatctccttcaccttcagctccgcgaaa 681

                                                                       
Query: 300 gcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatca 359
           || || ||||| || || || || ||||||||||||||||| || |||||||  || || 
Sbjct: 680 gcgtcagggtcgtccgcaagtcccagcgggtcgaagctgcccccggggtagatggggtcg 621

                                                                       
Query: 360 accacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacg 419
             |||||| || || || || || ||||| ||||| || || |||||||||||||| |  
Sbjct: 620 gtcacctctcccagaggaccgcccgcaatacggtatccctccacggcgcccatgaggata 561

                                                                       
Query: 420 acttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgagg 479
           || || ||||||||||| ||||| ||||| || || || || | ||||||||| || |||
Sbjct: 560 acctggcatgcccagattgcaagaatgctctgcgcgtgaaccaagctagggtttcccagg 501

                                                                       
Query: 480 tagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccg 539
           ||||| || || || |||||||| || || |  || ||||||||||| || ||||| |||
Sbjct: 500 tagtcaagccctccctcgctgaaaatctgagctccggccttgaaccacacggcctccccg 441

                                                                       
Query: 540 aacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatg 599
           ||||| |||||||| | ||| |||||||| ||||| ||||| || || || || ||||| 
Sbjct: 440 aactttactccatttctcgccagaagctccgggaaaacgcaacccagagcgcccagcatt 381

                                
Query: 600 gcccaccttgcagtggatcac 620
           |||||||  ||||||||||||
Sbjct: 380 gcccacc-ggcagtggatcac 361



to top

>emb|X02359.1|PECAB22L Petunia gene for chlorophyll a/b binding protein cab 22L
          Length = 1187

 Score =  192 bits (97), Expect = 1e-45
 Identities = 356/441 (80%), Gaps = 1/441 (0%)
 Strand = Plus / Minus

                                                                       
Query: 183 tcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaac 242
           ||||||||||| || |  |||||||| |||||||| ||||| || |  ||||| ||||||
Sbjct: 967 tcagcaaggttttccaatgggccctttccggtgacgatagcttgaataaagaatccaaac 908

                                                                       
Query: 243 atggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcc 302
           ||||||||||| ||||| |  |||||||||   || || |||||||| || || || |||
Sbjct: 907 atggagaacatagcaagtctgccattcttggtttccttcaccttgagttcagcaaaagcc 848

                                                                       
Query: 303 tctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaacc 362
           || || || ||||| ||||| |  ||||||||||||||||| ||||| ||||| || || 
Sbjct: 847 tccggatcctcggcaaggcccaatgggtcgaagctgccaccggggtaaagtgggtcgaca 788

                                                                       
Query: 363 acctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgact 422
           ||| |||| || || ||||||||||  ||||| || |||||||| ||||| | ||  |||
Sbjct: 787 accacaccaagaggtccaccagcaacacggtaaccctcaacggctcccatcaacaatact 728

                                                                       
Query: 423 tgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtag 482
           || || |||||||| || | |||||||||||| || || |  || |||||||| | ||||
Sbjct: 727 tggcaagcccagatggccaagatgctttgtgcgtggaccaaacttgggttgcccaagtag 668

                                                                       
Query: 483 tcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaac 542
           || || ||||| || ||||| ||||| || || ||||||| ||||||||||||||| |||
Sbjct: 667 tcaagtccaccctcactgaaaatttgtgatccagccttgagccatacagcctcaccaaac 608

                                                                       
Query: 543 ttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggcc 602
           ||||| || || || |||| |||||| ||||||||||| || || || || |||||||||
Sbjct: 607 ttgacaccgttacgggcaaaaagctcagggaagacgcaaccaagagctccaagcatggcc 548

                                
Query: 603 caccttgcagtggatcacctc 623
           || | ||||||||||||||||
Sbjct: 547 catc-tgcagtggatcacctc 528



to top

>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b-
           binding protein ( LHCP )
          Length = 1030

 Score =  188 bits (95), Expect = 2e-44
 Identities = 389/487 (79%)
 Strand = Plus / Minus

                                                                       
Query: 118 acttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcga 177
           |||||||||| || ||||| ||||| || ||||| || |||||||| || || |||||||
Sbjct: 973 acttgccggggacgaagttggtggcgaaggcccaggcattgttgtttacggggtcggcga 914

                                                                       
Query: 178 gatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagc 237
           ||||||| || | |||||||||||| ||||| |||||||| || |||||||||||||| |
Sbjct: 913 gatggtccgccaagttctcgaggggccccttcccggtgacgatggcctgcacgaagaatc 854

                                                                       
Query: 238 caaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcga 297
           | ||||||||||||||||| ||||| || ||||||| ||| || ||||| ||||| ||||
Sbjct: 853 cgaacatggagaacatggccaggcgtccgttcttgatctccttgaccttcagctcggcga 794

                                                                       
Query: 298 atgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggat 357
           | || || | ||| || || || ||||| ||||| |||||||| || ||||| || || |
Sbjct: 793 aggcttccgcgtcgtccgcgagcccgagggggtcaaagctgccgccggggtacagggggt 734

                                                                       
Query: 358 caaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagca 417
           | |||||||| || || || || || || | |||||| ||||| ||||| |||||||| |
Sbjct: 733 ccaccacctcgcccaggggaccgccggccacgcggtagccttcgacggcacccatgagga 674

                                                                       
Query: 418 cgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccga 477
           | || || || |||||||| || |||||||| || || || || |||   ||||| || |
Sbjct: 673 ccacctggcaggcccagatggccaggatgctctgcgcgtggaccagggaggggttcccca 614

                                                                       
Query: 478 ggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcac 537
           |||| |  || || || ||||| ||||| ||||| ||   ||||||||| || ||||| |
Sbjct: 613 ggtactgcagcccgccctcgctaaagatctgggaacccttcttgaaccacacggcctcgc 554

                                                                       
Query: 538 cgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagca 597
           | |||||||| || || || || || ||||| ||||||||||| |||||||| || ||||
Sbjct: 553 caaacttgacgccgttccgggcgaggagctccgggaagacgcacccgagcgcccccagca 494

                  
Query: 598 tggccca 604
           | |||||
Sbjct: 493 tcgccca 487



to top

>gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score =  186 bits (94), Expect = 6e-44
 Identities = 353/438 (80%), Gaps = 1/438 (0%)
 Strand = Plus / Minus

                                                                       
Query: 183 tcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaac 242
           ||||| |||||||||| ||| || || ||||||||||| |||||||||||||| || |||
Sbjct: 751 tcagcgaggttctcgatgggtcctttcccggtgacaatggcctgcacgaagaatccgaac 692

                                                                       
Query: 243 atggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcc 302
           ||||| |||||||| |  ||||| ||||||| ||| || ||||| ||||||||||| || 
Sbjct: 691 atggaaaacatggccaaccgcccgttcttgatctccttcaccttcagctccgcgaaagcg 632

                                                                       
Query: 303 tctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaacc 362
           || ||||| || || || |  ||||||||||||||||| || |||||||  || ||   |
Sbjct: 631 tcagggtcgtccgcaagtctcagcgggtcgaagctgcccccggggtagatggggtcggtc 572

                                                                       
Query: 363 acctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgact 422
           ||||| || || || || || ||||| ||||| || || |||||||||||||| | ||| 
Sbjct: 571 acctctcccagaggaccgcccgcaatacggtatccctccacggcgcccatgaggatgacc 512

                                                                       
Query: 423 tgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtag 482
           || ||||||||||| ||||| ||||| || || || || | ||||||||| || ||||||
Sbjct: 511 tggcatgcccagattgcaagaatgctctgcgcgtgaaccaagctagggtttcccaggtag 452

                                                                       
Query: 483 tcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaac 542
           || || || || |||||||| || || |  || ||||||||||| || ||||||||||||
Sbjct: 451 tcaagccctccctcgctgaaaatctgagctcccgccttgaaccacacggcctcaccgaac 392

                                                                       
Query: 543 ttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggcc 602
           || |||||||| |  || |||||||| ||||| ||||| || || || || ||||| |||
Sbjct: 391 ttaactccatttctagccagaagctccgggaaaacgcaacccagagcgcccagcattgcc 332

                             
Query: 603 caccttgcagtggatcac 620
           ||||  ||||||||||||
Sbjct: 331 cacc-ggcagtggatcac 315



to top

>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full
           insert sequence
          Length = 1040

 Score =  186 bits (94), Expect = 6e-44
 Identities = 192/222 (86%), Gaps = 2/222 (0%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||||||||| || ||||| |||||  | |||||||||||||||||||| || ||||
Sbjct: 865 ctcacttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcgg 806

                                                                       
Query: 175 cgagatggtc-agcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaag 233
           |||| ||||| |||| ||||||| | |||||||||||||||||| || ||||| ||||||
Sbjct: 805 cgaggtggtcgagca-ggttctccaaggggcccttgccggtgacgatggcctggacgaag 747

                                                                       
Query: 234 aagccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctcc 293
           ||||| ||||||||||||||||| ||||| |||||||||| ||| || ||||||||||| 
Sbjct: 746 aagccgaacatggagaacatggcgaggcggccattcttgatctccttgaccttgagctcg 687

                                                     
Query: 294 gcgaatgcctctgggtcatcggctaggccgagcgggtcgaag 335
           ||||| |   | ||||| ||||| ||||||||||||||||||
Sbjct: 686 gcgaaggtgacggggtcgtcggcgaggccgagcgggtcgaag 645



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 441 aggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctg 500
           |||||||| || || ||||| ||| | ||||||||||||||||||||||| ||||||  |
Sbjct: 536 aggatgctctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggag 477

                                     
Query: 501 aagatttgggagcctgccttgaacca 526
           ||||| |||| ||| |||||||||||
Sbjct: 476 aagatctgggcgccggccttgaacca 451



to top

>gb|AY617081.1| Pinus echinata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 762

 Score =  182 bits (92), Expect = 1e-42
 Identities = 352/438 (80%), Gaps = 1/438 (0%)
 Strand = Plus / Minus

                                                                       
Query: 183 tcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaac 242
           ||||| |||||||||| ||| || || |||||||| || |||||||||||||| || |||
Sbjct: 751 tcagcgaggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaac 692

                                                                       
Query: 243 atggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcc 302
           ||||| |||||||| |  ||||| ||||||| ||| || ||||| ||||||||||| || 
Sbjct: 691 atggaaaacatggccaaccgcccgttcttgatctccttcaccttcagctccgcgaaagcg 632

                                                                       
Query: 303 tctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaacc 362
           || ||||| || || || || ||||||||||||||||| || |||||||  || ||   |
Sbjct: 631 tcggggtcgtccgcaagtcccagcgggtcgaagctgcccccggggtagatggggtcggtc 572

                                                                       
Query: 363 acctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgact 422
           ||||| || |  || || || ||||| ||||| || || |||||||||||||| | ||| 
Sbjct: 571 acctctcccaaaggaccgcccgcaatacggtagccctccacggcgcccatgaggatgacc 512

                                                                       
Query: 423 tgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtag 482
           || ||||||||||| ||||| ||||| || || || || | ||||||||| || ||||||
Sbjct: 511 tggcatgcccagattgcaagaatgctctgcgcgtgaaccaagctagggtttcccaggtag 452

                                                                       
Query: 483 tcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaac 542
           || || || || |||||||| || || |  || ||||||||||| || ||||||||||||
Sbjct: 451 tcaagccctccctcgctgaaaatctgagctcccgccttgaaccacactgcctcaccgaac 392

                                                                       
Query: 543 ttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggcc 602
           || |||||||| |  || |||||||| ||||| ||||| || || || || ||||| |||
Sbjct: 391 tttactccatttctygccagaagctccgggaaaacgcaacccagagcgcccagcattgcc 332

                             
Query: 603 caccttgcagtggatcac 620
           ||||  ||||||||||||
Sbjct: 331 cacc-ggcagtggatcac 315



to top

>emb|X68333.1|HHLHC H.helix mRNA for light harvesting chlorophyll a/b binding protein
          Length = 686

 Score =  182 bits (92), Expect = 1e-42
 Identities = 347/432 (80%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||| ||||| |||||||| |||||| | |||||||| |||||||| || ||||| ||
Sbjct: 582 tcactttccggggacaaagttggtggcataggcccatgcattgttgtttactggatcagc 523

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            |||||||| || |||||||| |  || ||||| || || ||||| ||||| || |||||
Sbjct: 522 aagatggtcggctaggttctccaatggaccctttcctgtaacaatggcctgaacaaagaa 463

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
            ||||||||||||||||||||||| |  ||||||||||  || || ||||| ||||| ||
Sbjct: 462 accaaacatggagaacatggcaagtcttccattcttgagttccttaaccttaagctcagc 403

                                                                       
Query: 296 gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
            || || |||||||| || || ||||| |  |||||||| || || || ||||| |||||
Sbjct: 402 aaaggcttctgggtcctcagcaaggcctaatgggtcgaaacttcctccggggtaaagtgg 343

                                                                       
Query: 356 atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
            ||||| |||||||||||||| ||||| ||||| ||||| || |||||||| ||||| | 
Sbjct: 342 gtcaacaacctcaccgagtggtccaccggcaatacggtaaccctcaacggcacccattaa 283

                                                                       
Query: 416 cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
            |  |||||    ||||| ||||| | ||| ||||| ||||| || | ||| ||||||||
Sbjct: 282 gataacttgggtggcccatatagccaagatactttgggcatgaaccaagcttgggttgcc 223

                                                                       
Query: 476 gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
            | |||||| || ||||| || ||||| ||||| |  || ||||||||||| ||||||||
Sbjct: 222 caagtagtcaagcccaccctcactgaaaatttgagctccagccttgaaccacacagcctc 163

                       
Query: 536 accgaacttgac 547
           |||||| |||||
Sbjct: 162 accgaatttgac 151



to top

>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds
          Length = 1913

 Score =  182 bits (92), Expect = 1e-42
 Identities = 188/220 (85%)
 Strand = Plus / Minus

                                                                        
Query: 116  tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
            |||||||||||| || ||||| ||||| || ||||| |||||||||  ||| || |||||
Sbjct: 1534 tcacttgccggggacgaagttggtggcgaaggcccaggcgttgttggcgacggggtcggc 1475

                                                                        
Query: 176  gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            ||  ||||| || |||||||||| |||||||||||||||||| || ||||| ||||||||
Sbjct: 1474 gatgtggtcggccaggttctcgatggggcccttgccggtgacgatggcctgaacgaagaa 1415

                                                                        
Query: 236  gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
            ||| ||||||||||||||||| || ||||| ||||||| ||| || ||||| ||||||||
Sbjct: 1414 gccgaacatggagaacatggccagccgcccgttcttgatctccttcaccttcagctccgc 1355

                                                    
Query: 296  gaatgcctctgggtcatcggctaggccgagcgggtcgaag 335
            ||| ||||| ||||| ||||| || || ||||||||||||
Sbjct: 1354 gaaggcctcggggtcgtcggccagccccagcgggtcgaag 1315



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 143/178 (80%)
 Strand = Plus / Minus

                                                                        
Query: 429  gcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgagg 488
            |||||||| || |||||||| || || || || ||| | |||||||| ||||||||||||
Sbjct: 1221 gcccagatggcgaggatgctctgcgcgtggaccaggttggggttgcccaggtagtcgagg 1162

                                                                        
Query: 489  ccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaacttgact 548
            || || |||  |||||| |||| ||| ||||||||||| || ||||| |||||||  || 
Sbjct: 1161 ccgccctcggagaagatctgggcgcccgccttgaaccagacggcctccccgaactgcacc 1102

                                                                      
Query: 549  ccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggcccacc 606
            || ||    |  || ||||| ||||||| ||| |||||||| ||||||||||||||||
Sbjct: 1101 ccgttcttggagagcagctccgggaagatgcagccgagcgcgccgagcatggcccacc 1044



to top

>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll
           A/B-binding protein gene, complete cds
          Length = 1260

 Score =  182 bits (92), Expect = 1e-42
 Identities = 347/432 (80%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||| ||||| |||||||| |||||| | ||||| || ||||||||||| || || ||
Sbjct: 992 tcactttccggggacaaagttggtggcataggcccaagcattgttgttgactgggtcagc 933

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            || |||||||| | |||||| |  || ||||| ||||| || || ||||| ||||||||
Sbjct: 932 aaggtggtcagccaagttctccaatggtccctttccggtcacgatggcctgaacgaagaa 873

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
            || ||||| |||||||| || |  |  || ||||||| |||||| ||||||||||| ||
Sbjct: 872 cccgaacattgagaacatagccaacctaccgttcttgatctctttcaccttgagctcagc 813

                                                                       
Query: 296 gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
           |||||||||||||||||| || | ||| |  ||||| ||||||||||| ||||| | |||
Sbjct: 812 gaatgcctctgggtcatcagcaaagcccaatgggtcaaagctgccacctgggtacaatgg 753

                                                                       
Query: 356 atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
            |||  ||| ||||||||||| ||||| ||||| ||||| || || ||||| ||||| | 
Sbjct: 752 gtcagtcacttcaccgagtggtccaccggcaatacggtagccctcgacggctcccatcaa 693

                                                                       
Query: 416 cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
            |  ||||| || |||||||| || |  |||||||| ||||| |  | ||| ||||| ||
Sbjct: 692 gataacttggcaagcccagatggccaaaatgctttgagcatggatcaagcttgggttacc 633

                                                                       
Query: 476 gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
            | |||||| || ||||| || ||||||||||| || || ||||||||||||||||| ||
Sbjct: 632 caagtagtcaagtccaccctcactgaagatttgagacccggccttgaaccatacagcttc 573

                       
Query: 536 accgaacttgac 547
           ||||||||||||
Sbjct: 572 accgaacttgac 561



to top

>dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3102

 Score =  182 bits (92), Expect = 1e-42
 Identities = 421/528 (79%), Gaps = 2/528 (0%)
 Strand = Plus / Minus

                                                                        
Query: 118  acttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcga 177
            |||| ||||| |||||||| |||||| | ||||| ||||||||||| || || || || |
Sbjct: 2706 actttccggggacaaagtttgtggcataggcccaggcgttgttgttaacggggtcagcaa 2647

                                                                        
Query: 178  gatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagc 237
            | || ||| |||||||||| |  || || || || ||||||||||| || |||||||| |
Sbjct: 2646 ggtgatcaacaaggttctctaatggaccttttccagtgacaatagcttgaacgaagaatc 2587

                                                                        
Query: 238  caaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcga 297
            | |||||||||||||| ||||| |  || || || | ||| |||||||||||||| || |
Sbjct: 2586 cgaacatggagaacatagcaagcctaccgtttttaatctcctttaccttgagctcagcaa 2527

                                                                        
Query: 298  atgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggat 357
            | |||||||||||||| || || || |  ||||| ||||| ||||| ||||||||||| |
Sbjct: 2526 aagcctctgggtcatcagcaagacctaatgggtcaaagctaccaccggggtagagtgggt 2467

                                                                        
Query: 358  caaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagca 417
            |    |||||||| || || ||||||||||  ||||| || ||||  || ||||| | ||
Sbjct: 2466 cggtaacctcaccaagaggtccaccagcaacacggtaaccctcaatagctcccatcaaca 2407

                                                                        
Query: 418  cgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccga 477
            | ||||| || ||||| || || | ||||||||||||||| || |  || |||||||| |
Sbjct: 2406 caacttggcaagcccaaatggccaagatgctttgtgcatggaccaaacttgggttgccca 2347

                                                                        
Query: 478  ggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcac 537
             |||||| || ||||| |||||||| ||||| || || ||||||||||| ||||| ||||
Sbjct: 2346 agtagtcaagtccaccctcgctgaaaatttgagatccagccttgaaccagacagcttcac 2287

                                                                        
Query: 538  cgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagca 597
            |||||||||| ||||| || || |  || ||||||||||| || ||||| || || ||||
Sbjct: 2286 cgaacttgacaccattacgagccaagagttcggggaagacacaaccgagagctccaagca 2227

                                                            
Query: 598  tggcccaccttgcagtggatcacctcaagcttcccggttctttgcaaa 645
            | ||||| | | ||||| |||||||| ||| || |||||||| |||||
Sbjct: 2226 tagcccatc-tacagtgaatcacctctagc-tcacggttcttagcaaa 2181



to top

>emb|X16535.1|GMCAB4 G.max DNA for Cab4
          Length = 1470

 Score =  180 bits (91), Expect = 4e-42
 Identities = 355/443 (80%)
 Strand = Plus / Minus

                                                                        
Query: 114  cctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcg 173
            |||||||| ||||| |||||||| |||||| | ||||| || |||||||| || || || 
Sbjct: 1127 cctcactttccggggacaaagtttgtggcataggcccaagcattgttgttcactgggtca 1068

                                                                        
Query: 174  gcgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaag 233
            || || || ||||||||||| || | ||| ||||| || || ||||| ||||| || |||
Sbjct: 1067 gcaaggtgatcagcaaggttttctaagggtccctttcctgtcacaattgcctgaacaaag 1008

                                                                        
Query: 234  aagccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctcc 293
            || |||||||||||||||||||| |  |  |||||||||| ||| || ||||| ||||| 
Sbjct: 1007 aatccaaacatggagaacatggccaacctaccattcttgagctccttcaccttcagctca 948

                                                                        
Query: 294  gcgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagt 353
            || || |||||||||||||| || || || |  ||||| ||||||||||| || |||| |
Sbjct: 947  gcaaaagcctctgggtcatcagcaagacccaatgggtcaaagctgccacctggatagatt 888

                                                                        
Query: 354  ggatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatg 413
            ||||||  ||||||||| || || ||||||||||| ||||| || ||||| || ||||| 
Sbjct: 887  ggatcagtcacctcaccaagaggcccaccagcaatacggtaaccctcaactgcacccatc 828

                                                                        
Query: 414  agcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttg 473
            |  |  |||||    |||||||| ||||| |||||||||||||| |  ||||| ||||||
Sbjct: 827  aagataacttgggtggcccagatggcaagaatgctttgtgcatggatcaggcttgggttg 768

                                                                        
Query: 474  ccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcc 533
            || | |||||| || || || || ||||| || || || || ||||||||||| || |||
Sbjct: 767  cccaagtagtcaagcccgccctcactgaatatctgagacccggccttgaaccacacggcc 708

                                   
Query: 534  tcaccgaacttgactccattgcg 556
            ||||| ||||||||||| |||||
Sbjct: 707  tcaccaaacttgactccgttgcg 685



to top

>gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score =  178 bits (90), Expect = 1e-41
 Identities = 352/438 (80%), Gaps = 1/438 (0%)
 Strand = Plus / Minus

                                                                       
Query: 183 tcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaac 242
           ||||| |||||||||| ||| || || |||||||| || |||||||||||||| || |||
Sbjct: 751 tcagcgaggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaac 692

                                                                       
Query: 243 atggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcc 302
           ||||| |||||||| |  ||||| ||||||| ||| || ||||| ||||||||||| || 
Sbjct: 691 atggaaaacatggccaaccgcccgttcttgatctccttcaccttcagctccgcgaaagcg 632

                                                                       
Query: 303 tctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaacc 362
           || ||||| || || || || ||||||||||||||||| || |||||||  || ||   |
Sbjct: 631 tcggggtcgtccgcaagtcccagcgggtcgaagctgcccccggggtagatggggtcggtc 572

                                                                       
Query: 363 acctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgact 422
           ||| | || || || || || ||||| ||||| || || |||||||||||||| | ||| 
Sbjct: 571 accmctcccagaggaccgcccgcaatacggtagccctccacggcgcccatgaggatgacc 512

                                                                       
Query: 423 tgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtag 482
           || ||||||||||| ||||| ||||| || || || || | ||||||||| || ||||||
Sbjct: 511 tggcatgcccagattgcaagaatgctctgcgcgtgaaccaagctagggtttcccaggtag 452

                                                                       
Query: 483 tcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaac 542
           || || || || |||||||| || || |  || ||||||||||| || ||||| ||||||
Sbjct: 451 tcaagccctccctcgctgaaaatctgagctcccgccttgaaccacacggcctccccgaac 392

                                                                       
Query: 543 ttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggcc 602
           || |||||||| | ||| |||||||| ||||| ||||| || || || || ||||| |||
Sbjct: 391 tttactccatttctcgccagaagctccgggaaaacgcaacccagagcgcccagcattgcc 332

                             
Query: 603 caccttgcagtggatcac 620
           ||||  ||||||||||||
Sbjct: 331 cacc-ggcagtggatcac 315



to top

>emb|X56538.1|PSCABIIC P.sativum Cab-8 gene for photosystemm II chlorophyll a/b binding
            protein
          Length = 2236

 Score =  176 bits (89), Expect = 6e-41
 Identities = 374/469 (79%)
 Strand = Plus / Minus

                                                                        
Query: 115  ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
            ||||||| |||||||||||||| |||||| | | |||||| |||||||| || || ||||
Sbjct: 2118 ctcactttccgggaacaaagttggtggcatatgaccatgcattgttgttaactgggtcgg 2059

                                                                        
Query: 175  cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
              ||||| |||||||| ||||| |  || ||||| ||||| |||||||| || || ||||
Sbjct: 2058 aaagatgatcagcaagattctccaaaggtccctttccggtcacaatagcttgaacaaaga 1999

                                                                        
Query: 235  agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
            | |||||||| |||||||| || |  |  || |||||||  || || ||||| |  || |
Sbjct: 1998 atccaaacatagagaacatagctaatctaccgttcttgagttccttcaccttcaattctg 1939

                                                                        
Query: 295  cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
            ||||||| |||||||| || |||| ||| |  || || ||||| ||||| ||||| ||||
Sbjct: 1938 cgaatgcttctgggtcgtcagctaagcccaatggatcaaagctaccacctgggtaaagtg 1879

                                                                        
Query: 355  gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
            | |||||||||||||| || || ||||| ||||| ||||| ||||| || || ||||| |
Sbjct: 1878 ggtcaaccacctcaccaagaggcccaccggcaatacggtaaccttcgacagctcccatca 1819

                                                                        
Query: 415  gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
              |  ||||||   |||||||| |||||||||||||||||||| || | ||| ||||| |
Sbjct: 1818 agataacttgagtagcccagatggcaaggatgctttgtgcatggaccaagcttgggttac 1759

                                                                        
Query: 475  cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
            | | |||||| || ||||| ||||| |||||||| || |||||||||||||| ||||| |
Sbjct: 1758 ccaagtagtcaagtccaccctcgctaaagatttgagatcctgccttgaaccacacagctt 1699

                                                             
Query: 535  caccgaacttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
            ||||||| || || || ||||| |  | |||||| |||||||| |||||
Sbjct: 1698 caccgaatttaacaccgttgcgagacaaaagctctgggaagacacatcc 1650



to top

>dbj|D14002.1|LAUCAB Lettuce mRNA for light-harvesting chlorophyll a/b-binding protein
           (LHCP), complete cds
          Length = 905

 Score =  176 bits (89), Expect = 6e-41
 Identities = 342/425 (80%), Gaps = 1/425 (0%)
 Strand = Plus / Minus

                                                                       
Query: 204 cccttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgc 263
           ||||| || |||||||| || || || ||||| ||||||||||||||||| || || | |
Sbjct: 757 ccctttcctgtgacaatggcttgaacaaagaacccaaacatggagaacatagccagtctc 698

                                                                       
Query: 264 ccattcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggctaggccg 323
           |||||||||| ||| || ||||| | ||| || || |||||||| ||||| || ||||| 
Sbjct: 697 ccattcttgatctccttcaccttcaactcagcaaaagcctctggatcatctgcaaggccc 638

                                                                       
Query: 324 agcgggtcgaagctgccaccagggtagagtggatcaaccacctcaccgagtgggccacca 383
           |  ||||||||||| ||||||||||| ||||| ||||| |||||||| | ||| ||||| 
Sbjct: 637 aatgggtcgaagctaccaccagggtaaagtgggtcaacaacctcacccaatggtccaccg 578

                                                                       
Query: 384 gcaatgcggtacccttcaacggcgcccatgagcacgacttgacatgcccagatagcaagg 443
           ||||| | ||| || ||||| || ||||| |  | ||||||    ||||||||||| | |
Sbjct: 577 gcaattctgtagccctcaacagcacccatcaagatgacttgggtggcccagatagccaag 518

                                                                       
Query: 444 atgctttgtgcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctgaag 503
           ||||| || ||||| || |  |||||||| || | ||| || || ||||| || ||||||
Sbjct: 517 atgctctgagcatggaccaaactagggtttcccaagtaatcaagcccaccttcactgaag 458

                                                                       
Query: 504 atttgggagcctgccttgaaccatacagcctcaccgaacttgactccattgcgcgcaaga 563
           || ||||| || ||||||||||||||||||||||||||||| || ||||| || || |  
Sbjct: 457 atctgggatccagccttgaaccatacagcctcaccgaacttcacaccattacgggccaag 398

                                                                       
Query: 564 agctcggggaagacgcatccgagcgcaccgagcatggcccaccttgcagtggatcacctc 623
           ||||| ||||||||||| || || || || ||||| ||||| | |||||||||| |||||
Sbjct: 397 agctcagggaagacgcagccaagagctccaagcattgcccatc-tgcagtggatgacctc 339

                
Query: 624 aagct 628
           |||||
Sbjct: 338 aagct 334



to top

>gb|AY617084.1| Pinus contorta chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score =  174 bits (88), Expect = 2e-40
 Identities = 340/424 (80%)
 Strand = Plus / Minus

                                                                       
Query: 183 tcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaac 242
           ||||| |||||||||| ||| || || |||||||| || |||||||||||||| || |||
Sbjct: 751 tcagcgaggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaac 692

                                                                       
Query: 243 atggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcc 302
           ||||| |||||||| |  ||||| ||||||| ||| || ||||| ||||| ||||| || 
Sbjct: 691 atggaaaacatggccaaccgcccgttcttgatctccttcaccttcagctctgcgaaagcg 632

                                                                       
Query: 303 tctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaacc 362
           || ||||| || || || || ||||||||||||||||| || |||||||  || ||   |
Sbjct: 631 tcggggtcgtccgcgagtcccagcgggtcgaagctgcccccggggtagatggggtcggtc 572

                                                                       
Query: 363 acctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgact 422
           ||||| |  || || || || ||||| ||||| || || |||||||||||||| | ||| 
Sbjct: 571 acctctctcagaggaccgcccgcaatacggtagccctccacggcgcccatgaggatgacc 512

                                                                       
Query: 423 tgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtag 482
           || ||||||||||| ||||| ||||| || || || || | ||||||||| || ||||||
Sbjct: 511 tggcatgcccagattgcaagaatgctctgcgcgtgaaccaagctagggtttcccaggtag 452

                                                                       
Query: 483 tcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaac 542
           || || || || |||||||| || || |  || ||||||||||| || ||||||||||||
Sbjct: 451 tcaagccctccctcgctgaaaatctgagctcccgccttgaaccacacggcctcaccgaac 392

                                                                       
Query: 543 ttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggcc 602
           || |||||||| | ||| |||||||| ||||| ||||| || || || || ||||| |||
Sbjct: 391 tttactccatttctcgccagaagctccgggaaaacgcaacccagagcgcccagcattgcc 332

               
Query: 603 cacc 606
           ||||
Sbjct: 331 cacc 328



to top

>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein
           (CipLhcb1) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 975

 Score =  174 bits (88), Expect = 2e-40
 Identities = 345/428 (80%), Gaps = 2/428 (0%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| ||||| || ||||| |||||  | ||||| |||||||||||||| || || |
Sbjct: 851 ctcactttccggggacgaagttggtggcgtaggcccaggcgttgttgttgactgggtcag 792

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | || ||||| || |||||||| |  || ||||| ||||||||||| ||||| |||||||
Sbjct: 791 caaggtggtcggcgaggttctccaatggtccctttccggtgacaatggcctggacgaaga 732

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | || |||| |||||||||||| |  |  || |||||||  || || ||||||||||| |
Sbjct: 731 acccgaacacggagaacatggccaacctaccgttcttgagttccttgaccttgagctcgg 672

                                                                       
Query: 295 cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagt- 353
           |||| ||||||||||| || || || || |  ||||||||||||||||| ||||| ||| 
Sbjct: 671 cgaaagcctctgggtcgtcagcgagacccaatgggtcgaagctgccaccggggta-agtg 613

                                                                       
Query: 354 ggatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatg 413
           || |||   ||||||||||| || ||||| ||||| ||||| || || ||||||||||||
Sbjct: 612 gggtcagtgacctcaccgagaggcccaccggcaatacggtaaccctcgacggcgcccatg 553

                                                                       
Query: 414 agcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttg 473
           || | ||||||    |||||||| || |||||||| || || || | |||||| ||||||
Sbjct: 552 aggatgacttgggtggcccagatggcgaggatgctctgagcgtggatgaggcttgggttg 493

                                                                       
Query: 474 ccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcc 533
           || | ||||||||| ||||| ||||||||||| ||||| || || |||||||| || |||
Sbjct: 492 cccaagtagtcgagcccaccctcgctgaagatctgggaaccggctttgaaccagacggcc 433

                   
Query: 534 tcaccgaa 541
           || |||||
Sbjct: 432 tcgccgaa 425



to top

>emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b binding protein
          Length = 1656

 Score =  174 bits (88), Expect = 2e-40
 Identities = 420/528 (79%), Gaps = 2/528 (0%)
 Strand = Plus / Minus

                                                                        
Query: 118  acttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcga 177
            |||| ||||| |||||||| |||||| | ||||| ||||||||||| || || || || |
Sbjct: 1303 actttccggggacaaagtttgtggcataggcccaggcgttgttgttaacggggtcagcaa 1244

                                                                        
Query: 178  gatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagc 237
            | || ||| ||||||| || |  || || || || ||||||||||| || |||||||| |
Sbjct: 1243 ggtgatcaacaaggttatctaatggaccttttccagtgacaatagcttgaacgaagaatc 1184

                                                                        
Query: 238  caaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcga 297
            | |||||||||||||| ||||| |  || || || | ||| |||||||||||||| || |
Sbjct: 1183 cgaacatggagaacatagcaagcctaccgtttttaatctcctttaccttgagctcagcaa 1124

                                                                        
Query: 298  atgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggat 357
            | |||||||||||||| || || || |  ||||| ||||| ||||| ||||||||||| |
Sbjct: 1123 aagcctctgggtcatcagcaagacctaatgggtcaaagctaccaccggggtagagtgggt 1064

                                                                        
Query: 358  caaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagca 417
            |    |||||||| || || ||||||||||  ||||| || ||||  || ||||| | ||
Sbjct: 1063 cggtaacctcaccaagaggtccaccagcaacacggtaaccctcaatagctcccatcaaca 1004

                                                                        
Query: 418  cgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccga 477
            | ||||| || ||||| || || | ||||||||||||||| || |  || |||||||| |
Sbjct: 1003 caacttggcaagcccaaatggccaagatgctttgtgcatggaccaaacttgggttgccca 944

                                                                        
Query: 478  ggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcac 537
             |||||| || ||||| |||||||| ||||| || || ||||||||||| ||||| ||||
Sbjct: 943  agtagtcaagtccaccctcgctgaaaatttgagatccagccttgaaccagacagcttcac 884

                                                                        
Query: 538  cgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagca 597
            |||||||||| ||||| || || |  || ||||||||||| || ||||| || || ||||
Sbjct: 883  cgaacttgacaccattacgagccaagagttcggggaagacacaaccgagagctccaagca 824

                                                            
Query: 598  tggcccaccttgcagtggatcacctcaagcttcccggttctttgcaaa 645
            | ||||| | | ||||| |||||||| ||| || |||||||| |||||
Sbjct: 823  tagcccatc-tacagtgaatcacctctagc-tcacggttcttagcaaa 778



to top

>emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/b binding protein
          Length = 964

 Score =  174 bits (88), Expect = 2e-40
 Identities = 404/508 (79%), Gaps = 1/508 (0%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||| ||||| |||||||| |||||  | | ||| || |||||||| || || || ||
Sbjct: 871 tcactttccggggacaaagttggtggcgtaggaccaggcattgttgttaactgggtcagc 812

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            || ||||| || |||||||| |  || ||||| || ||||| ||||| || ||||||||
Sbjct: 811 aaggtggtcggctaggttctccaatggaccctttccagtgacgatagcttgaacgaagaa 752

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
            |||||||| |||||||| ||||| |  ||||||||||  | |||||| ||||| || ||
Sbjct: 751 tccaaacatagagaacatagcaagtctaccattcttgatgtgttttactttgagttcagc 692

                                                                       
Query: 296 gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
            || ||||||||||| || || || || |  ||||| ||||||||||| |||||||| ||
Sbjct: 691 aaaagcctctgggtcttcagcaagacccaatgggtcaaagctgccaccggggtagagcgg 632

                                                                       
Query: 356 atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
            || || |||||||| || |||||||||||||  ||||| ||||| || || ||||| | 
Sbjct: 631 gtcgacaacctcaccaagagggccaccagcaacacggtaaccttcgacagctcccatcaa 572

                                                                       
Query: 416 cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
           ||| ||||| || ||||| || || | |||||||||||| || || |  || ||||||||
Sbjct: 571 cacaacttggcaagcccaaatggccaagatgctttgtgcgtgaaccaaacttgggttgcc 512

                                                                       
Query: 476 gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
            | |||||| || ||||| ||||| || |||||||| || |||||||||||||| || ||
Sbjct: 511 caagtagtcaagtccaccctcgctaaaaatttgggatccagccttgaaccatactgcttc 452

                                                                       
Query: 536 accgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgag 595
           ||| |||||||| || || || || |  |||||||||||||| || || || || || ||
Sbjct: 451 accaaacttgaccccgttacgggccaagagctcggggaagacacaaccaagagctccaag 392

                                       
Query: 596 catggcccaccttgcagtggatcacctc 623
           ||| ||||| | ||||||||||||||||
Sbjct: 391 catagcccatc-tgcagtggatcacctc 365



to top

>gb|DQ471302.1| Carya cathayensis putative chloroplast chlorophyll a/b-binding
           protein (ABC) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 993

 Score =  172 bits (87), Expect = 9e-40
 Identities = 390/491 (79%)
 Strand = Plus / Minus

                                                                       
Query: 114 cctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcg 173
           |||||||| || || |||||||| |||||| | ||||| || |||||||| |||||||| 
Sbjct: 806 cctcactttccagggacaaagtttgtggcataagcccaagcattgttgtttacaggatca 747

                                                                       
Query: 174 gcgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaag 233
           || | ||||||||| |||||||| |  || |||||||| || ||||| || || || |||
Sbjct: 746 gccaaatggtcagccaggttctccaatggtcccttgccagtcacaatggcttggacaaag 687

                                                                       
Query: 234 aagccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctcc 293
           || |||||||||||||||||||| |  | ||||||||| | ||| |||||||||||||| 
Sbjct: 686 aacccaaacatggagaacatggccaatctcccattctttagctcctttaccttgagctca 627

                                                                       
Query: 294 gcgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagt 353
           || ||||||||||| ||||| || ||||| |  ||||| ||||| ||||| ||||| | |
Sbjct: 626 gcaaatgcctctggatcatcagcaaggcctaatgggtcaaagctcccacctgggtatatt 567

                                                                       
Query: 354 ggatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatg 413
           || ||   ||||||||| ||||| ||||||||||| ||||| || || || || ||||| 
Sbjct: 566 gggtctgtcacctcaccaagtggcccaccagcaatacggtagccctcgactgcacccatt 507

                                                                       
Query: 414 agcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttg 473
           |  |  |||||    ||||| || || || |||||||| ||||| || | ||| || || 
Sbjct: 506 aagatcacttgtgtggcccaaatggctagaatgctttgagcatggaccaagcttggattt 447

                                                                       
Query: 474 ccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcc 533
           || | |||||| || ||||| || || |||||||| |  || ||||||||||| ||||||
Sbjct: 446 cccaagtagtccagcccaccttcactaaagatttgagctccagccttgaaccagacagcc 387

                                                                       
Query: 534 tcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccg 593
           ||||| ||||| ||||||||||| || | ||| |||||||| || || || || || || 
Sbjct: 386 tcaccaaacttaactccattgcgagccaaaagttcggggaaaacacaaccaagagcccca 327

                      
Query: 594 agcatggccca 604
           |||||||||||
Sbjct: 326 agcatggccca 316



to top

>emb|Z75663.1|AGCHLABBP A.graveolens mRNA for chlorophyll a/b binding protein
          Length = 963

 Score =  172 bits (87), Expect = 9e-40
 Identities = 422/531 (79%), Gaps = 2/531 (0%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| ||||||||||||||||||||||| ||||| || |||||||| ||||| || |
Sbjct: 838 ctcactttccgggaacaaagttagtggcaaaggcccaggcattgttgttaacagggtctg 779

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | || |||||||| | |||||| |  || ||||| ||||| |||||||| || || ||||
Sbjct: 778 caaggtggtcagccaagttctctaatggaccctttccggtcacaatagcttgtacaaaga 719

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | |||||||||||||||||||| || |  ||||| || | ||| || ||||| ||||| |
Sbjct: 718 atccaaacatggagaacatggctagtcttccatttttcagctccttcaccttaagctctg 659

                                                                       
Query: 295 cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
           |  ||  ||||||||| || || ||||| |  ||||| ||||| || |||||||| || |
Sbjct: 658 cagatcgctctgggtcttcagcaaggcctaatgggtcaaagcttcctccagggtaaaggg 599

                                                                       
Query: 355 gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
           | || || |  || || ||||| ||||||||||  ||||| || ||||| |||||||| |
Sbjct: 598 ggtcgacaatttcccctagtggtccaccagcaacacggtaaccctcaactgcgcccatca 539

                                                                       
Query: 415 gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
             | |||||||   ||||||||||  |  |||||||||||||| || | ||| ||||| |
Sbjct: 538 agatgacttgagtagcccagatagataatatgctttgtgcatggaccaagcttgggttac 479

                                                                       
Query: 475 cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
           | | |||||| || ||||| |||||||||||||| || || ||||| ||||| || ||||
Sbjct: 478 ccaagtagtcaagtccaccctcgctgaagatttgtgatccagccttaaaccacactgcct 419

                                                                       
Query: 535 caccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccga 594
           | || |||||||| ||||| || || |  ||||| |||||||| || || || || || |
Sbjct: 418 cgccaaacttgacaccattacgagccaagagctcagggaagacacacccaagggctccaa 359

                                                              
Query: 595 gcatggcccaccttgcagtggatcacctcaagcttcccggttctttgcaaa 645
           |||||||||| | || |||||||||| ||||| ||| |||||||| |||||
Sbjct: 358 gcatggcccatc-tggagtggatcacttcaag-ttcacggttcttggcaaa 310



to top

>gb|K00972.1|PETCAB146 Petunia major chlorophyll a/b binding protein (Cab) clone pCab146,
           3' end and flank
          Length = 498

 Score =  172 bits (87), Expect = 9e-40
 Identities = 276/339 (81%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||| |||||||||||||| || ||| | | |||||| |||||||| || ||||| ||
Sbjct: 378 tcactttccgggaacaaagtttgtagcataggaccatgcattgttgttaactggatcagc 319

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            || ||||| ||||||||||| |  || ||||| |||||||| ||||||||||| |||||
Sbjct: 318 aaggtggtcggcaaggttctccaatggaccctttccggtgacgatagcctgcacaaagaa 259

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
            |||||||| |||||||| ||||| |  |||||||| | ||| || ||||||||||| ||
Sbjct: 258 tccaaacatagagaacatagcaagtctaccattcttaatctccttcaccttgagctcagc 199

                                                                       
Query: 296 gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
            || || || ||||| || |||||||| |  || |||||||| |||||||| || |||||
Sbjct: 198 aaaagcttcggggtcttcagctaggcccaatggatcgaagctaccaccaggataaagtgg 139

                                                                       
Query: 356 atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
            ||||  ||||||||||| || ||||||||||  ||||| || ||||| || ||||| | 
Sbjct: 138 gtcaataacctcaccgagaggtccaccagcaacacggtaaccctcaacagctcccatcaa 79

                                                  
Query: 416 cacgacttgacatgcccagatagcaaggatgctttgtgc 454
           ||||||||| || ||||| || || | ||||||||||||
Sbjct: 78  cacgacttggcaagcccaaatggccaagatgctttgtgc 40



to top

>gb|M14449.1|TOMCBPG Tomato chlorophyll a/b-binding protein gene Cab-1D, complete cds
          Length = 351

 Score =  172 bits (87), Expect = 9e-40
 Identities = 273/335 (81%)
 Strand = Plus / Minus

                                                                       
Query: 123 ccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgagatgg 182
           ||||||||||||||||||||  | | ||| ||||||||||| || || || || || || 
Sbjct: 344 ccgggaacaaagttagtggcgtaggaccaggcgttgttgtttactgggtctgcaaggtga 285

                                                                       
Query: 183 tcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaac 242
           |||||||||||||| |  || ||||| || || ||||| || || || ||||| ||||||
Sbjct: 284 tcagcaaggttctccaatggtccctttccagtaacaatggcttgaacaaagaatccaaac 225

                                                                       
Query: 243 atggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcc 302
           || |||||||| ||||| |  || ||||| | ||| || ||||||||||| || ||||||
Sbjct: 224 atagagaacatagcaagtctaccgttcttaatctccttaaccttgagctcagcaaatgcc 165

                                                                       
Query: 303 tctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaacc 362
           || ||||| || || ||||| |  ||||||||||| ||||| ||||||||||| || || 
Sbjct: 164 tcagggtcttcagcaaggcctaatgggtcgaagcttccaccggggtagagtgggtctaca 105

                                                                       
Query: 363 acctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgact 422
           |||||||| || || ||||||||||| ||||| ||||||||||| |||||||| || |||
Sbjct: 104 acctcaccaagaggtccaccagcaatacggtaaccttcaacggctcccatgagtacaact 45

                                              
Query: 423 tgacatgcccagatagcaaggatgctttgtgcatg 457
           || || |||||||| || | |||||| ||||||||
Sbjct: 44  tggcaagcccagatggccaagatgctctgtgcatg 10



to top

>emb|AJ538464.1|NTA538464 Nicotiana tabacum cDNA-AFLP-fragment BC2-M14-017
          Length = 330

 Score =  170 bits (86), Expect = 4e-39
 Identities = 194/230 (84%)
 Strand = Plus / Minus

                                                                       
Query: 204 cccttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgc 263
           ||||| |||||||| |||||||| |||||||| ||||||||||||||||||||||| |  
Sbjct: 289 ccctttccggtgacgatagcctgaacgaagaatccaaacatggagaacatggcaagtctg 230

                                                                       
Query: 264 ccattcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggctaggccg 323
           || ||||||| ||| |||||||||||||| || || || ||||||||||| || || || 
Sbjct: 229 ccgttcttgatctcctttaccttgagctcagcaaaagcttctgggtcatcagcaagaccc 170

                                                                       
Query: 324 agcgggtcgaagctgccaccagggtagagtggatcaaccacctcaccgagtgggccacca 383
           |  ||||| ||||| ||||||||||||||||| ||||| |||||||| || || ||||||
Sbjct: 169 aatgggtcaaagctaccaccagggtagagtgggtcaacaacctcaccaagaggtccacca 110

                                                             
Query: 384 gcaatgcggtacccttcaacggcgcccatgagcacgacttgacatgccca 433
           ||||  ||||| || |||||||| ||||| | ||| |||||||| |||||
Sbjct: 109 gcaacacggtaaccctcaacggctcccatcaacacaacttgacaagccca 60



to top

>emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll a/b binding protein
          Length = 980

 Score =  170 bits (86), Expect = 4e-39
 Identities = 350/438 (79%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||| ||||| |||||||| ||||||||   ||| || |||||||| || || || ||
Sbjct: 853 tcactttccggggacaaagttggtggcaaagttccaagcattgttgttaaccgggtcagc 794

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            || |||||||| ||||| || |  |||||||| ||||| |||||||| || || |||||
Sbjct: 793 aaggtggtcagcgaggttttccaatgggccctttccggtaacaatagcttgaacaaagaa 734

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
            ||||||||||| ||||| || |  |  |||||||| |  || || ||||| | ||| ||
Sbjct: 733 cccaaacatggaaaacatagccaacctaccattcttaatttccttcaccttcaactcagc 674

                                                                       
Query: 296 gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
           ||| || ||||||||||| || | ||| |  ||||| ||||| ||||||||||| |||||
Sbjct: 673 gaaggcttctgggtcatcagccaagcccaatgggtcaaagctaccaccagggtaaagtgg 614

                                                                       
Query: 356 atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
            |||||||||||||| || || ||||||||||| |||||||| ||||| || ||||| | 
Sbjct: 613 gtcaaccacctcaccaagaggcccaccagcaatacggtacccctcaacagcacccatcaa 554

                                                                       
Query: 416 cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
            |  |||||||| ||||| ||||||||||| ||||| ||||| || |  || ||||| ||
Sbjct: 553 gataacttgacaggcccaaatagcaaggatactttgagcatggaccaaacttgggttacc 494

                                                                       
Query: 476 gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
            | |||||| || ||||| ||||| |||||||| || || ||||| ||||| || |||||
Sbjct: 493 caagtagtcaagcccaccctcgctaaagatttgtgaacccgccttaaaccaaacggcctc 434

                             
Query: 536 accgaacttgactccatt 553
           ||||||||| || |||||
Sbjct: 433 accgaacttaacaccatt 416



to top

>gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB2) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1027

 Score =  168 bits (85), Expect = 1e-38
 Identities = 352/441 (79%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           ||||||||| ||| ||||||| ||||| || ||||| || |||||||| || || |||||
Sbjct: 816 tcacttgcctggagcaaagtttgtggcgaaggcccaagcattgttgttaactgggtcggc 757

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            || || |||||||||||||| |  || ||||| ||||| ||||| || || || |||||
Sbjct: 756 aaggtgatcagcaaggttctccaatggaccctttccggtcacaatggcttggacaaagaa 697

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
            || ||||| ||||||||||| |  |  || ||||||| ||| || ||||||||||| ||
Sbjct: 696 cccgaacattgagaacatggctaatctaccgttcttgatctccttcaccttgagctcagc 637

                                                                       
Query: 296 gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
            || ||||||||||| ||||| | ||| |  ||||| ||||| ||||| |||||||||||
Sbjct: 636 aaaagcctctgggtcctcggccaagcccaatgggtcaaagctaccacctgggtagagtgg 577

                                                                       
Query: 356 atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
            ||   ||||||||| ||||| ||||||||||  ||||| || |||| ||| ||||| | 
Sbjct: 576 gtcggtcacctcaccaagtggcccaccagcaacacggtagccctcaatggcacccatcaa 517

                                                                       
Query: 416 cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
            |  |||||||| |||||||| || ||||||||||| || || || |  || ||||||||
Sbjct: 516 gataacttgacaagcccagatggcgaggatgctttgagcgtggaccaaacttgggttgcc 457

                                                                       
Query: 476 gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
            | ||| || || ||||| ||||| ||||| ||||  || ||||||||||| ||||||||
Sbjct: 456 caagtaatcaagcccaccctcgctaaagatctgggctccggccttgaaccagacagcctc 397

                                
Query: 536 accgaacttgactccattgcg 556
           ||| |||||||| || |||||
Sbjct: 396 accaaacttgacaccgttgcg 376



to top

>gb|M64619.1|PEACAB66 Pea cab gene, complete cds
          Length = 1666

 Score =  168 bits (85), Expect = 1e-38
 Identities = 367/461 (79%)
 Strand = Plus / Minus

                                                                        
Query: 123  ccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgagatgg 182
            |||||||||||||| |||||| | | |||||| ||||||||||| || || || ||||| 
Sbjct: 1512 ccgggaacaaagttggtggcatatgaccatgcattgttgttgactgggtctgcaagatga 1453

                                                                        
Query: 183  tcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaac 242
            |||||||||||||| |  || ||||| || || |||||||| || |||||||| ||||||
Sbjct: 1452 tcagcaaggttctccaaaggaccctttccagttacaatagcttgaacgaagaatccaaac 1393

                                                                        
Query: 243  atggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcc 302
            || ||||||||||| |  |  || |||||||  || || ||||| |  || |||||||| 
Sbjct: 1392 attgagaacatggctaatctaccgttcttgagttccttcaccttcaattctgcgaatgct 1333

                                                                        
Query: 303  tctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaacc 362
            ||||| ||||| |||| ||| |  || || ||||| ||||| ||||| ||||||||||||
Sbjct: 1332 tctggatcatcagctaagcccaatggatcaaagcttccacctgggtaaagtggatcaacc 1273

                                                                        
Query: 363  acctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgact 422
            ||||||||||| || ||||| ||||| ||||| ||||| || || ||||| |  |  || 
Sbjct: 1272 acctcaccgagaggcccaccggcaatacggtaaccttcgacagctcccatcaagataacc 1213

                                                                        
Query: 423  tgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtag 482
            |||   ||||| || |||||||||||||| ||||| || | ||| |||||||| | ||| 
Sbjct: 1212 tgagtggcccatatggcaaggatgctttgagcatggaccaagcttgggttgcccaagtaa 1153

                                                                        
Query: 483  tcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaac 542
            || || ||||| || || |||||||| || |||||||||||||| ||||| || ||||| 
Sbjct: 1152 tcaagtccaccctcactaaagatttgagatcctgccttgaaccacacagcttcgccgaat 1093

                                                     
Query: 543  ttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
            || || || ||||| |  | |||||| |||||||| |||||
Sbjct: 1092 ttaacaccgttgcgagacaaaagctctgggaagacacatcc 1052



to top

>gb|K02067.1|PEACAB80 Pea (P.sativum) gene AB80 encoding major light-harvesting chlorophyll
            a/b-binding protein (polypeptide 15) complex precursor,
            complete coding sequence
          Length = 1993

 Score =  168 bits (85), Expect = 1e-38
 Identities = 367/461 (79%)
 Strand = Plus / Minus

                                                                        
Query: 123  ccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgagatgg 182
            |||||||||||||| |||||| | | |||||| ||||||||||| || || || ||||| 
Sbjct: 1813 ccgggaacaaagttggtggcatatgaccatgcattgttgttgactgggtctgcaagatga 1754

                                                                        
Query: 183  tcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaac 242
            |||||||||||||| |  || ||||| || || |||||||| || |||||||| ||||||
Sbjct: 1753 tcagcaaggttctccaaaggaccctttccagttacaatagcttgaacgaagaatccaaac 1694

                                                                        
Query: 243  atggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcc 302
            || ||||||||||| |  |  || |||||||  || || ||||| |  || |||||||| 
Sbjct: 1693 attgagaacatggctaatctaccgttcttgagttccttcaccttcaattctgcgaatgct 1634

                                                                        
Query: 303  tctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaacc 362
            ||||| ||||| |||| ||| |  || || ||||| ||||| ||||| ||||||||||||
Sbjct: 1633 tctggatcatcagctaagcccaatggatcaaagcttccacctgggtaaagtggatcaacc 1574

                                                                        
Query: 363  acctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgact 422
            ||||||||||| || ||||| ||||| ||||| ||||| || || ||||| |  |  || 
Sbjct: 1573 acctcaccgagaggcccaccggcaatacggtaaccttcgacagctcccatcaagataacc 1514

                                                                        
Query: 423  tgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtag 482
            |||   ||||| || |||||||||||||| ||||| || | ||| |||||||| | ||| 
Sbjct: 1513 tgagtggcccatatggcaaggatgctttgagcatggaccaagcttgggttgcccaagtaa 1454

                                                                        
Query: 483  tcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaac 542
            || || ||||| || || |||||||| || |||||||||||||| ||||| || ||||| 
Sbjct: 1453 tcaagtccaccctcactaaagatttgagatcctgccttgaaccacacagcttcgccgaat 1394

                                                     
Query: 543  ttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
            || || || ||||| |  | |||||| |||||||| |||||
Sbjct: 1393 ttaacaccgttgcgagacaaaagctctgggaagacacatcc 1353



to top

>gb|K00975.1|PETCAB10 Petunia major chlorophyll a/b binding protein (Cab) clone pCab10,
           3' end and flank
          Length = 367

 Score =  167 bits (84), Expect = 6e-38
 Identities = 192/228 (84%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||| |||||||||||||| |||||  | | ||| ||||||||||| || ||||||||
Sbjct: 231 tcactttccgggaacaaagtttgtggcgtaggaccaagcgttgttgttaactggatcggc 172

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            |||||||||||||||||||| |  || ||||| |||||||| |||||||| || || ||
Sbjct: 171 aagatggtcagcaaggttctccaatggaccctttccggtgacgatagcctgaacaaaaaa 112

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
            ||||||||||||||||| ||||| |  |||||||||| ||| || ||||||||||| ||
Sbjct: 111 tccaaacatggagaacatagcaagtctaccattcttgatctccttcaccttgagctcagc 52

                                                           
Query: 296 gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccacc 343
            ||||| |||||||||||||| ||||| |  || |||||||| |||||
Sbjct: 51  aaatgcttctgggtcatcggcaaggcctaatggatcgaagctaccacc 4



to top

>emb|AJ538931.1|NTA538931 Nicotiana tabacum cDNA-AFLP-fragment BT21-M1-005
          Length = 332

 Score =  165 bits (83), Expect = 2e-37
 Identities = 227/275 (82%)
 Strand = Plus / Minus

                                                                       
Query: 180 tggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagcca 239
           ||||| ||||||||||| |  || ||||| || ||||| |||||||| || ||||| |||
Sbjct: 315 tggtcggcaaggttctccaatggaccctttccagtgacgatagcctgaacaaagaatcca 256

                                                                       
Query: 240 aacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaat 299
           |||||||||||||| ||||| |  |||||||||| ||| |||||||||||||| || || 
Sbjct: 255 aacatggagaacatagcaagtctaccattcttgatctcctttaccttgagctcagcaaaa 196

                                                                       
Query: 300 gcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatca 359
           ||||||||||| || || || || |  |||||||| |||||||||||||| ||||| |||
Sbjct: 195 gcctctgggtcttcagcaagacccaatgggtcgaaactgccaccagggtaaagtgggtca 136

                                                                       
Query: 360 accacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacg 419
           || || |||||||| || ||||||||||  ||||| || |||||||| ||||| ||||| 
Sbjct: 135 acaacttcaccgagaggtccaccagcaacacggtaaccctcaacggctcccatcagcaca 76

                                              
Query: 420 acttgacatgcccagatagcaaggatgctttgtgc 454
           ||||| || ||||| || || |  |||||||||||
Sbjct: 75  acttggcaagcccaaatggccaaaatgctttgtgc 41



to top

>emb|X16536.1|GMCAB5 G.max DNA for Cab5
          Length = 1467

 Score =  165 bits (83), Expect = 2e-37
 Identities = 424/535 (79%), Gaps = 2/535 (0%)
 Strand = Plus / Minus

                                                                        
Query: 115  ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
            ||||||| ||||| |||||||| || ||| | ||||| || || ||||| || || || |
Sbjct: 1123 ctcactttccggggacaaagtttgtagcataggcccaggcattattgtttactgggtcag 1064

                                                                        
Query: 175  cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
            | || ||||||||||| || || |  || ||||| || || ||||| ||||| || ||||
Sbjct: 1063 ctaggtggtcagcaagattttccaaaggtccctttcctgtcacaattgcctgaacaaaga 1004

                                                                        
Query: 235  agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
            | |||||||||||||||||||| |  |  |||||||||| |||||| ||||| | ||| |
Sbjct: 1003 aaccaaacatggagaacatggccaacctaccattcttgagctctttcaccttcaactcag 944

                                                                        
Query: 295  cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
            | || |||||||||||||| || ||||| |  ||||| ||||||||||| || |||| ||
Sbjct: 943  caaaagcctctgggtcatcagcaaggcccaatgggtcaaagctgccacctggatagattg 884

                                                                        
Query: 355  gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
            | |||  ||||||||| || || ||||||||||| ||||| || |||||||| ||||| |
Sbjct: 883  ggtcagtcacctcaccaagaggcccaccagcaatacggtaaccctcaacggcacccatca 824

                                                                        
Query: 415  gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
              |  |||||    |||||||| ||||| |||||||||||||| |  ||||| |||||||
Sbjct: 823  agataacttgggtggcccagatggcaagaatgctttgtgcatggatcaggcttgggttgc 764

                                                                        
Query: 475  cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
            | | |||||| || ||||| || ||||| || || || || ||||||||||| || || |
Sbjct: 763  ccaagtagtcaagcccaccctcactgaatatctgagacccggccttgaaccacacggctt 704

                                                                        
Query: 535  caccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccga 594
            ||||||||||||| || ||||| || |  || |||||||| || || || || || || |
Sbjct: 703  caccgaacttgacaccgttgcgggccaagagttcggggaaaacacagcccagggctccca 644

                                                                   
Query: 595  gcatggcccaccttgcagtggatcacctcaagcttcccggttctttgcaaaggtc 649
             ||||||||| | || ||||||| || ||||| ||| |||||||| |||||||||
Sbjct: 643  acatggcccatc-tggagtggatgacttcaag-ttcacggttcttggcaaaggtc 591



to top

>gb|M16057.1|CUSLHCPA Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein,
           partial cds
          Length = 878

 Score =  165 bits (83), Expect = 2e-37
 Identities = 350/439 (79%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| || ||||||||||| || ||| | ||||| || ||||||||||| || || |
Sbjct: 769 ctcactttccaggaacaaagtttgtagcataggcccaagcattgttgttgactgggtcag 710

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | ||||| ||||| |  ||||| |  || ||||| ||||| || |||||||| || ||||
Sbjct: 709 caagatgatcagccaaattctccaatggaccctttccggtaacgatagcctgaacaaaga 650

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | ||||||||||||||||| || |  |  |||||||||| ||| || ||||| | ||| |
Sbjct: 649 atccaaacatggagaacatagctaaccttccattcttgagctccttaaccttcaactcag 590

                                                                       
Query: 295 cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
           ||||||||||||||||||| || |  || |  ||||||||||| ||||| |||||||  |
Sbjct: 589 cgaatgcctctgggtcatcagccaaacccaatgggtcgaagcttccacctgggtagatgg 530

                                                                       
Query: 355 gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
           | |||  |||||| |||||||||||||||||||| ||||| || || ||||| ||||| |
Sbjct: 529 ggtcagtcacctctccgagtgggccaccagcaatacggtaaccctcgacggcacccatca 470

                                                                       
Query: 415 gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
            ||| ||||| || |||||||| || |  ||||| || || || || | ||| |||||||
Sbjct: 469 acacaacttggcaagcccagatggccaaaatgctctgagcgtggaccaagctggggttgc 410

                                                                       
Query: 475 cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
           | | |||||| || || || ||||||||||| || || || ||||||||||| ||||| |
Sbjct: 409 ccaagtagtcaagcccgccctcgctgaagatctgcgaaccagccttgaaccacacagctt 350

                              
Query: 535 caccgaacttgactccatt 553
           |||| ||||| || |||||
Sbjct: 349 caccaaacttcacaccatt 331



to top

>gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/b-binding protein
           (CipLhcb1*3) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 941

 Score =  163 bits (82), Expect = 9e-37
 Identities = 343/430 (79%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| ||||| |||||||| |||||| | ||||| || |||||||||||||| || |
Sbjct: 851 ctcactttccggggacaaagtttgtggcatatgcccaagcattgttgttgacagggtcag 792

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | || ||||| |||||||| || || || ||||| ||||| ||||| ||||| || ||||
Sbjct: 791 caaggtggtctgcaaggttttccagcggtccctttccggtcacaatcgcctgaacaaaga 732

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | || ||||||||||||||||| |  |  || ||||| | |||||| || || | ||| |
Sbjct: 731 aaccgaacatggagaacatggctaatctaccgttcttcagctctttcactttcaactcag 672

                                                                       
Query: 295 cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
           | || |||||||||||||| || ||||| |  ||||||||||| ||||| ||||| | ||
Sbjct: 671 caaaagcctctgggtcatcagcaaggcccaatgggtcgaagcttccaccggggtaaattg 612

                                                                       
Query: 355 gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
           | |||  |||||||||||| || ||||| ||||| ||||| || || ||||| ||||| |
Sbjct: 611 ggtcagtcacctcaccgagaggcccaccggcaatacggtaaccctccacggcacccatca 552

                                                                       
Query: 415 gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
             |  |||||| | ||||| ||||| |||||||| |||||||| |  ||||| || ||||
Sbjct: 551 aaataacttgagaggcccaaatagccaggatgctctgtgcatgaatcaggcttggattgc 492

                                                                       
Query: 475 cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
           | | |||||| || ||||| || ||||| || || || || ||||| ||||| |||||||
Sbjct: 491 ccaagtagtcaagtccaccctcactgaatatctgagatccagccttaaaccacacagcct 432

                     
Query: 535 caccgaactt 544
           | ||||||||
Sbjct: 431 cgccgaactt 422



to top

>emb|X74731.1|AHLHCB A.hypochondriacus Lhcb1*Ah1 mRNA
          Length = 699

 Score =  163 bits (82), Expect = 9e-37
 Identities = 340/426 (79%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||| ||||| |||||||| || ||| | ||||| || |||||||| || || || ||
Sbjct: 561 tcactttccgggtacaaagttggtagcataggcccaagcattgttgttaaccgggtcagc 502

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            |||||||||||||||||||| |  |||||||| || || |||||||| || || |||||
Sbjct: 501 aagatggtcagcaaggttctccaatgggccctttcctgtaacaatagcttgaacaaagaa 442

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
            ||||||||||||||||| || |     |||||||| | ||| || || || | ||||||
Sbjct: 441 tccaaacatggagaacatagccaacataccattcttaatctccttcactttcaactccgc 382

                                                                       
Query: 296 gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
           ||| || || |||||||| |||| ||| |  ||||| ||||| ||||| ||||| |||||
Sbjct: 381 gaaagcatccgggtcatcagctaagcccaatgggtcaaagctaccacctgggtatagtgg 322

                                                                       
Query: 356 atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
            |||||||||||||| ||||||||||||||||| ||||| ||||| || || ||||| | 
Sbjct: 321 gtcaaccacctcaccaagtgggccaccagcaatacggtaaccttccactgcacccatcaa 262

                                                                       
Query: 416 cacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgcc 475
            |  |||||||| ||||| || |||||||| ||||| ||||| |  | ||| ||||| ||
Sbjct: 261 gattacttgacaggcccatattgcaaggatactttgggcatggatcaagcttgggttacc 202

                                                                       
Query: 476 gaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctc 535
            | ||| || || ||||| || || || ||||| || |||||||||||||| || || ||
Sbjct: 201 caagtaatcaagcccaccttcactaaaaatttgtgatcctgccttgaaccaaacggcttc 142

                 
Query: 536 accgaa 541
           ||||||
Sbjct: 141 accgaa 136



to top

>gb|AF162200.1|AF162200 Lactuca sativa light-harvesting chlorophyll a/b binding protein
           mRNA, complete sequence; nuclear gene for chloroplast
           product
          Length = 643

 Score =  163 bits (82), Expect = 9e-37
 Identities = 360/450 (80%), Gaps = 2/450 (0%)
 Strand = Plus / Minus

                                                                       
Query: 180 tggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagcca 239
           |||||||| |||||||| |  || ||||| ||||| ||||| || || || ||||| |||
Sbjct: 566 tggtcagcgaggttctccaatggtccctttccggtaacaatggcttgaacaaagaatcca 507

                                                                       
Query: 240 aacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaat 299
           ||||| ||||||||||| || |  || ||||||| ||| || || || ||||| || |||
Sbjct: 506 aacatagagaacatggctagtctaccgttcttgagctccttcactttcagctcagcaaat 447

                                                                       
Query: 300 gcctctgggtcatcggctag-gccgagcgggtcgaagctgccaccagggtagagtggatc 358
           |||||||||||||| || ||  || |  ||||||||||| ||||||||||| ||||| ||
Sbjct: 446 gcctctgggtcatcagccagacccaatggggtcgaagctaccaccagggtaaagtgggtc 387

                                                                       
Query: 359 aaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcac 418
           ||| |||||||| || || ||||||||||| | ||| |||||||| || ||||| |  | 
Sbjct: 386 aactacctcaccaagaggtccaccagcaattctgtaaccttcaactgcacccatcaagat 327

                                                                       
Query: 419 gacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgag 478
            |||||    |||||||| || |  |||||||||||||| |  |  || ||||| || | 
Sbjct: 326 cacttgggtagcccagatggctaaaatgctttgtgcatggatcaaacttgggttccccaa 267

                                                                       
Query: 479 gtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcacc 538
           |||||| || ||| | || || ||||| ||||| || |||||||||||||||||||||||
Sbjct: 266 gtagtcaagaccatcctcactaaagatctgggatccagccttgaaccatacagcctcacc 207

                                                                       
Query: 539 gaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcat 598
            |||||||| ||||| ||||| |  || |||||||||||||| || || || ||||||||
Sbjct: 206 aaacttgacaccattacgcgccaagagttcggggaagacgcacccaagagctccgagcat 147

                                         
Query: 599 ggcccaccttgcagtggatcacctcaagct 628
           |||||| | ||| |||||| ||||||||||
Sbjct: 146 ggcccatc-tgctgtggatgacctcaagct 118



to top

>dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10J15, TM0007,
             complete sequence
          Length = 92741

 Score =  163 bits (82), Expect = 9e-37
 Identities = 407/514 (79%), Gaps = 1/514 (0%)
 Strand = Plus / Plus

                                                                         
Query: 115   ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
             ||||||| || || |||||||| |||||| | ||||| || |||||||| || || || |
Sbjct: 65558 ctcactttccagggacaaagttggtggcataggcccaggcattgttgttaactgggtcag 65617

                                                                         
Query: 175   cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
               || ||||| ||||||||||| |  || ||||| ||||| |||||||| || || ||||
Sbjct: 65618 aaaggtggtctgcaaggttctccaaaggcccctttccggtcacaatagcttgaacaaaga 65677

                                                                         
Query: 235   agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
             | |||||||| ||||||||||| |  |  ||||||||||  || || || || ||||| |
Sbjct: 65678 atccaaacattgagaacatggccaaccttccattcttgagttccttcactttaagctcag 65737

                                                                         
Query: 295   cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
             | || |||||||||||||| || ||||| |  ||||| ||||||||||| ||||||||||
Sbjct: 65738 caaaagcctctgggtcatcagcaaggcccaatgggtcaaagctgccacctgggtagagtg 65797

                                                                         
Query: 355   gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
             | ||   ||||||||| || || ||||||||||| ||||| || ||||| || ||||| |
Sbjct: 65798 ggtcggtcacctcaccaagaggcccaccagcaatacggtaaccctcaactgctcccatca 65857

                                                                         
Query: 415   gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
               |  || |||   ||||| || ||||| ||||| || || || || ||||| |||||||
Sbjct: 65858 agataacctgagtggcccaaattgcaagaatgctctgagcgtggaccaggctcgggttgc 65917

                                                                         
Query: 475   cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
             | | |||||| || ||||| |||||||||||||| || || ||||||||||| |||||||
Sbjct: 65918 ccaagtagtcaagcccaccctcgctgaagatttgtgacccagccttgaaccacacagcct 65977

                                                                         
Query: 535   caccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccga 594
             ||||||| || || || ||||| || |  ||||| ||||| || || || |  || || |
Sbjct: 65978 caccgaatttaaccccgttgcgggccaagagctctgggaaaacacagcccaaagctccca 66037

                                               
Query: 595   gcatggcccaccttgcagtggatcacctcaagct 628
              |||||||||||| | ||||||||||||||||||
Sbjct: 66038 acatggcccacctag-agtggatcacctcaagct 66070



to top

>dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding protein, complete
           cds
          Length = 1010

 Score =  163 bits (82), Expect = 9e-37
 Identities = 417/526 (79%), Gaps = 2/526 (0%)
 Strand = Plus / Minus

                                                                       
Query: 123 ccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgagatgg 182
           ||||| |||||||| |||||| | ||||| || |||||| |||| || || || || |||
Sbjct: 835 ccggggacaaagtttgtggcataagcccaagcattgttggtgactgggtcagcaaggtgg 776

                                                                       
Query: 183 tcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaac 242
           |||||||||||||| | ||| ||||| || || ||||| ||||| || ||||| ||||||
Sbjct: 775 tcagcaaggttctcaatgggtccctttccagtcacaatggcctgaacaaagaatccaaac 716

                                                                       
Query: 243 atggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcc 302
           || |||||||| || || |  |||||||||| ||| || ||||| ||||| || || |||
Sbjct: 715 atagagaacatagccagtcttccattcttgagctccttcaccttaagctcagcaaaagcc 656

                                                                       
Query: 303 tctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaacc 362
           ||||||||||| || ||||| |  ||||| ||||| ||||| ||||| ||||| |||  |
Sbjct: 655 tctgggtcatcagcaaggcctaatgggtcaaagcttccacctgggtaaagtgggtcagtc 596

                                                                       
Query: 363 acctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgact 422
           |||||||| ||||| ||||||||||| ||||| || ||||| || ||||| |  |  || 
Sbjct: 595 acctcaccaagtggcccaccagcaatacggtaaccctcaacagcacccatcaagataacc 536

                                                                       
Query: 423 tgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtag 482
           ||    |||||||| || |  |||||||||||||| |  | ||| ||||| || | ||||
Sbjct: 535 tgtgtggcccagatggccaaaatgctttgtgcatggatcaagcttgggttacccaagtag 476

                                                                       
Query: 483 tcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaac 542
           || || ||||| || ||||| |||||||  || ||||||||||| || |||||||| |||
Sbjct: 475 tcaagcccaccttcactgaaaatttgggctccagccttgaaccaaacggcctcaccaaac 416

                                                                       
Query: 543 ttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggcc 602
           || || || || || || |  ||||| |||||||| || || || || || |||||||||
Sbjct: 415 ttaaccccgttacgggccaagagctcagggaagacacacccaagagctccaagcatggcc 356

                                                         
Query: 603 caccttgcagtggatcacctcaagcttcccggttctttgcaaaggt 648
           || | || |||||||||| |||||| || |||||||| ||||||||
Sbjct: 355 catc-tggagtggatcacttcaagc-tcacggttcttagcaaaggt 312



to top

>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete
             sequence
          Length = 139771

 Score =  161 bits (81), Expect = 4e-36
 Identities = 186/221 (84%)
 Strand = Plus / Plus

                                                                         
Query: 115   ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
             ||||||||||||| || ||||| |||||  | ||||| |||||||||  ||| || ||||
Sbjct: 78971 ctcacttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcgg 79030

                                                                         
Query: 175   cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
             |||  |||||    |||||||||| |||||||||||||||||| || ||||| |||||||
Sbjct: 79031 cgacgtggtcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaaga 79090

                                                                         
Query: 235   agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
             |||| ||||||||||||||||| ||||| || ||||||| ||| || ||||||||||| |
Sbjct: 79091 agccgaacatggagaacatggcgaggcggccgttcttgagctccttcaccttgagctcgg 79150

                                                      
Query: 295   cgaatgcctctgggtcatcggctaggccgagcgggtcgaag 335
             |||| |  || ||||| ||||| ||||||||||||||||||
Sbjct: 79151 cgaaggtgtcagggtcgtcggcgaggccgagcgggtcgaag 79191



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 94/116 (81%)
 Strand = Plus / Plus

                                                                         
Query: 429   gcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgagg 488
             |||||||| || |||||||| || || ||||| ||| | ||||| || ||||||||||| 
Sbjct: 79285 gcccagatggcgaggatgctctgcgcgtgcaccaggttggggttccccaggtagtcgagc 79344

                                                                     
Query: 489   ccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaactt 544
             || || |||  |||||| || | ||| ||||||||||| || ||||| ||||||||
Sbjct: 79345 cccccctcggagaagatctgcgcgccggccttgaaccacaccgcctccccgaactt 79400



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  161 bits (81), Expect = 4e-36
 Identities = 186/221 (84%)
 Strand = Plus / Minus

                                                                            
Query: 115      ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
                ||||||||||||| || ||||| |||||  | ||||| |||||||||  ||| || ||||
Sbjct: 21808845 ctcacttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcgg 21808786

                                                                            
Query: 175      cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
                |||  |||||    |||||||||| |||||||||||||||||| || ||||| |||||||
Sbjct: 21808785 cgacgtggtcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaaga 21808726

                                                                            
Query: 235      agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
                |||| ||||||||||||||||| ||||| || ||||||| ||| || ||||||||||| |
Sbjct: 21808725 agccgaacatggagaacatggcgaggcggccgttcttgagctccttcaccttgagctcgg 21808666

                                                         
Query: 295      cgaatgcctctgggtcatcggctaggccgagcgggtcgaag 335
                |||| |  || ||||| ||||| ||||||||||||||||||
Sbjct: 21808665 cgaaggtgtcagggtcgtcggcgaggccgagcgggtcgaag 21808625



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 94/116 (81%)
 Strand = Plus / Minus

                                                                            
Query: 429      gcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgagg 488
                |||||||| || |||||||| || || ||||| ||| | ||||| || ||||||||||| 
Sbjct: 21808531 gcccagatggcgaggatgctctgcgcgtgcaccaggttggggttccccaggtagtcgagc 21808472

                                                                        
Query: 489      ccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaactt 544
                || || |||  |||||| || | ||| ||||||||||| || ||||| ||||||||
Sbjct: 21808471 cccccctcggagaagatctgcgcgccggccttgaaccacaccgcctccccgaactt 21808416



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  161 bits (81), Expect = 4e-36
 Identities = 186/221 (84%)
 Strand = Plus / Minus

                                                                            
Query: 115      ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
                ||||||||||||| || ||||| |||||  | ||||| |||||||||  ||| || ||||
Sbjct: 21801874 ctcacttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcgg 21801815

                                                                            
Query: 175      cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
                |||  |||||    |||||||||| |||||||||||||||||| || ||||| |||||||
Sbjct: 21801814 cgacgtggtcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaaga 21801755

                                                                            
Query: 235      agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
                |||| ||||||||||||||||| ||||| || ||||||| ||| || ||||||||||| |
Sbjct: 21801754 agccgaacatggagaacatggcgaggcggccgttcttgagctccttcaccttgagctcgg 21801695

                                                         
Query: 295      cgaatgcctctgggtcatcggctaggccgagcgggtcgaag 335
                |||| |  || ||||| ||||| ||||||||||||||||||
Sbjct: 21801694 cgaaggtgtcagggtcgtcggcgaggccgagcgggtcgaag 21801654



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 94/116 (81%)
 Strand = Plus / Minus

                                                                            
Query: 429      gcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgagg 488
                |||||||| || |||||||| || || ||||| ||| | ||||| || ||||||||||| 
Sbjct: 21801560 gcccagatggcgaggatgctctgcgcgtgcaccaggttggggttccccaggtagtcgagc 21801501

                                                                        
Query: 489      ccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaactt 544
                || || |||  |||||| || | ||| ||||||||||| || ||||| ||||||||
Sbjct: 21801500 cccccctcggagaagatctgcgcgccggccttgaaccacaccgcctccccgaactt 21801445



to top

>dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I09, full
           insert sequence
          Length = 1106

 Score =  161 bits (81), Expect = 4e-36
 Identities = 186/221 (84%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||||||||| || ||||| |||||  | ||||| |||||||||  ||| || ||||
Sbjct: 844 ctcacttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcgg 785

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           |||  |||||    |||||||||| |||||||||||||||||| || ||||| |||||||
Sbjct: 784 cgacgtggtcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaaga 725

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           |||| ||||||||||||||||| ||||| || ||||||| ||| || ||||||||||| |
Sbjct: 724 agccgaacatggagaacatggcgaggcggccgttcttgagctccttcaccttgagctcgg 665

                                                    
Query: 295 cgaatgcctctgggtcatcggctaggccgagcgggtcgaag 335
           |||| |  || ||||| ||||| ||||||||||||||||||
Sbjct: 664 cgaaggtgtcagggtcgtcggcgaggccgagcgggtcgaag 624



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 94/116 (81%)
 Strand = Plus / Minus

                                                                       
Query: 429 gcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgagg 488
           |||||||| || |||||||| || || ||||| ||| | ||||| || ||||||||||| 
Sbjct: 530 gcccagatggcgaggatgctctgcgcgtgcaccaggttggggttccccaggtagtcgagc 471

                                                                   
Query: 489 ccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaactt 544
           || || |||  |||||| || | ||| ||||||||||| || ||||| ||||||||
Sbjct: 470 cccccctcggagaagatctgcgcgccggccttgaaccacaccgcctccccgaactt 415



to top

>dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-A06, full
           insert sequence
          Length = 685

 Score =  161 bits (81), Expect = 4e-36
 Identities = 186/221 (84%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||||||||| || ||||| |||||  | ||||| |||||||||  ||| || ||||
Sbjct: 419 ctcacttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcgg 360

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           |||  |||||    |||||||||| |||||||||||||||||| || ||||| |||||||
Sbjct: 359 cgacgtggtcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaaga 300

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           |||| ||||||||||||||||| ||||| || ||||||| ||| || ||||||||||| |
Sbjct: 299 agccgaacatggagaacatggcgaggcggccgttcttgagctccttcaccttgagctcgg 240

                                                    
Query: 295 cgaatgcctctgggtcatcggctaggccgagcgggtcgaag 335
           |||| |  || ||||| ||||| ||||||||||||||||||
Sbjct: 239 cgaaggtgtcagggtcgtcggcgaggccgagcgggtcgaag 199



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 77/96 (80%)
 Strand = Plus / Minus

                                                                       
Query: 429 gcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgagg 488
           |||||||| || |||||||| || || ||||| ||| | ||||| || ||||||||||| 
Sbjct: 105 gcccagatggcgaggatgctctgcgcgtgcaccaggttggggttccccaggtagtcgagc 46

                                               
Query: 489 ccaccgtcgctgaagatttgggagcctgccttgaac 524
           || || |||  |||||| || | ||| |||||||||
Sbjct: 45  cccccctcggagaagatctgcgcgccggccttgaac 10



to top

>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 1027

 Score =  161 bits (81), Expect = 4e-36
 Identities = 186/221 (84%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||||||||| || ||||| |||||  | ||||| |||||||||  ||| || ||||
Sbjct: 833 ctcacttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcgg 774

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           |||  |||||    |||||||||| |||||||||||||||||| || ||||| |||||||
Sbjct: 773 cgacgtggtcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaaga 714

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           |||| ||||||||||||||||| ||||| || ||||||| ||| || ||||||||||| |
Sbjct: 713 agccgaacatggagaacatggcgaggcggccgttcttgagctccttcaccttgagctcgg 654

                                                    
Query: 295 cgaatgcctctgggtcatcggctaggccgagcgggtcgaag 335
           |||| |  || ||||| ||||| ||||||||||||||||||
Sbjct: 653 cgaaggtgtcagggtcgtcggcgaggccgagcgggtcgaag 613



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 94/116 (81%)
 Strand = Plus / Minus

                                                                       
Query: 429 gcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgagg 488
           |||||||| || |||||||| || || ||||| ||| | ||||| || ||||||||||| 
Sbjct: 519 gcccagatggcgaggatgctctgcgcgtgcaccaggttggggttccccaggtagtcgagc 460

                                                                   
Query: 489 ccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaactt 544
           || || |||  |||||| || | ||| ||||||||||| || ||||| ||||||||
Sbjct: 459 cccccctcggagaagatctgcgcgccggccttgaaccacaccgcctccccgaactt 404



to top

>gb|DQ124219.1| Fagus sylvatica putative chlorophyll a/b-binding protein mRNA,
           partial cds
          Length = 780

 Score =  159 bits (80), Expect = 1e-35
 Identities = 412/520 (79%), Gaps = 2/520 (0%)
 Strand = Plus / Minus

                                                                       
Query: 129 acaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgagatggtcagca 188
           |||||||| |||||| | ||||| || |||||| |||| || || || || |||||||||
Sbjct: 773 acaaagtttgtggcataagcccaggcattgttggtgactgggtcagcaaggtggtcagca 714

                                                                       
Query: 189 aggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaacatggag 248
           |||||||| | ||| ||||| || || ||||| ||||| || ||||| |||||||| |||
Sbjct: 713 aggttctcaatgggtccctttccagtcacaatggcctggacaaagaaaccaaacatagag 654

                                                                       
Query: 249 aacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcctctggg 308
           ||||| || || |  |||||||||| ||| || ||||| ||||| || || |||||||||
Sbjct: 653 aacatagccagtcttccattcttgagctccttcaccttaagctcagcaaaagcctctggg 594

                                                                       
Query: 309 tcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaaccacctca 368
           ||||| || ||||| |  ||||| ||||| ||||| ||||| ||||| |||  |||||||
Sbjct: 593 tcatcagcaaggcctaatgggtcaaagcttccacctgggtaaagtgggtcagtcacctca 534

                                                                       
Query: 369 ccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgacttgacat 428
           || ||||| ||||||||||| ||||| || ||||| || ||||| |  |  || ||    
Sbjct: 533 ccaagtggcccaccagcaatacggtaaccctcaacagcacccatcaagagaacctgtgtg 474

                                                                       
Query: 429 gcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgagg 488
           |||||||| || |  |||||||||||||| |  | ||| ||||| || | |||||| || 
Sbjct: 473 gcccagatggccaaaatgctttgtgcatggatcaagcttgggttacccaagtagtcaagc 414

                                                                       
Query: 489 ccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaacttgact 548
           ||||| || ||||| |||||||  || ||||||||||| || |||||||| ||||| || 
Sbjct: 413 ccaccttcactgaaaatttgggctccagccttgaaccaaacggcctcaccaaacttaacc 354

                                                                       
Query: 549 ccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggcccacctt 608
           || || || || |  ||||| |||||||| || || || || || ||||||||||| | |
Sbjct: 353 ccgttacgggccaagagctcagggaagacacacccaagagctccaagcatggcccatc-t 295

                                                   
Query: 609 gcagtggatcacctcaagcttcccggttctttgcaaaggt 648
           | |||||||||| |||||| || |||||||| ||||||||
Sbjct: 294 ggagtggatcacttcaagc-tcacggttcttggcaaaggt 256



to top

>emb|X12980.1|GMCAB2 Soybean Cab2 gene for minor PSII LHCII chlorophyll a/b binding
           protein
          Length = 1354

 Score =  157 bits (79), Expect = 5e-35
 Identities = 334/419 (79%)
 Strand = Plus / Minus

                                                                       
Query: 138 gtggcaaacgcccatgcgttgttgttgacaggatcggcgagatggtcagcaaggttctcg 197
           |||||| | ||||| || |||||||| || ||||| || || ||||| || | |||||| 
Sbjct: 999 gtggcataggcccaggcattgttgtttactggatcagcaaggtggtcggccaagttctct 940

                                                                       
Query: 198 agggggcccttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggca 257
           | ||| ||||| || || ||||||||||| || ||||| ||||||||||| ||||| || 
Sbjct: 939 aagggtccctttccagtcacaatagcctgaacaaagaatccaaacatggaaaacatagcc 880

                                                                       
Query: 258 aggcgcccattcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggct 317
           |  |  |||||||||| |||||| ||||| | ||| || || |||||||||||||| || 
Sbjct: 879 aacctaccattcttgagctctttcacctttaactcggccaaagcctctgggtcatcagca 820

                                                                       
Query: 318 aggccgagcgggtcgaagctgccaccagggtagagtggatcaaccacctcaccgagtggg 377
           ||||| |  || || ||||||||||| ||||||| ||| |||  ||||||||| || || 
Sbjct: 819 aggcccaatggatcaaagctgccacctgggtagattgggtcagtcacctcaccaagaggc 760

                                                                       
Query: 378 ccaccagcaatgcggtacccttcaacggcgcccatgagcacgacttgacatgcccagata 437
           ||||| ||||| ||||| || |||||||| ||||| |  |  |||||    |||||||| 
Sbjct: 759 ccacctgcaatacggtaaccctcaacggcacccatcaagataacttgggtggcccagatg 700

                                                                       
Query: 438 gcaaggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcg 497
           ||||| |||||||||||||| |  ||||| |||||||| | |||||| || ||||| || 
Sbjct: 699 gcaagaatgctttgtgcatggatcaggcttgggttgcccaagtagtcaagcccaccctca 640

                                                                      
Query: 498 ctgaagatttgggagcctgccttgaaccatacagcctcaccgaacttgactccattgcg 556
           ||||| || || || || |||||||||||||| ||||| || |||||||| ||||||||
Sbjct: 639 ctgaatatctgagacccggccttgaaccatacggcctctccaaacttgacaccattgcg 581



to top

>gb|K00974.1|PETCAB4 Petunia major chlorophyll a/b binding protein (Cab) clone pCab4, 3'
           end
          Length = 387

 Score =  157 bits (79), Expect = 5e-35
 Identities = 310/387 (80%)
 Strand = Plus / Minus

                                                                       
Query: 125 gggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgagatggtc 184
           |||||||||||| |||||  | | ||| || |||||||| || || ||||| || |||||
Sbjct: 387 gggaacaaagtttgtggcgtaggaccaagcattgttgttaactgggtcggcaaggtggtc 328

                                                                       
Query: 185 agcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaacat 244
            ||||||||||| |  || ||||| || || ||||| ||||| || || || ||||||||
Sbjct: 327 ggcaaggttctccaatggaccctttccagtaacaatggcctgaacaaaaaatccaaacat 268

                                                                       
Query: 245 ggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcctc 304
           ||| ||||| ||||| |  |||||||||| ||| || ||||||||||| || ||||||||
Sbjct: 267 ggaaaacatagcaagtctaccattcttgatctccttcaccttgagctcagcaaatgcctc 208

                                                                       
Query: 305 tgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaaccac 364
           ||||||||| || || || |  || |||||||| ||||||||||||||||| ||||  ||
Sbjct: 207 tgggtcatcagcaagacccaatggatcgaagctaccaccagggtagagtgggtcaataac 148

                                                                       
Query: 365 ctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgacttg 424
           |||||| || || ||||||||||  ||||| || |||||||| ||||| | ||| |||||
Sbjct: 147 ctcaccaagaggcccaccagcaacacggtaaccctcaacggctcccatcaacacaacttg 88

                                                                       
Query: 425 acatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtagtc 484
            || |||||  | || | |||||||||||| || || |  || |||||||| | ||||||
Sbjct: 87  gcaagcccaactggccaagatgctttgtgcgtgaaccaaacttgggttgcccaagtagtc 28

                                      
Query: 485 gaggccaccgtcgctgaagatttggga 511
            ||  |||| ||||| |||||||||||
Sbjct: 27  aagttcaccctcgctaaagatttggga 1



to top

>gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete sequence
          Length = 124732

 Score =  155 bits (78), Expect = 2e-34
 Identities = 353/442 (79%), Gaps = 2/442 (0%)
 Strand = Plus / Plus

                                                                        
Query: 116  tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
            |||||| ||||| |||||||| ||||| || ||||| ||||||||||| || || || ||
Sbjct: 8571 tcactttccggggacaaagtttgtggcgaaggcccaagcgttgttgttaactgggtcagc 8630

                                                                        
Query: 176  gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            ||  |||||||||||||| |  |  || ||||| ||||| || || || || || |||||
Sbjct: 8631 gatgtggtcagcaaggttttttaaaggtccctttccggtcacgatggcttgaacaaagaa 8690

                                                                        
Query: 236  gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
             |||||||| |||||||| || |  |  ||||||||||  ||||| ||||| | ||| ||
Sbjct: 8691 tccaaacatagagaacatcgctaacctaccattcttgagttctttaacctttaactctgc 8750

                                                                        
Query: 296  gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtgg 355
             || ||||| ||||| || || ||||| |  ||||| ||||| ||||| || ||||||||
Sbjct: 8751 aaaagcctcggggtcctcagcaaggcccaatgggtcaaagcttccacctggatagagtgg 8810

                                                                        
Query: 356  atcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgag 415
             || || |||||||| || || ||||| ||||| ||||| |||||||| || ||||| | 
Sbjct: 8811 gtcgactacctcaccaagaggtccaccggcaatacggtaaccttcaacagctcccattaa 8870

                                                                        
Query: 416  cacgacttg-acatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
             |  ||||| ||| ||||| ||||||||||||||||||||||| || ||||| ||||| |
Sbjct: 8871 gataacttggaca-gcccaaatagcaaggatgctttgtgcatggactaggcttgggttac 8929

                                                                        
Query: 475  cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
            | | |||||| || ||||| || || |||||||| || |||||||| ||||| |||||||
Sbjct: 8930 ccaagtagtcaagtccaccctcactaaagatttgagatcctgccttaaaccacacagcct 8989

                                  
Query: 535  caccgaacttgactccattgcg 556
            ||||||| || || ||||||||
Sbjct: 8990 caccgaatttcacaccattgcg 9011



 Score =  155 bits (78), Expect = 2e-34
 Identities = 243/298 (81%)
 Strand = Plus / Minus

                                                                        
Query: 115  ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
            ||||||| |||||||||||||| |||||||| ||||| |||||| ||||||| ||||| |
Sbjct: 2074 ctcactttccgggaacaaagtttgtggcaaaggcccaagcgttgctgttgactggatcag 2015

                                                                        
Query: 175  cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
            |||  ||||||||||||||||| || || |||||  |||| ||||| ||||| ||||| |
Sbjct: 2014 cgatgtggtcagcaaggttctctagtggtcccttttcggttacaatggcctgaacgaaaa 1955

                                                                        
Query: 235  agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
            | |||||||| |||||||| || |  |  ||||||||||  ||||| ||||| | ||| |
Sbjct: 1954 atccaaacatcgagaacatagctaacctgccattcttgagttctttaacctttaactctg 1895

                                                                        
Query: 295  cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
            | || ||||||||||| || || ||||| |  ||||| ||||| ||||| ||||||||||
Sbjct: 1894 caaaagcctctgggtcgtctgcgaggcccaatgggtcaaagcttccaccggggtagagtg 1835

                                                                      
Query: 355  gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccat 412
            |||| || |||||||| || || ||| | ||||| ||||| || ||||| || |||||
Sbjct: 1834 gatcgactacctcaccaagaggtccatcggcaatacggtaaccctcaacagctcccat 1777



 Score =  119 bits (60), Expect = 1e-23
 Identities = 162/196 (82%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| ||||| |||||||| |||||||| ||||| |||||||||||||| || || |
Sbjct: 218 ctcactttccggggacaaagtttgtggcaaaggcccaagcgttgttgttgacggggtcag 159

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
            || |||||| ||||||||||| || || ||||| ||||| ||||| ||||| |||||||
Sbjct: 158 tgatatggtcggcaaggttctctagaggtccctttccggttacaatggcctgaacgaaga 99

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | |||||||| |||||||| || || |  |||||||| |  ||||| ||||| | ||| |
Sbjct: 98  atccaaacatagagaacatagctagcctaccattcttaagttctttcacctttaactctg 39

                           
Query: 295 cgaatgcctctgggtc 310
           | || |||||||||||
Sbjct: 38  caaaagcctctgggtc 23



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 430  cccagatagcaaggatgctttgtgcatgcacgaggctagggtt 472
            |||| |||||||||||||||||||| || || ||||| |||||
Sbjct: 1759 cccaaatagcaaggatgctttgtgcgtggactaggcttgggtt 1717



to top

>emb|AJ538493.1|NTA538493 Nicotiana tabacum cDNA-AFLP-fragment BC2-M31-012
          Length = 321

 Score =  155 bits (78), Expect = 2e-34
 Identities = 210/254 (82%)
 Strand = Plus / Minus

                                                                       
Query: 204 cccttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgc 263
           ||||| |||||| | ||||| || |||||||| |||||||| |||||||||||||| |  
Sbjct: 290 ccctttccggtggcgatagcatgaacgaagaatccaaacatagagaacatggcaagtctg 231

                                                                       
Query: 264 ccattcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggctaggccg 323
           || |||||||  || |||||||||||||| || || || |||||||| || || || || 
Sbjct: 230 ccgttcttgatttcctttaccttgagctcagcaaaagcttctgggtcttcagcaagaccc 171

                                                                       
Query: 324 agcgggtcgaagctgccaccagggtagagtggatcaaccacctcaccgagtgggccacca 383
           |  ||||||||||| ||||||||||||||||| ||||| ||||||||||| || ||||||
Sbjct: 170 aatgggtcgaagctaccaccagggtagagtgggtcaacaacctcaccgagaggtccacca 111

                                                                       
Query: 384 gcaatgcggtacccttcaacggcgcccatgagcacgacttgacatgcccagatagcaagg 443
           ||||  ||||| || |||||||| ||||| | ||| |||||||| ||||| || || |  
Sbjct: 110 gcaacacggtaaccctcaacggctcccatcaacacaacttgacaagcccaaatggccaat 51

                         
Query: 444 atgctttgtgcatg 457
           ||||||||||||||
Sbjct: 50  atgctttgtgcatg 37



to top

>emb|AJ538840.1|NTA538840 Nicotiana tabacum cDNA-AFLP-fragment BT2-M11-016
          Length = 315

 Score =  149 bits (75), Expect = 1e-32
 Identities = 225/275 (81%)
 Strand = Plus / Minus

                                                                       
Query: 180 tggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagcca 239
           ||||| ||||||||||| |  || ||||| || ||||| |||||||| || ||||| |||
Sbjct: 298 tggtcggcaaggttctccaatggaccctttccagtgacgatagcctgaacaaagaatcca 239

                                                                       
Query: 240 aacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaat 299
           |||||||||||||| ||||| |  |||||||||| ||| |||||||||||||| || || 
Sbjct: 238 aacatggagaacatagcaagtctaccattcttgatctcctttaccttgagctcagcaaaa 179

                                                                       
Query: 300 gcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatca 359
           ||||||||||| || || || || |  |||||||| |||||||||||||| ||||| |||
Sbjct: 178 gcctctgggtcttcagcaagtcccaatgggtcgaaactgccaccagggtaaagtgggtca 119

                                                                       
Query: 360 accacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacg 419
           || || || ||||| || ||||||||||  ||||| || |||||||| ||||| | ||| 
Sbjct: 118 acaacttcgccgagaggtccaccagcaacacggtaaccctcaacggctcccatcaacaca 59

                                              
Query: 420 acttgacatgcccagatagcaaggatgctttgtgc 454
           ||||| || ||||| || || |  |||||||||||
Sbjct: 58  acttggcaagcccaaatggccaaaatgctttgtgc 24



to top

>dbj|AB050123.1| Amaranthus tricolor cab1a mRNA for type I chlorophyll a/b-binding
           protein a, partial cds
          Length = 461

 Score =  147 bits (74), Expect = 5e-32
 Identities = 278/346 (80%)
 Strand = Plus / Minus

                                                                       
Query: 231 aagaagccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagc 290
           |||||||| |||||||||||||| || ||||| ||||||||||  ||||||||||| | |
Sbjct: 458 aagaagccgaacatggagaacatagcgaggcgaccattcttgatttcttttaccttcaac 399

                                                                       
Query: 291 tccgcgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtag 350
           || || ||||| ||||| ||||| |||| ||| ||||| ||||| ||||| || || || 
Sbjct: 398 tcagcaaatgcatctggatcatcagctaagccaagcggatcgaaactgcctcctggatac 339

                                                                       
Query: 351 agtggatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgccc 410
           || |||||||| ||||| || || || ||||| ||||| | ||| ||||| || || |||
Sbjct: 338 agaggatcaacaacctcgcctagaggcccacccgcaatcctgtaaccttcgacagcaccc 279

                                                                       
Query: 411 atgagcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctaggg 470
           ||||| |  || || || ||||||||||| | ||| ||||| || || |  | | | |||
Sbjct: 278 atgaggatcacctggcaagcccagatagccaagatactttgagcgtggatcaaggtcggg 219

                                                                       
Query: 471 ttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccataca 530
           || || | ||||||||| ||||| ||||||||||||||||| || ||||||||||| || 
Sbjct: 218 ttccccaagtagtcgagaccaccctcgctgaagatttgggaaccagccttgaaccaaact 159

                                                         
Query: 531 gcctcaccgaacttgactccattgcgcgcaagaagctcggggaaga 576
           || || |||||||| || ||||| |  ||||||||||| |||||||
Sbjct: 158 gcttctccgaacttaaccccattcctagcaagaagctccgggaaga 113



to top

>ref|XM_478729.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 972

 Score =  145 bits (73), Expect = 2e-31
 Identities = 162/189 (85%), Gaps = 2/189 (1%)
 Strand = Plus / Minus

                                                                       
Query: 148 cccatgcgttgttgttgacaggatcggcgagatggtc-agcaaggttctcgagggggccc 206
           |||| |||||||||  ||| || |||||||| ||||| |||| ||||||| | |||||||
Sbjct: 803 cccaggcgttgttggcgacggggtcggcgaggtggtcgagca-ggttctccaaggggccc 745

                                                                       
Query: 207 ttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgccca 266
           ||||||||||| || ||||| ||||||||||| ||||||||||||||||| ||||| |||
Sbjct: 744 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 685

                                                                       
Query: 267 ttcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggctaggccgagc 326
           ||||||| ||| || ||||||||||| ||||| |   | ||||| ||||| |||||||||
Sbjct: 684 ttcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcggcgaggccgagc 625

                    
Query: 327 gggtcgaag 335
           |||||||||
Sbjct: 624 gggtcgaag 616



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 441 aggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctg 500
           |||||||| || || ||||| ||| | ||||||||||||||||||||||| ||||||  |
Sbjct: 507 aggatgctctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggag 448

                                     
Query: 501 aagatttgggagcctgccttgaacca 526
           ||||| |||| ||| |||||||||||
Sbjct: 447 aagatctgggcgccggccttgaacca 422



to top

>ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 995

 Score =  145 bits (73), Expect = 2e-31
 Identities = 162/189 (85%), Gaps = 2/189 (1%)
 Strand = Plus / Minus

                                                                       
Query: 148 cccatgcgttgttgttgacaggatcggcgagatggtc-agcaaggttctcgagggggccc 206
           |||| |||||||||  ||| || |||||||| ||||| |||| ||||||| | |||||||
Sbjct: 827 cccaggcgttgttggcgacggggtcggcgaggtggtcgagca-ggttctccaaggggccc 769

                                                                       
Query: 207 ttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgccca 266
           ||||||||||| || ||||| ||||||||||| ||||||||||||||||| ||||| |||
Sbjct: 768 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 709

                                                                       
Query: 267 ttcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggctaggccgagc 326
           ||||||| ||| || ||||||||||| ||||| |   | ||||| ||||| |||||||||
Sbjct: 708 ttcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcggcgaggccgagc 649

                    
Query: 327 gggtcgaag 335
           |||||||||
Sbjct: 648 gggtcgaag 640



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 441 aggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctg 500
           |||||||| || || ||||| ||| | ||||||||||||||||||||||| ||||||  |
Sbjct: 531 aggatgctctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggag 472

                                     
Query: 501 aagatttgggagcctgccttgaacca 526
           ||||| |||| ||| |||||||||||
Sbjct: 471 aagatctgggcgccggccttgaacca 446



to top

>ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1007

 Score =  145 bits (73), Expect = 2e-31
 Identities = 162/189 (85%), Gaps = 2/189 (1%)
 Strand = Plus / Minus

                                                                       
Query: 148 cccatgcgttgttgttgacaggatcggcgagatggtc-agcaaggttctcgagggggccc 206
           |||| |||||||||  ||| || |||||||| ||||| |||| ||||||| | |||||||
Sbjct: 827 cccaggcgttgttggcgacggggtcggcgaggtggtcgagca-ggttctccaaggggccc 769

                                                                       
Query: 207 ttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgccca 266
           ||||||||||| || ||||| ||||||||||| ||||||||||||||||| ||||| |||
Sbjct: 768 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 709

                                                                       
Query: 267 ttcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggctaggccgagc 326
           ||||||| ||| || ||||||||||| ||||| |   | ||||| ||||| |||||||||
Sbjct: 708 ttcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcggcgaggccgagc 649

                    
Query: 327 gggtcgaag 335
           |||||||||
Sbjct: 648 gggtcgaag 640



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 441 aggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctg 500
           |||||||| || || ||||| ||| | ||||||||||||||||||||||| ||||||  |
Sbjct: 531 aggatgctctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggag 472

                                     
Query: 501 aagatttgggagcctgccttgaacca 526
           ||||| |||| ||| |||||||||||
Sbjct: 471 aagatctgggcgccggccttgaacca 446



to top

>ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1108

 Score =  145 bits (73), Expect = 2e-31
 Identities = 162/189 (85%), Gaps = 2/189 (1%)
 Strand = Plus / Minus

                                                                       
Query: 148 cccatgcgttgttgttgacaggatcggcgagatggtc-agcaaggttctcgagggggccc 206
           |||| |||||||||  ||| || |||||||| ||||| |||| ||||||| | |||||||
Sbjct: 829 cccaggcgttgttggcgacggggtcggcgaggtggtcgagca-ggttctccaaggggccc 771

                                                                       
Query: 207 ttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgccca 266
           ||||||||||| || ||||| ||||||||||| ||||||||||||||||| ||||| |||
Sbjct: 770 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 711

                                                                       
Query: 267 ttcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggctaggccgagc 326
           ||||||| ||| || ||||||||||| ||||| |   | ||||| ||||| |||||||||
Sbjct: 710 ttcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcggcgaggccgagc 651

                    
Query: 327 gggtcgaag 335
           |||||||||
Sbjct: 650 gggtcgaag 642



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 441 aggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctg 500
           |||||||| || || ||||| ||| | ||||||||||||||||||||||| ||||||  |
Sbjct: 533 aggatgctctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggag 474

                                     
Query: 501 aagatttgggagcctgccttgaacca 526
           ||||| |||| ||| |||||||||||
Sbjct: 473 aagatctgggcgccggccttgaacca 448



to top

>ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1000

 Score =  145 bits (73), Expect = 2e-31
 Identities = 162/189 (85%), Gaps = 2/189 (1%)
 Strand = Plus / Minus

                                                                       
Query: 148 cccatgcgttgttgttgacaggatcggcgagatggtc-agcaaggttctcgagggggccc 206
           |||| |||||||||  ||| || |||||||| ||||| |||| ||||||| | |||||||
Sbjct: 832 cccaggcgttgttggcgacggggtcggcgaggtggtcgagca-ggttctccaaggggccc 774

                                                                       
Query: 207 ttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgccca 266
           ||||||||||| || ||||| ||||||||||| ||||||||||||||||| ||||| |||
Sbjct: 773 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 714

                                                                       
Query: 267 ttcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggctaggccgagc 326
           ||||||| ||| || ||||||||||| ||||| |   | ||||| ||||| |||||||||
Sbjct: 713 ttcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcggcgaggccgagc 654

                    
Query: 327 gggtcgaag 335
           |||||||||
Sbjct: 653 gggtcgaag 645



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 441 aggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctg 500
           |||||||| || || ||||| ||| | ||||||||||||||||||||||| ||||||  |
Sbjct: 536 aggatgctctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggag 477

                                     
Query: 501 aagatttgggagcctgccttgaacca 526
           ||||| |||| ||| |||||||||||
Sbjct: 476 aagatctgggcgccggccttgaacca 451



to top

>ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1012

 Score =  145 bits (73), Expect = 2e-31
 Identities = 162/189 (85%), Gaps = 2/189 (1%)
 Strand = Plus / Minus

                                                                       
Query: 148 cccatgcgttgttgttgacaggatcggcgagatggtc-agcaaggttctcgagggggccc 206
           |||| |||||||||  ||| || |||||||| ||||| |||| ||||||| | |||||||
Sbjct: 832 cccaggcgttgttggcgacggggtcggcgaggtggtcgagca-ggttctccaaggggccc 774

                                                                       
Query: 207 ttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgccca 266
           ||||||||||| || ||||| ||||||||||| ||||||||||||||||| ||||| |||
Sbjct: 773 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 714

                                                                       
Query: 267 ttcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggctaggccgagc 326
           ||||||| ||| || ||||||||||| ||||| |   | ||||| ||||| |||||||||
Sbjct: 713 ttcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcggcgaggccgagc 654

                    
Query: 327 gggtcgaag 335
           |||||||||
Sbjct: 653 gggtcgaag 645



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 441 aggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctg 500
           |||||||| || || ||||| ||| | ||||||||||||||||||||||| ||||||  |
Sbjct: 536 aggatgctctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggag 477

                                     
Query: 501 aagatttgggagcctgccttgaacca 526
           ||||| |||| ||| |||||||||||
Sbjct: 476 aagatctgggcgccggccttgaacca 451



to top

>ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1032

 Score =  145 bits (73), Expect = 2e-31
 Identities = 162/189 (85%), Gaps = 2/189 (1%)
 Strand = Plus / Minus

                                                                       
Query: 148 cccatgcgttgttgttgacaggatcggcgagatggtc-agcaaggttctcgagggggccc 206
           |||| |||||||||  ||| || |||||||| ||||| |||| ||||||| | |||||||
Sbjct: 834 cccaggcgttgttggcgacggggtcggcgaggtggtcgagca-ggttctccaaggggccc 776

                                                                       
Query: 207 ttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgccca 266
           ||||||||||| || ||||| ||||||||||| ||||||||||||||||| ||||| |||
Sbjct: 775 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 716

                                                                       
Query: 267 ttcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggctaggccgagc 326
           ||||||| ||| || ||||||||||| ||||| |   | ||||| ||||| |||||||||
Sbjct: 715 ttcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcggcgaggccgagc 656

                    
Query: 327 gggtcgaag 335
           |||||||||
Sbjct: 655 gggtcgaag 647



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 441 aggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctg 500
           |||||||| || || ||||| ||| | ||||||||||||||||||||||| ||||||  |
Sbjct: 538 aggatgctctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggag 479

                                     
Query: 501 aagatttgggagcctgccttgaacca 526
           ||||| |||| ||| |||||||||||
Sbjct: 478 aagatctgggcgccggccttgaacca 453



to top

>ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1159

 Score =  145 bits (73), Expect = 2e-31
 Identities = 162/189 (85%), Gaps = 2/189 (1%)
 Strand = Plus / Minus

                                                                       
Query: 148 cccatgcgttgttgttgacaggatcggcgagatggtc-agcaaggttctcgagggggccc 206
           |||| |||||||||  ||| || |||||||| ||||| |||| ||||||| | |||||||
Sbjct: 867 cccaggcgttgttggcgacggggtcggcgaggtggtcgagca-ggttctccaaggggccc 809

                                                                       
Query: 207 ttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgccca 266
           ||||||||||| || ||||| ||||||||||| ||||||||||||||||| ||||| |||
Sbjct: 808 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 749

                                                                       
Query: 267 ttcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggctaggccgagc 326
           ||||||| ||| || ||||||||||| ||||| |   | ||||| ||||| |||||||||
Sbjct: 748 ttcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcggcgaggccgagc 689

                    
Query: 327 gggtcgaag 335
           |||||||||
Sbjct: 688 gggtcgaag 680



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 441 aggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctg 500
           |||||||| || || ||||| ||| | ||||||||||||||||||||||| ||||||  |
Sbjct: 571 aggatgctctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggag 512

                                     
Query: 501 aagatttgggagcctgccttgaacca 526
           ||||| |||| ||| |||||||||||
Sbjct: 511 aagatctgggcgccggccttgaacca 486



to top

>gb|AY389553.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           (CAB) mRNA, partial cds
          Length = 720

 Score =  145 bits (73), Expect = 2e-31
 Identities = 255/313 (81%), Gaps = 2/313 (0%)
 Strand = Plus / Minus

                                                                       
Query: 327 gggtcgaagctgccaccagggtagagtggatcaaccacctcaccgagtgggccaccagca 386
           |||||||||||||| || ||||| ||||| || || ||||| ||||| || || || |||
Sbjct: 628 gggtcgaagctgccgccggggtacagtgggtcgacgacctcgccgagcggcccgccggca 569

                                                                       
Query: 387 atgcggtacccttcaacggcgcccatgagcacgacttgacatgcccagatagcaaggatg 446
           |  | ||| || || ||||| |||||||| | ||| |||   ||||| || || || |||
Sbjct: 568 actctgtatccctcgacggcccccatgagaaggacctgagtcgcccatatggccagaatg 509

                                                                       
Query: 447 ctttgtgcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctgaagatt 506
           || ||||| || || |||||||||||||| |||||||| |  || || ||||||||||| 
Sbjct: 508 ctctgtgcgtggaccaggctagggttgcccaggtagtccaatccgccctcgctgaagatc 449

                                                                       
Query: 507 tgggagcctgccttgaaccatacagcctcaccgaacttgactccattgcgcgcaagaagc 566
           |||| ||| ||||||||||| || ||||| |||||||| || || ||||| || || |||
Sbjct: 448 tgggcgccggccttgaaccagaccgcctcgccgaacttcacgccgttgcgggcgaggagc 389

                                                                       
Query: 567 tcggggaagacgcatccgagcgcaccgagcatggcccaccttgcagtggatcacctcaag 626
           |||||||||||||| ||||| || || ||||| ||||||| |||||||||||||||| ||
Sbjct: 388 tcggggaagacgcagccgagagcgcccagcattgcccacc-tgcagtggatcacctcgag 330

                        
Query: 627 cttcccggttctt 639
           | |||||||||||
Sbjct: 329 c-tcccggttctt 318



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  145 bits (73), Expect = 2e-31
 Identities = 162/189 (85%), Gaps = 2/189 (1%)
 Strand = Plus / Minus

                                                                            
Query: 148      cccatgcgttgttgttgacaggatcggcgagatggtc-agcaaggttctcgagggggccc 206
                |||| |||||||||  ||| || |||||||| ||||| |||| ||||||| | |||||||
Sbjct: 22434840 cccaggcgttgttggcgacggggtcggcgaggtggtcgagca-ggttctccaaggggccc 22434782

                                                                            
Query: 207      ttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgccca 266
                ||||||||||| || ||||| ||||||||||| ||||||||||||||||| ||||| |||
Sbjct: 22434781 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 22434722

                                                                            
Query: 267      ttcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggctaggccgagc 326
                ||||||| ||| || ||||||||||| ||||| |   | ||||| ||||| |||||||||
Sbjct: 22434721 ttcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcggcgaggccgagc 22434662

                         
Query: 327      gggtcgaag 335
                |||||||||
Sbjct: 22434661 gggtcgaag 22434653



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                            
Query: 441      aggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctg 500
                |||||||| || || ||||| ||| | ||||||||||||||||||||||| ||||||  |
Sbjct: 22434544 aggatgctctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggag 22434485

                                          
Query: 501      aagatttgggagcctgccttgaacca 526
                ||||| |||| ||| |||||||||||
Sbjct: 22434484 aagatctgggcgccggccttgaacca 22434459



to top

>dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0406F06
          Length = 144533

 Score =  145 bits (73), Expect = 2e-31
 Identities = 162/189 (85%), Gaps = 2/189 (1%)
 Strand = Plus / Minus

                                                                         
Query: 148   cccatgcgttgttgttgacaggatcggcgagatggtc-agcaaggttctcgagggggccc 206
             |||| |||||||||  ||| || |||||||| ||||| |||| ||||||| | |||||||
Sbjct: 95907 cccaggcgttgttggcgacggggtcggcgaggtggtcgagca-ggttctccaaggggccc 95849

                                                                         
Query: 207   ttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgccca 266
             ||||||||||| || ||||| ||||||||||| ||||||||||||||||| ||||| |||
Sbjct: 95848 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 95789

                                                                         
Query: 267   ttcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggctaggccgagc 326
             ||||||| ||| || ||||||||||| ||||| |   | ||||| ||||| |||||||||
Sbjct: 95788 ttcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcggcgaggccgagc 95729

                      
Query: 327   gggtcgaag 335
             |||||||||
Sbjct: 95728 gggtcgaag 95720



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                         
Query: 441   aggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctg 500
             |||||||| || || ||||| ||| | ||||||||||||||||||||||| ||||||  |
Sbjct: 95611 aggatgctctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggag 95552

                                       
Query: 501   aagatttgggagcctgccttgaacca 526
             ||||| |||| ||| |||||||||||
Sbjct: 95551 aagatctgggcgccggccttgaacca 95526



to top

>dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-G05, full
           insert sequence
          Length = 1012

 Score =  145 bits (73), Expect = 2e-31
 Identities = 162/189 (85%), Gaps = 2/189 (1%)
 Strand = Plus / Minus

                                                                       
Query: 148 cccatgcgttgttgttgacaggatcggcgagatggtc-agcaaggttctcgagggggccc 206
           |||| |||||||||  ||| || |||||||| ||||| |||| ||||||| | |||||||
Sbjct: 832 cccaggcgttgttggcgacggggtcggcgaggtggtcgagca-ggttctccaaggggccc 774

                                                                       
Query: 207 ttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgccca 266
           ||||||||||| || ||||| ||||||||||| ||||||||||||||||| ||||| |||
Sbjct: 773 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 714

                                                                       
Query: 267 ttcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggctaggccgagc 326
           ||||||| ||| || ||||||||||| ||||| |   | ||||| ||||| |||||||||
Sbjct: 713 ttcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcggcgaggccgagc 654

                    
Query: 327 gggtcgaag 335
           |||||||||
Sbjct: 653 gggtcgaag 645



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 441 aggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctg 500
           |||||||| || || ||||| ||| | ||||||||||||||||||||||| ||||||  |
Sbjct: 536 aggatgctctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggag 477

                                     
Query: 501 aagatttgggagcctgccttgaacca 526
           ||||| |||| ||| |||||||||||
Sbjct: 476 aagatctgggcgccggccttgaacca 451



to top

>dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-F03, full
           insert sequence
          Length = 1000

 Score =  145 bits (73), Expect = 2e-31
 Identities = 162/189 (85%), Gaps = 2/189 (1%)
 Strand = Plus / Minus

                                                                       
Query: 148 cccatgcgttgttgttgacaggatcggcgagatggtc-agcaaggttctcgagggggccc 206
           |||| |||||||||  ||| || |||||||| ||||| |||| ||||||| | |||||||
Sbjct: 832 cccaggcgttgttggcgacggggtcggcgaggtggtcgagca-ggttctccaaggggccc 774

                                                                       
Query: 207 ttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgccca 266
           ||||||||||| || ||||| ||||||||||| ||||||||||||||||| ||||| |||
Sbjct: 773 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 714

                                                                       
Query: 267 ttcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggctaggccgagc 326
           ||||||| ||| || ||||||||||| ||||| |   | ||||| ||||| |||||||||
Sbjct: 713 ttcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcggcgaggccgagc 654

                    
Query: 327 gggtcgaag 335
           |||||||||
Sbjct: 653 gggtcgaag 645



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 441 aggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctg 500
           |||||||| || || ||||| ||| | ||||||||||||||||||||||| ||||||  |
Sbjct: 536 aggatgctctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggag 477

                                     
Query: 501 aagatttgggagcctgccttgaacca 526
           ||||| |||| ||| |||||||||||
Sbjct: 476 aagatctgggcgccggccttgaacca 451



to top

>dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-C03, full
           insert sequence
          Length = 973

 Score =  145 bits (73), Expect = 2e-31
 Identities = 162/189 (85%), Gaps = 2/189 (1%)
 Strand = Plus / Minus

                                                                       
Query: 148 cccatgcgttgttgttgacaggatcggcgagatggtc-agcaaggttctcgagggggccc 206
           |||| |||||||||  ||| || |||||||| ||||| |||| ||||||| | |||||||
Sbjct: 803 cccaggcgttgttggcgacggggtcggcgaggtggtcgagca-ggttctccaaggggccc 745

                                                                       
Query: 207 ttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgccca 266
           ||||||||||| || ||||| ||||||||||| ||||||||||||||||| ||||| |||
Sbjct: 744 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 685

                                                                       
Query: 267 ttcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggctaggccgagc 326
           ||||||| ||| || ||||||||||| ||||| |   | ||||| ||||| |||||||||
Sbjct: 684 ttcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcggcgaggccgagc 625

                    
Query: 327 gggtcgaag 335
           |||||||||
Sbjct: 624 gggtcgaag 616



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 441 aggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctg 500
           |||||||| || || ||||| ||| | ||||||||||||||||||||||| ||||||  |
Sbjct: 507 aggatgctctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggag 448

                                     
Query: 501 aagatttgggagcctgccttgaacca 526
           ||||| |||| ||| |||||||||||
Sbjct: 447 aagatctgggcgccggccttgaacca 422



to top

>dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C07, full
           insert sequence
          Length = 1012

 Score =  145 bits (73), Expect = 2e-31
 Identities = 162/189 (85%), Gaps = 2/189 (1%)
 Strand = Plus / Minus

                                                                       
Query: 148 cccatgcgttgttgttgacaggatcggcgagatggtc-agcaaggttctcgagggggccc 206
           |||| |||||||||  ||| || |||||||| ||||| |||| ||||||| | |||||||
Sbjct: 832 cccaggcgttgttggcgacggggtcggcgaggtggtcgagca-ggttctccaaggggccc 774

                                                                       
Query: 207 ttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgccca 266
           ||||||||||| || ||||| ||||||||||| ||||||||||||||||| ||||| |||
Sbjct: 773 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 714

                                                                       
Query: 267 ttcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggctaggccgagc 326
           ||||||| ||| || ||||||||||| ||||| |   | ||||| ||||| |||||||||
Sbjct: 713 ttcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcggcgaggccgagc 654

                    
Query: 327 gggtcgaag 335
           |||||||||
Sbjct: 653 gggtcgaag 645



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 441 aggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctg 500
           |||||||| || || ||||| ||| | ||||||||||||||||||||||| ||||||  |
Sbjct: 536 aggatgctctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggag 477

                                     
Query: 501 aagatttgggagcctgccttgaacca 526
           ||||| |||| ||| |||||||||||
Sbjct: 476 aagatctgggcgccggccttgaacca 451



to top

>dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-E11, full
           insert sequence
          Length = 995

 Score =  145 bits (73), Expect = 2e-31
 Identities = 162/189 (85%), Gaps = 2/189 (1%)
 Strand = Plus / Minus

                                                                       
Query: 148 cccatgcgttgttgttgacaggatcggcgagatggtc-agcaaggttctcgagggggccc 206
           |||| |||||||||  ||| || |||||||| ||||| |||| ||||||| | |||||||
Sbjct: 827 cccaggcgttgttggcgacggggtcggcgaggtggtcgagca-ggttctccaaggggccc 769

                                                                       
Query: 207 ttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgccca 266
           ||||||||||| || ||||| ||||||||||| ||||||||||||||||| ||||| |||
Sbjct: 768 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 709

                                                                       
Query: 267 ttcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggctaggccgagc 326
           ||||||| ||| || ||||||||||| ||||| |   | ||||| ||||| |||||||||
Sbjct: 708 ttcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcggcgaggccgagc 649

                    
Query: 327 gggtcgaag 335
           |||||||||
Sbjct: 648 gggtcgaag 640



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 441 aggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctg 500
           |||||||| || || ||||| ||| | ||||||||||||||||||||||| ||||||  |
Sbjct: 531 aggatgctctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggag 472

                                     
Query: 501 aagatttgggagcctgccttgaacca 526
           ||||| |||| ||| |||||||||||
Sbjct: 471 aagatctgggcgccggccttgaacca 446



to top

>dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-D10, full
           insert sequence
          Length = 1007

 Score =  145 bits (73), Expect = 2e-31
 Identities = 162/189 (85%), Gaps = 2/189 (1%)
 Strand = Plus / Minus

                                                                       
Query: 148 cccatgcgttgttgttgacaggatcggcgagatggtc-agcaaggttctcgagggggccc 206
           |||| |||||||||  ||| || |||||||| ||||| |||| ||||||| | |||||||
Sbjct: 827 cccaggcgttgttggcgacggggtcggcgaggtggtcgagca-ggttctccaaggggccc 769

                                                                       
Query: 207 ttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgccca 266
           ||||||||||| || ||||| ||||||||||| ||||||||||||||||| ||||| |||
Sbjct: 768 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 709

                                                                       
Query: 267 ttcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggctaggccgagc 326
           ||||||| ||| || ||||||||||| ||||| |   | ||||| ||||| |||||||||
Sbjct: 708 ttcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcggcgaggccgagc 649

                    
Query: 327 gggtcgaag 335
           |||||||||
Sbjct: 648 gggtcgaag 640



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 441 aggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctg 500
           |||||||| || || ||||| ||| | ||||||||||||||||||||||| ||||||  |
Sbjct: 531 aggatgctctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggag 472

                                     
Query: 501 aagatttgggagcctgccttgaacca 526
           ||||| |||| ||| |||||||||||
Sbjct: 471 aagatctgggcgccggccttgaacca 446



to top

>dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D02, full
           insert sequence
          Length = 1000

 Score =  145 bits (73), Expect = 2e-31
 Identities = 162/189 (85%), Gaps = 2/189 (1%)
 Strand = Plus / Minus

                                                                       
Query: 148 cccatgcgttgttgttgacaggatcggcgagatggtc-agcaaggttctcgagggggccc 206
           |||| |||||||||  ||| || |||||||| ||||| |||| ||||||| | |||||||
Sbjct: 832 cccaggcgttgttggcgacggggtcggcgaggtggtcgagca-ggttctccaaggggccc 774

                                                                       
Query: 207 ttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgccca 266
           ||||||||||| || ||||| ||||||||||| ||||||||||||||||| ||||| |||
Sbjct: 773 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 714

                                                                       
Query: 267 ttcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggctaggccgagc 326
           ||||||| ||| || ||||||||||| ||||| |   | ||||| ||||| |||||||||
Sbjct: 713 ttcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcggcgaggccgagc 654

                    
Query: 327 gggtcgaag 335
           |||||||||
Sbjct: 653 gggtcgaag 645



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 441 aggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctg 500
           |||||||| || || ||||| ||| | ||||||||||||||||||||||| ||||||  |
Sbjct: 536 aggatgctctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggag 477

                                     
Query: 501 aagatttgggagcctgccttgaacca 526
           ||||| |||| ||| |||||||||||
Sbjct: 476 aagatctgggcgccggccttgaacca 451



to top

>dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-G12, full
           insert sequence
          Length = 1032

 Score =  145 bits (73), Expect = 2e-31
 Identities = 162/189 (85%), Gaps = 2/189 (1%)
 Strand = Plus / Minus

                                                                       
Query: 148 cccatgcgttgttgttgacaggatcggcgagatggtc-agcaaggttctcgagggggccc 206
           |||| |||||||||  ||| || |||||||| ||||| |||| ||||||| | |||||||
Sbjct: 834 cccaggcgttgttggcgacggggtcggcgaggtggtcgagca-ggttctccaaggggccc 776

                                                                       
Query: 207 ttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgccca 266
           ||||||||||| || ||||| ||||||||||| ||||||||||||||||| ||||| |||
Sbjct: 775 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 716

                                                                       
Query: 267 ttcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggctaggccgagc 326
           ||||||| ||| || ||||||||||| ||||| |   | ||||| ||||| |||||||||
Sbjct: 715 ttcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcggcgaggccgagc 656

                    
Query: 327 gggtcgaag 335
           |||||||||
Sbjct: 655 gggtcgaag 647



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 441 aggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctg 500
           |||||||| || || ||||| ||| | ||||||||||||||||||||||| ||||||  |
Sbjct: 538 aggatgctctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggag 479

                                     
Query: 501 aagatttgggagcctgccttgaacca 526
           ||||| |||| ||| |||||||||||
Sbjct: 478 aagatctgggcgccggccttgaacca 453



to top

>gb|AY112240.1| Zea mays CL187_6 mRNA sequence
          Length = 770

 Score =  143 bits (72), Expect = 8e-31
 Identities = 180/216 (83%)
 Strand = Plus / Minus

                                                                       
Query: 120 ttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgaga 179
           |||||||| || ||||| |||||  | ||||| |||||||||  ||| || |||||||  
Sbjct: 472 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggcgacg 413

                                                                       
Query: 180 tggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagcca 239
           |||||    |||||||||| |||||||||||||||||| || ||||||||||||||||| 
Sbjct: 412 tggtcgaagaggttctcgatggggcccttgccggtgacgatggcctgcacgaagaagccg 353

                                                                       
Query: 240 aacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaat 299
           ||||||||||||||||||||||| || ||||||| ||| || ||||||||||| |||   
Sbjct: 352 aacatggagaacatggcaaggcggccgttcttgagctccttcaccttgagctcggcggcg 293

                                               
Query: 300 gcctctgggtcatcggctaggccgagcgggtcgaag 335
           |  || ||||| ||||| ||||| ||||||||||||
Sbjct: 292 gtgtccgggtcgtcggcgaggcccagcgggtcgaag 257



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 114/141 (80%)
 Strand = Plus / Minus

                                                                       
Query: 407 gcccatgagcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggct 466
           |||||||||||| || || || |||||||| || |||||||| ||||| ||||| ||| |
Sbjct: 185 gcccatgagcaccacctggcacgcccagatggccaggatgctctgtgcgtgcaccaggtt 126

                                                                       
Query: 467 agggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaacca 526
            ||||| || |||||||| || || || ||   |||||| || | ||| |||||||||||
Sbjct: 125 ggggttccccaggtagtccagcccgccctccgagaagatctgcgcgccggccttgaacca 66

                                
Query: 527 tacagcctcaccgaacttgac 547
            || ||||| |||||||||||
Sbjct: 65  caccgcctcgccgaacttgac 45



to top

>gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           40 mRNA, complete cds
          Length = 859

 Score =  141 bits (71), Expect = 3e-30
 Identities = 178/211 (84%), Gaps = 2/211 (0%)
 Strand = Plus / Minus

                                                                       
Query: 429 gcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgagg 488
           |||||||| || |||||||| || || || |||||||| |||||||| |||||||| |  
Sbjct: 542 gcccagatggccaggatgctctgcgcgtggacgaggctggggttgcccaggtagtccaat 483

                                                                       
Query: 489 ccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaacttgact 548
           || || ||||||||||| ||||  || ||||||||||| || ||||| |||||||| || 
Sbjct: 482 ccgccctcgctgaagatctgggctccggccttgaaccagaccgcctcgccgaacttcacg 423

                                                                       
Query: 549 ccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggcccacctt 608
           || ||||| || || ||||||||||||||||| ||||| ||||| |||||||||||||  
Sbjct: 422 ccgttgcgggcgaggagctcggggaagacgcagccgagagcacccagcatggcccacc-g 364

                                          
Query: 609 gcagtggatcacctcaagcttcccggttctt 639
           ||||||||||||||| ||| |||||||||||
Sbjct: 363 gcagtggatcacctcgagc-tcccggttctt 334



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 107/129 (82%), Gaps = 1/129 (0%)
 Strand = Plus / Minus

                                                                       
Query: 239 aaacatggagaacatggc-aaggcgcccattcttgacctcttttaccttgagctccgcga 297
           |||||||||||||| ||| ||| |  || ||||||| ||| || ||||| ||||| ||||
Sbjct: 735 aaacatggagaacagggccaagcctgccgttcttgatctccttcaccttcagctcggcga 676

                                                                       
Query: 298 atgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggat 357
           | ||||| ||||| ||||| ||||| ||||||||||||||||| || ||||| || || |
Sbjct: 675 aggcctcggggtcgtcggcgaggccaagcgggtcgaagctgccgccggggtaaagggggt 616

                    
Query: 358 caaccacct 366
           | |||||||
Sbjct: 615 cgaccacct 607



to top

>dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRNA for type II
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 989

 Score =  141 bits (71), Expect = 3e-30
 Identities = 128/147 (87%)
 Strand = Plus / Minus

                                                                       
Query: 189 aggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaacatggag 248
           |||||||||| |||||||||||||||||| || ||||| |||||||| || |||||||||
Sbjct: 751 aggttctcgatggggcccttgccggtgacgatggcctggacgaagaatccgaacatggag 692

                                                                       
Query: 249 aacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcctctggg 308
           |||||||| ||||| || ||||||| ||| || ||||||||||| ||||| |  || |||
Sbjct: 691 aacatggcgaggcggccgttcttgagctccttcaccttgagctcggcgaaggtgtcaggg 632

                                      
Query: 309 tcatcggctaggccgagcgggtcgaag 335
           || ||||| ||||||||||||||||||
Sbjct: 631 tcgtcggcgaggccgagcgggtcgaag 605



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 94/116 (81%)
 Strand = Plus / Minus

                                                                       
Query: 429 gcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgagg 488
           |||||||| || |||||||| || || ||||| ||| | ||||| || ||||||||||| 
Sbjct: 511 gcccagatggcgaggatgctctgcgcgtgcaccaggttggggttccccaggtagtcgagc 452

                                                                   
Query: 489 ccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaactt 544
           || || |||  |||||| || | ||| ||||||||||| || ||||| ||||||||
Sbjct: 451 cccccctcggagaagatctgcgcgccggccttgaaccacaccgcctccccgaactt 396



to top

>dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C08, full
           insert sequence
          Length = 1111

 Score =  137 bits (69), Expect = 5e-29
 Identities = 161/189 (85%), Gaps = 2/189 (1%)
 Strand = Plus / Minus

                                                                       
Query: 148 cccatgcgttgttgttgacaggatcggcgagatggtc-agcaaggttctcgagggggccc 206
           |||| |||||||||  ||| || |||||||| ||||| |||| ||||||| | |||||||
Sbjct: 832 cccaggcgttgttggcgacggggtcggcgaggtggtcgagca-ggttctccaaggggccc 774

                                                                       
Query: 207 ttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgccca 266
           ||||||||||| || ||||| ||||||||||| ||||||||||||||||| ||||| |||
Sbjct: 773 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 714

                                                                       
Query: 267 ttcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggctaggccgagc 326
           ||||||| ||| || ||||||||||  ||||| |   | ||||| ||||| |||||||||
Sbjct: 713 ttcttgatctccttgaccttgagcttggcgaaggtgacggggtcgtcggcgaggccgagc 654

                    
Query: 327 gggtcgaag 335
           |||||||||
Sbjct: 653 gggtcgaag 645



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 441 aggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctg 500
           |||||||| || || ||||| ||| | ||||||||||||||||||||||| ||||||  |
Sbjct: 536 aggatgctctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggag 477

                                     
Query: 501 aagatttgggagcctgccttgaacca 526
           ||||| |||| ||| |||||||||||
Sbjct: 476 aagatctgggcgccggccttgaacca 451



to top

>emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chlorophyll a/b-binding
           protein
          Length = 1126

 Score =  137 bits (69), Expect = 5e-29
 Identities = 147/173 (84%)
 Strand = Plus / Minus

                                                                       
Query: 120 ttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgaga 179
           |||||||| || ||||| |||||  | ||||| |||||||||  ||| || |||||||  
Sbjct: 824 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggcgacg 765

                                                                       
Query: 180 tggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagcca 239
           |||||    |||||||||| |||||||||||||||||| || ||||||||||||||||| 
Sbjct: 764 tggtcgaagaggttctcgatggggcccttgccggtgacgatggcctgcacgaagaagccg 705

                                                                
Query: 240 aacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctc 292
           ||||||||||||||||||||||| || ||||||| ||| || |||||||||||
Sbjct: 704 aacatggagaacatggcaaggcggccgttcttgagctccttcaccttgagctc 652



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 114/141 (80%)
 Strand = Plus / Minus

                                                                       
Query: 407 gcccatgagcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggct 466
           |||||||||||| || || || |||||||| || |||||||| ||||| ||||| ||| |
Sbjct: 537 gcccatgagcaccacctggcacgcccagatggccaggatgctctgtgcgtgcaccaggtt 478

                                                                       
Query: 467 agggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaacca 526
            ||||| || |||||||| || || || ||   |||||| || | ||| |||||||||||
Sbjct: 477 ggggttccccaggtagtccagcccgccctccgagaagatctgcgcgccggccttgaacca 418

                                
Query: 527 tacagcctcaccgaacttgac 547
            || ||||| |||||||||||
Sbjct: 417 caccgcctcgccgaacttgac 397



to top

>dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023001G03, full
           insert sequence
          Length = 1107

 Score =  137 bits (69), Expect = 5e-29
 Identities = 161/189 (85%), Gaps = 2/189 (1%)
 Strand = Plus / Minus

                                                                       
Query: 148 cccatgcgttgttgttgacaggatcggcgagatggtc-agcaaggttctcgagggggccc 206
           |||| |||||||||  ||| || |||||||| ||||| |||| ||||||| | |||||||
Sbjct: 828 cccaggcgttgttggcgacggggtcggcgaggtggtcgagca-ggttctccaaggggccc 770

                                                                       
Query: 207 ttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgccca 266
           ||||||||||| || | ||| ||||||||||| ||||||||||||||||| ||||| |||
Sbjct: 769 ttgccggtgacgatggtctggacgaagaagccgaacatggagaacatggcgaggcggcca 710

                                                                       
Query: 267 ttcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggctaggccgagc 326
           ||||||| ||| || ||||||||||| ||||| |   | ||||| ||||| |||||||||
Sbjct: 709 ttcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcggcgaggccgagc 650

                    
Query: 327 gggtcgaag 335
           |||||||||
Sbjct: 649 gggtcgaag 641



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 441 aggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctg 500
           |||||||| || || ||||| ||| | ||||||||||||||||||||||| ||||||  |
Sbjct: 532 aggatgctctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggag 473

                                     
Query: 501 aagatttgggagcctgccttgaacca 526
           ||||| |||| ||| |||||||||||
Sbjct: 472 aagatctgggcgccggccttgaacca 447



to top

>ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3);
           chlorophyll binding AT1G29910 (CAB3) mRNA, complete cds
          Length = 1020

 Score =  135 bits (68), Expect = 2e-28
 Identities = 164/196 (83%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| |||||||||||||| || || || |||||||||||||||||||| |||||||
Sbjct: 858 ctcactttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcgg 799

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | | |||||||||||||||||| |  || ||||| || |||||||| || || |||||||
Sbjct: 798 ccaaatggtcagcaaggttctctatcggtcccttaccagtgacaatggcttgaacgaaga 739

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | |||||||| |||||||| || |  |  || ||||||| ||| || ||||| | |||||
Sbjct: 738 atccaaacatagagaacatagccaatcttccgttcttgagctccttcaccttcaactccg 679

                           
Query: 295 cgaatgcctctgggtc 310
           |||| |||||||||||
Sbjct: 678 cgaaagcctctgggtc 663



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 117/144 (81%)
 Strand = Plus / Minus

                                                                       
Query: 464 gctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaa 523
           ||||||||| || | ||| ||||| || || ||||| ||||| || || || ||||||||
Sbjct: 506 gctagggtttcccaagtaatcgagtcctccatcgctaaagatctgtgaaccggccttgaa 447

                                                                       
Query: 524 ccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
           ||| || ||||| |||||||||||||| || |  || | |||||| ||||||||||| ||
Sbjct: 446 ccaaaccgcctctccgaacttgactccgttcctagccaaaagctcagggaagacgcagcc 387

                                   
Query: 584 gagcgcaccgagcatggcccacct 607
            || || |||||||| ||||||||
Sbjct: 386 tagggctccgagcatagcccacct 363



to top

>ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding AT1G29920 (CAB2)
           mRNA, complete cds
          Length = 1176

 Score =  135 bits (68), Expect = 2e-28
 Identities = 164/196 (83%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| |||||||||||||| |||||||| ||||| |||||||||||||| |||||||
Sbjct: 872 ctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcgg 813

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | | |||||||||||||||||| |  || ||||| || ||||| || || || |||||||
Sbjct: 812 ccaaatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaaga 753

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | |||||||| |||||||| || |  |  || ||||||| ||| |||||||| | ||| |
Sbjct: 752 atccaaacatagagaacatagccaatcttccgttcttgagctcctttaccttcaactcag 693

                           
Query: 295 cgaatgcctctgggtc 310
           |||| |||||||||||
Sbjct: 692 cgaaggcctctgggtc 677



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 118/144 (81%)
 Strand = Plus / Minus

                                                                       
Query: 464 gctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaa 523
           ||||||||| || | ||| ||||| || || ||||||||||| || || || ||||||||
Sbjct: 520 gctagggtttcccaagtaatcgagccctccatcgctgaagatctgtgaaccagccttgaa 461

                                                                       
Query: 524 ccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
           ||| || ||||| || ||||||||||| || |  || | |||||| ||||||||||| ||
Sbjct: 460 ccaaactgcctctccaaacttgactccgttcctggccaaaagctcagggaagacgcagcc 401

                                   
Query: 584 gagcgcaccgagcatggcccacct 607
            || || |||||||||||||||||
Sbjct: 400 tagggctccgagcatggcccacct 377



to top

>gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472) putative
           photosystem II type I chlorophyll a /b binding protein
           (At1g29920) mRNA, complete cds
          Length = 1044

 Score =  135 bits (68), Expect = 2e-28
 Identities = 164/196 (83%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| |||||||||||||| |||||||| ||||| |||||||||||||| |||||||
Sbjct: 858 ctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcgg 799

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | | |||||||||||||||||| |  || ||||| || ||||| || || || |||||||
Sbjct: 798 ccaaatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaaga 739

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | |||||||| |||||||| || |  |  || ||||||| ||| |||||||| | ||| |
Sbjct: 738 atccaaacatagagaacatagccaatcttccgttcttgagctcctttaccttcaactcag 679

                           
Query: 295 cgaatgcctctgggtc 310
           |||| |||||||||||
Sbjct: 678 cgaaggcctctgggtc 663



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 118/144 (81%)
 Strand = Plus / Minus

                                                                       
Query: 464 gctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaa 523
           ||||||||| || | ||| ||||| || || ||||||||||| || || || ||||||||
Sbjct: 506 gctagggtttcccaagtaatcgagccctccatcgctgaagatctgtgaaccagccttgaa 447

                                                                       
Query: 524 ccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
           ||| || ||||| || ||||||||||| || |  || | |||||| ||||||||||| ||
Sbjct: 446 ccaaactgcctctccaaacttgactccgttcctggccaaaagctcagggaagacgcagcc 387

                                   
Query: 584 gagcgcaccgagcatggcccacct 607
            || || |||||||||||||||||
Sbjct: 386 tagggctccgagcatggcccacct 363



to top

>gb|AY128345.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein, putative (At1g29920) mRNA, complete cds
          Length = 994

 Score =  135 bits (68), Expect = 2e-28
 Identities = 164/196 (83%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| |||||||||||||| |||||||| ||||| |||||||||||||| |||||||
Sbjct: 858 ctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcgg 799

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | | |||||||||||||||||| |  || ||||| || ||||| || || || |||||||
Sbjct: 798 ccaaatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaaga 739

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | |||||||| |||||||| || |  |  || ||||||| ||| |||||||| | ||| |
Sbjct: 738 atccaaacatagagaacatagccaatcttccgttcttgagctcctttaccttcaactcag 679

                           
Query: 295 cgaatgcctctgggtc 310
           |||| |||||||||||
Sbjct: 678 cgaaggcctctgggtc 663



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 118/144 (81%)
 Strand = Plus / Minus

                                                                       
Query: 464 gctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaa 523
           ||||||||| || | ||| ||||| || || ||||||||||| || || || ||||||||
Sbjct: 506 gctagggtttcccaagtaatcgagccctccatcgctgaagatctgtgaaccagccttgaa 447

                                                                       
Query: 524 ccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
           ||| || ||||| || ||||||||||| || |  || | |||||| ||||||||||| ||
Sbjct: 446 ccaaactgcctctccaaacttgactccgttcctggccaaaagctcagggaagacgcagcc 387

                                   
Query: 584 gagcgcaccgagcatggcccacct 607
            || || |||||||||||||||||
Sbjct: 386 tagggctccgagcatggcccacct 363



to top

>gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910)
           mRNA, complete cds
          Length = 870

 Score =  135 bits (68), Expect = 2e-28
 Identities = 164/196 (83%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| |||||||||||||| || || || |||||||||||||||||||| |||||||
Sbjct: 805 ctcactttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcgg 746

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | | |||||||||||||||||| |  || ||||| || |||||||| || || |||||||
Sbjct: 745 ccaaatggtcagcaaggttctctatcggtcccttaccagtgacaatggcttgaacgaaga 686

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | |||||||| |||||||| || |  |  || ||||||| ||| || ||||| | |||||
Sbjct: 685 atccaaacatagagaacatagccaatcttccgttcttgagctccttcaccttcaactccg 626

                           
Query: 295 cgaatgcctctgggtc 310
           |||| |||||||||||
Sbjct: 625 cgaaagcctctgggtc 610



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 117/144 (81%)
 Strand = Plus / Minus

                                                                       
Query: 464 gctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaa 523
           ||||||||| || | ||| ||||| || || ||||| ||||| || || || ||||||||
Sbjct: 453 gctagggtttcccaagtaatcgagtcctccatcgctaaagatctgtgaaccggccttgaa 394

                                                                       
Query: 524 ccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
           ||| || ||||| |||||||||||||| || |  || | |||||| ||||||||||| ||
Sbjct: 393 ccaaaccgcctctccgaacttgactccgttcctagccaaaagctcagggaagacgcagcc 334

                                   
Query: 584 gagcgcaccgagcatggcccacct 607
            || || |||||||| ||||||||
Sbjct: 333 tagggctccgagcatagcccacct 310



to top

>gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920)
           mRNA, complete cds
          Length = 898

 Score =  135 bits (68), Expect = 2e-28
 Identities = 164/196 (83%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| |||||||||||||| |||||||| ||||| |||||||||||||| |||||||
Sbjct: 805 ctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcgg 746

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | | |||||||||||||||||| |  || ||||| || ||||| || || || |||||||
Sbjct: 745 ccaaatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaaga 686

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | |||||||| |||||||| || |  |  || ||||||| ||| |||||||| | ||| |
Sbjct: 685 atccaaacatagagaacatagccaatcttccgttcttgagctcctttaccttcaactcag 626

                           
Query: 295 cgaatgcctctgggtc 310
           |||| |||||||||||
Sbjct: 625 cgaaggcctctgggtc 610



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 118/144 (81%)
 Strand = Plus / Minus

                                                                       
Query: 464 gctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaa 523
           ||||||||| || | ||| ||||| || || ||||||||||| || || || ||||||||
Sbjct: 453 gctagggtttcccaagtaatcgagccctccatcgctgaagatctgtgaaccagccttgaa 394

                                                                       
Query: 524 ccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
           ||| || ||||| || ||||||||||| || |  || | |||||| ||||||||||| ||
Sbjct: 393 ccaaactgcctctccaaacttgactccgttcctggccaaaagctcagggaagacgcagcc 334

                                   
Query: 584 gagcgcaccgagcatggcccacct 607
            || || |||||||||||||||||
Sbjct: 333 tagggctccgagcatggcccacct 310



to top

>gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910;
           F1N18.5) mRNA, complete cds
          Length = 1019

 Score =  135 bits (68), Expect = 2e-28
 Identities = 164/196 (83%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| |||||||||||||| || || || |||||||||||||||||||| |||||||
Sbjct: 858 ctcactttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcgg 799

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | | |||||||||||||||||| |  || ||||| || |||||||| || || |||||||
Sbjct: 798 ccaaatggtcagcaaggttctctatcggtcccttaccagtgacaatggcttgaacgaaga 739

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | |||||||| |||||||| || |  |  || ||||||| ||| || ||||| | |||||
Sbjct: 738 atccaaacatagagaacatagccaatcttccgttcttgagctccttcaccttcaactccg 679

                           
Query: 295 cgaatgcctctgggtc 310
           |||| |||||||||||
Sbjct: 678 cgaaagcctctgggtc 663



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 117/144 (81%)
 Strand = Plus / Minus

                                                                       
Query: 464 gctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaa 523
           ||||||||| || | ||| ||||| || || ||||| ||||| || || || ||||||||
Sbjct: 506 gctagggtttcccaagtaatcgagtcctccatcgctaaagatctgtgaaccggccttgaa 447

                                                                       
Query: 524 ccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
           ||| || ||||| |||||||||||||| || |  || | |||||| ||||||||||| ||
Sbjct: 446 ccaaaccgcctctccgaacttgactccgttcctagccaaaagctcagggaagacgcagcc 387

                                   
Query: 584 gagcgcaccgagcatggcccacct 607
            || || |||||||| ||||||||
Sbjct: 386 tagggctccgagcatagcccacct 363



to top

>gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920;
           F1N18.4) mRNA, complete cds
          Length = 1007

 Score =  135 bits (68), Expect = 2e-28
 Identities = 164/196 (83%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| |||||||||||||| |||||||| ||||| |||||||||||||| |||||||
Sbjct: 857 ctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcgg 798

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | | |||||||||||||||||| |  || ||||| || ||||| || || || |||||||
Sbjct: 797 ccaaatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaaga 738

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | |||||||| |||||||| || |  |  || ||||||| ||| |||||||| | ||| |
Sbjct: 737 atccaaacatagagaacatagccaatcttccgttcttgagctcctttaccttcaactcag 678

                           
Query: 295 cgaatgcctctgggtc 310
           |||| |||||||||||
Sbjct: 677 cgaaggcctctgggtc 662



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 118/144 (81%)
 Strand = Plus / Minus

                                                                       
Query: 464 gctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaa 523
           ||||||||| || | ||| ||||| || || ||||||||||| || || || ||||||||
Sbjct: 505 gctagggtttcccaagtaatcgagccctccatcgctgaagatctgtgaaccagccttgaa 446

                                                                       
Query: 524 ccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
           ||| || ||||| || ||||||||||| || |  || | |||||| ||||||||||| ||
Sbjct: 445 ccaaactgcctctccaaacttgactccgttcctggccaaaagctcagggaagacgcagcc 386

                                   
Query: 584 gagcgcaccgagcatggcccacct 607
            || || |||||||||||||||||
Sbjct: 385 tagggctccgagcatggcccacct 362



to top

>gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score =  135 bits (68), Expect = 2e-28
 Identities = 164/196 (83%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| |||||||||||||| |||||||| ||||| |||||||||||||| |||||||
Sbjct: 851 ctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcgg 792

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | | |||||||||||||||||| |  || ||||| || ||||| || || || |||||||
Sbjct: 791 ccaaatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaaga 732

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | |||||||| |||||||| || |  |  || ||||||| ||| |||||||| | ||| |
Sbjct: 731 atccaaacatagagaacatagccaatcttccgttcttgagctcctttaccttcaactcag 672

                           
Query: 295 cgaatgcctctgggtc 310
           |||| |||||||||||
Sbjct: 671 cgaaggcctctgggtc 656



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 118/144 (81%)
 Strand = Plus / Minus

                                                                       
Query: 464 gctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaa 523
           ||||||||| || | ||| ||||| || || ||||||||||| || || || ||||||||
Sbjct: 499 gctagggtttcccaagtaatcgagccctccatcgctgaagatctgtgaaccagccttgaa 440

                                                                       
Query: 524 ccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
           ||| || ||||| || ||||||||||| || |  || | |||||| ||||||||||| ||
Sbjct: 439 ccaaactgcctctccaaacttgactccgttcctggccaaaagctcagggaagacgcagcc 380

                                   
Query: 584 gagcgcaccgagcatggcccacct 607
            || || |||||||||||||||||
Sbjct: 379 tagggctccgagcatggcccacct 356



to top

>gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score =  135 bits (68), Expect = 2e-28
 Identities = 164/196 (83%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| |||||||||||||| |||||||| ||||| |||||||||||||| |||||||
Sbjct: 857 ctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcgg 798

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | | |||||||||||||||||| |  || ||||| || ||||| || || || |||||||
Sbjct: 797 ccaaatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaaga 738

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | |||||||| |||||||| || |  |  || ||||||| ||| |||||||| | ||| |
Sbjct: 737 atccaaacatagagaacatagccaatcttccgttcttgagctcctttaccttcaactcag 678

                           
Query: 295 cgaatgcctctgggtc 310
           |||| |||||||||||
Sbjct: 677 cgaaggcctctgggtc 662



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 118/144 (81%)
 Strand = Plus / Minus

                                                                       
Query: 464 gctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaa 523
           ||||||||| || | ||| ||||| || || ||||||||||| || || || ||||||||
Sbjct: 505 gctagggtttcccaagtaatcgagccctccatcgctgaagatctgtgaaccagccttgaa 446

                                                                       
Query: 524 ccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
           ||| || ||||| || ||||||||||| || |  || | |||||| ||||||||||| ||
Sbjct: 445 ccaaactgcctctccaaacttgactccgttcctggccaaaagctcagggaagacgcagcc 386

                                   
Query: 584 gagcgcaccgagcatggcccacct 607
            || || |||||||||||||||||
Sbjct: 385 tagggctccgagcatggcccacct 362



to top

>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete
             sequence
          Length = 101075

 Score =  135 bits (68), Expect = 2e-28
 Identities = 164/196 (83%)
 Strand = Plus / Minus

                                                                         
Query: 115   ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
             ||||||| |||||||||||||| || || || |||||||||||||||||||| |||||||
Sbjct: 22543 ctcactttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcgg 22484

                                                                         
Query: 175   cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
             | | |||||||||||||||||| |  || ||||| || |||||||| || || |||||||
Sbjct: 22483 ccaaatggtcagcaaggttctctatcggtcccttaccagtgacaatggcttgaacgaaga 22424

                                                                         
Query: 235   agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
             | |||||||| |||||||| || |  |  || ||||||| ||| || ||||| | |||||
Sbjct: 22423 atccaaacatagagaacatagccaatcttccgttcttgagctccttcaccttcaactccg 22364

                             
Query: 295   cgaatgcctctgggtc 310
             |||| |||||||||||
Sbjct: 22363 cgaaagcctctgggtc 22348



 Score =  135 bits (68), Expect = 2e-28
 Identities = 164/196 (83%)
 Strand = Plus / Minus

                                                                         
Query: 115   ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
             ||||||| |||||||||||||| |||||||| ||||| |||||||||||||| |||||||
Sbjct: 19897 ctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcgg 19838

                                                                         
Query: 175   cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
             | | |||||||||||||||||| |  || ||||| || ||||| || || || |||||||
Sbjct: 19837 ccaaatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaaga 19778

                                                                         
Query: 235   agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
             | |||||||| |||||||| || |  |  || ||||||| ||| |||||||| | ||| |
Sbjct: 19777 atccaaacatagagaacatagccaatcttccgttcttgagctcctttaccttcaactcag 19718

                             
Query: 295   cgaatgcctctgggtc 310
             |||| |||||||||||
Sbjct: 19717 cgaaggcctctgggtc 19702



 Score =  127 bits (64), Expect = 5e-26
 Identities = 163/196 (83%)
 Strand = Plus / Plus

                                                                         
Query: 115   ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
             ||||||| |||||||||||||| ||||| || ||||||||||||||||| || |||||||
Sbjct: 16110 ctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcgg 16169

                                                                         
Query: 175   cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
             | | |||||||||||||||||| |  || ||||| || ||||| || || || |||||||
Sbjct: 16170 ccaaatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaaga 16229

                                                                         
Query: 235   agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
             | |||||||| |||||||| || |  |  || ||||||| ||| || ||||| | ||| |
Sbjct: 16230 atccaaacatagagaacatagccaatcttccgttcttgagctccttcaccttcaactcag 16289

                             
Query: 295   cgaatgcctctgggtc 310
             ||||||||||||||||
Sbjct: 16290 cgaatgcctctgggtc 16305



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 119/144 (82%)
 Strand = Plus / Plus

                                                                         
Query: 464   gctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaa 523
             ||||||||| || | ||| ||||| || || ||||||||||| || || || ||||||||
Sbjct: 16462 gctagggtttcccaagtaatcgagccctccatcgctgaagatctgtgaaccggccttgaa 16521

                                                                         
Query: 524   ccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
             ||| || ||||| |||||||||||||| || |  || | |||||| ||||||||||| ||
Sbjct: 16522 ccaaaccgcctctccgaacttgactccgtttctagccaaaagctcagggaagacgcagcc 16581

                                     
Query: 584   gagcgcaccgagcatggcccacct 607
              || || |||||||||||||||||
Sbjct: 16582 tagggctccgagcatggcccacct 16605



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 118/144 (81%)
 Strand = Plus / Minus

                                                                         
Query: 464   gctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaa 523
             ||||||||| || | ||| ||||| || || ||||||||||| || || || ||||||||
Sbjct: 19545 gctagggtttcccaagtaatcgagccctccatcgctgaagatctgtgaaccagccttgaa 19486

                                                                         
Query: 524   ccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
             ||| || ||||| || ||||||||||| || |  || | |||||| ||||||||||| ||
Sbjct: 19485 ccaaactgcctctccaaacttgactccgttcctggccaaaagctcagggaagacgcagcc 19426

                                     
Query: 584   gagcgcaccgagcatggcccacct 607
              || || |||||||||||||||||
Sbjct: 19425 tagggctccgagcatggcccacct 19402



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 117/144 (81%)
 Strand = Plus / Minus

                                                                         
Query: 464   gctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaa 523
             ||||||||| || | ||| ||||| || || ||||| ||||| || || || ||||||||
Sbjct: 22191 gctagggtttcccaagtaatcgagtcctccatcgctaaagatctgtgaaccggccttgaa 22132

                                                                         
Query: 524   ccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
             ||| || ||||| |||||||||||||| || |  || | |||||| ||||||||||| ||
Sbjct: 22131 ccaaaccgcctctccgaacttgactccgttcctagccaaaagctcagggaagacgcagcc 22072

                                     
Query: 584   gagcgcaccgagcatggcccacct 607
              || || |||||||| ||||||||
Sbjct: 22071 tagggctccgagcatagcccacct 22048



to top

>gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete sequence
          Length = 1041

 Score =  135 bits (68), Expect = 2e-28
 Identities = 164/196 (83%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| |||||||||||||| |||||||| ||||| |||||||||||||| |||||||
Sbjct: 872 ctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcgg 813

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | | |||||||||||||||||| |  || ||||| || ||||| || || || |||||||
Sbjct: 812 ccaaatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaaga 753

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | |||||||| |||||||| || |  |  || ||||||| ||| || ||||| | ||| |
Sbjct: 752 atccaaacatagagaacatagccaatcttccgttcttgagctccttcaccttcaactcag 693

                           
Query: 295 cgaatgcctctgggtc 310
           ||||||||||||||||
Sbjct: 692 cgaatgcctctgggtc 677



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 116/144 (80%)
 Strand = Plus / Minus

                                                                       
Query: 464 gctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaa 523
           ||||||||| || | ||| ||||| || || ||||| ||||| || || || ||||||||
Sbjct: 520 gctagggtttcccaagtaatcgagccctccatcgctaaagatctgtgaaccagccttgaa 461

                                                                       
Query: 524 ccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
           ||| || ||||| || ||||||||||| || |  || | ||| || ||||||||||| ||
Sbjct: 460 ccaaactgcctctccaaacttgactccgttcctggccaaaagttcagggaagacgcagcc 401

                                   
Query: 584 gagcgcaccgagcatggcccacct 607
            || || |||||||||||||||||
Sbjct: 400 tagggctccgagcatggcccacct 377



to top

>emb|AJ538874.1|NTA538874 Nicotiana tabacum cDNA-AFLP-fragment BT2-M23-004
          Length = 311

 Score =  135 bits (68), Expect = 2e-28
 Identities = 209/256 (81%)
 Strand = Plus / Minus

                                                                       
Query: 180 tggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagcca 239
           ||||| ||||||||||| |  || ||||| || ||||| |||||||| || ||||| |||
Sbjct: 294 tggtcggcaaggttctccaatggaccctttccagtgacgatagcctgaacaaagaatcca 235

                                                                       
Query: 240 aacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaat 299
           |||||||||||||| ||||| |  |||||||||| ||| |||||||||||||| || || 
Sbjct: 234 aacatggagaacatagcaagtctaccattcttgatctcctttaccttgagctcagcaaaa 175

                                                                       
Query: 300 gcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatca 359
           |||| |||||| || || || || |  |||||||| |||||||||||||| ||||| |||
Sbjct: 174 gcctgtgggtcttcagcaagtcccaatgggtcgaaactgccaccagggtaaagtgggtca 115

                                                                       
Query: 360 accacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacg 419
           || || |||||||| || || |||||||  ||||| || ||||| || ||||| | ||| 
Sbjct: 114 acaacttcaccgagaggtcccccagcaacacggtaaccctcaactgctcccatcaacaca 55

                           
Query: 420 acttgacatgcccaga 435
           ||||| || |||||||
Sbjct: 54  acttggcaagcccaga 39



to top

>emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophyll a/b binding protein
          Length = 999

 Score =  135 bits (68), Expect = 2e-28
 Identities = 164/196 (83%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| |||||||||||||| |||||||| ||||| |||||||||||||| |||||||
Sbjct: 950 ctcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcgg 891

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | | |||||||||||||||||| |  || ||||| || ||||| || || || |||||||
Sbjct: 890 ccaaatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaaga 831

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | |||||||| |||||||| || |  |  || ||||||| ||| |||||||| | ||| |
Sbjct: 830 atccaaacatagagaacatagccaatcttccgttcttgagctcctttaccttcaactcag 771

                           
Query: 295 cgaatgcctctgggtc 310
           |||| |||||||||||
Sbjct: 770 cgaaggcctctgggtc 755



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 119/144 (82%)
 Strand = Plus / Minus

                                                                       
Query: 464 gctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaa 523
           ||||||||| || | ||| ||||| || || ||||||||||| || || || ||||||||
Sbjct: 598 gctagggtttcccaagtaatcgagccctccatcgctgaagatctgtgaaccagccttgaa 539

                                                                       
Query: 524 ccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
           ||| |||||||| || ||||||||||| || |  || | |||||| ||||||||||| ||
Sbjct: 538 ccaaacagcctctccaaacttgactccgttcctggccaaaagctcagggaagacgcagcc 479

                                   
Query: 584 gagcgcaccgagcatggcccacct 607
            || || |||||||||||||||||
Sbjct: 478 tagggctccgagcatggcccacct 455



to top

>gb|AY845253.1| Pisum sativum light-harvesting chlorophyll-a/b binding protein
           Lhcb1 mRNA, complete cds
          Length = 801

 Score =  133 bits (67), Expect = 8e-28
 Identities = 205/251 (81%)
 Strand = Plus / Minus

                                                                       
Query: 333 aagctgccaccagggtagagtggatcaaccacctcaccgagtgggccaccagcaatgcgg 392
           ||||| |||||||| || ||||| ||||| |||||||| || |||||||| ||||| |||
Sbjct: 584 aagctaccaccaggataaagtgggtcaacaacctcaccaagagggccaccggcaatacgg 525

                                                                       
Query: 393 tacccttcaacggcgcccatgagcacgacttgacatgcccagatagcaaggatgctttgt 452
           || |||||||| || ||||| |  |  || |||   |||||||| |||||||||||||| 
Sbjct: 524 taaccttcaacagctcccatcaagataacctgagtggcccagatggcaaggatgctttga 465

                                                                       
Query: 453 gcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggag 512
           ||||| || | ||| |||||||| | |||||| || ||||| ||||| |||||||| || 
Sbjct: 464 gcatggaccaagcttgggttgcccaagtagtcaagtccaccctcgctaaagatttgagat 405

                                                                       
Query: 513 cctgccttgaaccatacagcctcaccgaacttgactccattgcgcgcaagaagctcgggg 572
           |||||||||||||||||||| |||||||| || || || ||||| |  | |||||| |||
Sbjct: 404 cctgccttgaaccatacagcttcaccgaatttaacaccgttgcgagacaaaagctctggg 345

                      
Query: 573 aagacgcatcc 583
           ||||| |||||
Sbjct: 344 aagacacatcc 334



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 114/138 (82%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||| |||||||||||||| |||||| | | |||||| |||||||| || || |||| 
Sbjct: 801 tcactttccgggaacaaagttggtggcatatgaccatgcattgttgttaactgggtcgga 742

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            ||||| |||||||| ||||| |  || ||||| ||||| |||||||| || || |||||
Sbjct: 741 aagatgatcagcaagattctccaaaggtccctttccggtcacaatagcttgaacaaagaa 682

                             
Query: 236 gccaaacatggagaacat 253
            |||||||| ||||||||
Sbjct: 681 tccaaacattgagaacat 664



to top

>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence
          Length = 762

 Score =  133 bits (67), Expect = 8e-28
 Identities = 163/195 (83%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||| |||||||||||||| |||||||| ||||| |||||||||||||| ||||||||
Sbjct: 762 tcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 703

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            | |||||||||||||||||| |  || ||||| || ||||| || || || ||||||||
Sbjct: 702 caaatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaagaa 643

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
            |||||||| |||||||| || |  |  || ||||||| ||| |||||||| | ||| ||
Sbjct: 642 tccaaacatagagaacatagccaatcttccgttcttgagctcctttaccttcaactcagc 583

                          
Query: 296 gaatgcctctgggtc 310
           ||| |||||||||||
Sbjct: 582 gaaggcctctgggtc 568



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 118/144 (81%)
 Strand = Plus / Minus

                                                                       
Query: 464 gctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaa 523
           ||||||||| || | ||| ||||| || || ||||||||||| || || || ||||||||
Sbjct: 411 gctagggtttcccaagtaatcgagccctccatcgctgaagatctgtgaaccagccttgaa 352

                                                                       
Query: 524 ccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
           ||| || ||||| || ||||||||||| || |  || | |||||| ||||||||||| ||
Sbjct: 351 ccaaactgcctctccaaacttgactccgttcctggccaaaagctcagggaagacgcagcc 292

                                   
Query: 584 gagcgcaccgagcatggcccacct 607
            || || |||||||||||||||||
Sbjct: 291 tagggctccgagcatggcccacct 268



to top

>gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 804

 Score =  133 bits (67), Expect = 8e-28
 Identities = 163/195 (83%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||| |||||||||||||| |||||||| ||||| |||||||||||||| ||||||||
Sbjct: 804 tcactttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 745

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            | |||||||||||||||||| |  || ||||| || ||||| || || || ||||||||
Sbjct: 744 caaatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaagaa 685

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
            |||||||| |||||||| || |  |  || ||||||| ||| |||||||| | ||| ||
Sbjct: 684 tccaaacatagagaacatagccaatcttccgttcttgagctcctttaccttcaactcagc 625

                          
Query: 296 gaatgcctctgggtc 310
           ||| |||||||||||
Sbjct: 624 gaaggcctctgggtc 610



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 118/144 (81%)
 Strand = Plus / Minus

                                                                       
Query: 464 gctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaa 523
           ||||||||| || | ||| ||||| || || ||||||||||| || || || ||||||||
Sbjct: 453 gctagggtttcccaagtaatcgagccctccatcgctgaagatctgtgaaccagccttgaa 394

                                                                       
Query: 524 ccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
           ||| || ||||| || ||||||||||| || |  || | |||||| ||||||||||| ||
Sbjct: 393 ccaaactgcctctccaaacttgactccgttcctggccaaaagctcagggaagacgcagcc 334

                                   
Query: 584 gagcgcaccgagcatggcccacct 607
            || || |||||||||||||||||
Sbjct: 333 tagggctccgagcatggcccacct 310



to top

>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding
           protein (CABII) mRNA, partial cds
          Length = 714

 Score =  133 bits (67), Expect = 8e-28
 Identities = 178/215 (82%)
 Strand = Plus / Minus

                                                                       
Query: 120 ttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgaga 179
           |||||||| || ||||| |||||  | ||||| |||||||||  ||| || || |||| |
Sbjct: 574 ttgccggggacgaagttggtggcgtaagcccaggcgttgttggcgacggggtcagcgaca 515

                                                                       
Query: 180 tggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagcca 239
           |||||    |||||||||| ||| |||||||||||||| || ||||| |||||||| |||
Sbjct: 514 tggtcgaagaggttctcgatgggtcccttgccggtgacgatggcctggacgaagaaccca 455

                                                                       
Query: 240 aacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaat 299
           ||||||||||||||||| ||||| || ||||||| ||| || |||||||||||||||   
Sbjct: 454 aacatggagaacatggcgaggcggccgttcttgagctccttcaccttgagctccgcggcg 395

                                              
Query: 300 gcctctgggtcatcggctaggccgagcgggtcgaa 334
           |  || ||||||||||| || ||||||||||||||
Sbjct: 394 gtgtcggggtcatcggcgagcccgagcgggtcgaa 360



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 115/141 (81%)
 Strand = Plus / Minus

                                                                       
Query: 407 gcccatgagcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggct 466
           ||||||||||||||| || || |||||||| || |||||||| || || ||||| ||| |
Sbjct: 287 gcccatgagcacgacctggcacgcccagatggccaggatgctctgcgcgtgcaccaggtt 228

                                                                       
Query: 467 agggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaacca 526
            |||||||| |||||||| || || || ||   |||||| || | ||| |||||||||||
Sbjct: 227 cgggttgcccaggtagtccagcccgccctccgagaagatctgcgcgccggccttgaacca 168

                                
Query: 527 tacagcctcaccgaacttgac 547
            || ||||| |||||||||||
Sbjct: 167 caccgcctcgccgaacttgac 147



to top

>gb|M21396.1|SOYCBPA Soybean light-harvesting chlorophyll a/b-binding protein (LHCPII)
           mRNA, 3' end
          Length = 911

 Score =  133 bits (67), Expect = 8e-28
 Identities = 420/535 (78%), Gaps = 2/535 (0%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| ||||| |||||||| || ||| | ||||| || || ||||| || || || |
Sbjct: 741 ctcactttccggggacaaagtttgtagcataggcccaggcattattgtttactggttcag 682

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | || ||||||||||| || || |  || ||||| || || ||||| ||||| || ||||
Sbjct: 681 ctaggtggtcagcaagattttccaaaggtccctttcctgtcacaattgcctgaacaaaga 622

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | |||||||||||||||||||| |  |  |||||||||| |||||| ||||| | ||| |
Sbjct: 621 aaccaaacatggagaacatggccaacctaccattcttgatctctttcaccttcaactcag 562

                                                                       
Query: 295 cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
           | || |||||||||||||| || ||| | |  ||||| ||||||||||| || |||| ||
Sbjct: 561 caaaagcctctgggtcatcagcaagggccaatgggtcaaagctgccacctggatagattg 502

                                                                       
Query: 355 gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
           | |||  ||||||||| || || ||||||||||| ||||| || |||||||| ||||| |
Sbjct: 501 ggtcagtcacctcaccaagaggcccaccagcaatacggtaaccctcaacggcacccatca 442

                                                                       
Query: 415 gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
             |  |||||    |||||||| ||||| |||||||||||||| |  |||||  ||||||
Sbjct: 441 agataacttgggtggcccagatggcaagaatgctttgtgcatggatcaggctttggttgc 382

                                                                       
Query: 475 cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
           | | |||||| || ||||| || ||||| || || || || |||||||||||    || |
Sbjct: 381 ccaagtagtcaagcccaccctcactgaatatctgagacccggccttgaaccacgacgctt 322

                                                                       
Query: 535 caccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccga 594
           ||||||||||||| || ||||| || |  || |||||||| || || || || || || |
Sbjct: 321 caccgaacttgacaccgttgcgggccaagagttcggggaaaacacagcccagggctccca 262

                                                                  
Query: 595 gcatggcccaccttgcagtggatcacctcaagcttcccggttctttgcaaaggtc 649
            ||||||||| | || ||||||| || ||||| ||| |||||||| |||||||||
Sbjct: 261 acatggcccatc-tggagtggatgacttcaag-ttcacggttcttggcaaaggtc 209



to top

>gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid protein (polypeptide
           15) mRNA, clone pAB96
          Length = 822

 Score =  133 bits (67), Expect = 8e-28
 Identities = 205/251 (81%)
 Strand = Plus / Minus

                                                                       
Query: 333 aagctgccaccagggtagagtggatcaaccacctcaccgagtgggccaccagcaatgcgg 392
           ||||| |||||||| || ||||| ||||| |||||||| || |||||||| ||||| |||
Sbjct: 471 aagctaccaccaggataaagtgggtcaacaacctcaccaagagggccaccggcaatacgg 412

                                                                       
Query: 393 tacccttcaacggcgcccatgagcacgacttgacatgcccagatagcaaggatgctttgt 452
           || |||||||| || ||||| |  |  || |||   |||||||| |||||||||||||| 
Sbjct: 411 taaccttcaacagctcccatcaagataacctgagtggcccagatggcaaggatgctttga 352

                                                                       
Query: 453 gcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggag 512
           ||||| || | ||| |||||||| | |||||| || ||||| ||||| |||||||| || 
Sbjct: 351 gcatggaccaagcttgggttgcccaagtagtcaagtccaccctcgctaaagatttgagat 292

                                                                       
Query: 513 cctgccttgaaccatacagcctcaccgaacttgactccattgcgcgcaagaagctcgggg 572
           |||||||||||||||||||| |||||||| || || || ||||| |  | |||||| |||
Sbjct: 291 cctgccttgaaccatacagcttcaccgaatttaacaccgttgcgagacaaaagctctggg 232

                      
Query: 573 aagacgcatcc 583
           ||||| |||||
Sbjct: 231 aagacacatcc 221



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 116/141 (82%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||| |||||||||||||| || ||| | | ||||||||||||||| || || |||||
Sbjct: 688 tcactttccgggaacaaagttggtagcatatgaccatgcgttgttgttcactgggtcggc 629

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            ||||| || ||||||||||| |  || ||||| || || ||||||||  | || |||||
Sbjct: 628 aagatgatcggcaaggttctccaaaggaccctttccagttacaatagctggaacaaagaa 569

                                
Query: 236 gccaaacatggagaacatggc 256
            |||||||| |||||||||||
Sbjct: 568 accaaacatagagaacatggc 548



to top

>gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/b-binding protein
           (CipLhcb1*2) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 932

 Score =  131 bits (66), Expect = 3e-27
 Identities = 216/266 (81%)
 Strand = Plus / Minus

                                                                       
Query: 129 acaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgagatggtcagca 188
           |||||||| |||||  | ||||| ||||||||||||||||| ||||| || || || || 
Sbjct: 838 acaaagttggtggcgtaggcccaggcgttgttgttgacagggtcggcaaggtgatcggcg 779

                                                                       
Query: 189 aggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaacatggag 248
           |||||||| |  || |||||||| |||||||| || || |||||||| ||||| ||||||
Sbjct: 778 aggttctccaaaggtcccttgccagtgacaatggcttgaacgaagaaaccaaatatggag 719

                                                                       
Query: 249 aacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcctctggg 308
           |||||||| |  | |||||| || | |||||| ||||| |  || || || |||||||||
Sbjct: 718 aacatggccaatctcccatttttcaactctttcaccttcaattcagcaaaggcctctggg 659

                                                                       
Query: 309 tcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaaccacctca 368
           |||||||| ||||| |  ||||||||||| ||||| ||||||| ||| |||  |||||||
Sbjct: 658 tcatcggcaaggcccaatgggtcgaagctcccacccgggtagattgggtcagtcacctca 599

                                     
Query: 369 ccgagtgggccaccagcaatgcggta 394
           || |  || ||||| |||||||||||
Sbjct: 598 cccaaaggcccaccggcaatgcggta 573



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 96/116 (82%)
 Strand = Plus / Minus

                                                                       
Query: 429 gcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgagg 488
           |||||||| ||||||||||| |||||||| |  ||||| |||||||| | |||||| || 
Sbjct: 538 gcccagatggcaaggatgctctgtgcatggatcaggcttgggttgcccaagtagtcaagc 479

                                                                   
Query: 489 ccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaactt 544
           ||||| || ||||| || || || || ||||||||||| || ||||| ||||||||
Sbjct: 478 ccaccctcactgaatatctgagacccagccttgaaccacaccgcctccccgaactt 423



to top

>gb|K00973.1|PETCAB3 Petunia major chlorophyll a/b binding protein (Cab) clone pCab3, 3'
           end and flank
          Length = 511

 Score =  131 bits (66), Expect = 3e-27
 Identities = 207/254 (81%)
 Strand = Plus / Minus

                                                                       
Query: 180 tggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagcca 239
           ||||||||||| ||||| |  || ||||| |||||||| ||||| || || || || |||
Sbjct: 347 tggtcagcaagattctcaaatggcccctttccggtgacgatagcttgaacaaaaaatcca 288

                                                                       
Query: 240 aacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaat 299
           |||||||| ||||||||||| |  |||||||||| ||| || ||||||||||| || || 
Sbjct: 287 aacatggaaaacatggcaagtctaccattcttgatctccttcaccttgagctcagcaaaa 228

                                                                       
Query: 300 gcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatca 359
           |||||||||||||| || ||||| | ||| || ||||| ||||| ||| ||||||| |||
Sbjct: 227 gcctctgggtcatcagcaaggcccaacggatcaaagctaccacccgggcagagtgggtca 168

                                                                       
Query: 360 accacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacg 419
           |  |||||||| || || |||||||||| |||||| || ||||| || ||||| | ||| 
Sbjct: 167 ataacctcaccaagaggtccaccagcaacgcggtaaccctcaacagctcccatcaacaca 108

                         
Query: 420 acttgacatgccca 433
           ||||| || |||||
Sbjct: 107 acttggcaagccca 94



to top

>gb|M16058.1|CUSLHCPB Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein,
           partial cds
          Length = 748

 Score =  131 bits (66), Expect = 3e-27
 Identities = 348/442 (78%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| |||||||||||||| |||||| | ||||| || ||||||||||| || || |
Sbjct: 624 ctcactttccgggaacaaagtttgtggcatatgcccaagcattgttgttgactgggtcag 565

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | |  |||||||| | ||| || |  || ||||| || || ||||| || || |||||||
Sbjct: 564 ccaagtggtcagccaagttttccaaaggaccctttccagtaacaatggcttgaacgaaga 505

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | ||||||||||| ||||| || |  |  |||||||| | ||| || ||||| |  || |
Sbjct: 504 atccaaacatggaaaacattgccaaccttccattcttcaactccttaaccttcaattcag 445

                                                                       
Query: 295 cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
           |||| |||||||||||||| || |  || |  ||||| ||||| ||||| |||||||  |
Sbjct: 444 cgaaggcctctgggtcatcagccaaacccaatgggtcaaagcttccacctgggtagatgg 385

                                                                       
Query: 355 gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
           | |||  |||||| ||||||||||| |||||||| ||||| || || ||||| ||||| |
Sbjct: 384 ggtcagtcacctctccgagtgggccgccagcaatacggtaaccctcgacggcacccatca 325

                                                                       
Query: 415 gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
            ||| || || || |||||||| || |  ||||| || ||||| || | ||| |||||||
Sbjct: 324 acacaacctggcaagcccagatggccaaaatgctctgagcatggaccaagctggggttgc 265

                                                                       
Query: 475 cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
           | | |||||| || || || ||||||||||| || || || ||||||||||| |||||||
Sbjct: 264 ccaagtagtcaagcccgccctcgctgaagatctgagatccagccttgaaccaaacagcct 205

                                 
Query: 535 caccgaacttgactccattgcg 556
           |||| ||||| || ||||||||
Sbjct: 204 caccaaacttcacaccattgcg 183



to top

>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1);
           chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds
          Length = 1044

 Score =  127 bits (64), Expect = 5e-26
 Identities = 163/196 (83%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| |||||||||||||| ||||| || ||||||||||||||||| || |||||||
Sbjct: 871 ctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcgg 812

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | | |||||||||||||||||| |  || ||||| || ||||| || || || |||||||
Sbjct: 811 ccaaatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaaga 752

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | |||||||| |||||||| || |  |  || ||||||| ||| || ||||| | ||| |
Sbjct: 751 atccaaacatagagaacatagccaatcttccgttcttgagctccttcaccttcaactcag 692

                           
Query: 295 cgaatgcctctgggtc 310
           ||||||||||||||||
Sbjct: 691 cgaatgcctctgggtc 676



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 119/144 (82%)
 Strand = Plus / Minus

                                                                       
Query: 464 gctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaa 523
           ||||||||| || | ||| ||||| || || ||||||||||| || || || ||||||||
Sbjct: 519 gctagggtttcccaagtaatcgagccctccatcgctgaagatctgtgaaccggccttgaa 460

                                                                       
Query: 524 ccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
           ||| || ||||| |||||||||||||| || |  || | |||||| ||||||||||| ||
Sbjct: 459 ccaaaccgcctctccgaacttgactccgtttctagccaaaagctcagggaagacgcagcc 400

                                   
Query: 584 gagcgcaccgagcatggcccacct 607
            || || |||||||||||||||||
Sbjct: 399 tagggctccgagcatggcccacct 376



to top

>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein
           (At1g29930) mRNA, complete cds
          Length = 835

 Score =  127 bits (64), Expect = 5e-26
 Identities = 163/196 (83%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| |||||||||||||| ||||| || ||||||||||||||||| || |||||||
Sbjct: 805 ctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcgg 746

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | | |||||||||||||||||| |  || ||||| || ||||| || || || |||||||
Sbjct: 745 ccaaatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaaga 686

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | |||||||| |||||||| || |  |  || ||||||| ||| || ||||| | ||| |
Sbjct: 685 atccaaacatagagaacatagccaatcttccgttcttgagctccttcaccttcaactcag 626

                           
Query: 295 cgaatgcctctgggtc 310
           ||||||||||||||||
Sbjct: 625 cgaatgcctctgggtc 610



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 119/144 (82%)
 Strand = Plus / Minus

                                                                       
Query: 464 gctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaa 523
           ||||||||| || | ||| ||||| || || ||||||||||| || || || ||||||||
Sbjct: 453 gctagggtttcccaagtaatcgagccctccatcgctgaagatctgtgaaccggccttgaa 394

                                                                       
Query: 524 ccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
           ||| || ||||| |||||||||||||| || |  || | |||||| ||||||||||| ||
Sbjct: 393 ccaaaccgcctctccgaacttgactccgtttctagccaaaagctcagggaagacgcagcc 334

                                   
Query: 584 gagcgcaccgagcatggcccacct 607
            || || |||||||||||||||||
Sbjct: 333 tagggctccgagcatggcccacct 310



to top

>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At1g29930) mRNA, complete cds
          Length = 1014

 Score =  127 bits (64), Expect = 5e-26
 Identities = 163/196 (83%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| |||||||||||||| ||||| || ||||||||||||||||| || |||||||
Sbjct: 871 ctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcgg 812

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | | |||||||||||||||||| |  || ||||| || ||||| || || || |||||||
Sbjct: 811 ccaaatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaaga 752

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | |||||||| |||||||| || |  |  || ||||||| ||| || ||||| | ||| |
Sbjct: 751 atccaaacatagagaacatagccaatcttccgttcttgagctccttcaccttcaactcag 692

                           
Query: 295 cgaatgcctctgggtc 310
           ||||||||||||||||
Sbjct: 691 cgaatgcctctgggtc 676



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 119/144 (82%)
 Strand = Plus / Minus

                                                                       
Query: 464 gctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaa 523
           ||||||||| || | ||| ||||| || || ||||||||||| || || || ||||||||
Sbjct: 519 gctagggtttcccaagtaatcgagccctccatcgctgaagatctgtgaaccggccttgaa 460

                                                                       
Query: 524 ccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
           ||| || ||||| |||||||||||||| || |  || | |||||| ||||||||||| ||
Sbjct: 459 ccaaaccgcctctccgaacttgactccgtttctagccaaaagctcagggaagacgcagcc 400

                                   
Query: 584 gagcgcaccgagcatggcccacct 607
            || || |||||||||||||||||
Sbjct: 399 tagggctccgagcatggcccacct 376



to top

>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1019

 Score =  127 bits (64), Expect = 5e-26
 Identities = 163/196 (83%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| |||||||||||||| ||||| || ||||||||||||||||| || |||||||
Sbjct: 871 ctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcgg 812

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | | |||||||||||||||||| |  || ||||| || ||||| || || || |||||||
Sbjct: 811 ccaaatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaaga 752

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | |||||||| |||||||| || |  |  || ||||||| ||| || ||||| | ||| |
Sbjct: 751 atccaaacatagagaacatagccaatcttccgttcttgagctccttcaccttcaactcag 692

                           
Query: 295 cgaatgcctctgggtc 310
           ||||||||||||||||
Sbjct: 691 cgaatgcctctgggtc 676



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 119/144 (82%)
 Strand = Plus / Minus

                                                                       
Query: 464 gctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaa 523
           ||||||||| || | ||| ||||| || || ||||||||||| || || || ||||||||
Sbjct: 519 gctagggtttcccaagtaatcgagccctccatcgctgaagatctgtgaaccggccttgaa 460

                                                                       
Query: 524 ccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
           ||| || ||||| |||||||||||||| || |  || | |||||| ||||||||||| ||
Sbjct: 459 ccaaaccgcctctccgaacttgactccgtttctagccaaaagctcagggaagacgcagcc 400

                                   
Query: 584 gagcgcaccgagcatggcccacct 607
            || || |||||||||||||||||
Sbjct: 399 tagggctccgagcatggcccacct 376



to top

>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1045

 Score =  127 bits (64), Expect = 5e-26
 Identities = 163/196 (83%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| |||||||||||||| ||||| || ||||||||||||||||| || |||||||
Sbjct: 871 ctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcgg 812

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | | |||||||||||||||||| |  || ||||| || ||||| || || || |||||||
Sbjct: 811 ccaaatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaaga 752

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | |||||||| |||||||| || |  |  || ||||||| ||| || ||||| | ||| |
Sbjct: 751 atccaaacatagagaacatagccaatcttccgttcttgagctccttcaccttcaactcag 692

                           
Query: 295 cgaatgcctctgggtc 310
           ||||||||||||||||
Sbjct: 691 cgaatgcctctgggtc 676



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 119/144 (82%)
 Strand = Plus / Minus

                                                                       
Query: 464 gctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaa 523
           ||||||||| || | ||| ||||| || || ||||||||||| || || || ||||||||
Sbjct: 519 gctagggtttcccaagtaatcgagccctccatcgctgaagatctgtgaaccggccttgaa 460

                                                                       
Query: 524 ccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
           ||| || ||||| |||||||||||||| || |  || | |||||| ||||||||||| ||
Sbjct: 459 ccaaaccgcctctccgaacttgactccgtttctagccaaaagctcagggaagacgcagcc 400

                                   
Query: 584 gagcgcaccgagcatggcccacct 607
            || || |||||||||||||||||
Sbjct: 399 tagggctccgagcatggcccacct 376



to top

>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 999

 Score =  127 bits (64), Expect = 5e-26
 Identities = 163/196 (83%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| |||||||||||||| ||||| || ||||||||||||||||| || |||||||
Sbjct: 871 ctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcgg 812

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | | |||||||||||||||||| |  || ||||| || ||||| || || || |||||||
Sbjct: 811 ccaaatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaaga 752

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | |||||||| |||||||| || |  |  || ||||||| ||| || ||||| | ||| |
Sbjct: 751 atccaaacatagagaacatagccaatcttccgttcttgagctccttcaccttcaactcag 692

                           
Query: 295 cgaatgcctctgggtc 310
           ||||||||||||||||
Sbjct: 691 cgaatgcctctgggtc 676



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 119/144 (82%)
 Strand = Plus / Minus

                                                                       
Query: 464 gctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaa 523
           ||||||||| || | ||| ||||| || || ||||||||||| || || || ||||||||
Sbjct: 519 gctagggtttcccaagtaatcgagccctccatcgctgaagatctgtgaaccggccttgaa 460

                                                                       
Query: 524 ccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
           ||| || ||||| |||||||||||||| || |  || | |||||| ||||||||||| ||
Sbjct: 459 ccaaaccgcctctccgaacttgactccgtttctagccaaaagctcagggaagacgcagcc 400

                                   
Query: 584 gagcgcaccgagcatggcccacct 607
            || || |||||||||||||||||
Sbjct: 399 tagggctccgagcatggcccacct 376



to top

>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS89ZA03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score =  127 bits (64), Expect = 5e-26
 Identities = 163/196 (83%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| |||||||||||||| ||||| || ||||||||||||||||| || |||||||
Sbjct: 840 ctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcgg 781

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | | |||||||||||||||||| |  || ||||| || ||||| || || || |||||||
Sbjct: 780 ccaaatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaaga 721

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | |||||||| |||||||| || |  |  || ||||||| ||| || ||||| | ||| |
Sbjct: 720 atccaaacatagagaacatagccaatcttccgttcttgagctccttcaccttcaactcag 661

                           
Query: 295 cgaatgcctctgggtc 310
           ||||||||||||||||
Sbjct: 660 cgaatgcctctgggtc 645



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 119/144 (82%)
 Strand = Plus / Minus

                                                                       
Query: 464 gctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaa 523
           ||||||||| || | ||| ||||| || || ||||||||||| || || || ||||||||
Sbjct: 488 gctagggtttcccaagtaatcgagccctccatcgctgaagatctgtgaaccggccttgaa 429

                                                                       
Query: 524 ccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
           ||| || ||||| |||||||||||||| || |  || | |||||| ||||||||||| ||
Sbjct: 428 ccaaaccgcctctccgaacttgactccgtttctagccaaaagctcagggaagacgcagcc 369

                                   
Query: 584 gagcgcaccgagcatggcccacct 607
            || || |||||||||||||||||
Sbjct: 368 tagggctccgagcatggcccacct 345



to top

>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence,
           complete sequence
          Length = 82053

 Score =  127 bits (64), Expect = 5e-26
 Identities = 163/196 (83%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| |||||||||||||| ||||| || ||||||||||||||||| || |||||||
Sbjct: 751 ctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcgg 692

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | | |||||||||||||||||| |  || ||||| || ||||| || || || |||||||
Sbjct: 691 ccaaatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaaga 632

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | |||||||| |||||||| || |  |  || ||||||| ||| || ||||| | ||| |
Sbjct: 631 atccaaacatagagaacatagccaatcttccgttcttgagctccttcaccttcaactcag 572

                           
Query: 295 cgaatgcctctgggtc 310
           ||||||||||||||||
Sbjct: 571 cgaatgcctctgggtc 556



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 119/144 (82%)
 Strand = Plus / Minus

                                                                       
Query: 464 gctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaa 523
           ||||||||| || | ||| ||||| || || ||||||||||| || || || ||||||||
Sbjct: 399 gctagggtttcccaagtaatcgagccctccatcgctgaagatctgtgaaccggccttgaa 340

                                                                       
Query: 524 ccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
           ||| || ||||| |||||||||||||| || |  || | |||||| ||||||||||| ||
Sbjct: 339 ccaaaccgcctctccgaacttgactccgtttctagccaaaagctcagggaagacgcagcc 280

                                   
Query: 584 gagcgcaccgagcatggcccacct 607
            || || |||||||||||||||||
Sbjct: 279 tagggctccgagcatggcccacct 256



to top

>emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophyll a/b binding protein
          Length = 1109

 Score =  127 bits (64), Expect = 5e-26
 Identities = 163/196 (83%)
 Strand = Plus / Minus

                                                                        
Query: 115  ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
            ||||||| |||||||||||||| ||||| || ||||||||||||||||| || |||||||
Sbjct: 1022 ctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcgg 963

                                                                        
Query: 175  cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
            | | |||||||||||||||||| |  || ||||| || ||||| || || || |||||||
Sbjct: 962  ccaaatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaaga 903

                                                                        
Query: 235  agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
            | |||||||| |||||||| || |  |  || ||||||| ||| || ||||| | ||| |
Sbjct: 902  atccaaacatagagaacatagccaatcttccgttcttgagctccttcaccttcaactcag 843

                            
Query: 295  cgaatgcctctgggtc 310
            ||||||||||||||||
Sbjct: 842  cgaatgcctctgggtc 827



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 118/144 (81%)
 Strand = Plus / Minus

                                                                       
Query: 464 gctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaa 523
           ||||||||| || | ||| ||||| || || ||||||||||| || || || ||||||||
Sbjct: 670 gctagggtttcccaagtaatcgagccctccatcgctgaagatctgtgaaccggccttgaa 611

                                                                       
Query: 524 ccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
           ||| || ||||| |||||||||||||| || |  || | |||||| ||||||||||| ||
Sbjct: 610 ccaaaccgcctctccgaacttgactccgtttctagccaaaagctcagggaagacgcagcc 551

                                   
Query: 584 gagcgcaccgagcatggcccacct 607
            || || |||||||| ||||||||
Sbjct: 550 tagggctccgagcatagcccacct 527



to top

>emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophyll a/b binding protein
          Length = 1060

 Score =  127 bits (64), Expect = 5e-26
 Identities = 163/196 (83%)
 Strand = Plus / Minus

                                                                        
Query: 115  ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
            ||||||| |||||||||||||| || || || |||||||||||||||||||| |||||||
Sbjct: 1011 ctcactttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcgg 952

                                                                        
Query: 175  cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
            | | |||||||||||||||||| |  || ||||| || ||||| || || || |||||||
Sbjct: 951  ccaaatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaaga 892

                                                                        
Query: 235  agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
            | |||||||| |||||||| || |  |  || ||||||| ||| || ||||| | |||||
Sbjct: 891  atccaaacatagagaacatagccaatcttccgttcttgagctccttcaccttcaactccg 832

                            
Query: 295  cgaatgcctctgggtc 310
            |||| |||||||||||
Sbjct: 831  cgaaagcctctgggtc 816



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 117/144 (81%)
 Strand = Plus / Minus

                                                                       
Query: 464 gctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaa 523
           ||||||||| || | ||| ||||| || || ||||| ||||| || || || ||||||||
Sbjct: 659 gctagggtttcccaagtaatcgagtcctccatcgctaaagatctgtgaaccggccttgaa 600

                                                                       
Query: 524 ccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
           ||| || ||||| |||||||||||||| || |  || | |||||| ||||||||||| ||
Sbjct: 599 ccaaaccgcctctccgaacttgactccgttcctagccaaaagctcagggaagacgcagcc 540

                                   
Query: 584 gagcgcaccgagcatggcccacct 607
            || || |||||||| ||||||||
Sbjct: 539 tagggctccgagcatagcccacct 516



to top

>emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB precursor protein
          Length = 928

 Score =  125 bits (63), Expect = 2e-25
 Identities = 117/135 (86%)
 Strand = Plus / Minus

                                                                       
Query: 201 gggcccttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggcaagg 260
           ||||||||||||||||| ||||| ||||||||||| || ||||| |||||||||||||| 
Sbjct: 752 gggcccttgccggtgacgatagcttgcacgaagaacccgaacatagagaacatggcaaga 693

                                                                       
Query: 261 cgcccattcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggctagg 320
           || |||||||||| ||| || ||||| ||||||||||| |   | ||||| ||||| |||
Sbjct: 692 cggccattcttgatctccttcaccttaagctccgcgaaggtaacagggtcgtcggcaagg 633

                          
Query: 321 ccgagcgggtcgaag 335
           |||||||||||||||
Sbjct: 632 ccgagcgggtcgaag 618



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 50/58 (86%), Gaps = 1/58 (1%)
 Strand = Plus / Minus

                                                                     
Query: 566 ctcggggaagacgcatccgagcgcaccgagcatggcccaccttgcagtggatcacctc 623
           ||||||||||||||| || || || |||||||| |||||||  || ||||||||||||
Sbjct: 381 ctcggggaagacgcacccaagagcgccgagcatcgcccacc-ggccgtggatcacctc 325



to top

>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1078

 Score =  123 bits (62), Expect = 8e-25
 Identities = 383/490 (78%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           |||| ||||| || |||||||| |||||  | ||||| ||||||||||||||||| || |
Sbjct: 839 ctcatttgccagggacaaagttggtggcgtaggcccaggcgttgttgttgacagggtcag 780

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           |||| || || || |||||||| ||||| || ||||| || || || ||||| |||||||
Sbjct: 779 cgaggtgatcggcgaggttctctaggggtcctttgcctgtcacgatggcctggacgaaga 720

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | || ||||||||||||||||| |  ||||| ||||| | ||| || ||||| ||||| |
Sbjct: 719 acccgaacatggagaacatggccaaccgcccgttctttagctccttcaccttcagctctg 660

                                                                       
Query: 295 cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtg 354
           |||| || || ||||| || ||    || || ||||||||| ||||||| || || |  |
Sbjct: 659 cgaaagcgtccgggtcgtctgcccaccccagggggtcgaagttgccaccgggataaatgg 600

                                                                       
Query: 355 gatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatga 414
           | |||  |||||| || || || ||||| ||||  ||||| || |||| ||| |||||||
Sbjct: 599 ggtcagtcacctctcccaggggtccacccgcaacacggtagccctcaatggcacccatga 540

                                                                       
Query: 415 gcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgc 474
           | | ||| || |||||| |||| ||||| ||||| ||||| || |  |   | ||| |||
Sbjct: 539 ggatgacctggcatgccaagatggcaagaatgctctgtgcgtggattaaatttgggctgc 480

                                                                       
Query: 475 cgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcct 534
           | |||||||| || || || ||||||||||| || |  || ||||||||||| || ||||
Sbjct: 479 ccaggtagtcaagccctccctcgctgaagatctgagctcccgccttgaaccacaccgcct 420

                                                                       
Query: 535 caccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccga 594
           |||||||||| ||||| || |  ||||| ||||| ||||| ||||| || || ||||| |
Sbjct: 419 caccgaactttactccgtttctggcaaggagctctgggaatacgcagcccagagcaccca 360

                     
Query: 595 gcatggccca 604
            |||||||||
Sbjct: 359 acatggccca 350



to top

>gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb1) mRNA, partial cds
          Length = 414

 Score =  123 bits (62), Expect = 8e-25
 Identities = 170/206 (82%)
 Strand = Plus / Minus

                                                                       
Query: 132 aagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgagatggtcagcaagg 191
           ||||| |||||| | ||||| ||||||||||| || || ||||| || || ||||| |||
Sbjct: 273 aagttggtggcataggcccaggcgttgttgttaacggggtcggccaggtgatcagcgagg 214

                                                                       
Query: 192 ttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaacatggagaac 251
           ||||||| ||| || || |||||||| || |||||||||||||| || |||||||| |||
Sbjct: 213 ttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaaaac 154

                                                                       
Query: 252 atggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcctctgggtca 311
           ||||| |  ||||| ||||||| ||| || ||||| ||||||||||| || || ||||| 
Sbjct: 153 atggccaaccgcccgttcttgatctccttcaccttcagctccgcgaaagcgtcggggtcg 94

                                     
Query: 312 tcggctaggccgagcgggtcgaagct 337
           || || || || ||||||||||||||
Sbjct: 93  tcagcaagtcccagcgggtcgaagct 68



to top

>dbj|AB012639.1| Nicotiana sylvestris Lhcb1*7 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3663

 Score =  123 bits (62), Expect = 8e-25
 Identities = 377/482 (78%)
 Strand = Plus / Minus

                                                                        
Query: 123  ccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgagatgg 182
            ||||| || ||||| |||||| | ||||| || || ||||| || || || || ||||||
Sbjct: 3342 ccggggacgaagtttgtggcatatgcccaagcattattgttaacggggtctgcaagatgg 3283

                                                                        
Query: 183  tcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaac 242
            |||||||||||||| |  || ||||| || ||||| ||||| || || ||||| ||||||
Sbjct: 3282 tcagcaaggttctccaatggaccctttccagtgacgatagcttgaacaaagaatccaaac 3223

                                                                        
Query: 243  atggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcc 302
            ||||||||||| ||||| |  ||||||||||  || ||||| || ||||| || || || 
Sbjct: 3222 atggagaacatagcaagtctgccattcttgatttcctttactttaagctcagcaaaagct 3163

                                                                        
Query: 303  tctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaacc 362
            || |||||||| || || || |  || ||||| || || |||||||| ||||| ||||| 
Sbjct: 3162 tccgggtcatccgcaagacccaatggatcgaaactaccgccagggtaaagtgggtcaaca 3103

                                                                        
Query: 363  acctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgact 422
            |||||||| || || ||||||||||  ||||| || || ||||| ||||| | ||| |||
Sbjct: 3102 acctcaccaagaggcccaccagcaacacggtaaccctcgacggctcccatcaacacaact 3043

                                                                        
Query: 423  tgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtag 482
            || || ||||| || || | |||||||||||| || || |  || |||||||| |  |||
Sbjct: 3042 tggcaagcccaaattgccaagatgctttgtgcgtggaccaaacttgggttgcccaaatag 2983

                                                                        
Query: 483  tcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaac 542
            || || ||||| || || || || || || || || |||||||||||||| |||||||| 
Sbjct: 2982 tcaagtccaccctcactaaaaatctgtgatccagctttgaaccatacagcttcaccgaat 2923

                                                                        
Query: 543  ttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggcc 602
            ||||| || || || || |  ||||| || |||||||| || || || || |||||||||
Sbjct: 2922 ttgacaccgttacgggctaagagctcaggaaagacgcaaccaagagctccaagcatggcc 2863

              
Query: 603  ca 604
            ||
Sbjct: 2862 ca 2861



to top

>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 980

 Score =  121 bits (61), Expect = 3e-24
 Identities = 193/237 (81%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||| ||||| || ||||| |||||||| |||||||| ||||||||||| ||||| ||
Sbjct: 843 tcactttccggggacgaagttggtggcaaaggcccatgcattgttgttgactggatcagc 784

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            | |||||||||||| ||||| |  || ||||| |||||||| |||||||| ||||||||
Sbjct: 783 caaatggtcagcaagattctccaacggtccctttccggtgacgatagcctgaacgaagaa 724

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
            |||||||| |||||||| || |  |  || ||||||| ||| || ||||| | ||||||
Sbjct: 723 tccaaacatagagaacatagccaaccttccgttcttgatctccttcaccttcaactccgc 664

                                                                    
Query: 296 gaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagag 352
           ||| || ||||||||  | || || || | |||||| |||||||| || ||||||||
Sbjct: 663 gaaagcttctgggtcggcagcaagacccaacgggtcaaagctgcctcctgggtagag 607



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                       
Query: 479 gtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcacc 538
           ||||||||| || || ||||||||||| || || || ||||||||||| ||||| || ||
Sbjct: 477 gtagtcgagccctccttcgctgaagatctgtgaaccagccttgaaccaaacagcttctcc 418

                       
Query: 539 gaacttgactcc 550
           |||||| |||||
Sbjct: 417 gaacttcactcc 406



to top

>emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/b binding protein
          Length = 983

 Score =  121 bits (61), Expect = 3e-24
 Identities = 121/141 (85%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||| |||||||||||||| |||||| | |||||||| |||||||||||||| || | 
Sbjct: 815 tcactttccgggaacaaagttggtggcataggcccatgcattgttgttgacagggtcaga 756

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            |||||||||||||||||||| |  || ||||| || ||||||||||| || || |||||
Sbjct: 755 aagatggtcagcaaggttctccaaaggaccctttccagtgacaatagcttgaacaaagaa 696

                                
Query: 236 gccaaacatggagaacatggc 256
            |||||||| |||||||||||
Sbjct: 695 tccaaacatagagaacatggc 675



 Score =  101 bits (51), Expect = 3e-18
 Identities = 174/215 (80%)
 Strand = Plus / Minus

                                                                       
Query: 327 gggtcgaagctgccaccagggtagagtggatcaaccacctcaccgagtgggccaccagca 386
           ||||| ||||| ||||||||||||||||| |||   |||||||| || || |||||||||
Sbjct: 604 gggtcaaagctaccaccagggtagagtgggtcagtgacctcaccaagaggcccaccagca 545

                                                                       
Query: 387 atgcggtacccttcaacggcgcccatgagcacgacttgacatgcccagatagcaaggatg 446
           || ||||| |||||||| || ||||| |  || |||||    ||||| ||||||||||| 
Sbjct: 544 atacggtaaccttcaacagcacccatcaaaacaacttgggtagcccatatagcaaggata 485

                                                                       
Query: 447 ctttgtgcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctgaagatt 506
           ||||| ||||| || |  || ||||| || | |||||| || ||||| || || ||||||
Sbjct: 484 ctttgagcatggaccaaacttgggttacccaagtagtcaagtccaccctcactaaagatt 425

                                              
Query: 507 tgggagcctgccttgaaccatacagcctcaccgaa 541
           || || || ||||||||||||||||| ||||||||
Sbjct: 424 tgtgatccagccttgaaccatacagcttcaccgaa 390



to top

>gb|M34396.1|PMJCABF3 Polystichum munitum chlorophyll a/b-binding protein F3 gene (CABF3),
            complete cds
          Length = 1846

 Score =  121 bits (61), Expect = 3e-24
 Identities = 262/329 (79%)
 Strand = Plus / Minus

                                                                        
Query: 213  gtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgcccattcttg 272
            |||||||| || ||||| |||||||||||||||||||||||||| |  | ||||||||| 
Sbjct: 1360 gtgacaatggcttgcacaaagaagccaaacatggagaacatggccaacctcccattcttc 1301

                                                                        
Query: 273  acctcttttaccttgagctccgcgaatgcctctgggtcatcggctaggccgagcgggtcg 332
            | ||| || ||||| |  || ||||| || || ||||||||||| ||||| || ||||||
Sbjct: 1300 agctccttcaccttcaattcggcgaaggcttcggggtcatcggcaaggccaagggggtcg 1241

                                                                        
Query: 333  aagctgccaccagggtagagtggatcaaccacctcaccgagtgggccaccagcaatgcgg 392
            ||    || ||||||||||  || ||  | |||||||| ||||| ||||||||||  |||
Sbjct: 1240 aatgaccctccagggtagatggggtcctcaacctcaccaagtggcccaccagcaacacgg 1181

                                                                        
Query: 393  tacccttcaacggcgcccatgagcacgacttgacatgcccagatagcaaggatgctttgt 452
            || ||||| || || ||||| |  |  ||||| || ||||||||||| | ||||||||| 
Sbjct: 1180 tatccttccacagcacccatcaagatcacttggcaggcccagatagctaagatgctttga 1121

                                                                        
Query: 453  gcatgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggag 512
            || ||||| ||||| |||||||| | |||||| |  || || ||    ||||| || |||
Sbjct: 1120 gcgtgcacaaggctggggttgcccaagtagtccaaaccgccctccgcaaagatctgcgag 1061

                                         
Query: 513  cctgccttgaaccatacagcctcaccgaa 541
            ||||||||||||||||||||||| |||||
Sbjct: 1060 cctgccttgaaccatacagcctcgccgaa 1032



to top

>emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS93ZB12 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 972

 Score =  119 bits (60), Expect = 1e-23
 Identities = 163/196 (83%), Gaps = 1/196 (0%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| |||||||||||||| |||||||  ||||| |||||||||||||| |||||||
Sbjct: 842 ctcactttccgggaacaaagttggtggcaag-gcccaagcgttgttgttgactggatcgg 784

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | | |||||||||||||||||| |  || ||||| || ||||| || || || |||||||
Sbjct: 783 ccaaatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaaga 724

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | |||||||| |||||||| || |  |  || ||||||| ||| |||||||| | ||| |
Sbjct: 723 atccaaacatagagaacatagccaatcttccgttcttgagctcctttaccttcaactcag 664

                           
Query: 295 cgaatgcctctgggtc 310
           |||| |||||||||||
Sbjct: 663 cgaaggcctctgggtc 648



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 118/144 (81%)
 Strand = Plus / Minus

                                                                       
Query: 464 gctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaa 523
           ||||||||| || | ||| ||||| || || ||||||||||| || || || ||||||||
Sbjct: 491 gctagggtttcccaagtaatcgagccctccatcgctgaagatctgtgaaccagccttgaa 432

                                                                       
Query: 524 ccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
           ||| || ||||| || ||||||||||| || |  || | |||||| ||||||||||| ||
Sbjct: 431 ccaaactgcctctccaaacttgactccgttcctggccaaaagctcagggaagacgcagcc 372

                                   
Query: 584 gagcgcaccgagcatggcccacct 607
            || || |||||||||||||||||
Sbjct: 371 tagggctccgagcatggcccacct 348



to top

>emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b binding protein
          Length = 1011

 Score =  119 bits (60), Expect = 1e-23
 Identities = 132/156 (84%)
 Strand = Plus / Minus

                                                                       
Query: 180 tggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagcca 239
           |||||||| ||||||| || ||||||||||||||| || || ||||||||||||||||| 
Sbjct: 739 tggtcagccaggttctggatggggcccttgccggtcacgatggcctgcacgaagaagccg 680

                                                                       
Query: 240 aacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaat 299
           ||   |||||||||||||||||| || ||||||| ||| || ||||||||||| ||||| 
Sbjct: 679 aagcaggagaacatggcaaggcggccgttcttgatctccttcaccttgagctcagcgaag 620

                                               
Query: 300 gcctctgggtcatcggctaggccgagcgggtcgaag 335
           |  || |||||||| || ||||| || |||||||||
Sbjct: 619 gtgtcggggtcatcagccaggcccagggggtcgaag 584



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                       
Query: 472 tgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacag 531
           |||| |||||||| |||||||| |||  |||||| ||||  || ||||||||||| || |
Sbjct: 447 tgcccaggtagtccaggccaccctcggagaagatctgggcaccggccttgaaccacacgg 388

                           
Query: 532 cctcaccgaacttgac 547
            ||| |||||||||||
Sbjct: 387 gctcgccgaacttgac 372



to top

>emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chlorophyll a/b binding
           protein of photosystem II
          Length = 772

 Score =  119 bits (60), Expect = 1e-23
 Identities = 111/128 (86%)
 Strand = Plus / Minus

                                                                       
Query: 189 aggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaacatggag 248
           ||||| |||| ||||||||||||||| || || ||||||||||||||||| |||||||||
Sbjct: 634 aggttttcgatggggcccttgccggtcacgattgcctgcacgaagaagccgaacatggag 575

                                                                       
Query: 249 aacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcctctggg 308
           ||||| || || ||||| ||||| | ||| || ||||| ||||||||||| |||||||||
Sbjct: 574 aacatcgccagccgcccgttctttagctccttcaccttcagctccgcgaaggcctctggg 515

                   
Query: 309 tcatcggc 316
           || |||||
Sbjct: 514 tcgtcggc 507



to top

>gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds
          Length = 1100

 Score =  119 bits (60), Expect = 1e-23
 Identities = 153/184 (83%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||||||||| ||||| || |||||  | ||||| |||||||||  ||| || ||||
Sbjct: 840 ctcacttgccggggacaaaattggtggcgtatgcccaggcgttgttggcgacggggtcgg 781

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           |||  |||||   || |||||||| |||||||||||||||||| || ||||| |||||||
Sbjct: 780 cgacgtggtcgaaaaagttctcgatggggcccttgccggtgacgatggcctggacgaaga 721

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | || ||||||||||||||||| ||||| || || |||| ||| || ||||||| |||||
Sbjct: 720 aacccaacatggagaacatggcgaggcggccgttattgaactccttcaccttgaactccg 661

               
Query: 295 cgaa 298
           ||||
Sbjct: 660 cgaa 657



to top

>dbj|AB050125.1| Amaranthus tricolor cab1b mRNA for type I chlorophyll a/b-binding
           protein b, partial cds
          Length = 461

 Score =  117 bits (59), Expect = 5e-23
 Identities = 224/279 (80%)
 Strand = Plus / Minus

                                                                       
Query: 275 ctcttttaccttgagctccgcgaatgcctctgggtcatcggctaggccgagcgggtcgaa 334
           |||||||||||| | ||| || ||||| || |||||||| || | ||| | |||||| ||
Sbjct: 414 ctcttttaccttcaactctgcaaatgcatccgggtcatcagccaagcccaacgggtcaaa 355

                                                                       
Query: 335 gctgccaccagggtagagtggatcaaccacctcaccgagtgggccaccagcaatgcggta 394
           ||| ||||| ||||| ||||| || |||||||| || || || ||||||||||| |||||
Sbjct: 354 gctaccacccgggtaaagtgggtccaccacctctccaagaggcccaccagcaatacggta 295

                                                                       
Query: 395 cccttcaacggcgcccatgagcacgacttgacatgcccagatagcaaggatgctttgtgc 454
            || ||||| || ||||| || |  || ||||| ||||| ||||||||||| ||||| ||
Sbjct: 294 accctcaacagcacccattagaataacctgacaagcccaaatagcaaggatactttgggc 235

                                                                       
Query: 455 atgcacgaggctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcc 514
           ||| |  | ||| ||||| || | ||| || || ||||| || ||||||||||| |||||
Sbjct: 234 atggatcaagcttgggttacccaagtaatcaagcccaccttcactgaagatttgtgagcc 175

                                                  
Query: 515 tgccttgaaccatacagcctcaccgaacttgactccatt 553
            ||||||||||| ||||| ||||| ||||| || |||||
Sbjct: 174 cgccttgaaccaaacagcttcaccaaacttaacaccatt 136



to top

>gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 986

 Score =  115 bits (58), Expect = 2e-22
 Identities = 163/198 (82%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           ||||||||||||||| |||||||||||  | ||||| |||||||||   |||||||| ||
Sbjct: 849 tcacttgccgggaacgaagttagtggcgtaagcccaagcgttgttggcaacaggatcagc 790

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            |  |||||  | |||||||| |  ||||||||||||||||| || ||||| ||||||||
Sbjct: 789 aatgtggtcgactaggttctcaactgggcccttgccggtgacgatggcctggacgaagaa 730

                                                                       
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgc 295
            || |||||||||||||| || || |  |||||||||| ||| || ||||||||||| ||
Sbjct: 729 tccgaacatggagaacatagctagccttccattcttgagctccttcaccttgagctcggc 670

                             
Query: 296 gaatgcctctgggtcatc 313
            || ||||| ||||||||
Sbjct: 669 aaaggcctcggggtcatc 652



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 163/200 (81%), Gaps = 1/200 (0%)
 Strand = Plus / Minus

                                                                       
Query: 429 gcccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgagg 488
           |||||||| |||||||||||||| || || || ||| | ||||| || ||||||||||| 
Sbjct: 536 gcccagatcgcaaggatgctttgggcgtggaccaggttggggttccccaggtagtcgagc 477

                                                                       
Query: 489 ccaccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaacttgact 548
           || || ||   |||||| ||||| || ||||||||||| || ||||| ||||||| ||| 
Sbjct: 476 cctccctccgagaagatctgggacccggccttgaaccacaccgcctccccgaactggacc 417

                                                                       
Query: 549 ccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggcccacctt 608
           || ||   ||  || ||||| ||||||||||| ||||| || ||||||||||||||||| 
Sbjct: 416 ccgttcttcgacaggagctccgggaagacgcaaccgagagcgccgagcatggcccacctc 357

                               
Query: 609 gcagtggatcacctcaagct 628
           | ||||||||||||| ||||
Sbjct: 356 g-agtggatcacctccagct 338



to top

>gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b binding protein (LHCPII) gene,
            complete cds
          Length = 2095

 Score =  115 bits (58), Expect = 2e-22
 Identities = 91/102 (89%)
 Strand = Plus / Minus

                                                                        
Query: 191  gttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaacatggagaa 250
            |||||| | ||||||||||||||||||||| |||||||||||||| ||||||||||||||
Sbjct: 1671 gttctcaacggggcccttgccggtgacaatggcctgcacgaagaacccaaacatggagaa 1612

                                                      
Query: 251  catggcaaggcgcccattcttgacctcttttaccttgagctc 292
            ||| || || ||||| ||||||| ||| || |||||||||||
Sbjct: 1611 catagcgagacgcccgttcttgatctccttcaccttgagctc 1570



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                        
Query: 470  gttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatac 529
            |||||| |||||||||||||||||||||  ||| || |||| ||| ||||||||||| ||
Sbjct: 1392 gttgccaaggtagtcgaggccaccgtcggcgaaaatctgggcgccggccttgaaccagac 1333

                          
Query: 530  agcctcaccgaact 543
             |||||||||||||
Sbjct: 1332 ggcctcaccgaact 1319



to top

>gb|M15214.1|TOMCBPH Tomato chlorophyll a/b-binding protein gene Cab-3T, complete cds
          Length = 339

 Score =  113 bits (57), Expect = 7e-22
 Identities = 114/133 (85%)
 Strand = Plus / Minus

                                                                       
Query: 181 ggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaa 240
           |||| ||||||||||| |  || ||||| |||||||||||||| || || ||||||||||
Sbjct: 286 ggtcggcaaggttctccaatggaccctttccggtgacaatagcttgaacaaagaagccaa 227

                                                                       
Query: 241 acatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatg 300
           ||||||||||||| ||||| |  |||||||||| ||||||||||||||||||  | || |
Sbjct: 226 acatggagaacatagcaagtctaccattcttgatctcttttaccttgagctcatcaaaag 167

                        
Query: 301 cctctgggtcatc 313
           | |||||||||||
Sbjct: 166 cttctgggtcatc 154



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgtt 163
           |||||| |||||||||||||| |||||||| |||||  ||||||||||
Sbjct: 339 tcactttccgggaacaaagtttgtggcaaaggcccagacgttgttgtt 292



to top

>emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putative chlorophyll A-B binding
           protein type I
          Length = 684

 Score =  109 bits (55), Expect = 1e-20
 Identities = 115/135 (85%)
 Strand = Plus / Minus

                                                                       
Query: 201 gggcccttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggcaagg 260
           |||||||| || || ||||| ||||||||||||||||| |||||||||||||| || || 
Sbjct: 505 gggcccttcccagtcacaattgcctgcacgaagaagccgaacatggagaacatcgccagc 446

                                                                       
Query: 261 cgcccattcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggctagg 320
           ||||| ||||| | ||| || ||||| ||||||||||| ||||| ||||||||||| || 
Sbjct: 445 cgcccgttcttaatctccttcaccttcagctccgcgaacgcctccgggtcatcggccagc 386

                          
Query: 321 ccgagcgggtcgaag 335
           || || |||||||||
Sbjct: 385 cccagtgggtcgaag 371



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 56/65 (86%), Gaps = 1/65 (1%)
 Strand = Plus / Minus

                                                                       
Query: 564 agctcggggaagacgcatccgagcgcaccgagcatggcccaccttgcagtggatcacctc 623
           ||||| ||||| ||||| |||||||| || | ||||||||| || |||||||||||||||
Sbjct: 142 agctccgggaaaacgcagccgagcgcccccaacatggcccatct-gcagtggatcacctc 84

                
Query: 624 aagct 628
            ||||
Sbjct: 83  cagct 79



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                       
Query: 408 cccatgagcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggcta 467
           ||||||||||| || || || |||||||| || || ||||| ||||| || |  ||| ||
Sbjct: 298 cccatgagcacaacctggcaggcccagatggcgagtatgctctgtgcgtgaatcaggtta 239

                                  
Query: 468 gggttgccgaggtagtcgaggcc 490
           ||||| || ||||||||||||||
Sbjct: 238 gggttccccaggtagtcgaggcc 216



to top

>gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb2) mRNA, partial cds
          Length = 873

 Score =  109 bits (55), Expect = 1e-20
 Identities = 115/135 (85%)
 Strand = Plus / Minus

                                                                       
Query: 201 gggcccttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggcaagg 260
           |||||||| ||||| || || ||||||||||||||||| ||||||||||||||||| || 
Sbjct: 656 gggcccttcccggtcacgattgcctgcacgaagaagccgaacatggagaacatggccagc 597

                                                                       
Query: 261 cgcccattcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggctagg 320
           ||||| ||||| | ||| || ||||| ||||||||||| ||||| ||||| ||||| || 
Sbjct: 596 cgcccgttctttatctccttcacctttagctccgcgaaagcctccgggtcgtcggccagt 537

                          
Query: 321 ccgagcgggtcgaag 335
           || || |||||||||
Sbjct: 536 cccagtgggtcgaag 522



to top

>gb|M86906.1|PEACHLROPH Pea (subclone AB9) Cab9 gene, 3' end
          Length = 1919

 Score =  109 bits (55), Expect = 1e-20
 Identities = 334/427 (78%)
 Strand = Plus / Minus

                                                                       
Query: 130 caaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgagatggtcagcaa 189
           ||||||| |||||| | |||||||| |||||||| || ||||| || || ||||||||||
Sbjct: 571 caaagtttgtggcatatgcccatgcattgttgttcactggatcagccaggtggtcagcaa 512

                                                                       
Query: 190 ggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaacatggaga 249
           | || || |  || || || || || |||||||| || |||||||| |||||||| ||||
Sbjct: 511 gattttctattggtccttttcctgttacaatagcttgaacgaagaatccaaacattgaga 452

                                                                       
Query: 250 acatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcctctgggt 309
           |||| || |  |  |||||||| |  ||||| ||||| | ||| || ||||| |||||  
Sbjct: 451 acatcgctaacctaccattcttcagttctttcaccttcaactctgcaaatgcttctggaa 392

                                                                       
Query: 310 catcggctaggccgagcgggtcgaagctgccaccagggtagagtggatcaaccacctcac 369
             ||||| ||||| |  || || ||||| ||||| ||||| | |||||||||||||||||
Sbjct: 391 tctcggcaaggcctaatggatcaaagctaccacccgggtacaatggatcaaccacctcac 332

                                                                       
Query: 370 cgagtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgacttgacatg 429
           | || || ||||| ||||||||||| ||||| || || ||||| |  |  ||||||  ||
Sbjct: 331 caagaggtccaccggcaatgcggtaaccttccactgctcccattaagataacttgagttg 272

                                                                       
Query: 430 cccagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgaggc 489
           |||| |  | ||| ||||| ||||| || || ||||| ||||| || | |||||| || |
Sbjct: 271 cccataccgtaagaatgctctgtgcgtggacaaggcttgggttacccaagtagtcaagtc 212

                                                                       
Query: 490 caccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaacttgactc 549
           |||| || ||||||||||| || |||||||||||||| || ||||| || || ||||| |
Sbjct: 211 caccctcactgaagatttgtgatcctgccttgaaccacactgcctcgccaaatttgacac 152

                  
Query: 550 cattgcg 556
           | |||||
Sbjct: 151 cgttgcg 145



to top

>gb|AF104631.3| Chlamydomonas reinhardtii light harvesting complex II protein
           precursor (Lhcb3) mRNA, complete cds
          Length = 1314

 Score =  107 bits (54), Expect = 5e-20
 Identities = 117/138 (84%)
 Strand = Plus / Minus

                                                                       
Query: 198 agggggcccttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggca 257
           ||||||||||||||||| || || ||||| ||||||||||| ||||||||||||||||| 
Sbjct: 764 agggggcccttgccggtcacgatggcctggacgaagaagccgaacatggagaacatggcc 705

                                                                       
Query: 258 aggcgcccattcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggct 317
           ||||| || ||||||| ||| || ||||| ||||| ||||| || || ||||| || || 
Sbjct: 704 aggcggccgttcttgatctccttcaccttcagctcagcgaaagcatcggggtcctcagcc 645

                             
Query: 318 aggccgagcgggtcgaag 335
           ||||| || |||||||||
Sbjct: 644 aggcccagggggtcgaag 627



to top

>gb|DQ418483.1| Zingiber officinale chloroplast chlorophyll a/b-binding protein
           mRNA, partial cds; nuclear gene for chloroplast product
          Length = 393

 Score =  107 bits (54), Expect = 5e-20
 Identities = 231/290 (79%)
 Strand = Plus / Minus

                                                                       
Query: 291 tccgcgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtag 350
           |||||||| ||||| || || |||||||| || ||||| |||||||| || || ||||||
Sbjct: 355 tccgcgaaagcctcaggatcgtcggctagacccagcggttcgaagctccctccggggtag 296

                                                                       
Query: 351 agtggatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgccc 410
           || || || |||||||| || || ||||| || || |  |||||||| || |||||||||
Sbjct: 295 agcgggtcgaccacctcccctagcgggccgccggccacacggtacccctccacggcgccc 236

                                                                       
Query: 411 atgagcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctaggg 470
           || ||||| || ||  | ||||| || || |||||||| || || || |  ||||| |||
Sbjct: 235 atcagcaccacctgggacgcccatatggccaggatgctctgcgcgtggatcaggctgggg 176

                                                                       
Query: 471 ttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccataca 530
           ||||||||||| ||||| || || |||  |||||| || || || ||||||||||| || 
Sbjct: 175 ttgccgaggtaatcgagtccgccctcggagaagatctgcgacccggccttgaaccaaacc 116

                                                             
Query: 531 gcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgca 580
           ||||| ||||||||||| || ||||| |  || ||||| |||||||||||
Sbjct: 115 gcctcgccgaacttgacgccgttgcgggagaggagctccgggaagacgca 66



to top

>dbj|AB236867.1| Panax ginseng cab mRNA for chlorophyll a/b binding protein,
           complete cds
          Length = 935

 Score =  107 bits (54), Expect = 5e-20
 Identities = 194/238 (81%), Gaps = 2/238 (0%)
 Strand = Plus / Minus

                                                                       
Query: 408 cccatgagcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggcta 467
           ||||||||||| ||||| |  ||||||||||| |||||||| || ||||| || ||| | 
Sbjct: 528 cccatgagcacaacttggctggcccagatagccaggatgctctgggcatggacaaggttt 469

                                                                       
Query: 468 gggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccat 527
           |||||||| || ||||| |||||||| |||  |||||||||||  || ||||||||||| 
Sbjct: 468 gggttgccaagatagtcaaggccaccttcggagaagatttgggctccggccttgaaccaa 409

                                                                       
Query: 528 acagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagc 587
           || ||||| ||||| ||||| ||||| |  |||||||  || |||||||| || || || 
Sbjct: 408 actgcctcgccgaatttgacaccattccttgcaagaatttcagggaagacacagcctagt 349

                                                                     
Query: 588 gcaccgagcatggcccaccttgcagtggatcacctcaagcttcccggttctttgcaaa 645
           ||||| ||||||||||| | ||| ||||||||| || ||| || |||||||| |||||
Sbjct: 348 gcaccaagcatggcccatc-tgctgtggatcacttcgagc-tcacggttcttggcaaa 293



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 112/138 (81%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||| ||||| ||||||||||||||| | |||||||| ||||||   || || || ||
Sbjct: 820 tcactttccgggtacaaagttagtggcataagcccatgcattgttggctactgggtcagc 761

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            || |||||   ||||||||| |  |||||||| ||||||||||| ||||| || |||||
Sbjct: 760 aaggtggtcgtaaaggttctcaattgggccctttccggtgacaatggcctggacaaagaa 701

                             
Query: 236 gccaaacatggagaacat 253
            |||||||| || |||||
Sbjct: 700 tccaaacatagaaaacat 683



to top

>gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 1096

 Score =  107 bits (54), Expect = 5e-20
 Identities = 105/122 (86%)
 Strand = Plus / Minus

                                                                       
Query: 195 tcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatg 254
           |||| ||||||||||||||| || || ||||||||||||||||| |||||||||||||||
Sbjct: 795 tcgatggggcccttgccggttacgattgcctgcacgaagaagccgaacatggagaacatg 736

                                                                       
Query: 255 gcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcg 314
           || || ||||| ||||| | ||| || ||||| |||||||| || || || |||||||||
Sbjct: 735 gccagccgcccgttctttagctccttcaccttcagctccgcaaacgcttccgggtcatcg 676

             
Query: 315 gc 316
           ||
Sbjct: 675 gc 674



to top

>gb|K00976.1|PETCAB102 Petunia major chlorophyll a/b binding protein (Cab) clone pCab102,
           3' end and flank
          Length = 302

 Score =  105 bits (53), Expect = 2e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 116 tcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggc 175
           |||||| |||||||||||||| |||||||| ||||| || |||||||| || || || ||
Sbjct: 189 tcactttccgggaacaaagtttgtggcaaaggcccacgcattgttgttaacggggtcagc 130

                                                                       
Query: 176 gagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaa 235
            || |||||||| |||||||| |  || || || || ||||||||||| ||||| |||||
Sbjct: 129 aaggtggtcagcgaggttctccaatggaccttttccagtgacaatagcttgcacaaagaa 70

                                                                    
Query: 236 gccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctc 292
            |||||||||||||||   ||||| |  |||||||||| ||| || |||||||||||
Sbjct: 69  tccaaacatggagaacgcagcaagtctaccattcttgatctccttcaccttgagctc 13



to top

>gb|M16887.1|SIPCAB White campion chlorophyll a/b-binding protein precursor (CAB) mRNA,
           partial cds
          Length = 642

 Score =  105 bits (53), Expect = 2e-19
 Identities = 207/257 (80%), Gaps = 1/257 (0%)
 Strand = Plus / Minus

                                                                       
Query: 372 agtgggccaccagcaatgcggtacccttcaacggcgcccatgagcacgacttgacatgcc 431
           |||||||| ||| |||  ||||||||||| || ||||||||||| || ||||| || |||
Sbjct: 566 agtgggccgccaccaacacggtacccttcgacagcgcccatgaggacaacttggcaagcc 507

                                                                       
Query: 432 cagatagcaaggatgctttgtgcatgcacgaggctagggttgccgaggtagtcgaggcca 491
           ||||| || || ||||| || ||||| || ||| | |||||||| |||||||| || |||
Sbjct: 506 cagatggctagaatgctctgagcatggaccaggtttgggttgccaaggtagtcaagacca 447

                                                                       
Query: 492 ccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaacttgactcca 551
           || ||   ||| || || || |||||||||||||| || ||||| || || |||||||| 
Sbjct: 446 ccctcttggaatatctgagaccctgccttgaaccaaactgcctctccaaatttgactccg 387

                                                                       
Query: 552 ttgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggcccaccttgca 611
           ||    || || ||||||||||| |||||||| || ||||| ||||| ||||| | ||||
Sbjct: 386 ttcttagccaggagctcggggaaaacgcatccaagggcaccaagcattgcccatc-tgca 328

                            
Query: 612 gtggatcacctcaagct 628
           |||||||||||| ||||
Sbjct: 327 gtggatcacctctagct 311



to top

>gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein of PS II mRNA, partial
           cds
          Length = 551

 Score =  105 bits (53), Expect = 2e-19
 Identities = 244/308 (79%)
 Strand = Plus / Minus

                                                                       
Query: 147 gcccatgcgttgttgttgacaggatcggcgagatggtcagcaaggttctcgagggggccc 206
           ||||| |||||||||||||| || ||||| || || || || ||||| |||||||| || 
Sbjct: 365 gcccaggcgttgttgttgacggggtcggccaggtgatcggcgaggttntcgaggggtcct 306

                                                                       
Query: 207 ttgccggtgacaatagcctgcacgaagaagccaaacatggagaacatggcaaggcgccca 266
           ||||| || || || ||||| |||||||| || ||||||||||||||||| |  ||||| 
Sbjct: 305 ttgcccgtcacgatggcctggacgaagaacccgaacatggagaacatggccaaccgcccg 246

                                                                       
Query: 267 ttcttgacctcttttaccttgagctccgcgaatgcctctgggtcatcggctaggccgagc 326
           ||||| | ||| || ||||| ||||| ||||| || || ||||| || || |  || || 
Sbjct: 245 ttctttagctccttcaccttcagctctgcgaaagcgtccgggtcgtctgccaaccccagg 186

                                                                       
Query: 327 gggtcgaagctgccaccagggtagagtggatcaaccacctcaccgagtgggccaccagca 386
           ||||||||| ||||||| || || |  || |||  |||||| || || || ||||| |||
Sbjct: 185 gggtcgaagttgccaccgggataaatggggtcagtcacctctcccaggggtccacccgca 126

                                                                       
Query: 387 atgcggtacccttcaacggcgcccatgagcacgacttgacatgcccagatagcaaggatg 446
           |  ||||| || |||| ||| |||||||| | ||| || ||||||||||| ||||| |||
Sbjct: 125 acacggtagccctcaatggcacccatgaggatgacctggcatgcccagatggcaagaatg 66

                   
Query: 447 ctttgtgc 454
           ||||||||
Sbjct: 65  ctttgtgc 58



to top

>gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence
          Length = 827

 Score =  103 bits (52), Expect = 7e-19
 Identities = 121/144 (84%)
 Strand = Plus / Minus

                                                                       
Query: 464 gctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaa 523
           ||||||||| || | ||| ||||| || || |||||||||||||| || |||||||||||
Sbjct: 281 gctagggtttcccaagtaatcgagccctccatcgctgaagatttgtgaacctgccttgaa 222

                                                                       
Query: 524 ccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatcc 583
           ||| || ||||| |||||||||||||| || |  || | |||||| ||||||||||| ||
Sbjct: 221 ccaaaccgcctctccgaacttgactccgttcctggccaaaagctcagggaagacgcagcc 162

                                   
Query: 584 gagcgcaccgagcatggcccacct 607
            || || |||||||||||||||||
Sbjct: 161 tagggctccgagcatggcccacct 138



 Score =  101 bits (51), Expect = 3e-18
 Identities = 117/139 (84%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| |||||||||||||| ||||| || ||||||||||||||||| || |||||||
Sbjct: 633 ctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcgg 574

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | | |||||||||||| ||||| |  || ||||| || ||||| || || || || ||||
Sbjct: 573 ccaaatggtcagcaagattctccaacggtcccttaccagtgacgatggcttgaacaaaga 514

                              
Query: 235 agccaaacatggagaacat 253
           | |||||||| ||||||||
Sbjct: 513 atccaaacatagagaacat 495



to top

>gb|AF295639.1| Beta vulgaris chlorophyll a/b binding protein (cab) gene, partial
           cds, nuclear gene for chloroplast product
          Length = 507

 Score =  101 bits (51), Expect = 3e-18
 Identities = 281/355 (79%), Gaps = 2/355 (0%)
 Strand = Plus / Minus

                                                                       
Query: 294 gcgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggtagagt 353
           ||||| |||||||||||||| || | ||| |  || || ||||| ||||||||||| |||
Sbjct: 397 gcgaaggcctctgggtcatcagccaagcccaatggatcaaagctaccaccagggtaaagt 338

                                                                       
Query: 354 ggatcaaccacctcaccgagtgggccaccagcaatgcggtacccttcaacggcgcccatg 413
           ||||| ||||||||||| ||||| ||||| ||||  || || || |||||||| ||||| 
Sbjct: 337 ggatctaccacctcaccaagtggaccacctgcaacacgatagccctcaacggcacccatc 278

                                                                       
Query: 414 agcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggctagggttg 473
           |  |  || || || ||||| |||||||| || |||||||| || || |  || ||||| 
Sbjct: 277 aaaataacctggcaagcccaaatagcaagaatactttgtgcgtgtaccaaacttgggtta 218

                                                                       
Query: 474 ccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccatacagcc 533
           || | |||||| || ||||| || || |||||||| || |||||||||||||| ||||||
Sbjct: 217 cccaagtagtcaagtccaccctcactaaagatttgtgatcctgccttgaaccaaacagcc 158

                                                                       
Query: 534 tcaccgaacttgactccattgcgcgcaagaagctcggggaagacgcatccgagcgcaccg 593
           || || ||||| || |||||||| || |  | ||| ||||| || || || |  || || 
Sbjct: 157 tcgccaaacttaacaccattgcgggctaacaactctgggaatacacaacctaatgcgccc 98

                                                                  
Query: 594 agcatggcccaccttgcagtggatcacctcaagcttcccggttctttgcaaaggt 648
           | ||||||||| || ||| ||||||||||||||| || |||||||| ||||||||
Sbjct: 97  aacatggcccatct-gcaatggatcacctcaagc-tcacggttcttggcaaaggt 45



to top

>gb|AY219853.1| Nicotiana tabacum chlorophyll a/b binding protein mRNA, complete
           cds
          Length = 946

 Score =  101 bits (51), Expect = 3e-18
 Identities = 114/135 (84%)
 Strand = Plus / Minus

                                                                       
Query: 407 gcccatgagcacgacttgacatgcccagatagcaaggatgctttgtgcatgcacgaggct 466
           |||||| || || ||||| |||||||| ||||| ||||||||||| ||||| || ||| |
Sbjct: 566 gcccattaggacaacttggcatgcccaaatagcgaggatgctttgggcatggacaaggtt 507

                                                                       
Query: 467 agggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaacca 526
            ||||||||||||||||| || ||||| ||   |||||||||||  ||||||||||||||
Sbjct: 506 tgggttgccgaggtagtcaagtccaccttccgagaagatttgggctcctgccttgaacca 447

                          
Query: 527 tacagcctcaccgaa 541
            ||||| ||||||||
Sbjct: 446 aacagcttcaccgaa 432



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 116 tcacttgccgggaacaaagttagtggcaaacgccca 151
           |||||| ||||| ||||||||||||||||| |||||
Sbjct: 857 tcactttccgggtacaaagttagtggcaaaagccca 822



to top

>gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting complex II protein
           (Lhcb) mRNA, complete cds; nuclear gene for chloroplast
           product
          Length = 1024

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 95/110 (86%)
 Strand = Plus / Minus

                                                                       
Query: 189 aggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaacatggag 248
           |||||||  ||||||||||||||||| || || ||||| ||||||||||| |||||||||
Sbjct: 721 aggttctgcagggggcccttgccggtcacgatggcctgaacgaagaagccgaacatggag 662

                                                             
Query: 249 aacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaa 298
           |||||||| ||||| || ||||||| ||| || ||||| ||||| |||||
Sbjct: 661 aacatggccaggcggccgttcttgatctccttcaccttcagctcagcgaa 612



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 564 agctcggggaagacgcatccgagcgcaccgagcatggccca 604
           ||||||||||||| ||| || || || ||||||||||||||
Sbjct: 346 agctcggggaagatgcagcccagagcgccgagcatggccca 306



to top

>gb|AF495473.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
            m1 gene, complete cds; nuclear gene for chloroplast
            product
          Length = 1934

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 95/110 (86%)
 Strand = Plus / Minus

                                                                        
Query: 189  aggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaacatggag 248
            |||||||  ||||||||||||||||| || || ||||| ||||||||||| |||||||||
Sbjct: 1429 aggttctgcagggggcccttgccggtcacgatggcctgaacgaagaagccgaacatggag 1370

                                                              
Query: 249  aacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaa 298
            |||||||| ||||| || ||||||| ||| || ||||| ||||| |||||
Sbjct: 1369 aacatggccaggcggccgttcttgatctccttcaccttcagctcagcgaa 1320



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 564 agctcggggaagacgcatccgagcgcaccgagcatggccca 604
           ||||||||||||| ||| || || || ||||||||||||||
Sbjct: 906 agctcggggaagatgcagcccagagcgccgagcatggccca 866



to top

>gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m7 (Lhcbm7) mRNA, complete cds
          Length = 1016

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 95/110 (86%)
 Strand = Plus / Minus

                                                                       
Query: 189 aggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaacatggag 248
           ||||||| || ||||||||||||||| || || ||||| ||||||||||| |||||||||
Sbjct: 718 aggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatggag 659

                                                             
Query: 249 aacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaa 298
           |||||||| ||||| || ||||||| ||| || ||||| ||||| |||||
Sbjct: 658 aacatggccaggcggccgttcttgatctccttcaccttcagctcagcgaa 609



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Minus

                                                                       
Query: 468 gggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccat 527
           |||||||| |||||||| ||||| || ||   |||||| |||| ||| ||||||||||| 
Sbjct: 436 gggttgcccaggtagtccaggccgccctcagagaagatctgggcgccggccttgaaccag 377

                           
Query: 528 acagcctcaccgaact 543
           |||||||| |||||||
Sbjct: 376 acagcctcgccgaact 361



to top

>gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m10 (Lhcbm10) mRNA, complete cds
          Length = 1077

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 95/110 (86%)
 Strand = Plus / Minus

                                                                       
Query: 189 aggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaacatggag 248
           ||||||| || ||||||||||||||| || || ||||| ||||||||||| |||||||||
Sbjct: 719 aggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatggag 660

                                                             
Query: 249 aacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaa 298
           |||||||| ||||| || ||||||| ||| || ||||| ||||| |||||
Sbjct: 659 aacatggccaggcggccgttcttgatctccttcaccttcagctcagcgaa 610



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Minus

                                                                       
Query: 468 gggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccat 527
           |||||||| |||||||| ||||| || ||   |||||| |||| ||| ||||||||||| 
Sbjct: 440 gggttgcccaggtagtccaggccgccctcagagaagatctgggcgccggccttgaaccag 381

                           
Query: 528 acagcctcaccgaact 543
           |||||||| |||||||
Sbjct: 380 acagcctcgccgaact 365



to top

>gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvesting chlorophyll-a/b
           binding protein (LhcII-1.3) mRNA, complete cds; nuclear
           gene for chloroplast product
          Length = 1100

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 95/110 (86%)
 Strand = Plus / Minus

                                                                       
Query: 189 aggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaacatggag 248
           ||||||| || ||||||||||||||| || || ||||| ||||||||||| |||||||||
Sbjct: 713 aggttctggacggggcccttgccggtcacgatggcctggacgaagaagccgaacatggag 654

                                                             
Query: 249 aacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaa 298
           |||||||| ||||| || ||||||| ||| || ||||| ||||| |||||
Sbjct: 653 aacatggccaggcggccgttcttgatctccttcaccttcagctcagcgaa 604



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 468 gggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccat 527
           |||||||| |||||||| ||||| || |||  |||||| |||| ||| ||||||||||| 
Sbjct: 434 gggttgcccaggtagtccaggccgccctcggagaagatctgggcgccggccttgaaccag 375

                           
Query: 528 acagcctcaccgaact 543
           |||||||| |||||||
Sbjct: 374 acagcctcgccgaact 359



to top

>emb|BX814964.1|CNS0AE8Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS20ZE02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 307

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 74/82 (90%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| |||||||||||||| ||||| || ||||||||||||||||| || |||||||
Sbjct: 175 ctcactttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcgg 116

                                 
Query: 175 cgagatggtcagcaaggttctc 196
           | | ||||||||||||||||||
Sbjct: 115 ccaaatggtcagcaaggttctc 94



to top

>dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-4, complete cds
          Length = 988

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 95/110 (86%)
 Strand = Plus / Minus

                                                                       
Query: 189 aggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaacatggag 248
           |||||||  ||||||||||||||||| || || ||||| ||||||||||| |||||||||
Sbjct: 705 aggttctgcagggggcccttgccggtcacgatggcctgaacgaagaagccgaacatggag 646

                                                             
Query: 249 aacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaa 298
           |||||||| ||||| || ||||||| ||| || ||||| ||||| |||||
Sbjct: 645 aacatggccaggcggccgttcttgatctccttcaccttcagctcagcgaa 596



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 564 agctcggggaagacgcatccgagcgcaccgagcatggccca 604
           ||||||||||||| ||| || || || ||||||||||||||
Sbjct: 330 agctcggggaagatgcagcccagagcgccgagcatggccca 290



to top

>dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-1.3, complete cds
          Length = 1107

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 95/110 (86%)
 Strand = Plus / Minus

                                                                       
Query: 189 aggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaacatggag 248
           ||||||| || ||||||||||||||| || || ||||| ||||||||||| |||||||||
Sbjct: 747 aggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatggag 688

                                                             
Query: 249 aacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaa 298
           |||||||| ||||| || ||||||| ||| || ||||| ||||| |||||
Sbjct: 687 aacatggccaggcggccgttcttgatctccttcaccttcagctcagcgaa 638



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Minus

                                                                       
Query: 468 gggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccat 527
           |||||||| |||||||| ||||| || ||   |||||| |||| ||| ||||||||||| 
Sbjct: 468 gggttgcccaggtagtccaggccgccctcagagaagatctgggcgccggccttgaaccag 409

                           
Query: 528 acagcctcaccgaact 543
           |||||||| |||||||
Sbjct: 408 acagcctcgccgaact 393



to top

>dbj|AB051206.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
            binding protein LhcII-4, complete cds
          Length = 1781

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 95/110 (86%)
 Strand = Plus / Minus

                                                                        
Query: 189  aggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaacatggag 248
            |||||||  ||||||||||||||||| || || ||||| ||||||||||| |||||||||
Sbjct: 1342 aggttctgcagggggcccttgccggtcacgatggcctgaacgaagaagccgaacatggag 1283

                                                              
Query: 249  aacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaa 298
            |||||||| ||||| || ||||||| ||| || ||||| ||||| |||||
Sbjct: 1282 aacatggccaggcggccgttcttgatctccttcaccttcagctcagcgaa 1233



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 564 agctcggggaagacgcatccgagcgcaccgagcatggccca 604
           ||||||||||||| ||| || || || ||||||||||||||
Sbjct: 819 agctcggggaagatgcagcccagagcgccgagcatggccca 779



to top

>dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
            binding protein LhcII-1.3, complete cds
          Length = 1835

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 95/110 (86%)
 Strand = Plus / Minus

                                                                        
Query: 189  aggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaacatggag 248
            ||||||| || ||||||||||||||| || || ||||| ||||||||||| |||||||||
Sbjct: 1589 aggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatggag 1530

                                                              
Query: 249  aacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaa 298
            |||||||| ||||| || ||||||| ||| || ||||| ||||| |||||
Sbjct: 1529 aacatggccaggcggccgttcttgatctccttcaccttcagctcagcgaa 1480



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Minus

                                                                        
Query: 468  gggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgccttgaaccat 527
            |||||||| |||||||| ||||| || ||   |||||| |||| ||| ||||||||||| 
Sbjct: 1096 gggttgcccaggtagtccaggccgccctcagagaagatctgggcgccggccttgaaccag 1037

                            
Query: 528  acagcctcaccgaact 543
            |||||||| |||||||
Sbjct: 1036 acagcctcgccgaact 1021



to top

>gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative chlorophyll a/b-binding
           protein mRNA, complete cds
          Length = 1118

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 171/212 (80%)
 Strand = Plus / Minus

                                                                       
Query: 126 ggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcggcgagatggtca 185
           ||||||||||| |||||| | ||||| ||||| ||||| || || || || || ||||| 
Sbjct: 877 ggaacaaagttggtggcataagcccaggcgttattgttcaccgggtcagcaaggtggtcg 818

                                                                       
Query: 186 gcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaagaagccaaacatg 245
           || | |||||| || || ||||| || |||||||| ||||||||||| || |||||||| 
Sbjct: 817 gccaagttctccagcggaccctttccagtgacaatcgcctgcacgaaaaaaccaaacata 758

                                                                       
Query: 246 gagaacatggcaaggcgcccattcttgacctcttttaccttgagctccgcgaatgcctct 305
           |||||||| || || |  |||||||| | ||| || ||||| ||||| || || ||||| 
Sbjct: 757 gagaacattgccagcctaccattctttaactccttcaccttcagctcagcaaaggcctcg 698

                                           
Query: 306 gggtcatcggctaggccgagcgggtcgaagct 337
           ||||| ||||| | ||| ||||||||||||||
Sbjct: 697 gggtcgtcggccaagcccagcgggtcgaagct 666



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 183/230 (79%), Gaps = 1/230 (0%)
 Strand = Plus / Minus

                                                                       
Query: 399 tcaacggcgcccatgagcacgacttgacatgcccagatagcaaggatgctttgtgcatgc 458
           ||||| ||||||||||| || ||||||  |||||||||||| | ||||||||| ||||| 
Sbjct: 604 tcaacagcgcccatgaggacaacttgaactgcccagatagccaagatgctttgagcatgg 545

                                                                       
Query: 459 acgaggctagggttgccgaggtagtcgaggccaccgtcgctgaagatttgggagcctgcc 518
           |  | | | ||||| || |  || || || ||||| ||||||||||| || || || || 
Sbjct: 544 atcaagtttgggttacccaaataatcaagcccaccctcgctgaagatctgagaaccagct 485

                                                                       
Query: 519 ttgaaccatacagcctcaccgaacttgactccattgcgcgcaagaagctcggggaagacg 578
           |||||||| || ||||| || ||||| || |||||||| || | |||||| ||||||| |
Sbjct: 484 ttgaaccacaccgcctcgccaaactttacgccattgcgagccaaaagctctgggaagatg 425

                                                             
Query: 579 catccgagcgcaccgagcatggcccaccttgcagtggatcacctcaagct 628
           || || || ||||| | ||||||||||| || ||||||| ||||| ||||
Sbjct: 424 caacccagtgcacccaacatggcccaccgtg-agtggatgacctccagct 376



to top

>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1)
           mRNA, complete cds
          Length = 1008

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 188/235 (80%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
           ||||||| ||||| || ||||| || || || |||||||| ||||||||||| ||||| |
Sbjct: 864 ctcactttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 805

                                                                       
Query: 175 cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
           | |  ||||| || |||||||| |  || ||||| ||||||||||| ||||| |||||||
Sbjct: 804 ccaagtggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaaga 745

                                                                       
Query: 235 agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
           | |||||||| |||||||| || |  |  || ||||||| ||| || ||||| | |||||
Sbjct: 744 atccaaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactccg 685

                                                                  
Query: 295 cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggta 349
           |||| ||||| ||||||   || ||||| |  ||||||||||| ||||| |||||
Sbjct: 684 cgaaagcctcggggtcagtagcgaggcccaatgggtcgaagctcccacctgggta 630



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 91/113 (80%)
 Strand = Plus / Minus

                                                                       
Query: 492 ccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaacttgactcca 551
           |||||||||||||| || || || ||||||||||| || || || |||||||| ||||| 
Sbjct: 484 ccgtcgctgaagatctgtgaaccagccttgaaccaaaccgcttctccgaacttcactccg 425

                                                                
Query: 552 ttgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggccca 604
           || |  || |  ||||| ||||| ||||| || || || ||||||||||||||
Sbjct: 424 ttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggccca 372



to top

>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.3 mRNA, complete cds
          Length = 3299

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 188/235 (80%)
 Strand = Plus / Plus

                                                                        
Query: 115  ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
            ||||||| ||||| || ||||| ||||| || ||||| |||||||||||||| || ||||
Sbjct: 2484 ctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcgg 2543

                                                                        
Query: 175  cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
            | | |||||| || |||||||| |  || ||||| |||||||| || || || |||||||
Sbjct: 2544 ccaaatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaaga 2603

                                                                        
Query: 235  agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
            | |||||||| |||||||| || |  |  || ||||||| ||| || ||||| | ||| |
Sbjct: 2604 atccaaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactctg 2663

                                                                   
Query: 295  cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggta 349
            |||| ||||| ||||||   || ||||| |  ||||||||||||||||| |||||
Sbjct: 2664 cgaaagcctcggggtcagtagcgaggcccaatgggtcgaagctgccacctgggta 2718



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 91/113 (80%)
 Strand = Plus / Plus

                                                                        
Query: 492  ccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaacttgactcca 551
            |||||||||||||| || || || ||||||||||| || || || |||||||| ||||| 
Sbjct: 2825 ccgtcgctgaagatctgtgaaccggccttgaaccaaaccgcttctccgaacttcactccg 2884

                                                                 
Query: 552  ttgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggccca 604
            || |  || |  ||||| ||||| ||||| || || || ||||||||||||||
Sbjct: 2885 ttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggccca 2937



to top

>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.2 mRNA, complete cds
          Length = 3338

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 188/235 (80%)
 Strand = Plus / Plus

                                                                        
Query: 115  ctcacttgccgggaacaaagttagtggcaaacgcccatgcgttgttgttgacaggatcgg 174
            ||||||| ||||| || ||||| ||||| || ||||| |||||||||||||| || ||||
Sbjct: 2484 ctcactttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcgg 2543

                                                                        
Query: 175  cgagatggtcagcaaggttctcgagggggcccttgccggtgacaatagcctgcacgaaga 234
            | | |||||| || |||||||| |  || ||||| |||||||| || || || |||||||
Sbjct: 2544 ccaaatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaaga 2603

                                                                        
Query: 235  agccaaacatggagaacatggcaaggcgcccattcttgacctcttttaccttgagctccg 294
            | |||||||| |||||||| || |  |  || ||||||| ||| || ||||| | ||| |
Sbjct: 2604 atccaaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactctg 2663

                                                                   
Query: 295  cgaatgcctctgggtcatcggctaggccgagcgggtcgaagctgccaccagggta 349
            |||| ||||| ||||||   || ||||| |  ||||||||||||||||| |||||
Sbjct: 2664 cgaaagcctcggggtcagtagcgaggcccaatgggtcgaagctgccacctgggta 2718



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 91/113 (80%)
 Strand = Plus / Plus

                                                                        
Query: 492  ccgtcgctgaagatttgggagcctgccttgaaccatacagcctcaccgaacttgactcca 551
            |||||||||||||| || || || ||||||||||| || || || |||||||| ||||| 
Sbjct: 2864 ccgtcgctgaagatctgtgaaccggccttgaaccaaaccgcttctccgaacttcactccg 2923

                                                                 
Query: 552  ttgcgcgcaagaagctcggggaagacgcatccgagcgcaccgagcatggccca 604
            || |  || |  ||||| ||||| ||||| || || || ||||||||||||||
Sbjct: 2924 ttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggccca 2976


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,010,251
Number of Sequences: 3902068
Number of extensions: 4010251
Number of successful extensions: 69744
Number of sequences better than 10.0: 441
Number of HSP's better than 10.0 without gapping: 439
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 68147
Number of HSP's gapped (non-prelim): 1198
length of query: 649
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 626
effective length of database: 17,143,297,704
effective search space: 10731704362704
effective search space used: 10731704362704
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top