ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags21h19
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|BX640780.1|HSM806865 Homo sapiens mRNA; cDNA DKFZp686M11210 ... 42 0.27
2gb|U32305.2| Caenorhabditis elegans cosmid B0336, complete sequence 40 1.1
3emb|BX248341.1| Mycobacterium bovis subsp. bovis AF2122/97 compl... 40 1.1
4gb|AF398588.1| Discoderus cordicollis wingless (wg) gene, partia... 40 1.1
5ref|XM_527016.1| PREDICTED: Pan troglodytes similar to FLJ00292 ... 38 4.3
6gb|AC138394.7| Mus musculus chromosome 3, clone RP23-333D8, comp... 38 4.3
7gb|AC158935.4| Mus musculus chromosome 3, clone RP24-180K20, com... 38 4.3
8ref|XM_938912.1| PREDICTED: Homo sapiens TIFA-related protein TI... 38 4.3
9ref|XM_928467.1| PREDICTED: Homo sapiens TIFA-related protein TI... 38 4.3
10gb|AC022092.8| Homo sapiens chromosome 5 clone CTB-138E5, comple... 38 4.3
11dbj|AK131088.1| Homo sapiens mRNA for FLJ00292 protein 38 4.3
12gb|AC151286.4| Mus musculus BAC clone RP23-368B8 from chromosome... 38 4.3

>emb|BX640780.1|HSM806865 Homo sapiens mRNA; cDNA DKFZp686M11210 (from clone DKFZp686M11210)
          Length = 3661

 Score = 42.1 bits (21), Expect = 0.27
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 74  aacctggagcaggtccccctt 94
           |||||||||||||||||||||
Sbjct: 590 aacctggagcaggtccccctt 610



to top

>gb|U32305.2| Caenorhabditis elegans cosmid B0336, complete sequence
          Length = 40214

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 52    aaaacacaccggttttcgcaaaaa 75
             ||||||||||||||| ||||||||
Sbjct: 27773 aaaacacaccggtttccgcaaaaa 27750



to top

>emb|BX248341.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 8/14
          Length = 306050

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 6      tcctcaaatcctacgagcttcaacaaga 33
              |||||||||||| |||||| ||||||||
Sbjct: 276887 tcctcaaatccttcgagctgcaacaaga 276914



to top

>gb|AF398588.1| Discoderus cordicollis wingless (wg) gene, partial cds
          Length = 504

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 64  ttttcgcaaaaacctggagcaggt 87
           ||||||||||||||||||| ||||
Sbjct: 340 ttttcgcaaaaacctggagaaggt 317



to top

>ref|XM_527016.1| PREDICTED: Pan troglodytes similar to FLJ00292 protein (LOC471638),
           mRNA
          Length = 1134

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 75  acctggagcaggtccccct 93
           |||||||||||||||||||
Sbjct: 926 acctggagcaggtccccct 944



to top

>gb|AC138394.7| Mus musculus chromosome 3, clone RP23-333D8, complete sequence
          Length = 227600

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 69    gcaaaaacctggagcaggt 87
             |||||||||||||||||||
Sbjct: 36011 gcaaaaacctggagcaggt 36029



to top

>gb|AC158935.4| Mus musculus chromosome 3, clone RP24-180K20, complete sequence
          Length = 157284

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 69     gcaaaaacctggagcaggt 87
              |||||||||||||||||||
Sbjct: 132310 gcaaaaacctggagcaggt 132328



to top

>ref|XM_938912.1| PREDICTED: Homo sapiens TIFA-related protein TIFAB (TIFAB), mRNA
          Length = 1443

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 75   acctggagcaggtccccct 93
            |||||||||||||||||||
Sbjct: 1235 acctggagcaggtccccct 1253



to top

>ref|XM_928467.1| PREDICTED: Homo sapiens TIFA-related protein TIFAB (TIFAB), mRNA
          Length = 1443

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 75   acctggagcaggtccccct 93
            |||||||||||||||||||
Sbjct: 1235 acctggagcaggtccccct 1253



to top

>gb|AC022092.8| Homo sapiens chromosome 5 clone CTB-138E5, complete sequence
          Length = 102444

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 75    acctggagcaggtccccct 93
             |||||||||||||||||||
Sbjct: 65540 acctggagcaggtccccct 65522



to top

>dbj|AK131088.1| Homo sapiens mRNA for FLJ00292 protein
          Length = 5814

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 75  acctggagcaggtccccct 93
           |||||||||||||||||||
Sbjct: 378 acctggagcaggtccccct 396



to top

>gb|AC151286.4| Mus musculus BAC clone RP23-368B8 from chromosome 17, complete sequence
          Length = 178835

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 21     agcttcaacaagagtacat 39
              |||||||||||||||||||
Sbjct: 132371 agcttcaacaagagtacat 132353


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 763,692
Number of Sequences: 3902068
Number of extensions: 763692
Number of successful extensions: 49445
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 49432
Number of HSP's gapped (non-prelim): 13
length of query: 97
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 76
effective length of database: 17,151,101,840
effective search space: 1303483739840
effective search space used: 1303483739840
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top