ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags21h13 |
|---|---|
| Clone Library Name | barley_pub |
>emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene Length = 1862 Score = 545 bits (275), Expect = e-152 Identities = 302/313 (96%) Strand = Plus / Minus Query: 121 tgtgnaaataacctcaacgtactcagtgtctcaggatcgatagctggagctataggcagc 180 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1459 tgtgtaaataacctcaacgtactcagtgtctcaggatcgatagctggagctataggcagc 1400 Query: 181 aaggatgacagcaagtggtcgatcagcgaatcttagagcagtcgacgntttttntnatgg 240 ||||||||||||||||||||||||||||||||||||||||||||||| | |||| Sbjct: 1399 aaggatgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatgg 1340 Query: 241 cgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcc 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1339 cgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcc 1280 Query: 301 cacccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggngctctgggctg 360 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 1279 cacccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctg 1220 Query: 361 cgccggccagtctctngacgccgctgcagcaggccacaggcggtttggcgccgttgccgc 420 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1219 cgccggccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgc 1160 Query: 421 gggcataggagat 433 ||||||||||||| Sbjct: 1159 gggcataggagat 1147 Score = 79.8 bits (40), Expect = 7e-12 Identities = 40/40 (100%) Strand = Plus / Minus Query: 68 ccacatggagataatatatgagagcatttattcatatata 107 |||||||||||||||||||||||||||||||||||||||| Sbjct: 1512 ccacatggagataatatatgagagcatttattcatatata 1473 Score = 69.9 bits (35), Expect = 7e-09 Identities = 35/35 (100%) Strand = Plus / Minus Query: 1 cgatacaacagtgtgccggccatgcagagctggct 35 ||||||||||||||||||||||||||||||||||| Sbjct: 1580 cgatacaacagtgtgccggccatgcagagctggct 1546
>emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid transfer protein precursor Length = 691 Score = 444 bits (224), Expect = e-121 Identities = 287/310 (92%) Strand = Plus / Minus Query: 121 tgtgnaaataacctcaacgtactcagtgtctcaggatcgatagctggagctataggcagc 180 |||| ||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| Sbjct: 444 tgtgtaaataacctcaacgtactcagcgtctcagcatcgatagctggagctataggcagc 385 Query: 181 aaggatgacagcaagtggtcgatcagcgaatcttagagcagtcgacgntttttntnatgg 240 ||||||||||||||||||||||||||||||||||||||||||||||| | |||| Sbjct: 384 aaggatgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatgg 325 Query: 241 cgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcc 300 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 324 cgtaggggacgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcc 265 Query: 301 cacccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggngctctgggctg 360 |||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| Sbjct: 264 cacccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgcgctg 205 Query: 361 cgccggccagtctctngacgccgctgcagcaggccacaggcggtttggcgccgttgccgc 420 ||||||||| ||||| ||||||||||||||||||| |||| | || |||||||||||| Sbjct: 204 cgccggccaatctcttgacgccgctgcagcaggccggaggcaggatgccgccgttgccgc 145 Query: 421 gggcatagga 430 ||||||||| Sbjct: 144 tggcatagga 135 Score = 79.8 bits (40), Expect = 7e-12 Identities = 40/40 (100%) Strand = Plus / Minus Query: 68 ccacatggagataatatatgagagcatttattcatatata 107 |||||||||||||||||||||||||||||||||||||||| Sbjct: 510 ccacatggagataatatatgagagcatttattcatatata 471 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Minus Query: 1 cgatacaacagtgtgccggccatgcagagctggct 35 ||||||||||| ||| |||||||||||||||||| Sbjct: 574 cgatacaacagagtgttggccatgcagagctggct 540
>emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene Length = 1567 Score = 392 bits (198), Expect = e-106 Identities = 232/245 (94%) Strand = Plus / Minus Query: 189 cagcaagtggtcgatcagcgaatcttagagcagtcgacgntttttntnatggcgtagggg 248 ||||||||||| ||||||||||||||||||||||| ||| | |||||||||||| Sbjct: 1026 cagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtagggg 967 Query: 249 acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 308 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 966 acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 907 Query: 309 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggngctctgggctgcgccggcc 368 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Sbjct: 906 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 847 Query: 369 agtctctngacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 428 ||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 846 agtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 787 Query: 429 gagat 433 ||||| Sbjct: 786 gagat 782
>gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt4.9) gene, complete cds Length = 3238 Score = 392 bits (198), Expect = e-106 Identities = 232/245 (94%) Strand = Plus / Minus Query: 189 cagcaagtggtcgatcagcgaatcttagagcagtcgacgntttttntnatggcgtagggg 248 ||||||||||| ||||||||||||||||||||||| ||| | |||||||||||| Sbjct: 2422 cagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtagggg 2363 Query: 249 acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 308 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2362 acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 2303 Query: 309 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggngctctgggctgcgccggcc 368 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Sbjct: 2302 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 2243 Query: 369 agtctctngacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 428 ||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2242 agtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 2183 Query: 429 gagat 433 ||||| Sbjct: 2182 gagat 2178
>emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA Length = 705 Score = 369 bits (186), Expect = 5e-99 Identities = 229/245 (93%) Strand = Plus / Minus Query: 189 cagcaagtggtcgatcagcgaatcttagagcagtcgacgntttttntnatggcgtagggg 248 ||||||||||| ||||||||||||||||||||||||||| | |||||||||||| Sbjct: 421 cagcaagtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 362 Query: 249 acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 308 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| Sbjct: 361 acgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccagca 302 Query: 309 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggngctctgggctgcgccggcc 368 ||||||||||||||||||||||||||||| |||||||||| ||||||||| ||||||||| Sbjct: 301 gcgctcttgatgcacttgcacgccgcttgtttgtcagcggtgctctgggcagcgccggcc 242 Query: 369 agtctctngacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 428 ||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 241 agtctcttgacgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcatag 182 Query: 429 gagat 433 ||||| Sbjct: 181 gagat 177 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 83 atatgagagcatttattcatatata 107 ||||||||||||||||||||||||| Sbjct: 498 atatgagagcatttattcatatata 474
>gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer protein precursor gene, complete cds Length = 573 Score = 365 bits (184), Expect = 8e-98 Identities = 277/310 (89%) Strand = Plus / Minus Query: 121 tgtgnaaataacctcaacgtactcagtgtctcaggatcgatagctggagctataggcagc 180 |||| ||||||||||||||||||||| ||||||| |||||||||||||||||||||||| Sbjct: 515 tgtgtaaataacctcaacgtactcagcgtctcagcatcgatagctggagctataggcaga 456 Query: 181 aaggatgacagcaagtggtcgatcagcgaatcttagagcagtcgacgntttttntnatgg 240 || || | |||||||||||||||||| |||||||||||||||||||| | | |||| Sbjct: 455 aacgacggcagcaagtggtcgatcagtgaatcttagagcagtcgacggaagtgctgatgg 396 Query: 241 cgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcc 300 |||||||||||||||||||||| |||||||||| |||||||||||||||||||||| || Sbjct: 395 agtaggggacgctgacgccgcacttggaggggatgccggcggccttgccagcgtttaacc 336 Query: 301 cacccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggngctctgggctg 360 || | |||||||||||||||||||||||| |||||||||||||||||| |||||| |||| Sbjct: 335 cagcggcagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctctgcgctg 276 Query: 361 cgccggccagtctctngacgccgctgcagcaggccacaggcggtttggcgccgttgccgc 420 ||||||||| ||||| ||||||||||||||||||| |||| | || |||||||||||| Sbjct: 275 cgccggccaatctcttgacgccgctgcagcaggccggaggcaggatgccgccgttgccgc 216 Query: 421 gggcatagga 430 ||||||||| Sbjct: 215 tggcatagga 206 Score = 60.0 bits (30), Expect = 6e-06 Identities = 33/34 (97%) Strand = Plus / Minus Query: 74 ggagataatatatgagagcatttattcatatata 107 ||||||||||||||||| |||||||||||||||| Sbjct: 573 ggagataatatatgagatcatttattcatatata 540
>emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non specific lipid transfer protein precursor Length = 2122 Score = 236 bits (119), Expect = 5e-59 Identities = 216/250 (86%) Strand = Plus / Minus Query: 184 gatgacagcaagtggtcgatcagcgaatcttagagcagtcgacgntttttntnatggcgt 243 |||| ||||||||| |||||||||||||||||||||||||||| | ||||||| Sbjct: 1636 gatggcagcaagtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgt 1577 Query: 244 aggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccac 303 |||||||||| ||||||||| | | |||||| |||||||||||||||||||| |||||| Sbjct: 1576 aggggacgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccag 1517 Query: 304 ccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggngctctgggctgcgc 363 | ||||||||||||||||||||||||||||||||||||||||||| |||| |||||| || Sbjct: 1516 cagcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctccgggctgagc 1457 Query: 364 cggccagtctctngacgccgctgcagcaggccacaggcggtttggcgccgttgccgcggg 423 ||| || ||| |||||||||||||||||| ||| || |||||||||||||||| | Sbjct: 1456 tggctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgttgccgcgtg 1397 Query: 424 cataggagat 433 |||||||||| Sbjct: 1396 cataggagat 1387 Score = 50.1 bits (25), Expect = 0.006 Identities = 32/33 (96%), Gaps = 1/33 (3%) Strand = Plus / Minus Query: 1 cgatacaacagtgtg-ccggccatgcagagctg 32 ||||||||||||||| ||||||||||||||||| Sbjct: 1814 cgatacaacagtgtggccggccatgcagagctg 1782 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 83 atatgagagcatttattcata 103 ||||||||||||||||||||| Sbjct: 1745 atatgagagcatttattcata 1725
>emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for type 1 non-specific lipid transfer protein precursor (ltp9.2 gene) Length = 604 Score = 228 bits (115), Expect = 1e-56 Identities = 215/250 (86%) Strand = Plus / Minus Query: 184 gatgacagcaagtggtcgatcagcgaatcttagagcagtcgacgntttttntnatggcgt 243 |||| ||||||||| |||||||||||||||||||||||||||| | ||||||| Sbjct: 332 gatggcagcaagtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgt 273 Query: 244 aggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccac 303 | |||||||| ||||||||| | | |||||| |||||||||||||||||||| |||||| Sbjct: 272 aagggacgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccag 213 Query: 304 ccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggngctctgggctgcgc 363 | ||||||||||||||||||||||||||||||||||||||||||| |||| |||||| || Sbjct: 212 cagcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctccgggctgagc 153 Query: 364 cggccagtctctngacgccgctgcagcaggccacaggcggtttggcgccgttgccgcggg 423 ||| || ||| |||||||||||||||||| ||| || |||||||||||||||| | Sbjct: 152 tggctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgttgccgcgtg 93 Query: 424 cataggagat 433 |||||||||| Sbjct: 92 cataggagat 83 Score = 50.1 bits (25), Expect = 0.006 Identities = 32/33 (96%), Gaps = 1/33 (3%) Strand = Plus / Minus Query: 1 cgatacaacagtgtg-ccggccatgcagagctg 32 ||||||||||||||| ||||||||||||||||| Sbjct: 511 cgatacaacagtgtggccggccatgcagagctg 479 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 83 atatgagagcatttattcatatata 107 ||||||||||||||||||||||||| Sbjct: 437 atatgagagcatttattcatatata 413
>emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific lipid transfer protein precursor (ltp9.2 gene) Length = 708 Score = 220 bits (111), Expect = 3e-54 Identities = 214/250 (85%) Strand = Plus / Minus Query: 184 gatgacagcaagtggtcgatcagcgaatcttagagcagtcgacgntttttntnatggcgt 243 |||| ||||| ||| |||||||||||||||||||||||||||| | ||||||| Sbjct: 433 gatggcagcatgtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgt 374 Query: 244 aggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccac 303 |||||| ||| ||||||||| | | |||||| |||||||||||||||||||| |||||| Sbjct: 373 aggggatgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccag 314 Query: 304 ccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggngctctgggctgcgc 363 | |||||||||||||| |||||||||||||||||||||||||||| |||| |||||| || Sbjct: 313 cagcagcgctcttgatacacttgcacgccgcttgcttgtcagcggtgctccgggctgagc 254 Query: 364 cggccagtctctngacgccgctgcagcaggccacaggcggtttggcgccgttgccgcggg 423 ||| || ||| |||||||||||||||||| ||| ||| |||||||||||||||| | Sbjct: 253 tggctagactcctaacgccgctgcagcaggccgcagacgggctggcgccgttgccgcgtg 194 Query: 424 cataggagat 433 |||||||||| Sbjct: 193 cataggagat 184 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 81 atatatgagagcatttattcatatata 107 ||||||||||||||||||||||||||| Sbjct: 542 atatatgagagcatttattcatatata 516 Score = 50.1 bits (25), Expect = 0.006 Identities = 32/33 (96%), Gaps = 1/33 (3%) Strand = Plus / Minus Query: 1 cgatacaacagtgtg-ccggccatgcagagctg 32 ||||||||||||||| ||||||||||||||||| Sbjct: 614 cgatacaacagtgtggccggccatgcagagctg 582
>emb|X68656.1|HVCW19 H.vulgare Cw-19 mRNA Length = 660 Score = 216 bits (109), Expect = 5e-53 Identities = 119/123 (96%) Strand = Plus / Minus Query: 311 gctcttgatgcacttgcacgccgcttgcttgtcagcggngctctgggctgcgccggccag 370 |||||||| |||| |||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 285 gctcttgaggcacctgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccag 226 Query: 371 tctctngacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatagga 430 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 225 tctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatagga 166 Query: 431 gat 433 ||| Sbjct: 165 gat 163
>gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 214 bits (108), Expect = 2e-52 Identities = 199/231 (86%) Strand = Plus / Minus Query: 203 tcagcgaatcttagagcagtcgacgntttttntnatggcgtaggggacgctgacgccgca 262 |||||||||||||||||||||||| | ||||||||||||||||| |||||||| Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289 Query: 263 catggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgca 322 | | | |||||| || ||||||||||||||||| |||||| | |||||||||||||| || Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229 Query: 323 cttgcacgccgcttgcttgtcagcggngctctgggctgcgccggccagtctctngacgcc 382 |||||||||||||||||||||||||| |||| |||||| || ||| || ||| ||||| Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacgcc 169 Query: 383 gctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagat 433 ||||||||||||| ||| ||| ||||||||||||||||| ||||||||||| Sbjct: 168 gctgcagcaggccgcagacgggttggcgccgttgccgcgtgcataggagat 118
>gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 214 bits (108), Expect = 2e-52 Identities = 199/231 (86%) Strand = Plus / Minus Query: 203 tcagcgaatcttagagcagtcgacgntttttntnatggcgtaggggacgctgacgccgca 262 |||||||||||||||||||||||| | ||||||||||||||||| |||||||| Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289 Query: 263 catggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgca 322 | | | |||||| || ||||||||||||||||| |||||| | |||||||||||||| || Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229 Query: 323 cttgcacgccgcttgcttgtcagcggngctctgggctgcgccggccagtctctngacgcc 382 |||||||||||||||||||||||||| |||| |||||| || ||| || ||| ||||| Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacgcc 169 Query: 383 gctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagat 433 ||||||||||||| ||| ||| ||||||||||||||||| ||||||||||| Sbjct: 168 gctgcagcaggccgcagacgggttggcgccgttgccgcgtgcataggagat 118
>gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 214 bits (108), Expect = 2e-52 Identities = 199/231 (86%) Strand = Plus / Minus Query: 203 tcagcgaatcttagagcagtcgacgntttttntnatggcgtaggggacgctgacgccgca 262 ||||||||||||||||||||| ||| | | ||||||||||||| |||||||||||| Sbjct: 348 tcagcgaatcttagagcagtccacggatgagctaatggcgtaggggatgctgacgccgca 289 Query: 263 catggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgca 322 | |||||||||| || |||||||| |||||||| |||||||| ||||| ||||| ||||| Sbjct: 288 cttggaggggatgcctgcggcctttccagcgttgagcccaccagcagcactcttaatgca 229 Query: 323 cttgcacgccgcttgcttgtcagcggngctctgggctgcgccggccagtctctngacgcc 382 |||||||||||||||||||||||||| |||| | |||||||||||||| ||| ||| || Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgcgctgcgccggccagactcctgacacc 169 Query: 383 gctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagat 433 |||||||||||| |||| || ||| |||| ||||||| ||||||||||| Sbjct: 168 actgcagcaggccgcaggtgggctggagccgctgccgcgtgcataggagat 118
>emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non specific lipid transfer protein precursor Length = 2087 Score = 212 bits (107), Expect = 7e-52 Identities = 213/250 (85%) Strand = Plus / Minus Query: 184 gatgacagcaagtggtcgatcagcgaatcttagagcagtcgacgntttttntnatggcgt 243 |||| ||||||||| |||||||| ||||||||||||||||||| | ||||||| Sbjct: 1624 gatggcagcaagtgctcgatcagtgaatcttagagcagtcgaccgaagagctgatggcgt 1565 Query: 244 aggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccac 303 |||||||||| ||||||||| | | |||||| ||||||||||||||||| || |||||| Sbjct: 1564 aggggacgctaacgccgcactttgtggggatgccggcggccttgccagcattgagcccag 1505 Query: 304 ccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggngctctgggctgcgc 363 | |||||||||||||||||||||||| |||||||||||||||||| |||| |||||| || Sbjct: 1504 cagcagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctccgggctgagc 1445 Query: 364 cggccagtctctngacgccgctgcagcaggccacaggcggtttggcgccgttgccgcggg 423 ||| || ||| |||||||||||||||||| ||| || |||||||||||||||| | Sbjct: 1444 tggctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgttgccgcgtg 1385 Query: 424 cataggagat 433 |||||||||| Sbjct: 1384 cataggagat 1375 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 83 atatgagagcatttattcatatata 107 ||||||||||||||||||||||||| Sbjct: 1733 atatgagagcatttattcatatata 1709 Score = 42.1 bits (21), Expect = 1.5 Identities = 31/33 (93%), Gaps = 1/33 (3%) Strand = Plus / Minus Query: 1 cgatacaacagtgtg-ccggccatgcagagctg 32 ||||| ||||||||| ||||||||||||||||| Sbjct: 1802 cgatataacagtgtggccggccatgcagagctg 1770
>gb|AY789644.1| Triticum aestivum lipid transfer protein 4 (LTP4) mRNA, complete cds Length = 345 Score = 133 bits (67), Expect = 5e-28 Identities = 158/189 (83%) Strand = Plus / Minus Query: 242 gtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagccc 301 ||||||||||||||||| |||| |||||||||| | |||||| |||| | || | ||| Sbjct: 309 gtaggggacgctgacgcggcacttggaggggatctctgcggccgtgccttctttgacccc 250 Query: 302 acccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggngctctgggctgc 361 ||| ||||| |||||||||||| ||||||||||| ||||||||||| |||| || Sbjct: 249 accggcagcactcttgatgcacaggcacgccgctttcttgtcagcggcagtctgcacttg 190 Query: 362 gccggccagtctctngacgccgctgcagcaggccacaggcggtttggcgccgttgccgcg 421 |||||||| |||| ||||||||||||||||||| ||| ||| |||||||||||||||| Sbjct: 189 gccggccaatctcctgacgccgctgcagcaggccgcagacgggctggcgccgttgccgcg 130 Query: 422 ggcatagga 430 |||||||| Sbjct: 129 tgcatagga 121
>gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) gene, complete cds Length = 3448 Score = 103 bits (52), Expect = 5e-19 Identities = 144/176 (81%) Strand = Plus / Minus Query: 199 tcgatcagcgaatcttagagcagtcgacgntttttntnatggcgtaggggacgctgacgc 258 |||||||| | |||||||||||||| ||| | | |||| |||||||| |||||||| Sbjct: 3208 tcgatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgc 3149 Query: 259 cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 318 ||||| |||||||||| | || ||||| || | ||| |||||||| ||||| ||||||| Sbjct: 3148 cgcacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttga 3089 Query: 319 tgcacttgcacgccgcttgcttgtcagcggngctctgggctgcgccggccagtctc 374 ||||| |||| |||||||||||||| |||| |||| | ||| |||||||| |||| Sbjct: 3088 tgcacctgcatgccgcttgcttgtcggcggtgctccgcgctaagccggccaatctc 3033 Score = 44.1 bits (22), Expect = 0.37 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 2 gatacaacagtgtgccggccatgcagagctggct 35 |||||||||||| |||||| |||||||||||||| Sbjct: 3394 gatacaacagtg-gccggctatgcagagctggct 3362
>gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein precursor (LTP1) mRNA, complete cds Length = 737 Score = 103 bits (52), Expect = 5e-19 Identities = 144/176 (81%) Strand = Plus / Minus Query: 199 tcgatcagcgaatcttagagcagtcgacgntttttntnatggcgtaggggacgctgacgc 258 |||||||| | |||||||||||||| ||| | | |||| |||||||| |||||||| Sbjct: 412 tcgatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgc 353 Query: 259 cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 318 ||||| |||||||||| | || ||||| || | ||| |||||||| ||||| ||||||| Sbjct: 352 cgcacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttga 293 Query: 319 tgcacttgcacgccgcttgcttgtcagcggngctctgggctgcgccggccagtctc 374 ||||| |||| |||||||||||||| |||| |||| | ||| |||||||| |||| Sbjct: 292 tgcacctgcatgccgcttgcttgtcggcggtgctccgcgctaagccggccaatctc 237 Score = 44.1 bits (22), Expect = 0.37 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 2 gatacaacagtgtgccggccatgcagagctggct 35 |||||||||||| |||||| |||||||||||||| Sbjct: 598 gatacaacagtg-gccggctatgcagagctggct 566
>gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) mRNA, complete cds Length = 348 Score = 101 bits (51), Expect = 2e-18 Identities = 116/138 (84%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgttt 296 |||| |||||||| ||||||||||||| |||||||||| | || ||||| || | ||| Sbjct: 314 atggagtaggggatgctgacgccgcacttggaggggatacttgcagcctttccggggttg 255 Query: 297 agcccacccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggngctctgg 356 |||||||| ||||| |||||||||||| |||| |||||||||||||| |||| |||| | Sbjct: 254 agcccaccggcagcactcttgatgcacctgcatgccgcttgcttgtcggcggtgctccgc 195 Query: 357 gctgcgccggccagtctc 374 ||| |||||||| |||| Sbjct: 194 gctaagccggccaatctc 177
>gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 101 bits (51), Expect = 2e-18 Identities = 116/138 (84%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgttt 296 |||| |||||||| ||||||||||||| |||||||||| | || ||||| || | ||| Sbjct: 314 atggagtaggggatgctgacgccgcacttggaggggatacttgcagcctttccggggttg 255 Query: 297 agcccacccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggngctctgg 356 |||||||| ||||| |||||||||||| |||| |||||||||||||| |||| |||| | Sbjct: 254 agcccaccggcagcactcttgatgcacctgcatgccgcttgcttgtcggcggtgctccgc 195 Query: 357 gctgcgccggccagtctc 374 ||| |||||||| |||| Sbjct: 194 gctaagccggccaatctc 177
>gb|AY754742.1| Triticum aestivum lipid transfer protein (LTP2) mRNA, complete cds Length = 348 Score = 87.7 bits (44), Expect = 3e-14 Identities = 126/154 (81%) Strand = Plus / Minus Query: 242 gtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagccc 301 |||||||||||||||||||||| ||||||| || || ||||||||| | ||| ||||| Sbjct: 309 gtaggggacgctgacgccgcacttggagggaatgcctgcggccttgttggggttgagccc 250 Query: 302 acccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggngctctgggctgc 361 || ||| | ||||||| |||| |||| | ||||||||||| |||| |||| | ||| Sbjct: 249 tccggcaacactcttgaggcacctgcatgtagcttgcttgtcggcggtgctccgcgctaa 190 Query: 362 gccggccagtctctngacgccgctgcagcaggcc 395 |||||||| | || ||||||||||||||||||| Sbjct: 189 gccggccaatttcctgacgccgctgcagcaggcc 156
>gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein precursor (LTP2) mRNA, complete cds Length = 730 Score = 87.7 bits (44), Expect = 3e-14 Identities = 126/154 (81%) Strand = Plus / Minus Query: 242 gtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagccc 301 |||||||||||||||||||||| ||||||| || || ||||||||| | ||| ||||| Sbjct: 388 gtaggggacgctgacgccgcacttggagggaatgcctgcggccttgttggggttgagccc 329 Query: 302 acccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggngctctgggctgc 361 || ||| | ||||||| |||| |||| | ||||||||||| |||| |||| | ||| Sbjct: 328 tccggcaacactcttgaggcacctgcatgtagcttgcttgtcggcggtgctccgcgctaa 269 Query: 362 gccggccagtctctngacgccgctgcagcaggcc 395 |||||||| | || ||||||||||||||||||| Sbjct: 268 gccggccaatttcctgacgccgctgcagcaggcc 235
>emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non specific lipid transfer protein precursor Length = 496 Score = 87.7 bits (44), Expect = 3e-14 Identities = 126/154 (81%) Strand = Plus / Minus Query: 242 gtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagccc 301 |||||||||||||||||||||| ||||||| || || ||||||||| | ||| ||||| Sbjct: 329 gtaggggacgctgacgccgcacttggagggaatgcctgcggccttgttggggttgagccc 270 Query: 302 acccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggngctctgggctgc 361 || ||| | ||||||| |||| |||| | ||||||||||| |||| |||| | ||| Sbjct: 269 tccggcaacactcttgaggcacctgcatgtagcttgcttgtcggcggtgctccgcgctaa 210 Query: 362 gccggccagtctctngacgccgctgcagcaggcc 395 |||||||| | || ||||||||||||||||||| Sbjct: 209 gccggccaatttcctgacgccgctgcagcaggcc 176
>emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid transfer protein precursor Length = 627 Score = 81.8 bits (41), Expect = 2e-12 Identities = 123/151 (81%) Strand = Plus / Minus Query: 242 gtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagccc 301 |||||||||||||||||||||| |||||||||| || |||||| |||| ||||| | | Sbjct: 311 gtaggggacgctgacgccgcacctggaggggatgcctgcggccctgccggcgttgtacgc 252 Query: 302 acccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggngctctgggctgc 361 || || | ||||||| |||| |||||| ||||||||||| |||| |||| | ||| Sbjct: 251 gccggcgacactcttgaggcacctgcacgtagcttgcttgtcggcggtgctccgcgctaa 192 Query: 362 gccggccagtctctngacgccgctgcagcag 392 |||||||| ||||| ||| ||||| |||||| Sbjct: 191 gccggccaatctcttgactccgctacagcag 161
>emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA Length = 724 Score = 81.8 bits (41), Expect = 2e-12 Identities = 124/151 (82%), Gaps = 1/151 (0%) Strand = Plus / Minus Query: 242 gtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagccc 301 |||||||||||||||||||||| |||||||||| || |||||| |||| ||||| | | Sbjct: 379 gtaggggacgctgacgccgcacctggaggggatgcctgcggccctgccggcgttgtacgc 320 Query: 302 acccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggngctctgggctgc 361 || ||| | ||||||| |||| |||||| ||||||||||| |||| |||| | ||| Sbjct: 319 gccggca-cactcttgaggcacctgcacgtagcttgcttgtcggcggtgctccgcgctaa 261 Query: 362 gccggccagtctctngacgccgctgcagcag 392 |||||||| ||||| ||| ||||| |||||| Sbjct: 260 gccggccaatctcttgactccgctacagcag 230
>gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0086N07 map S790A, complete sequence Length = 178523 Score = 73.8 bits (37), Expect = 4e-10 Identities = 58/65 (89%) Strand = Plus / Plus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgttt 296 |||| |||||||||||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 94044 atggtgtaggggacgctgacgccgcacttggaggggatgctggcggcgttgccggcgttg 94103 Query: 297 agccc 301 ||||| Sbjct: 94104 agccc 94108
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 73.8 bits (37), Expect = 4e-10 Identities = 58/65 (89%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgttt 296 |||| |||||||||||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 736722 atggtgtaggggacgctgacgccgcacttggaggggatgctggcggcgttgccggcgttg 736663 Query: 297 agccc 301 ||||| Sbjct: 736662 agccc 736658 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 732595 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcgtt 732537 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 240 gcgtaggggacgctgacgccgcacatggaggggattccggcg 281 |||||||||| | ||||||||||| |||||||||| |||||| Sbjct: 722703 gcgtaggggatgttgacgccgcacttggaggggatgccggcg 722662
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 73.8 bits (37), Expect = 4e-10 Identities = 58/65 (89%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgttt 296 |||| |||||||||||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 13090036 atggtgtaggggacgctgacgccgcacttggaggggatgctggcggcgttgccggcgttg 13089977 Query: 297 agccc 301 ||||| Sbjct: 13089976 agccc 13089972 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgttt 296 |||| |||||||||||||||||||||| | |||||||| | |||||| ||||| ||||| Sbjct: 702420 atggtgtaggggacgctgacgccgcacttagaggggatgctggcggcgttgccggcgttg 702361 Query: 297 agccc 301 ||||| Sbjct: 702360 agccc 702356 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 692743 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcgtt 692685 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcg 281 ||||||||||||| | ||||| ||||| |||||||||| |||||| Sbjct: 679448 atggcgtaggggatgttgacgtcgcacttggaggggatgccggcg 679404
>emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein Length = 799 Score = 73.8 bits (37), Expect = 4e-10 Identities = 58/65 (89%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgttt 296 |||| |||||||||||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 417 atggtgtaggggacgctgacgccgcacttggaggggatgctggcggcgttgccggcgttg 358 Query: 297 agccc 301 ||||| Sbjct: 357 agccc 353
>emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15 Length = 511 Score = 73.8 bits (37), Expect = 4e-10 Identities = 58/65 (89%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgttt 296 |||| |||||||||||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 392 atggtgtaggggacgctgacgccgcacttggaggggatgctggcggcgttgccggcgttg 333 Query: 297 agccc 301 ||||| Sbjct: 332 agccc 328
>dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086A05, full insert sequence Length = 843 Score = 73.8 bits (37), Expect = 4e-10 Identities = 58/65 (89%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgttt 296 |||| |||||||||||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 436 atggtgtaggggacgctgacgccgcacttggaggggatgctggcggcgttgccggcgttg 377 Query: 297 agccc 301 ||||| Sbjct: 376 agccc 372
>dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-H12, full insert sequence Length = 846 Score = 73.8 bits (37), Expect = 4e-10 Identities = 58/65 (89%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgttt 296 |||| |||||||||||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 435 atggtgtaggggacgctgacgccgcacttggaggggatgctggcggcgttgccggcgttg 376 Query: 297 agccc 301 ||||| Sbjct: 375 agccc 371
>dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-A04, full insert sequence Length = 995 Score = 73.8 bits (37), Expect = 4e-10 Identities = 58/65 (89%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgttt 296 |||| |||||||||||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 649 atggtgtaggggacgctgacgccgcacttggaggggatgctggcggcgttgccggcgttg 590 Query: 297 agccc 301 ||||| Sbjct: 589 agccc 585
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 73.8 bits (37), Expect = 4e-10 Identities = 58/65 (89%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgttt 296 |||| |||||||||||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 13170215 atggtgtaggggacgctgacgccgcacttggaggggatgctggcggcgttgccggcgttg 13170156 Query: 297 agccc 301 ||||| Sbjct: 13170155 agccc 13170151 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgttt 296 |||| |||||||||||||||||||||| | |||||||| | |||||| ||||| ||||| Sbjct: 702420 atggtgtaggggacgctgacgccgcacttagaggggatgctggcggcgttgccggcgttg 702361 Query: 297 agccc 301 ||||| Sbjct: 702360 agccc 702356 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 692743 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcgtt 692685 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcg 281 ||||||||||||| | ||||| ||||| |||||||||| |||||| Sbjct: 679448 atggcgtaggggatgttgacgtcgcacttggaggggatgccggcg 679404
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 73.8 bits (37), Expect = 4e-10 Identities = 58/65 (89%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgttt 296 |||| |||||||||||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 736722 atggtgtaggggacgctgacgccgcacttggaggggatgctggcggcgttgccggcgttg 736663 Query: 297 agccc 301 ||||| Sbjct: 736662 agccc 736658 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 732595 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcgtt 732537 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 240 gcgtaggggacgctgacgccgcacatggaggggattccggcg 281 |||||||||| | ||||||||||| |||||||||| |||||| Sbjct: 722703 gcgtaggggatgttgacgccgcacttggaggggatgccggcg 722662
>emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136_E08 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 118211 Score = 73.8 bits (37), Expect = 4e-10 Identities = 58/65 (89%) Strand = Plus / Plus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgttt 296 |||| |||||||||||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 42412 atggtgtaggggacgctgacgccgcacttggaggggatgctggcggcgttgccggcgttg 42471 Query: 297 agccc 301 ||||| Sbjct: 42472 agccc 42476 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 46539 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcgtt 46597 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 240 gcgtaggggacgctgacgccgcacatggaggggattccggcg 281 |||||||||| | ||||||||||| |||||||||| |||||| Sbjct: 56431 gcgtaggggatgttgacgccgcacttggaggggatgccggcg 56472
>gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) mRNA, complete cds Length = 799 Score = 73.8 bits (37), Expect = 4e-10 Identities = 58/65 (89%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgttt 296 |||| |||||||||||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 417 atggtgtaggggacgctgacgccgcacttggaggggatgctggcggcgttgccggcgttg 358 Query: 297 agccc 301 ||||| Sbjct: 357 agccc 353
>emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA Length = 717 Score = 69.9 bits (35), Expect = 7e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||||||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 273 atggtgtaggggacgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 215
>emb|X71667.1|SVLTP1 S.vulgare ltp1 gene Length = 1499 Score = 69.9 bits (35), Expect = 7e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||||||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 976 atggtgtaggggacgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 918
>gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA, complete cds Length = 695 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgttt 296 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||||| Sbjct: 316 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcgttt 257 Query: 297 ag 298 || Sbjct: 256 ag 255
>gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LT1 mRNA, complete cds Length = 530 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgttt 296 |||| |||||||||||||||||||||| | |||||||| | |||||| ||||| ||||| Sbjct: 405 atggtgtaggggacgctgacgccgcacttagaggggatgctggcggcgttgccggcgttg 346 Query: 297 agccc 301 ||||| Sbjct: 345 agccc 341
>emb|X71668.1|SVLTP2 S.vulgare ltp2 gene Length = 1800 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgcc 289 |||| |||||||| ||||||||||||| |||||||||| | |||||||||||| Sbjct: 944 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggccttgcc 892
>emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA Length = 732 Score = 65.9 bits (33), Expect = 1e-07 Identities = 121/151 (80%) Strand = Plus / Minus Query: 242 gtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagccc 301 ||||||||||||||| |||||| |||||||||| || |||||| | || ||||| | | Sbjct: 382 gtaggggacgctgaccccgcacctggaggggatgcctgcggcccttccggcgttgtacgc 323 Query: 302 acccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggngctctgggctgc 361 || || | ||||||| |||| |||||| ||||||||||| |||| |||| | ||| Sbjct: 322 gccggcgacactcttgaggcacctgcacgtagcttgcttgtcggcggtgctccgcgctaa 263 Query: 362 gccggccagtctctngacgccgctgcagcag 392 |||||||| ||||| ||| ||||| |||||| Sbjct: 262 gccggccaatctcttgactccgctacagcag 232
>dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023053H09, full insert sequence Length = 2882 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgttt 296 |||| |||||||||||||||||||||| | |||||||| | |||||| ||||| ||||| Sbjct: 2424 atggtgtaggggacgctgacgccgcacttagaggggatgctggcggcgttgccggcgttg 2365 Query: 297 agccc 301 ||||| Sbjct: 2364 agccc 2360
>dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-003-B09, full insert sequence Length = 551 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgttt 296 |||| |||||||||||||||||||||| | |||||||| | |||||| ||||| ||||| Sbjct: 301 atggtgtaggggacgctgacgccgcacttagaggggatgctggcggcgttgccggcgttg 242 Query: 297 agccc 301 ||||| Sbjct: 241 agccc 237
>gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT IV mRNA, complete cds Length = 507 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgttt 296 |||| |||||||||||||||||||||| | |||||||| | |||||| ||||| ||||| Sbjct: 352 atggtgtaggggacgctgacgccgcacttagaggggatgctggcggcgttgccggcgttg 293 Query: 297 agccc 301 ||||| Sbjct: 292 agccc 288
>emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa0025K19 of library OSJNBa from chromosome 11 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 181322 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Plus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgttt 296 |||| |||||||||||||||||||||| | |||||||| | |||||| ||||| ||||| Sbjct: 40552 atggtgtaggggacgctgacgccgcacttagaggggatgctggcggcgttgccggcgttg 40611 Query: 297 agccc 301 ||||| Sbjct: 40612 agccc 40616 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 50229 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcgtt 50287 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Plus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcg 281 ||||||||||||| | ||||| ||||| |||||||||| |||||| Sbjct: 63524 atggcgtaggggatgttgacgtcgcacttggaggggatgccggcg 63568
>gb|AF017360.1|AF017360 Oryza sativa lipid transfer protein LPT III mRNA, complete cds Length = 805 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 246 gggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagccc 301 |||||||||||||||||| |||||||||| | |||||| ||||| ||||| ||||| Sbjct: 383 gggacgctgacgccgcacttggaggggatgctggcggcgttgccggcgttgagccc 328
>gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LPT1 mRNA, complete cds Length = 647 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 448 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcgtt 390
>emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, complete CDS Length = 1485 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 680 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcgtt 622
>emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1 Length = 692 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 310 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcgtt 252
>dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-C01, full insert sequence Length = 718 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 101 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcgtt 159
>dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-C07, full insert sequence Length = 1003 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 633 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcgtt 575
>dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-G08, full insert sequence Length = 840 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 416 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcgtt 358
>gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT II mRNA, complete cds Length = 845 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 398 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcgtt 340
>gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA, complete cds Length = 770 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 402 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 344
>gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transfer protein 1 (plt1) gene, partial cds Length = 698 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 312 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 254
>gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 514 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 304 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 246
>gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transfer protein 1 (plt1) gene, partial cds Length = 514 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 304 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 246
>gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 804 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 413 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 355
>gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 831 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 430 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 372
>gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 323 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 265
>gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 323 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 265
>gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 323 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 265
>gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 323 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 265
>gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 323 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 265
>gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 323 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 265
>gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 323 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 265
>gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 323 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 265
>gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 323 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 265
>gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transfer protein 2 (plt2) gene, partial cds Length = 613 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 297 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 239
>gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transfer protein 2 (pl2) gene, partial cds Length = 613 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 297 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 239
>gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 826 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 394 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 336
>gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 822 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 394 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 336
>gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 829 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 393 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 335
>gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phospholipid transfer protein 2 (plt2) gene, complete cds Length = 816 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 394 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 336
>gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 394 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 336
>gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 826 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 394 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 336
>gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 818 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 394 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 336
>gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholipid transfer protein 2 (plt2) gene, complete cds Length = 822 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 394 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 336
>gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 394 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 336
>gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 832 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 394 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 336
>gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 820 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 394 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 336
>gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 394 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcgtt 336
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcg 281 ||||||||||||| | ||||||||||| |||||||||| |||||| Sbjct: 14437043 atggcgtaggggatgttgacgccgcacttggaggggatgccggcg 14436999
>dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1116_C12 Length = 116758 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcg 281 ||||||||||||| | ||||||||||| |||||||||| |||||| Sbjct: 45541 atggcgtaggggatgttgacgccgcacttggaggggatgccggcg 45497
>gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence Length = 827 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggc 283 |||| |||||||| ||||||||||||| |||||||||| | |||||| Sbjct: 413 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 367
>gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 699 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| ||||||| || | |||||| ||||| ||||| Sbjct: 297 atggtgtaggggatgctgacgccgcacttggagggtatgctggcggcgttgccggcgtt 239
>gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 780 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggc 283 |||| |||||||| ||||||||||||| |||||||||| | |||||| Sbjct: 395 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 349
>gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 714 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggc 283 |||| |||||||| ||||||||||||| |||||||||| | |||||| Sbjct: 320 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 274
>gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 648 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggc 283 |||| |||||||| ||||||||||||| |||||||||| | |||||| Sbjct: 419 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 373
>gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phospholipid transfer protein 1 (plt1) gene, complete cds Length = 829 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggc 283 |||| |||||||| ||||||||||||| |||||||||| | |||||| Sbjct: 432 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 386
>gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 831 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggc 283 |||| |||||||| ||||||||||||| |||||||||| | |||||| Sbjct: 434 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 388
>gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 821 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggc 283 |||| |||||||| ||||||||||||| |||||||||| | |||||| Sbjct: 429 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 383
>gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 832 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggc 283 |||| |||||||| ||||||||||||| |||||||||| | |||||| Sbjct: 432 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 386
>gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 835 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggc 283 |||| |||||||| ||||||||||||| |||||||||| | |||||| Sbjct: 429 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 383
>gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 814 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggc 283 |||| |||||||| ||||||||||||| |||||||||| | |||||| Sbjct: 429 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 383
>gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||| ||||| | |||||| ||||| ||||| Sbjct: 394 atggtgtaggggatgctgacgccgcacttggacgggatgctggcggcgttgccggcgtt 336
>gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtt 295 |||| |||||||| ||||||||||||| |||| ||||| | |||||| ||||| ||||| Sbjct: 394 atggtgtaggggatgctgacgccgcacttggacgggatgctggcggcgttgccggcgtt 336
>gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3' end Length = 677 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggc 283 |||| |||||||| ||||||||||||| |||||||||| | |||||| Sbjct: 243 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 197
>gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, complete cds. of clone 9C2 Length = 813 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcggc 283 |||| |||||||| ||||||||||||| |||||||||| | |||||| Sbjct: 430 atggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 384
>dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-125-E10, full insert sequence Length = 793 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 240 gcgtaggggacgctgacgccgcacatggaggggattccggcg 281 |||||||||| | ||||||||||| |||||||||| |||||| Sbjct: 406 gcgtaggggatgttgacgccgcacttggaggggatgccggcg 365
>dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033094A19, full insert sequence Length = 3876 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 240 gcgtaggggacgctgacgccgcacatggaggggattccggcg 281 |||||||||| | ||||||||||| |||||||||| |||||| Sbjct: 3492 gcgtaggggatgttgacgccgcacttggaggggatgccggcg 3451
>dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044B21, full insert sequence Length = 792 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 240 gcgtaggggacgctgacgccgcacatggaggggattccggcg 281 |||||||||| | ||||||||||| |||||||||| |||||| Sbjct: 408 gcgtaggggatgttgacgccgcacttggaggggatgccggcg 367
>dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-E10, full insert sequence Length = 745 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcg 281 ||||||||||||| | ||||| ||||| |||||||||| |||||| Sbjct: 413 atggcgtaggggatgttgacgtcgcacttggaggggatgccggcg 369
>gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 709 Score = 50.1 bits (25), Expect = 0.006 Identities = 37/41 (90%) Strand = Plus / Minus Query: 243 taggggacgctgacgccgcacatggaggggattccggcggc 283 ||||||| ||||||||||||| |||||||||| | |||||| Sbjct: 292 taggggatgctgacgccgcacttggaggggatgctggcggc 252
>gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precursor (LTP2) mRNA, complete cds Length = 840 Score = 46.1 bits (23), Expect = 0.094 Identities = 38/43 (88%) Strand = Plus / Minus Query: 253 tgacgccgcacatggaggggattccggcggccttgccagcgtt 295 ||||||||||| |||||||||| | |||||| ||||| ||||| Sbjct: 377 tgacgccgcacttggaggggatgctggcggcattgccggcgtt 335
>gb|BC045114.1| Mus musculus cyclic nucleotide gated channel beta 1b, mRNA (cDNA clone IMAGE:4504353), partial cds Length = 4763 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Plus Query: 379 cgccgctgcagcaggccacagg 400 |||||||||||||||||||||| Sbjct: 367 cgccgctgcagcaggccacagg 388
>gb|AC182436.1| Mus musculus chromosome 5, clone wi1-1982K15, complete sequence Length = 43869 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Plus Query: 379 cgccgctgcagcaggccacagg 400 |||||||||||||||||||||| Sbjct: 43282 cgccgctgcagcaggccacagg 43303
>gb|AC102518.11| Mus musculus chromosome 8, clone RP24-502J8, complete sequence Length = 199824 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Plus Query: 379 cgccgctgcagcaggccacagg 400 |||||||||||||||||||||| Sbjct: 52943 cgccgctgcagcaggccacagg 52964
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 377 gacgccgctgcagcaggccac 397 ||||||||||||||||||||| Sbjct: 41554621 gacgccgctgcagcaggccac 41554641
>dbj|AP004073.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0614D08 Length = 147548 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 377 gacgccgctgcagcaggccac 397 ||||||||||||||||||||| Sbjct: 110914 gacgccgctgcagcaggccac 110934
>gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid transfer protein 6 (Ltp6) gene, promoter and complete cds Length = 3257 Score = 42.1 bits (21), Expect = 1.5 Identities = 39/45 (86%) Strand = Plus / Minus Query: 237 atggcgtaggggacgctgacgccgcacatggaggggattccggcg 281 ||||||||||||| | ||||||||||| || |||||| |||||| Sbjct: 2766 atggcgtaggggatgttgacgccgcacttgctggggatgccggcg 2722
>dbj|AP003687.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0660F12 Length = 147203 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 377 gacgccgctgcagcaggccac 397 ||||||||||||||||||||| Sbjct: 122820 gacgccgctgcagcaggccac 122840
>emb|AL590110.11| Human DNA sequence from clone RP11-254O21 on chromosome 1 Contains the 3' end of a novel gene, complete sequence Length = 128843 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 69 cacatggagataatatatga 88 |||||||||||||||||||| Sbjct: 114026 cacatggagataatatatga 114007
>emb|AL157829.24| Human DNA sequence from clone RP11-305F14 on chromosome 9 Contains part of the ASTN2 gene for astrotactin2 (KIAA0634), and a CpG island, complete sequence Length = 162575 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 73 tggagataatatatgagagc 92 |||||||||||||||||||| Sbjct: 31942 tggagataatatatgagagc 31961
>dbj|AK056395.1| Homo sapiens cDNA FLJ31833 fis, clone NT2RP6000130 Length = 3692 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 178 agcaaggatgacagcaagtg 197 |||||||||||||||||||| Sbjct: 1826 agcaaggatgacagcaagtg 1807
>emb|BX649439.8| Zebrafish DNA sequence from clone DKEY-21A8 in linkage group 2, complete sequence Length = 146298 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 73 tggagataatatatgagagc 92 |||||||||||||||||||| Sbjct: 85666 tggagataatatatgagagc 85685
>gb|AC044817.5|AC044817 Homo sapiens, clone RP11-197P20, complete sequence Length = 109398 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 agcaaggatgacagcaagtg 197 |||||||||||||||||||| Sbjct: 100675 agcaaggatgacagcaagtg 100694
>gb|AC091182.5| Homo sapiens chromosome 8, clone RP11-527N22, complete sequence Length = 206852 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 178 agcaaggatgacagcaagtg 197 |||||||||||||||||||| Sbjct: 90670 agcaaggatgacagcaagtg 90651
>dbj|AP006306.1| Homo sapiens genomic DNA, chromosome 8 clone:RP11-591J4, complete sequence Length = 211750 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 agcaaggatgacagcaagtg 197 |||||||||||||||||||| Sbjct: 90149 agcaaggatgacagcaagtg 90168
>dbj|AP006304.1| Homo sapiens genomic DNA, chromosome 8 clone:RP11-53I21, complete sequence Length = 156583 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 agcaaggatgacagcaagtg 197 |||||||||||||||||||| Sbjct: 142238 agcaaggatgacagcaagtg 142257
>dbj|AP000070.1| Homo sapiens genomic DNA, chromosome 8p11.2, senescence gene region, section 6/19 Length = 100000 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 178 agcaaggatgacagcaagtg 197 |||||||||||||||||||| Sbjct: 19820 agcaaggatgacagcaagtg 19801 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,162,312 Number of Sequences: 3902068 Number of extensions: 2162312 Number of successful extensions: 37757 Number of sequences better than 10.0: 122 Number of HSP's better than 10.0 without gapping: 124 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 37366 Number of HSP's gapped (non-prelim): 383 length of query: 433 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 411 effective length of database: 17,147,199,772 effective search space: 7047499106292 effective search space used: 7047499106292 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
