| Clone Name | rbags21g12 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AK104758.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-G08, full insert sequence Length = 1107 Score = 317 bits (160), Expect = 2e-83 Identities = 265/300 (88%) Strand = Plus / Minus Query: 337 caaggttgattaacgtcattacagcagcaatcaggtgaaccactgggacaaaaatttggt 396 |||| ||||||| |||||||||| ||||||||| ||||| ||||||||||| | ||| | Sbjct: 788 caagattgattagtgtcattacagaagcaatcagatgaacaactgggacaaatacttgat 729 Query: 397 ctctcttctttctctctccatatccattaaaagcaataatcatcgaggaagtatggatga 456 | || |||||||||| | || |||||||||||||||||||| ||| | || ||||||| Sbjct: 728 cacttctctttctctcgtcgtacccattaaaagcaataatcattgagaatgtgtggatga 669 Query: 457 ccaagaatccaagtgaaataattgctgacacaaggaaaaatggcatccttgagcaccttt 516 ||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||| Sbjct: 668 ccaagaatccaagagaaataatggctgacacaaggaaaaatggcatccttgagcactttt 609 Query: 517 cgacataaaatgttgctcgaccaaatgctggggttaggaggctgaggcagaaaaagactg 576 | ||||||||||| |||| || |||||||| |||| |||||||||||||||||||| | Sbjct: 608 caacataaaatgtagctctgccgaatgctggagttaaaaggctgaggcagaaaaagacgg 549 Query: 577 catgagccagtccatgacctaaaccaccagccaacgagattagcatcttgtctgtcaaac 636 ||||||||| |||||| |||||||||||||||||||| |||||||||||||||||||||| Sbjct: 548 catgagccactccatggcctaaaccaccagccaacgatattagcatcttgtctgtcaaac 489
>dbj|AK060159.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-G12, full insert sequence Length = 1107 Score = 317 bits (160), Expect = 2e-83 Identities = 265/300 (88%) Strand = Plus / Minus Query: 337 caaggttgattaacgtcattacagcagcaatcaggtgaaccactgggacaaaaatttggt 396 |||| ||||||| |||||||||| ||||||||| ||||| ||||||||||| | ||| | Sbjct: 788 caagattgattagtgtcattacagaagcaatcagatgaacaactgggacaaatacttgat 729 Query: 397 ctctcttctttctctctccatatccattaaaagcaataatcatcgaggaagtatggatga 456 | || |||||||||| | || |||||||||||||||||||| ||| | || ||||||| Sbjct: 728 cacttctctttctctcgtcgtacccattaaaagcaataatcattgagaatgtgtggatga 669 Query: 457 ccaagaatccaagtgaaataattgctgacacaaggaaaaatggcatccttgagcaccttt 516 ||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||| Sbjct: 668 ccaagaatccaagagaaataatggctgacacaaggaaaaatggcatccttgagcactttt 609 Query: 517 cgacataaaatgttgctcgaccaaatgctggggttaggaggctgaggcagaaaaagactg 576 | ||||||||||| |||| || |||||||| |||| |||||||||||||||||||| | Sbjct: 608 caacataaaatgtagctctgccgaatgctggagttaaaaggctgaggcagaaaaagacgg 549 Query: 577 catgagccagtccatgacctaaaccaccagccaacgagattagcatcttgtctgtcaaac 636 ||||||||| |||||| |||||||||||||||||||| |||||||||||||||||||||| Sbjct: 548 catgagccactccatggcctaaaccaccagccaacgatattagcatcttgtctgtcaaac 489
>dbj|AK064930.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000O04, full insert sequence Length = 2412 Score = 268 bits (135), Expect = 2e-68 Identities = 237/271 (87%) Strand = Plus / Minus Query: 337 caaggttgattaacgtcattacagcagcaatcaggtgaaccactgggacaaaaatttggt 396 |||| ||||||| |||||||||| ||||||||| ||||| ||||||||||| | ||| | Sbjct: 2112 caagattgattagtgtcattacagaagcaatcagatgaacaactgggacaaatacttgat 2053 Query: 397 ctctcttctttctctctccatatccattaaaagcaataatcatcgaggaagtatggatga 456 | || |||||||||| | || |||||||||||||||||||| ||| | || ||||||| Sbjct: 2052 cacttctctttctctcgtcgtacccattaaaagcaataatcattgagaatgtgtggatga 1993 Query: 457 ccaagaatccaagtgaaataattgctgacacaaggaaaaatggcatccttgagcaccttt 516 ||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||| Sbjct: 1992 ccaagaatccaagagaaataatggctgacacaaggaaaaatggcatccttgagcactttt 1933 Query: 517 cgacataaaatgttgctcgaccaaatgctggggttaggaggctgaggcagaaaaagactg 576 | ||||||||||| |||| || |||||||| |||| |||||||||||||||||||| | Sbjct: 1932 caacataaaatgtagctctgccgaatgctggagttaaaaggctgaggcagaaaaagacgg 1873 Query: 577 catgagccagtccatgacctaaaccaccagc 607 ||||||||| |||||| |||||||||||||| Sbjct: 1872 catgagccactccatggcctaaaccaccagc 1842 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 607 ccaacgagattagcatcttgtctgtcaaac 636 ||||||| |||||||||||||||||||||| Sbjct: 523 ccaacgatattagcatcttgtctgtcaaac 494
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 157 bits (79), Expect = 5e-35 Identities = 115/127 (90%) Strand = Plus / Minus Query: 481 ctgacacaaggaaaaatggcatccttgagcacctttcgacataaaatgttgctcgaccaa 540 |||||||||||||||||||||||||||||||| |||| ||||||||||| |||| || | Sbjct: 9905307 ctgacacaaggaaaaatggcatccttgagcacttttcaacataaaatgtagctctgccga 9905248 Query: 541 atgctggggttaggaggctgaggcagaaaaagactgcatgagccagtccatgacctaaac 600 ||||||| |||| |||||||||||||||||||| |||||||||| |||||| ||||||| Sbjct: 9905247 atgctggagttaaaaggctgaggcagaaaaagacggcatgagccactccatggcctaaac 9905188 Query: 601 caccagc 607 ||||||| Sbjct: 9905187 caccagc 9905181 Score = 109 bits (55), Expect = 1e-20 Identities = 112/131 (85%) Strand = Plus / Minus Query: 353 cattacagcagcaatcaggtgaaccactgggacaaaaatttggtctctcttctttctctc 412 |||||||| ||||||||| ||||| ||||||||||| | ||| || || |||||||||| Sbjct: 9905673 cattacagaagcaatcagatgaacaactgggacaaatacttgatcacttctctttctctc 9905614 Query: 413 tccatatccattaaaagcaataatcatcgaggaagtatggatgaccaagaatccaagtga 472 | || |||||||||||||||||||| ||| | || |||||||||||||||||||| || Sbjct: 9905613 gtcgtacccattaaaagcaataatcattgagaatgtgtggatgaccaagaatccaagaga 9905554 Query: 473 aataattgctg 483 |||||| |||| Sbjct: 9905553 aataatggctg 9905543 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 607 ccaacgagattagcatcttgtctgtcaaac 636 ||||||| |||||||||||||||||||||| Sbjct: 9903862 ccaacgatattagcatcttgtctgtcaaac 9903833 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 476 aattgctgacacaaggaaaa 495 |||||||||||||||||||| Sbjct: 6717952 aattgctgacacaaggaaaa 6717933
>dbj|AP005007.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0521F09 Length = 164823 Score = 157 bits (79), Expect = 5e-35 Identities = 115/127 (90%) Strand = Plus / Minus Query: 481 ctgacacaaggaaaaatggcatccttgagcacctttcgacataaaatgttgctcgaccaa 540 |||||||||||||||||||||||||||||||| |||| ||||||||||| |||| || | Sbjct: 86269 ctgacacaaggaaaaatggcatccttgagcacttttcaacataaaatgtagctctgccga 86210 Query: 541 atgctggggttaggaggctgaggcagaaaaagactgcatgagccagtccatgacctaaac 600 ||||||| |||| |||||||||||||||||||| |||||||||| |||||| ||||||| Sbjct: 86209 atgctggagttaaaaggctgaggcagaaaaagacggcatgagccactccatggcctaaac 86150 Query: 601 caccagc 607 ||||||| Sbjct: 86149 caccagc 86143 Score = 109 bits (55), Expect = 1e-20 Identities = 112/131 (85%) Strand = Plus / Minus Query: 353 cattacagcagcaatcaggtgaaccactgggacaaaaatttggtctctcttctttctctc 412 |||||||| ||||||||| ||||| ||||||||||| | ||| || || |||||||||| Sbjct: 86635 cattacagaagcaatcagatgaacaactgggacaaatacttgatcacttctctttctctc 86576 Query: 413 tccatatccattaaaagcaataatcatcgaggaagtatggatgaccaagaatccaagtga 472 | || |||||||||||||||||||| ||| | || |||||||||||||||||||| || Sbjct: 86575 gtcgtacccattaaaagcaataatcattgagaatgtgtggatgaccaagaatccaagaga 86516 Query: 473 aataattgctg 483 |||||| |||| Sbjct: 86515 aataatggctg 86505 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 607 ccaacgagattagcatcttgtctgtcaaac 636 ||||||| |||||||||||||||||||||| Sbjct: 84824 ccaacgatattagcatcttgtctgtcaaac 84795
>ref|NM_128701.1| Arabidopsis thaliana unknown protein AT2G31440 mRNA, complete cds Length = 753 Score = 63.9 bits (32), Expect = 6e-07 Identities = 95/116 (81%) Strand = Plus / Minus Query: 492 aaaaatggcatccttgagcacctttcgacataaaatgttgctcgaccaaatgctggggtt 551 |||||||||| | | || || ||||||||||| ||||| ||| ||||||| ||||| ||| Sbjct: 470 aaaaatggcaccttcgaacatctttcgacatagaatgtggctggaccaaacgctggagtt 411 Query: 552 aggaggctgaggcagaaaaagactgcatgagccagtccatgacctaaaccaccagc 607 | |||||| | || || || || ||||| |||| |||||||||||||||||||| Sbjct: 410 aagaggctcaaacaaaagaatacagcatgcgccacaccatgacctaaaccaccagc 355
>gb|AY097412.1| Arabidopsis thaliana At2g31440/T28P16.7 mRNA, complete cds Length = 753 Score = 63.9 bits (32), Expect = 6e-07 Identities = 95/116 (81%) Strand = Plus / Minus Query: 492 aaaaatggcatccttgagcacctttcgacataaaatgttgctcgaccaaatgctggggtt 551 |||||||||| | | || || ||||||||||| ||||| ||| ||||||| ||||| ||| Sbjct: 470 aaaaatggcaccttcgaacatctttcgacatagaatgtggctggaccaaacgctggagtt 411 Query: 552 aggaggctgaggcagaaaaagactgcatgagccagtccatgacctaaaccaccagc 607 | |||||| | || || || || ||||| |||| |||||||||||||||||||| Sbjct: 410 aagaggctcaaacaaaagaatacagcatgcgccacaccatgacctaaaccaccagc 355
>gb|AC007169.8| Arabidopsis thaliana chromosome 2 clone T28P16 map nga361, complete sequence Length = 55944 Score = 63.9 bits (32), Expect = 6e-07 Identities = 95/116 (81%) Strand = Plus / Minus Query: 492 aaaaatggcatccttgagcacctttcgacataaaatgttgctcgaccaaatgctggggtt 551 |||||||||| | | || || ||||||||||| ||||| ||| ||||||| ||||| ||| Sbjct: 16787 aaaaatggcaccttcgaacatctttcgacatagaatgtggctggaccaaacgctggagtt 16728 Query: 552 aggaggctgaggcagaaaaagactgcatgagccagtccatgacctaaaccaccagc 607 | |||||| | || || || || ||||| |||| |||||||||||||||||||| Sbjct: 16727 aagaggctcaaacaaaagaatacagcatgcgccacaccatgacctaaaccaccagc 16672
>gb|AY064157.1| Arabidopsis thaliana At2g31440/T28P16.7 mRNA, complete cds Length = 1021 Score = 63.9 bits (32), Expect = 6e-07 Identities = 95/116 (81%) Strand = Plus / Minus Query: 492 aaaaatggcatccttgagcacctttcgacataaaatgttgctcgaccaaatgctggggtt 551 |||||||||| | | || || ||||||||||| ||||| ||| ||||||| ||||| ||| Sbjct: 531 aaaaatggcaccttcgaacatctttcgacatagaatgtggctggaccaaacgctggagtt 472 Query: 552 aggaggctgaggcagaaaaagactgcatgagccagtccatgacctaaaccaccagc 607 | |||||| | || || || || ||||| |||| |||||||||||||||||||| Sbjct: 471 aagaggctcaaacaaaagaatacagcatgcgccacaccatgacctaaaccaccagc 416
>gb|AY088444.1| Arabidopsis thaliana clone 6704 mRNA, complete sequence Length = 1080 Score = 63.9 bits (32), Expect = 6e-07 Identities = 95/116 (81%) Strand = Plus / Minus Query: 492 aaaaatggcatccttgagcacctttcgacataaaatgttgctcgaccaaatgctggggtt 551 |||||||||| | | || || ||||||||||| ||||| ||| ||||||| ||||| ||| Sbjct: 616 aaaaatggcaccttcgaacatctttcgacatagaatgtggctggaccaaacgctggagtt 557 Query: 552 aggaggctgaggcagaaaaagactgcatgagccagtccatgacctaaaccaccagc 607 | |||||| | || || || || ||||| |||| |||||||||||||||||||| Sbjct: 556 aagaggctcaaacaaaagaatacagcatgcgccacaccatgacctaaaccaccagc 501
>gb|AC147427.2| Oryza sativa chromosome 3 B1394A07 genomic sequence, complete sequence Length = 175704 Score = 48.1 bits (24), Expect = 0.036 Identities = 33/36 (91%) Strand = Plus / Minus Query: 492 aaaaatggcatccttgagcacctttcgacataaaat 527 ||||||| |||| ||||||||||||| ||||||||| Sbjct: 168644 aaaaatgacatctttgagcacctttcaacataaaat 168609 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 580 gagccagtccatgacctaaaccacc 604 |||||| |||||||||||||||||| Sbjct: 168543 gagccactccatgacctaaaccacc 168519
>gb|AC128646.5| Oryza sativa chromosome 3 BAC OSJNBb0029I19 genomic sequence, complete sequence Length = 120254 Score = 48.1 bits (24), Expect = 0.036 Identities = 33/36 (91%) Strand = Plus / Minus Query: 492 aaaaatggcatccttgagcacctttcgacataaaat 527 ||||||| |||| ||||||||||||| ||||||||| Sbjct: 6741 aaaaatgacatctttgagcacctttcaacataaaat 6706 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 580 gagccagtccatgacctaaaccacc 604 |||||| |||||||||||||||||| Sbjct: 6640 gagccactccatgacctaaaccacc 6616
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 48.1 bits (24), Expect = 0.036 Identities = 33/36 (91%) Strand = Plus / Plus Query: 492 aaaaatggcatccttgagcacctttcgacataaaat 527 ||||||| |||| ||||||||||||| ||||||||| Sbjct: 24467216 aaaaatgacatctttgagcacctttcaacataaaat 24467251 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 580 gagccagtccatgacctaaaccacc 604 |||||| |||||||||||||||||| Sbjct: 24467317 gagccactccatgacctaaaccacc 24467341
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 48.1 bits (24), Expect = 0.036 Identities = 33/36 (91%) Strand = Plus / Plus Query: 492 aaaaatggcatccttgagcacctttcgacataaaat 527 ||||||| |||| ||||||||||||| ||||||||| Sbjct: 24384685 aaaaatgacatctttgagcacctttcaacataaaat 24384720 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 580 gagccagtccatgacctaaaccacc 604 |||||| |||||||||||||||||| Sbjct: 24384786 gagccactccatgacctaaaccacc 24384810
>gb|AC138318.7| Mus musculus chromosome 3, clone RP23-358I23, complete sequence Length = 201126 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Minus Query: 472 aaataattgctgacacaaggaaaaatg 498 ||||||||||||||||| ||||||||| Sbjct: 20032 aaataattgctgacacacggaaaaatg 20006 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Minus Query: 472 aaataattgctgacacaaggaaaaat 497 ||||||||||||||||| |||||||| Sbjct: 18388 aaataattgctgacacacggaaaaat 18363
>gb|AC125476.30| Medicago truncatula clone mth2-10e13, complete sequence Length = 153919 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Plus Query: 388 aaatttggtctctcttctttctctctc 414 |||||||||||||||| |||||||||| Sbjct: 95558 aaatttggtctctcttatttctctctc 95584
>gb|AC131721.4| Mus musculus BAC clone RP23-142L24 from chromosome 15, complete sequence Length = 230892 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaaga 573 |||||||||||||||||||||| Sbjct: 41509 aggaggctgaggcagaaaaaga 41488
>dbj|AB089429.1| Cryptomeria japonica DNA, microsatellite region, clone:Cjg0177F Length = 457 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Minus Query: 392 ttggtctctcttctttctctct 413 |||||||||||||||||||||| Sbjct: 417 ttggtctctcttctttctctct 396
>gb|AC098616.2| Homo sapiens chromosome 3 clone RP11-279I18, complete sequence Length = 159629 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Plus Query: 550 ttaggaggctgaggcagaaaaa 571 |||||||||||||||||||||| Sbjct: 82147 ttaggaggctgaggcagaaaaa 82168
>gb|AC092503.2| Homo sapiens chromosome 3 clone RP11-539L2, complete sequence Length = 195568 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Plus Query: 550 ttaggaggctgaggcagaaaaa 571 |||||||||||||||||||||| Sbjct: 25865 ttaggaggctgaggcagaaaaa 25886
>gb|AC092814.2| Homo sapiens chromosome 1 clone RP11-565J7, complete sequence Length = 170245 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Minus Query: 550 ttaggaggctgaggcagaaaaa 571 |||||||||||||||||||||| Sbjct: 27979 ttaggaggctgaggcagaaaaa 27958
>gb|AC078860.19| Homo sapiens 12 BAC RP11-186F10 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 145165 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Plus Query: 550 ttaggaggctgaggcagaaaaa 571 |||||||||||||||||||||| Sbjct: 116579 ttaggaggctgaggcagaaaaa 116600
>gb|AC156348.3| Colobus guereza clone CH272-110A23, complete sequence Length = 115353 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Minus Query: 550 ttaggaggctgaggcagaaaaa 571 |||||||||||||||||||||| Sbjct: 67493 ttaggaggctgaggcagaaaaa 67472 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 380 tgggacaaaaatttggtctc 399 |||||||||||||||||||| Sbjct: 74635 tgggacaaaaatttggtctc 74654
>gb|CP000070.1| Trypanosoma brucei chromosome 7, complete sequence Length = 2205233 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 284 catcgcagctgtcacacacag 304 ||||||||||||||||||||| Sbjct: 451250 catcgcagctgtcacacacag 451230 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 284 catcgcagctgtcacacacag 304 ||||||||||||||||||||| Sbjct: 445689 catcgcagctgtcacacacag 445669
>gb|AC159447.1| Trypanosoma brucei chromosome 7 clone RPCI93-43M14, complete sequence Length = 128897 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 284 catcgcagctgtcacacacag 304 ||||||||||||||||||||| Sbjct: 36804 catcgcagctgtcacacacag 36784 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 284 catcgcagctgtcacacacag 304 ||||||||||||||||||||| Sbjct: 31243 catcgcagctgtcacacacag 31223
>gb|AC138654.4| Mus musculus BAC clone RP23-344O11 from chromosome 5, complete sequence Length = 198036 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 550 ttaggaggctgaggcagaaaa 570 ||||||||||||||||||||| Sbjct: 187275 ttaggaggctgaggcagaaaa 187295
>gb|AC136513.2| Mus musculus BAC clone RP23-477N9 from chromosome 5, complete sequence Length = 188517 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 550 ttaggaggctgaggcagaaaa 570 ||||||||||||||||||||| Sbjct: 186474 ttaggaggctgaggcagaaaa 186454
>ref|XM_819659.1| Trypanosoma brucei TREU927 clone RPCI93-43M14 hypothetical protein (Tb927.7.1880) partial mRNA Length = 882 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 284 catcgcagctgtcacacacag 304 ||||||||||||||||||||| Sbjct: 73 catcgcagctgtcacacacag 53
>ref|XM_819655.1| Trypanosoma brucei TREU927 clone RPCI93-43M14 hypothetical protein (Tb927.7.1840) partial mRNA Length = 882 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 284 catcgcagctgtcacacacag 304 ||||||||||||||||||||| Sbjct: 73 catcgcagctgtcacacacag 53
>ref|XM_671151.1| Plasmodium berghei strain ANKA V-type H(+)-translocating pyrophosphatase (PB001147.00.0) partial mRNA Length = 2151 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 466 caagtgaaataattgctgaca 486 ||||||||||||||||||||| Sbjct: 2089 caagtgaaataattgctgaca 2069
>emb|AL683826.14| Human DNA sequence from clone XXyac-21CG7 on chromosome 10 Contains gene FLJ21665, the gene for stresscopin (SPC) (SCP UCN3 UCNIII) and the 5' end of a ribosomal protein L26 (RPL26) pseudogene, complete sequence Length = 103752 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 397 ctctcttctttctctctccat 417 ||||||||||||||||||||| Sbjct: 77870 ctctcttctttctctctccat 77890
>emb|AL512303.10| Human DNA sequence from clone RP1-249I4 on chromosome 6 Contains the KIAA0441 gene and a putative novel gene, complete sequence Length = 106408 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 395 gtctctcttctttctctctcc 415 ||||||||||||||||||||| Sbjct: 28858 gtctctcttctttctctctcc 28878
>emb|AL449344.5| Human DNA sequence from clone RP11-280L17 on chromosome 9 Contains the 5' end of a novel gene, complete sequence Length = 178473 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 tctttctctctccatatccat 423 ||||||||||||||||||||| Sbjct: 1881 tctttctctctccatatccat 1901
>emb|AL139135.15| Human DNA sequence from clone RP11-463J7 on chromosome 1q31.1-31.3 Contains a coronin actin binding protein 1C (CORO1C) pseudogene, the 3' end of a novel gene and a glycine cleavage system protein H (aminomethyl carrier) (GCSH) pseudogene, complete sequence Length = 165919 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 396 tctctcttctttctctctcca 416 ||||||||||||||||||||| Sbjct: 50217 tctctcttctttctctctcca 50237
>gb|AC115282.2| Homo sapiens chromosome 3 clone RP11-122D19, complete sequence Length = 181061 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 390 atttggtctctcttctttctctctc 414 ||||| ||||||||||||||||||| Sbjct: 57236 atttgatctctcttctttctctctc 57260
>gb|AC006282.4| Arabidopsis thaliana chromosome 2 clone F13K3 map g6825, complete sequence Length = 92376 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 461 gaatccaagtgaaataattgc 481 ||||||||||||||||||||| Sbjct: 43909 gaatccaagtgaaataattgc 43929
>gb|AC092440.5| Homo sapiens BAC clone RP11-453O5 from 4, complete sequence Length = 164781 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 398 tctcttctttctctctccata 418 ||||||||||||||||||||| Sbjct: 19320 tctcttctttctctctccata 19340
>emb|BX648501.1|HSM808649 Homo sapiens mRNA; cDNA DKFZp686G1495 (from clone DKFZp686G1495) Length = 6804 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 tctttctctctccatatccat 423 ||||||||||||||||||||| Sbjct: 4059 tctttctctctccatatccat 4079
>dbj|AB018120.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MWJ3 Length = 42356 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 395 gtctctcttctttctctctcc 415 ||||||||||||||||||||| Sbjct: 14352 gtctctcttctttctctctcc 14372
>emb|AL513424.3|HS109M15 Homo sapiens chromosome 9 BAC RP11-109M15, complete sequence Length = 184365 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 tctttctctctccatatccat 423 ||||||||||||||||||||| Sbjct: 119000 tctttctctctccatatccat 118980
>gb|BC094882.1| Homo sapiens hypothetical gene LOC283846, mRNA (cDNA clone MGC:105000 IMAGE:3093162), complete cds Length = 2436 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 1925 aggaggctgaggcagaaaaa 1944
>gb|BC073943.1| Homo sapiens hypothetical gene LOC283846, mRNA (cDNA clone IMAGE:5396010), partial cds Length = 1158 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 731 aggaggctgaggcagaaaaa 750
>gb|BC061522.1| Homo sapiens hypothetical gene LOC283846, mRNA (cDNA clone MGC:70907 IMAGE:6190707), complete cds Length = 1367 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 940 aggaggctgaggcagaaaaa 959
>gb|AC154400.2| Mus musculus BAC clone RP23-163P4 from chromosome 16, complete sequence Length = 180951 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 396 tctctcttctttctctctccatat 419 |||||||||| ||||||||||||| Sbjct: 136360 tctctcttctctctctctccatat 136337
>ref|XM_510755.1| PREDICTED: Pan troglodytes similar to nuclear pore complex interacting protein (LOC453845), mRNA Length = 685 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 498 aggaggctgaggcagaaaaa 517
>gb|AC169501.2| Mus musculus BAC clone RP24-445O18 from chromosome 17, complete sequence Length = 202078 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 547 gggttaggaggctgaggcag 566 |||||||||||||||||||| Sbjct: 139414 gggttaggaggctgaggcag 139433
>ref|XM_450211.1| Oryza sativa (japonica cultivar-group), mRNA Length = 949 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 396 tctctcttctttctctctcc 415 |||||||||||||||||||| Sbjct: 34 tctctcttctttctctctcc 53
>gb|DP000016.1| Pan troglodytes target 1 genomic scaffold Length = 1623484 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 380 tgggacaaaaatttggtctc 399 |||||||||||||||||||| Sbjct: 834642 tgggacaaaaatttggtctc 834661
>gb|AC163207.6| Mus musculus chromosome 1, clone RP24-137J11, complete sequence Length = 169102 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 21808 aggaggctgaggcagaaaaa 21789
>gb|AC161520.6| Mus musculus chromosome 7, clone RP24-282D19, complete sequence Length = 165232 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 595 ctaaaccaccagccaacgag 614 |||||||||||||||||||| Sbjct: 134084 ctaaaccaccagccaacgag 134065
>gb|AC157936.5| Mus musculus chromosome 5, clone RP24-246K15, complete sequence Length = 178000 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 550 ttaggaggctgaggcagaaa 569 |||||||||||||||||||| Sbjct: 113152 ttaggaggctgaggcagaaa 113171
>gb|AE008471.1| Streptococcus pneumoniae R6 section 87 of 184 of the complete genome Length = 10029 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 486 acaaggaaaaatggcatcct 505 |||||||||||||||||||| Sbjct: 3843 acaaggaaaaatggcatcct 3862
>gb|AY850394.1| Lycopersicon esculentum cultivar Heinz1706 chromosome 12 centromeric region Length = 326112 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 396 tctctcttctttctctctcc 415 |||||||||||||||||||| Sbjct: 185160 tctctcttctttctctctcc 185179
>gb|AY020333.1| Oryza sativa microsatellite MRG2658 containing (GA)X14, genomic sequence Length = 228 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 396 tctctcttctttctctctcc 415 |||||||||||||||||||| Sbjct: 215 tctctcttctttctctctcc 196
>gb|AC120527.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0011J22 map R10571S, complete sequence Length = 154441 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 394 ggtctctcttctttctctct 413 |||||||||||||||||||| Sbjct: 138167 ggtctctcttctttctctct 138186
>gb|AC166643.7| Mus musculus chromosome 18, clone RP24-241J8, complete sequence Length = 173501 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 gcaacctcctggcacaaggt 342 |||||||||||||||||||| Sbjct: 76636 gcaacctcctggcacaaggt 76655
>gb|AC152065.4| Mus musculus BAC clone RP23-16D9 from chromosome 12, complete sequence Length = 226392 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 396 tctctcttctttctctctcc 415 |||||||||||||||||||| Sbjct: 159076 tctctcttctttctctctcc 159095
>gb|AC162854.7| Mus musculus chromosome 1, clone RP24-335B5, complete sequence Length = 162297 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 550 ttaggaggctgaggcagaaa 569 |||||||||||||||||||| Sbjct: 133385 ttaggaggctgaggcagaaa 133366
>gb|AY714780.1| Homo sapiens carboxypeptidase B2 (plasma, carboxypeptidase U) (CPB2) gene, complete cds Length = 55829 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 40277 aggaggctgaggcagaaaaa 40258
>gb|AC130138.9| Rattus norvegicus 2 BAC CH230-204B23 (Children's Hospital Oakland Research Institute) complete sequence Length = 189178 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 595 ctaaaccaccagccaacgag 614 |||||||||||||||||||| Sbjct: 173435 ctaaaccaccagccaacgag 173416
>ref|XM_365020.1| Magnaporthe grisea 70-15 hypothetical protein (MG09865.4) partial mRNA Length = 1404 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 221 agactgtcgatgttgctgct 240 |||||||||||||||||||| Sbjct: 1115 agactgtcgatgttgctgct 1134
>gb|AY679523.1| Homo sapiens cell division cycle 2-like 5 (cholinesterase-related cell division controller) (CDC2L5) gene, complete cds Length = 148952 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 65596 aggaggctgaggcagaaaaa 65577
>gb|AY298979.1|AY298978S2 Meleagris gallopavo beta-actin gene, intron 3 Length = 307 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 555 aggctgaggcagaaaaagactgca 578 ||||||||| |||||||||||||| Sbjct: 134 aggctgaggaagaaaaagactgca 111
>gb|AC148824.5| Pan troglodytes BAC clone CH251-507H8 from chromosome 7, complete sequence Length = 189932 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 51478 aggaggctgaggcagaaaaa 51497
>gb|AC084310.16| Mus musculus chromosome 1, clone RP23-10C10, complete sequence Length = 194800 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 396 tctctcttctttctctctcc 415 |||||||||||||||||||| Sbjct: 70901 tctctcttctttctctctcc 70882
>ref|NG_005305.1| Homo sapiens sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3/GIY-YIG domain containing 1 region (SULT1A3/GIYD1@) on chromosome 16 Length = 152926 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 40352 aggaggctgaggcagaaaaa 40333
>gb|AC087729.2| Pan troglodytes clone RP43-143F17, complete sequence Length = 208928 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 380 tgggacaaaaatttggtctc 399 |||||||||||||||||||| Sbjct: 136083 tgggacaaaaatttggtctc 136102
>gb|AC147040.3| Pan troglodytes BAC clone RP43-121E14 from 7, complete sequence Length = 142854 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 22450 aggaggctgaggcagaaaaa 22469
>gb|AC142405.4| Mus musculus BAC clone RP24-559P3 from chromosome 5, complete sequence Length = 144109 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 396 tctctcttctttctctctcc 415 |||||||||||||||||||| Sbjct: 117415 tctctcttctttctctctcc 117396
>gb|AC087252.3| Papio anubis clone RP41-265N24, complete sequence Length = 179525 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 380 tgggacaaaaatttggtctc 399 |||||||||||||||||||| Sbjct: 6676 tgggacaaaaatttggtctc 6695
>gb|AC115860.9| Mus musculus chromosome 1, clone RP24-290C11, complete sequence Length = 240785 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 103207 aggaggctgaggcagaaaaa 103226
>gb|AF165141.4| Homo sapiens chromosome 8 clone XX-224L15 map 8q21.13, complete sequence Length = 46919 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 550 ttaggaggctgaggcagaaa 569 |||||||||||||||||||| Sbjct: 34032 ttaggaggctgaggcagaaa 34051
>gb|AC084697.4| Homo sapiens chromosome 8 clone XX-6L9 map q21.13, complete sequence Length = 107517 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 550 ttaggaggctgaggcagaaa 569 |||||||||||||||||||| Sbjct: 59098 ttaggaggctgaggcagaaa 59117
>gb|AC110566.17| Mus musculus chromosome 5, clone RP23-300A10, complete sequence Length = 175471 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 550 ttaggaggctgaggcagaaa 569 |||||||||||||||||||| Sbjct: 11186 ttaggaggctgaggcagaaa 11205
>gb|AY498718.1| Homo sapiens pps22-1 protein mRNA, partial cds Length = 321 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 50 aggaggctgaggcagaaaaa 69
>ref|XM_849264.1| PREDICTED: Canis familiaris similar to FLJ44048 protein (LOC611582), mRNA Length = 10485 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 564 cagaaaaagactgcatgagc 583 |||||||||||||||||||| Sbjct: 6869 cagaaaaagactgcatgagc 6888
>gb|AC121604.3| Mus musculus BAC clone RP23-312E2 from chromosome 8, complete sequence Length = 209383 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 395 gtctctcttctttctctctc 414 |||||||||||||||||||| Sbjct: 95021 gtctctcttctttctctctc 95002
>gb|AC106873.3| Homo sapiens BAC clone RP11-374M7 from 7, complete sequence Length = 99596 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 380 tgggacaaaaatttggtctc 399 |||||||||||||||||||| Sbjct: 32907 tgggacaaaaatttggtctc 32926
>gb|AC072061.8| Homo sapiens BAC clone RP11-467D6 from 7, complete sequence Length = 167852 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 147772 aggaggctgaggcagaaaaa 147753
>gb|AC113110.17| Mus musculus chromosome 16, clone RP23-328A9, complete sequence Length = 240173 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 396 tctctcttctttctctctccatat 419 |||||||||| ||||||||||||| Sbjct: 236105 tctctcttctctctctctccatat 236128
>gb|AC115410.4| Rattus norvegicus 2 BAC CH230-46P5 (Children's Hospital Oakland Research Institute) complete sequence Length = 232501 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 396 tctctcttctttctctctcc 415 |||||||||||||||||||| Sbjct: 119160 tctctcttctttctctctcc 119179
>gb|AC012645.7| Homo sapiens chromosome 16 clone RP11-455F5, complete sequence Length = 192943 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 160736 aggaggctgaggcagaaaaa 160717
>gb|AC136018.5| Mus musculus BAC clone RP24-125E6 from chromosome 7, complete sequence Length = 210491 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 595 ctaaaccaccagccaacgag 614 |||||||||||||||||||| Sbjct: 147960 ctaaaccaccagccaacgag 147979
>gb|AC146043.2| Pan troglodytes BAC clone RP43-109E16 from 7, complete sequence Length = 154413 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 120218 aggaggctgaggcagaaaaa 120237
>gb|AC124550.4| Mus musculus BAC clone RP23-211F21 from chromosome 1, complete sequence Length = 204588 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 77302 aggaggctgaggcagaaaaa 77283
>gb|AC109364.6| Mus musculus BAC clone RP23-127N24 from chromosome 17, complete sequence Length = 198838 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 547 gggttaggaggctgaggcag 566 |||||||||||||||||||| Sbjct: 52307 gggttaggaggctgaggcag 52326
>gb|AC004381.1|HUAC004381 Homo sapiens Chromosome 16 BAC clone CIT987SK-44M2, complete sequence Length = 213541 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 117588 aggaggctgaggcagaaaaa 117569
>gb|AC002044.1|HUAC002044 Human Chromosome 16 BAC clone CIT987SK-A-418G10, complete sequence Length = 218074 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 165372 aggaggctgaggcagaaaaa 165353
>gb|AC015884.15| Homo sapiens chromosome 17, clone RP11-216P6, complete sequence Length = 207661 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 543 gctggggttaggaggctgaggcag 566 |||||||| ||||||||||||||| Sbjct: 42182 gctggggtcaggaggctgaggcag 42205
>gb|AC073530.18| Homo sapiens 12 BAC RP11-123O10 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 156390 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 396 tctctcttctttctctctccatat 419 |||||||||| ||||||||||||| Sbjct: 128866 tctctcttctctctctctccatat 128889
>gb|AC012569.18| Homo sapiens chromosome , clone RP11-8H2, complete sequence Length = 153276 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 4928 aggaggctgaggcagaaaaa 4909
>gb|AC005537.2| Homo sapiens BAC clone GS1-308H5 from 7, complete sequence Length = 176750 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 23471 aggaggctgaggcagaaaaa 23490
>gb|AC107736.10| Mus musculus chromosome 7, clone RP23-354B2, complete sequence Length = 272413 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 558 ctgaggcagaaaaagactgcatga 581 ||||||||||||||| |||||||| Sbjct: 43116 ctgaggcagaaaaagtctgcatga 43139
>gb|AC073270.6| Homo sapiens BAC clone RP11-468B6 from 7, complete sequence Length = 188679 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 28659 aggaggctgaggcagaaaaa 28640
>gb|AC078942.7| Homo sapiens BAC clone RP11-554E10 from 7, complete sequence Length = 111061 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 75400 aggaggctgaggcagaaaaa 75381
>gb|AC004910.2| Homo sapiens PAC clone RP5-859M6 from 7, complete sequence Length = 102703 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 100661 aggaggctgaggcagaaaaa 100642
>gb|AC004894.1| Homo sapiens PAC clone RP4-808G16 from 7, complete sequence Length = 164511 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 934 aggaggctgaggcagaaaaa 953
>gb|DQ249182.1| Homo sapiens isolate 541CLS41 haplotype HLA-B5001/HLA-Cw0602 genomic sequence Length = 346809 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 187017 aggaggctgaggcagaaaaa 187036
>gb|DQ249181.1| Homo sapiens isolate 541CLS37 haplotype HLA-B070201/HLA-Cw07020103 genomic sequence Length = 341361 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 190054 aggaggctgaggcagaaaaa 190073
>gb|DQ249180.1| Homo sapiens isolate 495CLS44 haplotype HLA-B570101/HLA-Cw0602 genomic sequence Length = 265420 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 190182 aggaggctgaggcagaaaaa 190201
>gb|DQ249179.1| Homo sapiens isolate 495CLS7 haplotype HLA-B3801/HLA-Cw120301 genomic sequence Length = 338517 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 186319 aggaggctgaggcagaaaaa 186338
>gb|DQ249177.1| Homo sapiens isolate 218CLS60 haplotype HLA-B15010101/HLA-Cw030401 genomic sequence Length = 351341 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 201962 aggaggctgaggcagaaaaa 201981
>gb|DQ249176.1| Homo sapiens isolate 218CLS51 haplotype HLA-B140201/HLA-Cw0802 genomic sequence Length = 363675 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 201738 aggaggctgaggcagaaaaa 201757
>gb|DQ249175.1| Homo sapiens isolate 144CLS7 haplotype HLA-B3801/HLA-Cw120301 genomic sequence Length = 328871 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 187304 aggaggctgaggcagaaaaa 187323
>gb|DQ249174.1| Homo sapiens isolate 144CLS49 haplotype HLA-B080101/HLA-Cw070101 genomic sequence Length = 338544 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 197980 aggaggctgaggcagaaaaa 197999
>gb|DQ249173.1| Homo sapiens isolate 135CLS51 haplotype HLA-B140201/HLA-Cw0802 genomic sequence Length = 336776 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 180843 aggaggctgaggcagaaaaa 180862
>gb|DQ249172.1| Homo sapiens isolate 135CLS49 haplotype HLA-B080101/HLA-Cw070101 genomic sequence Length = 342745 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 178593 aggaggctgaggcagaaaaa 178612
>gb|AC142351.1| Pan troglodytes BAC clone RP43-21J15 from 7, complete sequence Length = 159635 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 75596 aggaggctgaggcagaaaaa 75615
>gb|AC146208.2| Pan troglodytes BAC clone RP43-34A11 from 7, complete sequence Length = 169225 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 5724 aggaggctgaggcagaaaaa 5705
>gb|BC110658.1| Homo sapiens cDNA clone IMAGE:6069264, **** WARNING: chimeric clone **** Length = 3090 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 2587 aggaggctgaggcagaaaaa 2606
>gb|AC106782.5| Homo sapiens chromosome 16 clone RP11-347C12, complete sequence Length = 181001 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 32426 aggaggctgaggcagaaaaa 32407
>emb|BX088580.11| Human DNA sequence from clone DASS-209N9 on chromosome 6, complete sequence Length = 48454 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 30501 aggaggctgaggcagaaaaa 30482
>emb|AL731535.6| Human DNA sequence from clone RP11-534N5 on chromosome 10 Contains the 5' end of a novel gene (KIAA0592) and one CpG island, complete sequence Length = 34521 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 16988 aggaggctgaggcagaaaaa 16969
>emb|AL773544.5| Human DNA sequence from clone DAQB-185I1 on chromosome 6 Contains the C6orf15 gene for chromosome 6 open reading frame 15, the CDSN gene for corneodesmosin, the PSORS1C1 gene for psoriasis susceptibility 1 candidate 1, the PSORS1C2 gene for psoriasis susceptibility 1 candidate 2, the POLR2LP pseudogene for polymerase (RNA) II (DNA directed) polypeptide L, the C6orf18 gene for chromosome 6 open reading frame 18, the TCF19 gene for transcription factor 19 (SC1), the POU5F1 gene for POU domain, class 5, transcription factor 1, the PSORS1C3 gene for psoriasis susceptibility 1 candidate 3, and 1 CpG island, complete sequence Length = 113388 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 110815 aggaggctgaggcagaaaaa 110796
>emb|AL954360.3| Human DNA sequence from clone RP11-98I6 on chromosome 10 Contains a novel protein similar to KIAA0592, solute carrier family 9 member 3 (SLC9A3) pseudogene and novel protein similar to N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2 (ASAH2), complete sequence Length = 163231 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 7958 aggaggctgaggcagaaaaa 7939
>emb|AL772400.3| Human DNA sequence from clone RP11-540N4 on chromosome X Contains the 3' end of the PRPS1 gene for phosphoribosyl pyrophosphate synthetase 1 (PRSI), complete sequence Length = 74714 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 249 aggaggctgaggcagaaaaa 230
>emb|AL606807.34| Human DNA sequence from clone RP11-316P17 on chromosome 9 Contains a novel gene and a CpG island, complete sequence Length = 59078 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 53700 aggaggctgaggcagaaaaa 53719
>emb|AL662844.12| Human DNA sequence from clone XXbac-299F13 on chromosome 6 contains the gene for STG protein, the CDSN gene for corneodesmosin, the gene for SEEK1 protein, the gene for SPR1 protein, the gene for HCR, the TCF19 gene for transcription factor 19, the POU5F1 gene for POU domain, class 5, transcription factor 1, a putative novel transcript and four CpG islands, complete sequence Length = 204298 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 128457 aggaggctgaggcagaaaaa 128438
>emb|AL645465.15| Human DNA sequence from clone RP11-518L10 on chromosome 1 Contains the gene for a novel protein, a novel gene, a TGFB-induced factor 2 (TALE family homeobox) (TGIF2) pseudogene and the 3' end of the ADSS gene for adenylosuccinate synthase, complete sequence Length = 80142 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 16004 aggaggctgaggcagaaaaa 16023
>emb|AL713888.10| Human DNA sequence from clone RP11-524O24 on chromosome 10 Contains the SLC25A16 gene for member 16 solute carrier family 25 (mitochondrial carrier; Graves disease autoantigen), a ribosomal protein L26 (RPL26) pseudogene, a novel pseudogene, the 5' end of the gene for leukemia-associated protein with a CXXC domain (LCX) and two CpG islands, complete sequence Length = 141221 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 549 gttaggaggctgaggcagaa 568 |||||||||||||||||||| Sbjct: 105373 gttaggaggctgaggcagaa 105354
>emb|AL671972.8| Human DNA sequence from clone RP11-341A19 on chromosome 10 Contains the 3' end of the MRF2 gene for modulator recognition factor 2, complete sequence Length = 163336 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 157689 aggaggctgaggcagaaaaa 157670
>emb|AL662833.4| Human DNA sequence from clone XXbac-101P6 on chromosome 6 contains the gene for HCR, the TCF19 gene for transcription factor 19, the POU5F1 gene for POU domain, class 5, transcription factor 1, a putative novel transcript, the HLA-C gene for major histocompatibility complex, class I, C, a ubiquitin specific protease 8 (USP8) pseudogene, a ribosomal protein L3 (RPL3) pseudogene, a WAS protein family, member 3 (WASF3) pseudogene and three CpG islands, complete sequence Length = 168887 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 50156 aggaggctgaggcagaaaaa 50137
>emb|AL589764.19| Human DNA sequence from clone RP11-806J18 on chromosome 1 Contains the PSMB4 gene for proteasome (prosome, macropain) subunit beta type 4, the POGZ gene for pogo transposable element with ZNF domain and two CpG islands, complete sequence Length = 126491 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 84629 aggaggctgaggcagaaaaa 84610
>emb|AL589794.7| Human DNA sequence from clone RP11-564C4 on chromosome 10 Contains the 3' end of the gene for apobec-1 complementation factor (ACF) (ASP), the gene for a novel protein similar to N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2 (ASAH2), the cathepsin L-like 2 (CTSLL2) pseudogene, three novel pseudogenes (KIAA1553), a novel gene, a protein geranylgeranyltransferase type I beta subunit (PGGT1B) pseudogene and a CpG island, complete sequence Length = 178899 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 88984 aggaggctgaggcagaaaaa 89003
>emb|AL513492.10| Human DNA sequence from clone RP11-365P20 on chromosome 6, complete sequence Length = 113677 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 81719 aggaggctgaggcagaaaaa 81738
>emb|AL590559.3| Human DNA sequence from clone RP11-393N21 on chromosome 1 Contains the 5' end of the gene for PAI-1 mRNA-binding protein (PAI-RBP1), a poly(A) binding protein, cytoplasmic 4 (PABPC4) pseudogene, a novel gene and a CpG island, complete sequence Length = 150651 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 140426 aggaggctgaggcagaaaaa 140407
>emb|AL451054.22| Human DNA sequence from clone RP11-275O4 on chromosome 1 Contains two tubulin beta pseudogenes, a novel gene, the 5' end of a novel protein (MGC42493) and four CpG islands, complete sequence Length = 147567 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 126226 aggaggctgaggcagaaaaa 126207
>emb|AL512343.21| Human DNA sequence from clone RP11-396C23 on chromosome 1 Contains the H3F3A gene for H3 histone, family 3A, a nove gene and four CpG islands, complete sequence Length = 105087 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 396 tctctcttctttctctctcc 415 |||||||||||||||||||| Sbjct: 83047 tctctcttctttctctctcc 83066
>emb|AL513013.12| Human DNA sequence from clone RP5-990P15 on chromosome 1 Contains the 5' end of a novel gene, a novel gene (DKFZp564J047), two novel genes and a CpG island, complete sequence Length = 77001 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 73607 aggaggctgaggcagaaaaa 73626
>gb|AC182351.3| Ateles geoffroyi clone UC1-76C3, complete sequence Length = 212614 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 175578 aggaggctgaggcagaaaaa 175559
>emb|AL391839.9| Human DNA sequence from clone RP11-135A24 on chromosome 10 Contains the 5' end of the EPC1 gene for enhancer of polycomb homolog 1, (Drosophila), the 5' end of the gene for a novel protein (FLJ32762) (FLJ25419), two novel genes and a CpG island, complete sequence Length = 162591 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 59275 aggaggctgaggcagaaaaa 59294
>emb|AL442003.8| Human DNA sequence from clone RP11-324H6 on chromosome 10 Contains the gene for a novel protein similar to ARF GTPase-activating protein (MRIP2), the 3' end of the gene for translocase of inner mitochondrial membrane 23 (TIMM23), a novel gene, a solute carrier family 9 isoform 3 (SLC9A3) pseudogene, a novel gene, the 5' end of gene FLJ10824, a pseudogene similar to part of KIAA0592/FLJ10824 and two CpG islands, complete sequence Length = 163570 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 121400 aggaggctgaggcagaaaaa 121381
>emb|AL391121.29| Human DNA sequence from clone RP11-47A8 on chromosome 10 Contains the 3' end of the SUFU gene for suppressor of fused homolog (Drosophila), the TRIM8 gene for tripartite motif-containing 8, the ARL3 gene for ADP-ribosylation factor-like 3, the SFXN2 gene for sideroflexin 2 and three CpG islands, complete sequence Length = 166600 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 135424 aggaggctgaggcagaaaaa 135405
>emb|AL390715.23| Human DNA sequence from clone RP11-167O6 on chromosome 10 Contains the ARHGAP12 gene for Rho GTPase activating protein 12 and two CpG islands, complete sequence Length = 189161 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 550 ttaggaggctgaggcagaaa 569 |||||||||||||||||||| Sbjct: 161655 ttaggaggctgaggcagaaa 161674
>emb|AL360169.17| Human DNA sequence from clone RP11-732M18 on chromosome 6 Contains the 5' end of the gene for tubby super-family protein (TUSP, KIAA1397), a novel gene, part of a novel gene and two CpG islands, complete sequence Length = 180635 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 156488 aggaggctgaggcagaaaaa 156507
>emb|AL357121.30| Human DNA sequence from clone RP11-381J15 on chromosome 6 Contains parts of 2 novel genes, complete sequence Length = 53985 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 7320 aggaggctgaggcagaaaaa 7339
>emb|AL359195.24| Human DNA sequence from clone RP11-36D19 on chromosome 10 Contains part of a pseudogene similar to nuclear pore complex interacting proteins (NPIP), a eukaryotic translation initiation factor 5A (EIF5A) pseudogene, the MAT1A gene for methionine adenosyltransferase I alpha, a novel zinc finger protein pseudogene, three novel genes, the 5' end of the gene for a novel protein (MGC4248) and three CpG islands, complete sequence Length = 171148 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 417 tatccattaaaagcaataat 436 |||||||||||||||||||| Sbjct: 137370 tatccattaaaagcaataat 137389
>emb|AL358073.24| Human DNA sequence from clone RP11-458I7 on chromosome 1 Contains the 5' end of the ZA20D1 gene for zinc finger, A20 domain containing 1, a ribosomal protein L6 (RPL6) pseudogene, the VPS45A gene for vacuolar protein sorting 45A (yeast), the gene for CK2 interacting protein 1; HQ0024c protein (CKIP-1), a novel gene and a CpG island, complete sequence Length = 188211 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 12102 aggaggctgaggcagaaaaa 12121
>emb|AL359180.17| Human DNA sequence from clone RP11-320G21 on chromosome 13, complete sequence Length = 159229 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 84317 aggaggctgaggcagaaaaa 84336
>emb|AL357336.11| Human DNA sequence from clone RP11-373N18 on chromosome 10 Contains a novel gene, the 3' end of a novel gene and a CpZG island, complete sequence Length = 54727 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 380 tgggacaaaaatttggtctc 399 |||||||||||||||||||| Sbjct: 40455 tgggacaaaaatttggtctc 40474
>emb|AL356971.10| Human DNA sequence from clone RP11-58A9 on chromosome 6, complete sequence Length = 116576 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 9626 aggaggctgaggcagaaaaa 9645
>emb|AL355574.27| Human DNA sequence from clone RP11-432J22 on chromosome 9 Contains the 5' end of gene DKFZp434G2311, a novel gene, the GDBR1 gene for putative glialblastoma cell differentiation-related, 3' end of gene MGC23427 and five CpG islands, complete sequence Length = 139653 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 125324 aggaggctgaggcagaaaaa 125305
>emb|AL356212.13| Human DNA sequence from clone RP4-686B20 on chromosome 1p31.3-32.3 Contains the 3' end of the AK3 gene for adenylate kinase 3, the 5' end of a variant of the DNAJC6 gene for DnaJ (Hsp40) homolog subfamily C member 6, complete sequence Length = 31403 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 459 aggaggctgaggcagaaaaa 440
>emb|AL356413.11| Human DNA sequence from clone RP11-498F10 on chromosome 13, complete sequence Length = 146278 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 400 tcttctttctctctccatat 419 |||||||||||||||||||| Sbjct: 12234 tcttctttctctctccatat 12215
>emb|AL355989.11| Human DNA sequence from clone RP11-272J7 on chromosome 10 Contains a transcription elongation factor B (SIII) pseudogene, a novel gene, a heterogeneous nuclear ribonucleoprotein A3 (HNRPA3) pseudogene gene and a CpG island, complete sequence Length = 161451 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 53895 aggaggctgaggcagaaaaa 53876
>emb|AL356269.10| Human DNA sequence from clone RP11-420J12 on chromosome 13, complete sequence Length = 141895 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 140762 aggaggctgaggcagaaaaa 140781
>emb|AL356104.6| Human DNA sequence from clone RP11-356J7 on chromosome 1 Contains the 3' end of the ARHGEF11 gene for Rho guanine nucleotide exchange factor (GEF) 11, a novel gene (FLJ32884), the 3' end of the gene for a novel protein similar to mouse Jedi soluble isoform 736 and three CpG islands, complete sequence Length = 96693 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 20921 aggaggctgaggcagaaaaa 20902
>emb|AL354932.26| Human DNA sequence from clone RP11-117L21 on chromosome 9 Contains the 5' end of the MELK gene for maternal embryonic leucine zipper kinase (KIAA0175) and two CpG islands, complete sequence Length = 155989 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 139540 aggaggctgaggcagaaaaa 139521
>emb|AL162505.20| Human DNA sequence from clone RP11-327D19 on chromosome 20 Contains the 5' end of two variants of the CBFA2T2 gene for runt domain core-binding factor alpha subunit 2 and a CpG island, complete sequence Length = 77498 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 28152 aggaggctgaggcagaaaaa 28171
>emb|AL354721.18| Human DNA sequence from clone RP11-373E22 on chromosome 1 Contains part of gene DKFZP566D1346, complete sequence Length = 57070 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 18336 aggaggctgaggcagaaaaa 18317
>emb|AL354928.9| Human DNA sequence from clone RP11-175D17 on chromosome 9 Contains the 5' end of the NR6A1 gene for nuclear receptor (subfamily 6, group A) member 1, three novel genes, the RPL35 gene for ribosomal protein L35, the gene for a hypothetical protein similar to actin related protein 2/3 complex subunit 5 (MGC3038), the 3' end of the GOLGA1 gene for golgi autoantigen (golgin subfamily a, 1) and six CpG islands, complete sequence Length = 176539 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 19801 aggaggctgaggcagaaaaa 19820
>emb|AL158829.14| Human DNA sequence from clone RP11-406O23 on chromosome 9 Contains part of the AKAP2 (PALM2) gene for A kinase (PRKA) anchor protein 2 (paralemmin 2), a novel gene and a CpG island, complete sequence Length = 136723 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 85611 aggaggctgaggcagaaaaa 85630
>gb|AC087215.5| Papio anubis clone RP41-455I14, complete sequence Length = 68430 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 64236 aggaggctgaggcagaaaaa 64217
>emb|AL139350.17| Human DNA sequence from clone RP11-307O10 on chromosome 20 Contains part of a novel gene, an EST, an STS and GSSs, complete sequence Length = 181585 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 17151 aggaggctgaggcagaaaaa 17132
>emb|AL157758.10| Human DNA sequence from clone RP11-106H11 on chromosome 13 Contains the 5' end of a novel gene (contains FLJ31860 and KIAA0853), possible ortholog of mouse 3110050K21Rik protein, the 3' end of the CPB2 gene for carboxypeptidase B2 (plasma, carboxypeptidase U) and a CpG island, complete sequence Length = 58097 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 53186 aggaggctgaggcagaaaaa 53205
>emb|AL138878.10| Human DNA sequence from clone RP11-288G3 on chromosome 6 Contains the 3' end of the RIOK1 gene for RIO kinase 1 (yeast), a hetergeneous riboprotein L (HNRNP L) pseudogene, a ribosomal protein S26 pseudogene and a isocitrate dehydrogenase 1 (IDH1) pseudogene, complete sequence Length = 128320 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 68524 aggaggctgaggcagaaaaa 68543
>emb|AL138741.13| Human DNA sequence from clone RP3-516D24 on chromosome 6, complete sequence Length = 67372 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 1424 aggaggctgaggcagaaaaa 1405
>emb|AL137787.11| Human DNA sequence from clone RP5-1070B1 on chromosome Xq22.1-23 Contains the 3' end of a novel gene, a novel gene (KIAA1817) and the 5' end of the PRPS1 for phosphoribosyl pyrophosphate synthetase 1 (PRSI) gene, complete sequence Length = 89446 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 87695 aggaggctgaggcagaaaaa 87676
>gb|AC117509.9| Homo sapiens 3 BAC RP11-31B16 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 113201 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 82971 aggaggctgaggcagaaaaa 82952
>emb|AL133282.15| Human DNA sequence from clone RP11-264C15 on chromosome 9q32-34.11 Contains part of the ASTN2 gene for astrotactin2 (KIAA0634) and a novel gene, complete sequence Length = 130526 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 126753 aggaggctgaggcagaaaaa 126772
>emb|AL122007.7|HSJ757N13 Human DNA sequence from clone RP4-757N13 on chromosome 1p13.1-13.3 Contains the 3' end of the GDAP2 gene for ganglioside induced differentiation associated protein 2, complete sequence Length = 69867 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 55781 aggaggctgaggcagaaaaa 55762
>emb|AL035662.65|HS599F21 Human DNA sequence from clone RP4-599F21 on chromosome 20q12-13.12 Contains the 5' end of the NCOA5 gene for nuclear receptor coactivator 5, the RPL13P2 gene for ribosomal protein L13 pseudogene 2, the TNFRSF5 gene for tumor necrosis factor receptor superfamily member 5 and two CpG islands, complete sequence Length = 95283 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 396 tctctcttctttctctctcc 415 |||||||||||||||||||| Sbjct: 47639 tctctcttctttctctctcc 47620 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 396 tctctcttctttctctctcc 415 |||||||||||||||||||| Sbjct: 47417 tctctcttctttctctctcc 47398
>emb|AL034419.22|HS1108D11 Human DNA sequence from clone RP5-1108D11 on chromosome 20q12-13.11 Contains the 3' end of the JPH2 gene for junctophilin 2 (JP2, JP-2), the 3' end of the C20orf100 gene for a novel HMG (high mobility group) box protein similar to KIAA0737, KIAA0808 and TNRC9 (CAGF9) and two CpG islands, complete sequence Length = 152209 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 36779 aggaggctgaggcagaaaaa 36798
>emb|AL035415.22|HS705F19 Human DNA sequence from clone RP4-705F19 on chromosome 1p32.2-34.2 Contains the 5' end of the SSBP3 gene for single stranded DNA binding protein 3, two novel genes and a CpG island, complete sequence Length = 136502 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 99851 aggaggctgaggcagaaaaa 99832
>emb|AL035089.21|HS1030M6 Human DNA sequence from clone RP5-1030M6 on chromosome 20q12-13.2 Contains the 5' end of the C20orf100 gene for a novel HMG (high mobility group) box protein similar to KIAA0808, two novel genes and two CpG islands, complete sequence Length = 173804 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 32035 aggaggctgaggcagaaaaa 32016
>emb|AL024498.13|HS417M14 Human DNA sequence from clone RP3-417M14 on chromosome 6p23-25.1 Contains a novel gene, the gene for a novel serine/threonine-protein kinase (possible ortholog of rodent MAK (male germ cell-associated kinase), the 3' end of the GCMB gene for glial cells missing (Drosophila) homolog b and a CpG island, complete sequence Length = 144189 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 83118 aggaggctgaggcagaaaaa 83137
>emb|AL031597.7|HS996D20 Human DNA sequence from clone RP5-996D20 on chromosome 22q13.31-13.32, complete sequence Length = 98100 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 46999 aggaggctgaggcagaaaaa 46980
>emb|AL031577.1|HS391O22 Human DNA sequence from clone RP3-391O22 on chromosome 6p21.2-21.31 Contains a ribosomal protein L44 (RPL44) pseudogene, the 3' end of gene FLJ32402, a ribosomal protein L7 (RPL7) pseudogene and an interferon induced transmembrane protein 2 (1-8D) or 3 (1-8U) (IFITM2, IFITM3) pseudogene, complete sequence Length = 126807 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 23108 aggaggctgaggcagaaaaa 23127
>gb|AC008534.7| Homo sapiens chromosome 5 clone CTC-484P3, complete sequence Length = 253402 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 252368 aggaggctgaggcagaaaaa 252349
>gb|AC026110.42| Homo sapiens 12 BAC RP11-434E3 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 153190 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 549 gttaggaggctgaggcagaa 568 |||||||||||||||||||| Sbjct: 25994 gttaggaggctgaggcagaa 26013
>gb|AC073493.27| Homo sapiens Xp BAC RP11-631N21 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 211422 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 30149 aggaggctgaggcagaaaaa 30130
>emb|Y11463.1|SPDNAGCPO Streptococcus pneumoniae dnaG, rpoD, cpoA genes and ORF3 and ORF5 Length = 4061 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 486 acaaggaaaaatggcatcct 505 |||||||||||||||||||| Sbjct: 2563 acaaggaaaaatggcatcct 2582
>gb|AC090255.4| Homo sapiens chromosome 8, clone RP11-34M16, complete sequence Length = 145705 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 550 ttaggaggctgaggcagaaa 569 |||||||||||||||||||| Sbjct: 45708 ttaggaggctgaggcagaaa 45727
>gb|AC116715.22| Mus musculus chromosome 5, clone RP23-129N14, complete sequence Length = 193245 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 550 ttaggaggctgaggcagaaa 569 |||||||||||||||||||| Sbjct: 5861 ttaggaggctgaggcagaaa 5842
>gb|AC006269.13| Homo sapiens chromosome , clone RP11-515E23, complete sequence Length = 167229 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 550 ttaggaggctgaggcagaaa 569 |||||||||||||||||||| Sbjct: 720 ttaggaggctgaggcagaaa 739
>gb|AC009124.8| Homo sapiens chromosome 16 clone RP11-489A11, complete sequence Length = 168268 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 17224 aggaggctgaggcagaaaaa 17205
>emb|AL646051.19| Mouse DNA sequence from clone RP23-222M22 on chromosome 11 Contains the 5' end of the Hs3st3a gene for heparan sulfate (glucosamine) 3-O-sulfotransferase 3A and a CpG island, complete sequence Length = 144847 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 408 ctctctccatatccattaaa 427 |||||||||||||||||||| Sbjct: 139825 ctctctccatatccattaaa 139844
>emb|AL663014.3|OSJN00212 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0067G11, complete sequence Length = 156983 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 500 catccttgagcacctttcgacataaaat 527 |||| ||||||||||||| ||||||||| Sbjct: 43882 catctttgagcacctttcaacataaaat 43855
>gb|AF458661.1| Homo sapiens tropomyosin-like gene, partial sequence Length = 2239 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 380 tgggacaaaaatttggtctc 399 |||||||||||||||||||| Sbjct: 1247 tgggacaaaaatttggtctc 1228
>emb|AJ006345.1|HSA6345 Homo sapiens KVLQT1 gene Length = 404123 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 322100 aggaggctgaggcagaaaaa 322119
>emb|CR936848.6| Mouse DNA sequence from clone DN-315E9 on chromosome 3, complete sequence Length = 144824 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 548 ggttaggaggctgaggcagaaaaa 571 |||||||||||||||||| ||||| Sbjct: 42650 ggttaggaggctgaggcacaaaaa 42673
>emb|CR388229.14| Human DNA sequence from clone DADB-104B20 on chromosome 6, complete sequence Length = 121659 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 30795 aggaggctgaggcagaaaaa 30776
>emb|BX927346.12| Zebrafish DNA sequence from clone CH211-168M18 in linkage group 5, complete sequence Length = 141135 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 550 ttaggaggctgaggcagaaaaaga 573 ||||||||| |||||||||||||| Sbjct: 41820 ttaggaggcagaggcagaaaaaga 41843
>emb|AL929371.6| Mouse DNA sequence from clone RP23-176O5 on chromosome 11 Contains a ribosomal protein S2 (Rps2) pseudogene, a novel gene, an apurinic/apyrimidinic endonuclease 2 (Apex2) pseudogene, the Rtn4 gene for reticulon 4, the 3' end of the gene for a novel protein (C230094A16Rik) (MGC38936) and a CpG island, complete sequence Length = 212042 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 396 tctctcttctttctctctcc 415 |||||||||||||||||||| Sbjct: 16762 tctctcttctttctctctcc 16781
>gb|AC021424.6| Homo sapiens chromosome 11, clone RP11-38L8, complete sequence Length = 181025 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 60824 aggaggctgaggcagaaaaa 60805
>emb|CR847794.5| Human DNA sequence from clone DAMA-213L4 on chromosome 6, complete sequence Length = 59046 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 47114 aggaggctgaggcagaaaaa 47095
>gb|AC175824.2| Pan troglodytes BAC clone CH251-171H18 from chromosome unknown, complete sequence Length = 146069 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 122450 aggaggctgaggcagaaaaa 122469
>gb|AC012182.7| Homo sapiens chromosome 16 clone RP11-332G1, complete sequence Length = 188926 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 160734 aggaggctgaggcagaaaaa 160715
>gb|AC090160.6| Homo sapiens chromosome 11, clone RP11-413N10, complete sequence Length = 170008 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 2250 aggaggctgaggcagaaaaa 2231
>gb|AC120053.4| Homo sapiens chromosome 8, clone CTD-2006H14, complete sequence Length = 124497 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 549 gttaggaggctgaggcagaa 568 |||||||||||||||||||| Sbjct: 466 gttaggaggctgaggcagaa 485
>gb|AC010834.19| Homo sapiens chromosome 8, clone RP11-10N23, complete sequence Length = 175967 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 549 gttaggaggctgaggcagaa 568 |||||||||||||||||||| Sbjct: 70337 gttaggaggctgaggcagaa 70318
>gb|AC118647.4| Homo sapiens chromosome 18, clone RP11-474O19, complete sequence Length = 71808 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 30888 aggaggctgaggcagaaaaa 30907
>gb|AC126917.1| Homo sapiens chromosome 5 clone RP11-467F22, complete sequence Length = 206737 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 129833 aggaggctgaggcagaaaaa 129852
>emb|CR759815.3| Human DNA sequence from clone DAMC-88G10 on chromosome 6, complete sequence Length = 102782 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 55620 aggaggctgaggcagaaaaa 55601
>gb|AC011061.13| Homo sapiens chromosome 17, clone RP11-12H18, complete sequence Length = 165643 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 81271 aggaggctgaggcagaaaaa 81252
>gb|AC096971.2| Homo sapiens chromosome 3 clone RP11-430J3, complete sequence Length = 163863 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 15024 aggaggctgaggcagaaaaa 15043
>gb|AC009646.12| Homo sapiens chromosome 8, clone RP11-162D9, complete sequence Length = 183519 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 145900 aggaggctgaggcagaaaaa 145881
>gb|AC026122.14| Homo sapiens 12 BAC RP11-902D13 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 184834 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 87562 aggaggctgaggcagaaaaa 87543
>emb|CR627429.1| Homo sapiens mRNA; cDNA DKFZp779O1248 (from clone DKFZp779O1248) Length = 4739 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 4025 aggaggctgaggcagaaaaa 4006
>gb|AC103949.6| Homo sapiens chromosome 18, clone RP11-671P2, complete sequence Length = 177301 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 88505 aggaggctgaggcagaaaaa 88524
>gb|AC011490.7| Homo sapiens chromosome 19 clone CTB-179L3, complete sequence Length = 115289 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 69663 aggaggctgaggcagaaaaa 69682
>gb|AC105021.6| Homo sapiens chromosome 17, clone CTD-2033D24, complete sequence Length = 143552 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 550 ttaggaggctgaggcagaaa 569 |||||||||||||||||||| Sbjct: 26050 ttaggaggctgaggcagaaa 26031
>gb|AC087378.6| Homo sapiens chromosome 11, clone RP11-375L11, complete sequence Length = 166379 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 153180 aggaggctgaggcagaaaaa 153199
>gb|AC095351.5| Homo sapiens X BAC RP11-359C4 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 194296 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 128980 aggaggctgaggcagaaaaa 128961
>gb|AC092940.6| Homo sapiens 3 BAC RP11-128L14 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 164805 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 331 ctggcacaaggttgattaac 350 |||||||||||||||||||| Sbjct: 5981 ctggcacaaggttgattaac 6000
>gb|AC153725.3| Medicago truncatula clone mth2-78c5, complete sequence Length = 137377 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 396 tctctcttctttctctctcc 415 |||||||||||||||||||| Sbjct: 62583 tctctcttctttctctctcc 62602
>dbj|AK128772.1| Homo sapiens cDNA FLJ45371 fis, clone BRHIP3017855, highly similar to Homo sapiens nuclear pore complex interacting protein (NPIP) Length = 4289 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 3868 aggaggctgaggcagaaaaa 3887
>dbj|AK125638.1| Homo sapiens cDNA FLJ43650 fis, clone SYNOV4001342 Length = 2572 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 850 aggaggctgaggcagaaaaa 831
>gb|AC120780.32| Pan troglodytes clone rp43-22b16, complete sequence Length = 193047 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 166666 aggaggctgaggcagaaaaa 166685
>gb|AC158506.9| Pan troglodytes clone rp43-145f17, complete sequence Length = 155707 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 91971 aggaggctgaggcagaaaaa 91990
>gb|AC141418.11| Pan troglodytes clone rp43-121l12, complete sequence Length = 164116 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 7961 aggaggctgaggcagaaaaa 7980
>gb|AC097268.10| Pan troglodytes BAC RP43-43O8 (Roswell Park Cancer Institute) complete sequence Length = 241278 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 104416 aggaggctgaggcagaaaaa 104435
>gb|AC183100.3| Pan troglodytes BAC clone CH251-736D14 from chromosome 16, complete sequence Length = 173550 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 141730 aggaggctgaggcagaaaaa 141711
>emb|BX664707.24| Zebrafish DNA sequence from clone DKEYP-74B6 in linkage group 7, complete sequence Length = 210220 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 119 taagatgacaagtccactagcgag 142 ||||||||||| |||||||||||| Sbjct: 21724 taagatgacaaatccactagcgag 21747
>gb|AC023789.8| Mus musculus chromosome 4 clone RP23-43A16, complete sequence Length = 146120 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 143323 aggaggctgaggcagaaaaa 143342
>gb|AC166601.4| Nomascus leucogenys leucogenys clone CH271-401M10, complete sequence Length = 184404 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 380 tgggacaaaaatttggtctc 399 |||||||||||||||||||| Sbjct: 120799 tgggacaaaaatttggtctc 120818
>gb|AC090573.6| Homo sapiens chromosome 8, clone RP11-440B23, complete sequence Length = 204032 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 549 gttaggaggctgaggcagaa 568 |||||||||||||||||||| Sbjct: 78119 gttaggaggctgaggcagaa 78100
>gb|AC104538.2| Homo sapiens chromosome 19 clone CTB-66B24, complete sequence Length = 54423 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 20909 aggaggctgaggcagaaaaa 20928
>gb|AC103870.3| Homo sapiens chromosome 11, clone RP11-702L21, complete sequence Length = 182598 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 121266 aggaggctgaggcagaaaaa 121247
>gb|AC112195.2| Homo sapiens chromosome 5 clone RP11-436K21, complete sequence Length = 135423 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 73415 aggaggctgaggcagaaaaa 73434
>gb|AC091699.6| Homo sapiens chromosome 10 clone RP11-296D9, complete sequence Length = 196856 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 12498 aggaggctgaggcagaaaaa 12479
>gb|AC087441.9| Homo sapiens chromosome 11, clone RP11-438N5, complete sequence Length = 151606 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 550 ttaggaggctgaggcagaaa 569 |||||||||||||||||||| Sbjct: 43849 ttaggaggctgaggcagaaa 43830
>gb|AC102944.2| Homo sapiens chromosome 8, clone CTD2-3082P9, complete sequence Length = 144383 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 22678 aggaggctgaggcagaaaaa 22659
>gb|AC008740.7| Homo sapiens chromosome 16 clone CTD-2547E10, complete sequence Length = 158388 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 47547 aggaggctgaggcagaaaaa 47566
>gb|AC069197.6| Homo sapiens chromosome 15, clone RP11-505I24, complete sequence Length = 116742 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 32763 aggaggctgaggcagaaaaa 32744
>gb|AC015674.12| Homo sapiens chromosome 17, clone RP11-138C9, complete sequence Length = 187822 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 108311 aggaggctgaggcagaaaaa 108292
>gb|AC107970.4| Homo sapiens chromosome 11, clone CTD-2238L16, complete sequence Length = 155365 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 550 ttaggaggctgaggcagaaa 569 |||||||||||||||||||| Sbjct: 17165 ttaggaggctgaggcagaaa 17146
>gb|AC098873.3| Homo sapiens BAC clone RP11-793H20 from 4, complete sequence Length = 119147 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 31128 aggaggctgaggcagaaaaa 31147
>gb|AC093883.2| Homo sapiens BAC clone RP11-660B13 from 4, complete sequence Length = 181124 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 58890 aggaggctgaggcagaaaaa 58909
>gb|AC080079.5| Homo sapiens BAC clone RP11-511B7 from 4, complete sequence Length = 112516 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 69227 aggaggctgaggcagaaaaa 69246
>gb|AC011393.5| Homo sapiens chromosome 5 clone CTB-178O17, complete sequence Length = 111271 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 89393 aggaggctgaggcagaaaaa 89412
>gb|AC099680.2| Homo sapiens chromosome 1 clone RP4-700A9, complete sequence Length = 89056 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 87515 aggaggctgaggcagaaaaa 87496
>gb|AC026839.7| Homo sapiens chromosome 5, clone RP11-186B13, complete sequence Length = 156721 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 53990 aggaggctgaggcagaaaaa 53971
>ref|XM_933915.1| PREDICTED: Homo sapiens KIAA0220-like protein, transcript variant 41 (LOC23117), mRNA Length = 12496 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 12141 aggaggctgaggcagaaaaa 12160
>ref|XM_933906.1| PREDICTED: Homo sapiens KIAA0220-like protein, transcript variant 38 (LOC23117), mRNA Length = 12571 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 12216 aggaggctgaggcagaaaaa 12235
>ref|XM_933902.1| PREDICTED: Homo sapiens KIAA0220-like protein, transcript variant 37 (LOC23117), mRNA Length = 10871 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 10459 aggaggctgaggcagaaaaa 10478
>ref|XM_933891.1| PREDICTED: Homo sapiens KIAA0220-like protein, transcript variant 34 (LOC23117), mRNA Length = 11778 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 11423 aggaggctgaggcagaaaaa 11442
>ref|XM_933883.1| PREDICTED: Homo sapiens KIAA0220-like protein, transcript variant 31 (LOC23117), mRNA Length = 11320 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 10965 aggaggctgaggcagaaaaa 10984
>ref|XM_933880.1| PREDICTED: Homo sapiens KIAA0220-like protein, transcript variant 29 (LOC23117), mRNA Length = 9949 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 9464 aggaggctgaggcagaaaaa 9483
>ref|XM_933869.1| PREDICTED: Homo sapiens KIAA0220-like protein, transcript variant 26 (LOC23117), mRNA Length = 9342 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 8930 aggaggctgaggcagaaaaa 8949
>ref|XM_933850.1| PREDICTED: Homo sapiens KIAA0220-like protein, transcript variant 21 (LOC23117), mRNA Length = 7944 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 7589 aggaggctgaggcagaaaaa 7608
>ref|XM_933847.1| PREDICTED: Homo sapiens KIAA0220-like protein, transcript variant 20 (LOC23117), mRNA Length = 7835 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 7480 aggaggctgaggcagaaaaa 7499
>ref|XM_933829.1| PREDICTED: Homo sapiens KIAA0220-like protein, transcript variant 13 (LOC23117), mRNA Length = 5894 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 5479 aggaggctgaggcagaaaaa 5498
>ref|XM_290670.6| PREDICTED: Homo sapiens KIAA0220-like protein, transcript variant 1 (LOC23117), mRNA Length = 5839 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 5484 aggaggctgaggcagaaaaa 5503
>ref|XM_933823.1| PREDICTED: Homo sapiens KIAA0220-like protein, transcript variant 10 (LOC23117), mRNA Length = 5253 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 4898 aggaggctgaggcagaaaaa 4917
>ref|XM_933822.1| PREDICTED: Homo sapiens KIAA0220-like protein, transcript variant 9 (LOC23117), mRNA Length = 4923 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 4568 aggaggctgaggcagaaaaa 4587
>ref|XM_933819.1| PREDICTED: Homo sapiens KIAA0220-like protein, transcript variant 8 (LOC23117), mRNA Length = 4678 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 4323 aggaggctgaggcagaaaaa 4342
>ref|XM_933818.1| PREDICTED: Homo sapiens KIAA0220-like protein, transcript variant 7 (LOC23117), mRNA Length = 4123 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 3768 aggaggctgaggcagaaaaa 3787
>ref|XM_933815.1| PREDICTED: Homo sapiens KIAA0220-like protein, transcript variant 6 (LOC23117), mRNA Length = 4615 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 4266 aggaggctgaggcagaaaaa 4285
>ref|XM_933812.1| PREDICTED: Homo sapiens KIAA0220-like protein, transcript variant 5 (LOC23117), mRNA Length = 3701 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 552 aggaggctgaggcagaaaaa 571 |||||||||||||||||||| Sbjct: 3346 aggaggctgaggcagaaaaa 3365 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6,955,780 Number of Sequences: 3902068 Number of extensions: 6955780 Number of successful extensions: 854753 Number of sequences better than 10.0: 442 Number of HSP's better than 10.0 without gapping: 444 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 840526 Number of HSP's gapped (non-prelim): 14222 length of query: 636 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 613 effective length of database: 17,143,297,704 effective search space: 10508841492552 effective search space used: 10508841492552 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)