Clone Name	rbags21f03
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	ref|XM_468609.1| Oryza sativa (japonica cultivar-group), mRNA	470	e-129
2	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	470	e-129
3	gb|AC135559.4| Oryza sativa chromosome 3 BAC OSJNBa0030J19 genom...	470	e-129
4	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	470	e-129
5	gb|AY103571.1| Zea mays PCO153825 mRNA sequence	466	e-128
6	gb|BT017787.1| Zea mays clone EL01N0504C04.c mRNA sequence	442	e-121
7	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	434	e-118
8	dbj|AP005198.3| Oryza sativa (japonica cultivar-group) genomic D...	434	e-118
9	dbj|AP003700.3| Oryza sativa (japonica cultivar-group) genomic D...	434	e-118
10	gb|BT016384.1| Zea mays clone Contig217 mRNA sequence	426	e-116
11	ref|XM_479144.1| Oryza sativa (japonica cultivar-group), mRNA	412	e-112
12	gb|AY103771.1| Zea mays PCO152633 mRNA sequence	391	e-105
13	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	365	1e-97
14	dbj|AP003992.2| Oryza sativa (japonica cultivar-group) genomic D...	365	1e-97
15	dbj|AK121069.1| Oryza sativa (japonica cultivar-group) cDNA clon...	365	1e-97
16	dbj|AB077113.1| Prunus persica mRNA, microsatellite marker M9a	238	2e-59
17	dbj|AP006094.1| Lotus japonicus genomic DNA, chromosome 4, clone...	206	6e-50
18	gb|BT016406.1| Zea mays clone Contig239 mRNA sequence	194	2e-46
19	gb|AC126783.33| Medicago truncatula clone mth2-15k17, complete s...	161	3e-36
20	gb|AC147877.10| Medicago truncatula clone mth2-9b13, complete se...	139	1e-29
21	emb|CT573365.4| M.truncatula DNA sequence from clone MTH2-89E15 ...	139	1e-29
22	ref|NM_105728.2| Arabidopsis thaliana structural constituent of ...	137	5e-29
23	gb|AY091706.1| Arabidopsis thaliana At1g70600/F5A18_22 mRNA, com...	137	5e-29
24	gb|AY048228.1| Arabidopsis thaliana At1g70600/F5A18_22 mRNA, com...	137	5e-29
25	gb|AY039519.1| Arabidopsis thaliana At1g70600/F5A18_22 mRNA, com...	137	5e-29
26	emb|BX813428.1|CNS0AARB Arabidopsis thaliana Full-length cDNA Co...	137	5e-29
27	emb|BX827775.1|CNS0A4FW Arabidopsis thaliana Full-length cDNA Co...	137	5e-29
28	gb|AC010796.7|AC010796 Arabidopsis thaliana chromosome 1 BAC F24...	137	5e-29
29	gb|AC011663.7|AC011663 Arabidopsis thaliana chromosome 1 BAC F5A...	137	5e-29
30	gb|AY085573.1| Arabidopsis thaliana clone 15789 mRNA, complete s...	137	5e-29
31	emb|X91959.1|AT60SRL27 A.thaliana mRNA for 60S ribosomal protein...	137	5e-29
32	gb|AY804547.1| Drosophila yakuba strain Tai18 ribosomal protein ...	135	2e-28
33	gb|AY804546.1| Drosophila santomea strain STO.4 ribosomal protei...	135	2e-28
34	gb|AY804956.1| Drosophila yakuba isolate 1250_4 RpL27A gene, par...	135	2e-28
35	gb|AY804955.1| Drosophila yakuba isolate 1250_3 RpL27A gene, par...	135	2e-28
36	gb|AY804953.1| Drosophila yakuba isolate 1250_1 RpL27A gene, par...	135	2e-28
37	gb|AY804952.1| Drosophila santomea isolate 1250_3 RpL27A gene, p...	135	2e-28
38	gb|AY804951.1| Drosophila santomea isolate 1250_2 RpL27A gene, p...	135	2e-28
39	gb|AY804950.1| Drosophila santomea isolate 1250_1 RpL27A gene, p...	135	2e-28
40	gb|AY804949.1| Drosophila santomea isolate 1566_4 RpL27A gene, p...	135	2e-28
41	gb|AY804948.1| Drosophila santomea isolate 1566_3 RpL27A gene, p...	135	2e-28
42	gb|AY804947.1| Drosophila santomea isolate 1566_2 RpL27A gene, p...	135	2e-28
43	gb|AY804946.1| Drosophila santomea isolate 1566_1 RpL27A gene, p...	135	2e-28
44	gb|AY804944.1| Drosophila yakuba isolate SaoT_2 RpL27A gene, par...	135	2e-28
45	gb|AY804943.1| Drosophila yakuba isolate SaoT_1 RpL27A gene, par...	135	2e-28
46	gb|AY232080.1| Drosophila yakuba clone yak-ad_RpL27A mRNA sequence	135	2e-28
47	gb|AY231794.1| Drosophila yakuba clone yak-em_RpL27A mRNA sequence	135	2e-28
48	gb|AY804954.1| Drosophila yakuba isolate 1250_2 RpL27A gene, par...	131	3e-27
49	gb|AY804945.1| Drosophila yakuba isolate SaoT_3 RpL27A gene, par...	131	3e-27
50	ref|NM_102178.2| Arabidopsis thaliana RPL27A (RIBOSOMAL PROTEIN ...	129	1e-26
51	gb|AF349525.1| Arabidopsis thaliana putative 60s ribosomal prote...	129	1e-26
52	gb|AF324716.2| Arabidopsis thaliana At1g23290 (At1g23290/F26F24_...	129	1e-26
53	emb|BX817859.1|CNS0AEEA Arabidopsis thaliana Full-length cDNA Co...	129	1e-26
54	emb|BX814201.1|CNS0AC9G Arabidopsis thaliana Full-length cDNA Co...	129	1e-26
55	emb|BX814197.1|CNS0AC79 Arabidopsis thaliana Full-length cDNA Co...	129	1e-26
56	emb|BX814930.1|CNS0ABGE Arabidopsis thaliana Full-length cDNA Co...	129	1e-26
57	gb|AC005292.4|AC005292 Genomic sequence for Arabidopsis thaliana...	129	1e-26
58	gb|DQ191629.1| Solanum tuberosum ribosomal protein L27a-like pro...	125	2e-25
59	gb|BT000542.1| Arabidopsis thaliana 60s ribosomal protein l27a. ...	125	2e-25
60	gb|AF410280.1|AF410280 Arabidopsis thaliana At1g23290/F26F24_23 ...	125	2e-25
61	gb|AY086256.1| Arabidopsis thaliana clone 23092 mRNA, complete s...	125	2e-25
62	gb|AF459726.1| Elaeocarpus angustifolius clone scu22Eg microsate...	123	7e-25
63	dbj|AB042856.1| Panax ginseng mRNA for 60S ribosomal protein L27...	121	3e-24
64	gb|BT022137.2| Drosophila melanogaster IP01552 full insert cDNA	119	1e-23
65	ref|NM_057615.3| Drosophila melanogaster Ribosomal protein L27A ...	119	1e-23
66	gb|AY071144.1| Drosophila melanogaster RE17991 full length cDNA	119	1e-23
67	gb|AC092232.1|AC092232 Drosophila melanogaster, chromosome 2L, r...	119	1e-23
68	gb|AE003576.5| Drosophila melanogaster chromosome 2L, section 15...	119	1e-23
69	gb|U66357.1|DMU66357 Drosophila melanogaster ribosomal protein R...	119	1e-23
70	gb|U66358.1|DMU66358 Drosophila melanogaster ribosomal protein L...	119	1e-23
71	gb|AC004267.1|AC004267 Drosophila melanogaster DNA sequence (P1 ...	119	1e-23
72	gb|DQ191661.1| Solanum tuberosum ribosomal protein L27a-like pro...	117	4e-23
73	emb|X74484.1|DMRPL27A D.melanogaster mRNA for ribosomal protein ...	103	7e-19
74	gb|AY432710.1| Aedes aegypti ASAP ID: 34035 cytosolic large ribo...	98	4e-17
75	gb|DQ440054.1| Aedes aegypti clone AE-306 60S ribosomal protein ...	98	4e-17
76	gb|AY961477.1| Phytophthora infestans clone MY-19-H-09 ribosomal...	94	6e-16
77	emb|BX005667.1|CNS08CJB Single read from an extremity of a full-...	90	1e-14
78	gb|BC064441.1| Danio rerio zgc:77235, mRNA (cDNA clone MGC:77235...	88	4e-14
79	ref|NM_200030.1| Danio rerio zgc:77235 (zgc:77235), mRNA	88	4e-14
80	emb|BX071844.1|CNS09RLK Single read from an extremity of a full-...	82	2e-12
81	emb|BX071644.1|CNS09RG0 Single read from an extremity of a full-...	82	2e-12
82	emb|BX071615.1|CNS09RF7 Single read from an extremity of a full-...	82	2e-12
83	emb|BX071614.1|CNS09RF6 Single read from an extremity of a full-...	82	2e-12
84	emb|BX071463.1|CNS09RAZ Single read from an extremity of a full-...	82	2e-12
85	emb|BX071150.1|CNS09R2A Single read from an extremity of a full-...	82	2e-12
86	emb|BX071149.1|CNS09R29 Single read from an extremity of a full-...	82	2e-12
87	emb|BX071048.1|CNS09QZG Single read from an extremity of a full-...	82	2e-12
88	emb|BX071325.1|CNS09R75 Single read from an extremity of a full-...	82	2e-12
89	emb|BX071324.1|CNS09R74 Single read from an extremity of a full-...	82	2e-12
90	emb|BX070859.1|CNS09QU7 Single read from an extremity of a full-...	82	2e-12
91	emb|BX070688.1|CNS09QPG Single read from an extremity of a full-...	82	2e-12
92	emb|BX070687.1|CNS09QPF Single read from an extremity of a full-...	82	2e-12
93	emb|BX070669.1|CNS09QOX Single read from an extremity of a full-...	82	2e-12
94	emb|BX070195.1|CNS09QBR Single read from an extremity of a full-...	82	2e-12
95	emb|BX070000.1|CNS09Q6C Single read from an extremity of a full-...	82	2e-12
96	emb|BX069999.1|CNS09Q6B Single read from an extremity of a full-...	82	2e-12
97	emb|BX069998.1|CNS09Q6A Single read from an extremity of a full-...	82	2e-12
98	emb|BX069997.1|CNS09Q69 Single read from an extremity of a full-...	82	2e-12
99	emb|BX069926.1|CNS09Q4A Single read from an extremity of a full-...	82	2e-12
100	emb|BX069763.1|CNS09PZR Single read from an extremity of a full-...	82	2e-12
101	emb|BX069694.1|CNS09PXU Single read from an extremity of a full-...	82	2e-12
102	emb|BX069346.1|CNS09PO6 Single read from an extremity of a full-...	82	2e-12
103	emb|BX069225.1|CNS09PKT Single read from an extremity of a full-...	82	2e-12
104	emb|BX069118.1|CNS09PHU Single read from an extremity of a full-...	82	2e-12
105	emb|BX069067.1|CNS09PGF Single read from an extremity of a full-...	82	2e-12
106	emb|BX069066.1|CNS09PGE Single read from an extremity of a full-...	82	2e-12
107	emb|BX068786.1|CNS09P8M Single read from an extremity of a full-...	82	2e-12
108	emb|BX068729.1|CNS09P71 Single read from an extremity of a full-...	82	2e-12
109	emb|BX068402.1|CNS09OXY Single read from an extremity of a full-...	82	2e-12
110	emb|BX068401.1|CNS09OXX Single read from an extremity of a full-...	82	2e-12
111	emb|BX068341.1|CNS09OW9 Single read from an extremity of a full-...	82	2e-12
112	emb|BX068158.1|CNS09OR6 Single read from an extremity of a full-...	82	2e-12
113	emb|BX067962.1|CNS09OLQ Single read from an extremity of a full-...	82	2e-12
114	emb|BX067750.1|CNS09OFU Single read from an extremity of a full-...	82	2e-12
115	emb|BX067375.1|CNS09O5F Single read from an extremity of a full-...	82	2e-12
116	emb|BX067374.1|CNS09O5E Single read from an extremity of a full-...	82	2e-12
117	emb|BX067204.1|CNS09O0O Single read from an extremity of a full-...	82	2e-12
118	emb|BX067203.1|CNS09O0N Single read from an extremity of a full-...	82	2e-12
119	emb|BX066717.1|CNS09NN5 Single read from an extremity of a full-...	82	2e-12
120	emb|BX066486.1|CNS09NGQ Single read from an extremity of a full-...	82	2e-12
121	emb|BX066485.1|CNS09NGP Single read from an extremity of a full-...	82	2e-12
122	emb|BX066475.1|CNS09NGF Single read from an extremity of a full-...	82	2e-12
123	emb|BX066474.1|CNS09NGE Single read from an extremity of a full-...	82	2e-12
124	emb|BX066450.1|CNS09NFQ Single read from an extremity of a full-...	82	2e-12
125	emb|BX066388.1|CNS09NE0 Single read from an extremity of a full-...	82	2e-12
126	emb|BX065859.1|CNS09MZB Single read from an extremity of a full-...	82	2e-12
127	emb|BX065576.1|CNS09MRG Single read from an extremity of a full-...	82	2e-12
128	emb|BX065497.1|CNS09MP9 Single read from an extremity of a full-...	82	2e-12
129	emb|BX064955.1|CNS09MA7 Single read from an extremity of a full-...	82	2e-12
130	emb|BX064954.1|CNS09MA6 Single read from an extremity of a full-...	82	2e-12
131	emb|BX064810.1|CNS09M66 Single read from an extremity of a full-...	82	2e-12
132	emb|BX064779.1|CNS09M5B Single read from an extremity of a full-...	82	2e-12
133	emb|BX064778.1|CNS09M5A Single read from an extremity of a full-...	82	2e-12
134	emb|BX064611.1|CNS09M0N Single read from an extremity of a full-...	82	2e-12
135	emb|BX064509.1|CNS09LXT Single read from an extremity of a full-...	82	2e-12
136	emb|BX064049.1|CNS09LL1 Single read from an extremity of a full-...	82	2e-12
137	emb|BX063943.1|CNS09LI3 Single read from an extremity of a full-...	82	2e-12
138	emb|BX063942.1|CNS09LI2 Single read from an extremity of a full-...	82	2e-12
139	emb|BX063825.1|CNS09LET Single read from an extremity of a full-...	82	2e-12
140	emb|BX063744.1|CNS09LCK Single read from an extremity of a full-...	82	2e-12
141	emb|BX063729.1|CNS09LC5 Single read from an extremity of a full-...	82	2e-12
142	emb|BX063616.1|CNS09L90 Single read from an extremity of a full-...	82	2e-12
143	emb|BX063581.1|CNS09L81 Single read from an extremity of a full-...	82	2e-12
144	emb|BX063323.1|CNS09L0V Single read from an extremity of a full-...	82	2e-12
145	emb|BX062743.1|CNS09KKR Single read from an extremity of a full-...	82	2e-12
146	emb|BX062645.1|CNS09KI1 Single read from an extremity of a full-...	82	2e-12
147	emb|BX062417.1|CNS09KBP Single read from an extremity of a full-...	82	2e-12
148	emb|BX062386.1|CNS09KAU Single read from an extremity of a full-...	82	2e-12
149	emb|BX061846.1|CNS09JVU Single read from an extremity of a full-...	82	2e-12
150	emb|BX061653.1|CNS09JQH Single read from an extremity of a full-...	82	2e-12
151	emb|BX061652.1|CNS09JQG Single read from an extremity of a full-...	82	2e-12
152	emb|BX061533.1|CNS09JN5 Single read from an extremity of a full-...	82	2e-12
153	emb|BX061500.1|CNS09JM8 Single read from an extremity of a full-...	82	2e-12
154	emb|BX061418.1|CNS09JJY Single read from an extremity of a full-...	82	2e-12
155	emb|BX061372.1|CNS09JIO Single read from an extremity of a full-...	82	2e-12
156	emb|BX061371.1|CNS09JIN Single read from an extremity of a full-...	82	2e-12
157	emb|BX060850.1|CNS09J46 Single read from an extremity of a full-...	82	2e-12
158	emb|BX060762.1|CNS09J1Q Single read from an extremity of a full-...	82	2e-12
159	emb|BX060638.1|CNS09IYA Single read from an extremity of a full-...	82	2e-12
160	emb|BX060485.1|CNS09IU1 Single read from an extremity of a full-...	82	2e-12
161	emb|BX060484.1|CNS09IU0 Single read from an extremity of a full-...	82	2e-12
162	emb|BX060483.1|CNS09ITZ Single read from an extremity of a full-...	82	2e-12
163	emb|BX060482.1|CNS09ITY Single read from an extremity of a full-...	82	2e-12
164	emb|BX060103.1|CNS09IJF Single read from an extremity of a full-...	82	2e-12
165	emb|BX060038.1|CNS09IHM Single read from an extremity of a full-...	82	2e-12
166	emb|BX059961.1|CNS09IFH Single read from an extremity of a full-...	82	2e-12
167	emb|BX059617.1|CNS09I5X Single read from an extremity of a full-...	82	2e-12
168	emb|BX059580.1|CNS09I4W Single read from an extremity of a full-...	82	2e-12
169	emb|BX059462.1|CNS09I1M Single read from an extremity of a full-...	82	2e-12
170	emb|BX059461.1|CNS09I1L Single read from an extremity of a full-...	82	2e-12
171	emb|BX059340.1|CNS09HY8 Single read from an extremity of a full-...	82	2e-12
172	emb|BX059085.1|CNS09HR5 Single read from an extremity of a full-...	82	2e-12
173	emb|BX058666.1|CNS09HFI Single read from an extremity of a full-...	82	2e-12
174	emb|BX058616.1|CNS09HE4 Single read from an extremity of a full-...	82	2e-12
175	emb|BX058582.1|CNS09HD6 Single read from an extremity of a full-...	82	2e-12
176	emb|BX058544.1|CNS09HC4 Single read from an extremity of a full-...	82	2e-12
177	emb|BX058454.1|CNS09H9M Single read from an extremity of a full-...	82	2e-12
178	emb|BX058452.1|CNS09H9K Single read from an extremity of a full-...	82	2e-12
179	emb|BX058451.1|CNS09H9J Single read from an extremity of a full-...	82	2e-12
180	emb|BX058229.1|CNS09H3D Single read from an extremity of a full-...	82	2e-12
181	emb|BX056605.1|CNS09FU9 Single read from an extremity of a full-...	82	2e-12
182	emb|BX056604.1|CNS09FU8 Single read from an extremity of a full-...	82	2e-12
183	emb|BX057878.1|CNS09GTM Single read from an extremity of a full-...	82	2e-12
184	emb|BX057784.1|CNS09GR0 Single read from an extremity of a full-...	82	2e-12
185	emb|BX057633.1|CNS09GMT Single read from an extremity of a full-...	82	2e-12
186	emb|BX057505.1|CNS09GJ9 Single read from an extremity of a full-...	82	2e-12
187	emb|BX057495.1|CNS09GIZ Single read from an extremity of a full-...	82	2e-12
188	emb|BX055833.1|CNS09F8T Single read from an extremity of a full-...	82	2e-12
189	emb|BX055484.1|CNS09EZ4 Single read from an extremity of a full-...	82	2e-12
190	emb|BX053216.1|CNS09D84 Single read from an extremity of a full-...	82	2e-12
191	emb|BX053162.1|CNS09D6M Single read from an extremity of a full-...	82	2e-12
192	emb|BX053144.1|CNS09D64 Single read from an extremity of a full-...	82	2e-12
193	emb|BX055141.1|CNS09EPL Single read from an extremity of a full-...	82	2e-12
194	emb|BX054882.1|CNS09EIE Single read from an extremity of a full-...	82	2e-12
195	emb|BX053068.1|CNS09D40 Single read from an extremity of a full-...	82	2e-12
196	emb|BX054081.1|CNS09DW5 Single read from an extremity of a full-...	82	2e-12
197	emb|BX053881.1|CNS09DQL Single read from an extremity of a full-...	82	2e-12
198	emb|BX053707.1|CNS09DLR Single read from an extremity of a full-...	82	2e-12
199	emb|BX053706.1|CNS09DLQ Single read from an extremity of a full-...	82	2e-12
200	emb|BX053663.1|CNS09DKJ Single read from an extremity of a full-...	82	2e-12
201	emb|BX052674.1|CNS09CT2 Single read from an extremity of a full-...	82	2e-12
202	emb|BX052301.1|CNS09CIP Single read from an extremity of a full-...	82	2e-12
203	emb|BX051916.1|CNS09C80 Single read from an extremity of a full-...	82	2e-12
204	emb|BX051464.1|CNS09BVG Single read from an extremity of a full-...	82	2e-12
205	emb|BX051169.1|CNS09BN9 Single read from an extremity of a full-...	82	2e-12
206	emb|BX050918.1|CNS09BGA Single read from an extremity of a full-...	82	2e-12
207	emb|BX050847.1|CNS09BEB Single read from an extremity of a full-...	82	2e-12
208	emb|BX050846.1|CNS09BEA Single read from an extremity of a full-...	82	2e-12
209	emb|BX050735.1|CNS09BB7 Single read from an extremity of a full-...	82	2e-12
210	emb|BX050637.1|CNS09B8H Single read from an extremity of a full-...	82	2e-12
211	emb|BX050473.1|CNS09B3X Single read from an extremity of a full-...	82	2e-12
212	emb|BX050285.1|CNS09AYP Single read from an extremity of a full-...	82	2e-12
213	emb|BX049853.1|CNS09AMP Single read from an extremity of a full-...	82	2e-12
214	emb|BX049852.1|CNS09AMO Single read from an extremity of a full-...	82	2e-12
215	emb|BX049352.1|CNS09A8S Single read from an extremity of a full-...	82	2e-12
216	emb|BX049279.1|CNS09A6R Single read from an extremity of a full-...	82	2e-12
217	emb|BX049134.1|CNS09A2Q Single read from an extremity of a full-...	82	2e-12
218	emb|BX048838.1|CNS099UI Single read from an extremity of a full-...	82	2e-12
219	emb|BX048660.1|CNS099PK Single read from an extremity of a full-...	82	2e-12
220	emb|BX046531.1|CNS0982F Single read from an extremity of a full-...	82	2e-12
221	emb|BX046527.1|CNS0982B Single read from an extremity of a full-...	82	2e-12
222	emb|BX048302.1|CNS099FM Single read from an extremity of a full-...	82	2e-12
223	emb|BX048147.1|CNS099BB Single read from an extremity of a full-...	82	2e-12
224	emb|BX048146.1|CNS099BA Single read from an extremity of a full-...	82	2e-12
225	emb|BX048050.1|CNS0998M Single read from an extremity of a full-...	82	2e-12
226	emb|BX047926.1|CNS09956 Single read from an extremity of a full-...	82	2e-12
227	emb|BX047906.1|CNS0994M Single read from an extremity of a full-...	82	2e-12
228	emb|BX047760.1|CNS0990K Single read from an extremity of a full-...	82	2e-12
229	emb|BX047689.1|CNS098YL Single read from an extremity of a full-...	82	2e-12
230	emb|BX047677.1|CNS098Y9 Single read from an extremity of a full-...	82	2e-12
231	emb|BX047676.1|CNS098Y8 Single read from an extremity of a full-...	82	2e-12
232	emb|BX047547.1|CNS098UN Single read from an extremity of a full-...	82	2e-12
233	emb|BX047520.1|CNS098TW Single read from an extremity of a full-...	82	2e-12
234	emb|BX047255.1|CNS098MJ Single read from an extremity of a full-...	82	2e-12
235	emb|BX047102.1|CNS098IA Single read from an extremity of a full-...	82	2e-12
236	emb|BX046950.1|CNS098E2 Single read from an extremity of a full-...	82	2e-12
237	emb|BX046739.1|CNS09887 Single read from an extremity of a full-...	82	2e-12
238	emb|BX046675.1|CNS0986F Single read from an extremity of a full-...	82	2e-12
239	emb|BX046022.1|CNS097OA Single read from an extremity of a full-...	82	2e-12
240	emb|BX046021.1|CNS097O9 Single read from an extremity of a full-...	82	2e-12
241	emb|BX045808.1|CNS097IC Single read from an extremity of a full-...	82	2e-12
242	emb|BX045791.1|CNS097HV Single read from an extremity of a full-...	82	2e-12
243	emb|BX045765.1|CNS097H5 Single read from an extremity of a full-...	82	2e-12
244	emb|BX045764.1|CNS097H4 Single read from an extremity of a full-...	82	2e-12
245	emb|BX045565.1|CNS097BL Single read from an extremity of a full-...	82	2e-12
246	emb|BX043029.1|CNS095D5 Single read from an extremity of a full-...	82	2e-12
247	emb|BX044717.1|CNS096O1 Single read from an extremity of a full-...	82	2e-12
248	emb|BX044716.1|CNS096O0 Single read from an extremity of a full-...	82	2e-12
249	emb|BX044419.1|CNS096FR Single read from an extremity of a full-...	82	2e-12
250	emb|BX044308.1|CNS096CO Single read from an extremity of a full-...	82	2e-12
251	emb|BX044225.1|CNS096AD Single read from an extremity of a full-...	82	2e-12
252	emb|BX044005.1|CNS09649 Single read from an extremity of a full-...	82	2e-12
253	emb|BX043494.1|CNS095Q2 Single read from an extremity of a full-...	82	2e-12
254	emb|BX043388.1|CNS095N4 Single read from an extremity of a full-...	82	2e-12
255	emb|BX043306.1|CNS095KU Single read from an extremity of a full-...	82	2e-12
256	emb|BX042574.1|CNS0950I Single read from an extremity of a full-...	82	2e-12
257	emb|BX042573.1|CNS0950H Single read from an extremity of a full-...	82	2e-12
258	emb|BX042534.1|CNS094ZE Single read from an extremity of a full-...	82	2e-12
259	emb|BX042035.1|CNS094LJ Single read from an extremity of a full-...	82	2e-12
260	emb|BX041883.1|CNS094HB Single read from an extremity of a full-...	82	2e-12
261	emb|BX041665.1|CNS094B9 Single read from an extremity of a full-...	82	2e-12
262	emb|BX041364.1|CNS0942W Single read from an extremity of a full-...	82	2e-12
263	emb|BX041363.1|CNS0942V Single read from an extremity of a full-...	82	2e-12
264	emb|BX041181.1|CNS093XT Single read from an extremity of a full-...	82	2e-12
265	emb|BX041016.1|CNS093T8 Single read from an extremity of a full-...	82	2e-12
266	emb|BX040956.1|CNS093RK Single read from an extremity of a full-...	82	2e-12
267	emb|BX040955.1|CNS093RJ Single read from an extremity of a full-...	82	2e-12
268	emb|BX040768.1|CNS093MC Single read from an extremity of a full-...	82	2e-12
269	emb|BX040258.1|CNS09386 Single read from an extremity of a full-...	82	2e-12
270	emb|BX040257.1|CNS09385 Single read from an extremity of a full-...	82	2e-12
271	emb|BX040215.1|CNS0936Z Single read from an extremity of a full-...	82	2e-12
272	emb|BX040210.1|CNS0936U Single read from an extremity of a full-...	82	2e-12
273	emb|BX039720.1|CNS092T8 Single read from an extremity of a full-...	82	2e-12
274	emb|BX039593.1|CNS092PP Single read from an extremity of a full-...	82	2e-12
275	emb|BX038555.1|CNS091WV Single read from an extremity of a full-...	82	2e-12
276	emb|BX038371.1|CNS091RR Single read from an extremity of a full-...	82	2e-12
277	emb|BX038370.1|CNS091RQ Single read from an extremity of a full-...	82	2e-12
278	emb|BX038029.1|CNS091I9 Single read from an extremity of a full-...	82	2e-12
279	emb|BX038028.1|CNS091I8 Single read from an extremity of a full-...	82	2e-12
280	emb|BX038002.1|CNS091HI Single read from an extremity of a full-...	82	2e-12
281	emb|BX037726.1|CNS0919U Single read from an extremity of a full-...	82	2e-12
282	emb|BX037704.1|CNS09198 Single read from an extremity of a full-...	82	2e-12
283	emb|BX037688.1|CNS0918S Single read from an extremity of a full-...	82	2e-12
284	emb|BX037668.1|CNS09188 Single read from an extremity of a full-...	82	2e-12
285	emb|BX037021.1|CNS090Q9 Single read from an extremity of a full-...	82	2e-12
286	emb|BX032436.1|CNS08X6W Single read from an extremity of a full-...	82	2e-12
287	emb|BX022760.1|CNS08PQ4 Single read from an extremity of a full-...	82	2e-12
288	emb|BX021276.1|CNS08OKW Single read from an extremity of a full-...	82	2e-12
289	emb|BX020664.1|CNS08O3W Single read from an extremity of a full-...	82	2e-12
290	emb|BX020663.1|CNS08O3V Single read from an extremity of a full-...	82	2e-12
291	emb|BX020342.1|CNS08NUY Single read from an extremity of a full-...	82	2e-12
292	emb|BX020341.1|CNS08NUX Single read from an extremity of a full-...	82	2e-12
293	emb|BX017080.1|CNS08LCC Single read from an extremity of a full-...	82	2e-12
294	emb|BX015695.1|CNS08K9V Single read from an extremity of a full-...	82	2e-12
295	emb|BX016091.1|CNS08KKV Single read from an extremity of a full-...	82	2e-12
296	emb|BX015264.1|CNS08JXW Single read from an extremity of a full-...	82	2e-12
297	emb|BX014967.1|CNS08JPN Single read from an extremity of a full-...	82	2e-12
298	emb|BX014077.1|CNS08J0X Single read from an extremity of a full-...	82	2e-12
299	emb|BX010268.1|CNS08G34 Single read from an extremity of a full-...	82	2e-12
300	emb|BX008036.1|CNS08ED4 Single read from an extremity of a full-...	82	2e-12
301	emb|BX008035.1|CNS08ED3 Single read from an extremity of a full-...	82	2e-12
302	emb|BX007645.1|CNS08E29 Single read from an extremity of a full-...	82	2e-12
303	emb|BX006393.1|CNS08D3H Single read from an extremity of a full-...	82	2e-12
304	emb|BX006392.1|CNS08D3G Single read from an extremity of a full-...	82	2e-12
305	ref|XM_320804.2| Anopheles gambiae str. PEST ENSANGP00000017987 ...	82	2e-12
306	gb|AY826145.1| Aedes albopictus clone AL_181 60S ribosomal prote...	80	9e-12
307	dbj|AB169006.1| Macaca fascicularis testis cDNA, clone: QtsA-165...	80	9e-12
308	emb|BX053417.1|CNS09DDP Single read from an extremity of a full-...	78	4e-11
309	emb|BX072340.1|CNS09RZC Single read from an extremity of a full-...	78	4e-11
310	emb|BX064012.1|CNS09LK0 Single read from an extremity of a full-...	78	4e-11
311	emb|BX064011.1|CNS09LJZ Single read from an extremity of a full-...	78	4e-11
312	emb|BX063708.1|CNS09LBK Single read from an extremity of a full-...	78	4e-11
313	emb|BX063707.1|CNS09LBJ Single read from an extremity of a full-...	78	4e-11
314	emb|BX056068.1|CNS09FFC Single read from an extremity of a full-...	78	4e-11
315	emb|BX052072.1|CNS09CCC Single read from an extremity of a full-...	78	4e-11
316	emb|BX029896.1|CNS08V8C Single read from an extremity of a full-...	78	4e-11
317	gb|AC012187.3|F13K23 Sequence of BAC F13K23 from Arabidopsis tha...	78	4e-11
318	gb|AY440238.1| Armigeres subalbatus ASAP ID: 39091 cytosolic lar...	74	6e-10
319	gb|CP000081.1| Leishmania major chromosome 35, complete sequence	74	6e-10
320	ref|XM_838388.1| Leishmania major strain Friedlin 60S ribosomal ...	74	6e-10
321	ref|XM_838390.1| Leishmania major strain Friedlin 60S ribosomal ...	74	6e-10
322	emb|BX071464.1|CNS09RB0 Single read from an extremity of a full-...	74	6e-10
323	emb|BX071369.1|CNS09R8D Single read from an extremity of a full-...	74	6e-10
324	emb|BX070860.1|CNS09QU8 Single read from an extremity of a full-...	74	6e-10
325	emb|BX070196.1|CNS09QBS Single read from an extremity of a full-...	74	6e-10
326	emb|BX069764.1|CNS09PZS Single read from an extremity of a full-...	74	6e-10
327	emb|BX069119.1|CNS09PHV Single read from an extremity of a full-...	74	6e-10
328	emb|BX068787.1|CNS09P8N Single read from an extremity of a full-...	74	6e-10
329	emb|BX068730.1|CNS09P72 Single read from an extremity of a full-...	74	6e-10
330	emb|BX068159.1|CNS09OR7 Single read from an extremity of a full-...	74	6e-10
331	emb|BX067963.1|CNS09OLR Single read from an extremity of a full-...	74	6e-10
332	emb|BX066389.1|CNS09NE1 Single read from an extremity of a full-...	74	6e-10
333	emb|BX066287.1|CNS09NB7 Single read from an extremity of a full-...	74	6e-10
334	emb|BX066286.1|CNS09NB6 Single read from an extremity of a full-...	74	6e-10
335	emb|BX065577.1|CNS09MRH Single read from an extremity of a full-...	74	6e-10
336	emb|BX065498.1|CNS09MPA Single read from an extremity of a full-...	74	6e-10
337	emb|BX065054.1|CNS09MCY Single read from an extremity of a full-...	74	6e-10
338	emb|BX064050.1|CNS09LL2 Single read from an extremity of a full-...	74	6e-10
339	emb|BX063617.1|CNS09L91 Single read from an extremity of a full-...	74	6e-10
340	emb|BX063582.1|CNS09L82 Single read from an extremity of a full-...	74	6e-10
341	emb|BX062744.1|CNS09KKS Single read from an extremity of a full-...	74	6e-10
342	emb|BX062032.1|CNS09K10 Single read from an extremity of a full-...	74	6e-10
343	emb|BX061419.1|CNS09JJZ Single read from an extremity of a full-...	74	6e-10
344	emb|BX060763.1|CNS09J1R Single read from an extremity of a full-...	74	6e-10
345	emb|BX060104.1|CNS09IJG Single read from an extremity of a full-...	74	6e-10
346	emb|BX060039.1|CNS09IHN Single read from an extremity of a full-...	74	6e-10
347	emb|BX059596.1|CNS09I5C Single read from an extremity of a full-...	74	6e-10
348	emb|BX059581.1|CNS09I4X Single read from an extremity of a full-...	74	6e-10
349	emb|BX059233.1|CNS09HV9 Single read from an extremity of a full-...	74	6e-10
350	emb|BX058230.1|CNS09H3E Single read from an extremity of a full-...	74	6e-10
351	emb|BX056621.1|CNS09FUP Single read from an extremity of a full-...	74	6e-10
352	emb|BX055855.1|CNS09F9F Single read from an extremity of a full-...	74	6e-10
353	emb|BX055853.1|CNS09F9D Single read from an extremity of a full-...	74	6e-10
354	emb|BX056291.1|CNS09FLJ Single read from an extremity of a full-...	74	6e-10
355	emb|BX055142.1|CNS09EPM Single read from an extremity of a full-...	74	6e-10
356	emb|BX053163.1|CNS09D6N Single read from an extremity of a full-...	74	6e-10
357	emb|BX053069.1|CNS09D41 Single read from an extremity of a full-...	74	6e-10
358	emb|BX053882.1|CNS09DQM Single read from an extremity of a full-...	74	6e-10
359	emb|BX052302.1|CNS09CIQ Single read from an extremity of a full-...	74	6e-10
360	emb|BX051963.1|CNS09C9B Single read from an extremity of a full-...	74	6e-10
361	emb|BX051465.1|CNS09BVH Single read from an extremity of a full-...	74	6e-10
362	emb|BX051098.1|CNS09BLA Single read from an extremity of a full-...	74	6e-10
363	emb|BX051097.1|CNS09BL9 Single read from an extremity of a full-...	74	6e-10
364	emb|BX050778.1|CNS09BCE Single read from an extremity of a full-...	74	6e-10
365	emb|BX050638.1|CNS09B8I Single read from an extremity of a full-...	74	6e-10
366	emb|BX046528.1|CNS0982C Single read from an extremity of a full-...	74	6e-10
367	emb|BX046456.1|CNS0980C Single read from an extremity of a full-...	74	6e-10
368	emb|BX048303.1|CNS099FN Single read from an extremity of a full-...	74	6e-10
369	emb|BX047907.1|CNS0994N Single read from an extremity of a full-...	74	6e-10
370	emb|BX046951.1|CNS098E3 Single read from an extremity of a full-...	74	6e-10
371	emb|BX046676.1|CNS0986G Single read from an extremity of a full-...	74	6e-10
372	emb|BX045090.1|CNS096YE Single read from an extremity of a full-...	74	6e-10
373	emb|BX043030.1|CNS095D6 Single read from an extremity of a full-...	74	6e-10
374	emb|BX044388.1|CNS096EW Single read from an extremity of a full-...	74	6e-10
375	emb|BX044213.1|CNS096A1 Single read from an extremity of a full-...	74	6e-10
376	emb|BX044006.1|CNS0964A Single read from an extremity of a full-...	74	6e-10
377	emb|BX043903.1|CNS0961F Single read from an extremity of a full-...	74	6e-10
378	emb|BX041884.1|CNS094HC Single read from an extremity of a full-...	74	6e-10
379	emb|BX041453.1|CNS0945D Single read from an extremity of a full-...	74	6e-10
380	emb|BX040769.1|CNS093MD Single read from an extremity of a full-...	74	6e-10
381	emb|BX040585.1|CNS093H9 Single read from an extremity of a full-...	74	6e-10
382	emb|BX038382.1|CNS091S2 Single read from an extremity of a full-...	74	6e-10
383	emb|BX032666.1|CNS08XDA Single read from an extremity of a full-...	74	6e-10
384	emb|BX032437.1|CNS08X6X Single read from an extremity of a full-...	74	6e-10
385	emb|BX031688.1|CNS08WM4 Single read from an extremity of a full-...	74	6e-10
386	emb|BX028447.1|CNS08U43 Single read from an extremity of a full-...	74	6e-10
387	emb|BX028274.1|CNS08TZA Single read from an extremity of a full-...	74	6e-10
388	emb|BX021277.1|CNS08OKX Single read from an extremity of a full-...	74	6e-10
389	emb|BX017081.1|CNS08LCD Single read from an extremity of a full-...	74	6e-10
390	emb|BX014078.1|CNS08J0Y Single read from an extremity of a full-...	74	6e-10
391	emb|BX013872.1|CNS08IV8 Single read from an extremity of a full-...	74	6e-10
392	emb|BX013871.1|CNS08IV7 Single read from an extremity of a full-...	74	6e-10
393	emb|BX010269.1|CNS08G35 Single read from an extremity of a full-...	74	6e-10
394	emb|BX009357.1|CNS08FDT Single read from an extremity of a full-...	74	6e-10
395	emb|BX007646.1|CNS08E2A Single read from an extremity of a full-...	74	6e-10
396	dbj|AB226252.1| Aspergillus oryzae cDNA, contig sequence: AoEST3111	74	6e-10
397	dbj|AP007167.1| Aspergillus oryzae RIB40 genomic DNA, SC020	74	6e-10
398	emb|AM049100.1| Georissus sp. APV-2005 mRNA for ribosomal protei...	72	2e-09
399	emb|BX068340.1|CNS09OW8 Single read from an extremity of a full-...	70	9e-09
400	emb|BX022761.1|CNS08PQ5 Single read from an extremity of a full-...	70	9e-09
401	emb|BX006006.1|CNS08CSQ Single read from an extremity of a full-...	70	9e-09
402	ref|NM_001034084.1| Pan troglodytes ribosomal protein L27a (RPL2...	68	4e-08
403	ref|NM_000990.3| Homo sapiens ribosomal protein L27a (RPL27A), mRNA	68	4e-08
404	gb|BC005326.1| Homo sapiens ribosomal protein L27a, mRNA (cDNA c...	68	4e-08
405	ref|XM_388032.1| Gibberella zeae PH-1 chromosome 4 RL2A_ERYGR 60...	68	4e-08
406	emb|AL590867.10| Human DNA sequence from clone RP11-475C16 on ch...	68	4e-08
407	emb|BX066718.1|CNS09NN6 Single read from an extremity of a full-...	68	4e-08
408	emb|BX064612.1|CNS09M0O Single read from an extremity of a full-...	68	4e-08
409	emb|BX062646.1|CNS09KI2 Single read from an extremity of a full-...	68	4e-08
410	emb|BX042036.1|CNS094LK Single read from an extremity of a full-...	68	4e-08
411	gb|BC066326.1| Homo sapiens ribosomal protein L27a, mRNA (cDNA c...	68	4e-08
412	emb|CR936817.1| Homo sapiens mRNA; cDNA DKFZp686E23167 (from clo...	68	4e-08
413	emb|CR857381.1| Pongo pygmaeus mRNA; cDNA DKFZp468N1916 (from cl...	68	4e-08
414	gb|BC020169.1|BC020169 Homo sapiens, clone IMAGE:3543815, mRNA, ...	68	4e-08
415	ref|XM_941582.1| PREDICTED: Homo sapiens similar to 60S ribosoma...	68	4e-08
416	ref|XM_371853.4| PREDICTED: Homo sapiens similar to 60S ribosoma...	68	4e-08
417	gb|AY044167.1| Homo sapiens clone IMAGE:BE741130 mRNA sequence	68	4e-08
418	dbj|AB188277.1| Pan troglodytes rpl27a mRNA for ribosomal protei...	68	4e-08
419	gb|U14968.1|HSU14968 Human ribosomal protein L27a mRNA, complete...	68	4e-08
420	emb|BX071843.1|CNS09RLJ Single read from an extremity of a full-...	66	1e-07
421	emb|BX071047.1|CNS09QZF Single read from an extremity of a full-...	66	1e-07
422	emb|BX070670.1|CNS09QOY Single read from an extremity of a full-...	66	1e-07
423	emb|BX069224.1|CNS09PKS Single read from an extremity of a full-...	66	1e-07
424	emb|BX065781.1|CNS09MX5 Single read from an extremity of a full-...	66	1e-07
425	emb|BX065069.1|CNS09MDD Single read from an extremity of a full-...	66	1e-07
426	emb|BX064806.1|CNS09M62 Single read from an extremity of a full-...	66	1e-07
427	emb|BX064710.1|CNS09M3E Single read from an extremity of a full-...	66	1e-07
428	ref|XM_968497.1| PREDICTED: Tribolium castaneum similar to 60S r...	66	1e-07
429	emb|BX059595.1|CNS09I5B Single read from an extremity of a full-...	66	1e-07
430	emb|BX059232.1|CNS09HV8 Single read from an extremity of a full-...	66	1e-07
431	emb|BX058615.1|CNS09HE3 Single read from an extremity of a full-...	66	1e-07
432	emb|BX058329.1|CNS09H65 Single read from an extremity of a full-...	66	1e-07
433	emb|BX058255.1|CNS09H43 Single read from an extremity of a full-...	66	1e-07
434	emb|BX056620.1|CNS09FUO Single read from an extremity of a full-...	66	1e-07
435	emb|BX057313.1|CNS09GDX Single read from an extremity of a full-...	66	1e-07
436	emb|BX057272.1|CNS09GCS Single read from an extremity of a full-...	66	1e-07
437	emb|BX057100.1|CNS09G80 Single read from an extremity of a full-...	66	1e-07
438	emb|BX056824.1|CNS09G0C Single read from an extremity of a full-...	66	1e-07
439	emb|BX056459.1|CNS09FQ7 Single read from an extremity of a full-...	66	1e-07
440	emb|BX055894.1|CNS09FAI Single read from an extremity of a full-...	66	1e-07
441	emb|BX055854.1|CNS09F9E Single read from an extremity of a full-...	66	1e-07
442	emb|BX056290.1|CNS09FLI Single read from an extremity of a full-...	66	1e-07
443	emb|BX053228.1|CNS09D8G Single read from an extremity of a full-...	66	1e-07
444	emb|BX053079.1|CNS09D4B Single read from an extremity of a full-...	66	1e-07
445	emb|BX051962.1|CNS09C9A Single read from an extremity of a full-...	66	1e-07
446	emb|BX051915.1|CNS09C7Z Single read from an extremity of a full-...	66	1e-07
447	emb|BX051054.1|CNS09BK2 Single read from an extremity of a full-...	66	1e-07
448	emb|BX050777.1|CNS09BCD Single read from an extremity of a full-...	66	1e-07
449	emb|BX049278.1|CNS09A6Q Single read from an extremity of a full-...	66	1e-07
450	emb|BX048984.1|CNS099YK Single read from an extremity of a full-...	66	1e-07
451	emb|BX048627.1|CNS099ON Single read from an extremity of a full-...	66	1e-07
452	emb|BX046455.1|CNS0980B Single read from an extremity of a full-...	66	1e-07
453	emb|BX044387.1|CNS096EV Single read from an extremity of a full-...	66	1e-07
454	emb|BX044163.1|CNS0968N Single read from an extremity of a full-...	66	1e-07
455	emb|BX043902.1|CNS0961E Single read from an extremity of a full-...	66	1e-07
456	emb|BX043699.1|CNS095VR Single read from an extremity of a full-...	66	1e-07
457	emb|BX041767.1|CNS094E3 Single read from an extremity of a full-...	66	1e-07
458	emb|BX040584.1|CNS093H8 Single read from an extremity of a full-...	66	1e-07
459	emb|BX040214.1|CNS0936Y Single read from an extremity of a full-...	66	1e-07
460	emb|BX032665.1|CNS08XD9 Single read from an extremity of a full-...	66	1e-07
461	emb|BX031689.1|CNS08WM5 Single read from an extremity of a full-...	66	1e-07
462	emb|BX020026.1|CNS08NM6 Single read from an extremity of a full-...	66	1e-07
463	emb|BX016439.1|CNS08KUJ Single read from an extremity of a full-...	66	1e-07
464	emb|BX014615.1|CNS08JFV Single read from an extremity of a full-...	66	1e-07
465	emb|BX009356.1|CNS08FDS Single read from an extremity of a full-...	66	1e-07
466	gb|AF400186.1| Spodoptera frugiperda ribosomal protein L27A mRNA...	66	1e-07
467	ref|XM_215041.3| PREDICTED: Rattus norvegicus ribosomal protein ...	66	1e-07
468	emb|X52733.1|RRRPL27A Rat mRNA for ribosomal protein L27a	66	1e-07
469	gb|AF088913.1|AF088913 Petunia x hybrida ribosomal protein L27a ...	66	1e-07
470	ref|XM_518819.1| PREDICTED: Pan troglodytes similar to 60S ribos...	64	6e-07
471	emb|BX046775.1|CNS09897 Single read from an extremity of a full-...	64	6e-07
472	emb|BX045089.1|CNS096YD Single read from an extremity of a full-...	64	6e-07
473	gb|L19698.1|RATRALA Rat GTP-binding protein (ral A) mRNA, comple...	64	6e-07
474	gb|AY752829.1| Culicoides sonorensis clone CsRPL27A ribosomal pr...	62	2e-06
475	emb|BX063824.1|CNS09LES Single read from an extremity of a full-...	62	2e-06
476	gb|AF401582.1| Ictalurus punctatus ribosomal protein L27a mRNA, ...	62	2e-06
477	gb|AY853171.1| Pectinaria gouldii ribosomal protein L27a mRNA, c...	60	9e-06
478	gb|BC086939.1| Mus musculus ribosomal protein L27a, mRNA (cDNA c...	60	9e-06
479	gb|AC139675.11| Mus musculus chromosome 3, clone RP23-328D16, co...	60	9e-06
480	gb|BC081430.1| Mus musculus ribosomal protein L27a, mRNA (cDNA c...	60	9e-06
481	ref|NM_011975.2| Mus musculus ribosomal protein L27a (Rpl27a), mRNA	60	9e-06
482	ref|XM_001005964.1| PREDICTED: Mus musculus similar to 60S ribos...	60	9e-06
483	ref|XM_484309.4| PREDICTED: Mus musculus similar to 60S ribosoma...	60	9e-06
484	ref|XM_976624.1| PREDICTED: Mus musculus similar to 60S ribosoma...	60	9e-06
485	ref|XM_981758.1| PREDICTED: Mus musculus similar to ribosomal pr...	60	9e-06
486	ref|XM_975156.1| PREDICTED: Mus musculus similar to ribosomal pr...	60	9e-06
487	gb|AC126441.5| Mus musculus BAC clone RP23-431D8 from chromosome...	60	9e-06
488	gb|AC124457.4| Mus musculus BAC clone RP24-134O20 from chromosom...	60	9e-06
489	emb|CR718092.2|CNS0GH0Y Tetraodon nigroviridis full-length cDNA	60	9e-06
490	emb|BX071281.1|CNS09R5X Single read from an extremity of a full-...	60	9e-06
491	emb|BX038003.1|CNS091HJ Single read from an extremity of a full-...	60	9e-06
492	emb|AJ307670.1|MMU307670 Mus musculus St5 gene, L27a gene and Ki...	60	9e-06
493	dbj|AK138110.1| Mus musculus 16 days neonate thymus cDNA, RIKEN ...	60	9e-06
494	dbj|AK150907.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	60	9e-06
495	dbj|AK167792.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-...	60	9e-06
496	dbj|AK167915.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length...	60	9e-06
497	dbj|AK010286.1| Mus musculus ES cells cDNA, RIKEN full-length en...	60	9e-06
498	dbj|AK008531.1| Mus musculus adult male small intestine cDNA, RI...	60	9e-06
499	dbj|AK007837.1| Mus musculus 10 day old male pancreas cDNA, RIKE...	60	9e-06
500	dbj|AK011361.1| Mus musculus 10 days embryo whole body cDNA, RIK...	60	9e-06

---

>ref|XM_468609.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 694

 Score =  470 bits (237), Expect = e-129
 Identities = 378/423 (89%), Gaps = 4/423 (0%)
 Strand = Plus / Minus

                                                                       
Query: 173 gcgccgccggcggccttgatcttcttctcggcgatcttggagatgagcttggccttgacg 232
           |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 452 gcgccgccggcggccttgatcttcttctcggcgaccttggagatgagcttggccttgacg 393

                                                                       
Query: 233 acgatgggcttctccggc---agcatccccttgccgagcaccttgaagtagccgaactgc 289
           ||||||||| ||| |||    ||||||||||||||||||||||||  |||||||||||| 
Sbjct: 392 acgatgggcctctgcgggggaagcatccccttgccgagcaccttggtgtagccgaactgg 333

                                                                       
Query: 290 gagacgtcgacgacgggggccttgtcgccgccggcctccgcggccttgtcggacggcacc 349
           | |||||||| ||||||||||||| || |||||||||| |||||||||||||  ||||||
Sbjct: 332 gtgacgtcgatgacgggggccttgccggcgccggcctcggcggccttgtcggtgggcacc 273

                                                                       
Query: 350 atggaccagagcctctcgacgttgacggtcggggtgtagaacctgttgctgagcttgtgg 409
           ||||||||||| | ||||||||||||||  |||  || ||||||||||||||||||||||
Sbjct: 272 atggaccagaggcgctcgacgttgacggcggggcagtggaacctgttgctgagcttgtgg 213

                                                                       
Query: 410 aagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcg 469
           ||||| | ||| ||||| ||| ||||||||||| || |||||||||||||| ||||| ||
Sbjct: 212 aagtagcgcatgccgaccttg-ccgaagtagcccgggtggtacttgtcgaacaggatccg 154

                                                                       
Query: 470 gtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcccac 529
           |||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | 
Sbjct: 153 gtggtggtgcatccctccggcgttaccgcggcctccggggtgcttgcggtgcttcccgat 94

                                                                       
Query: 530 acgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttcttgaggcgggtcgt 589
            |||||||||||||| || ||||||||||||||||| ||||||||||||| ||| || ||
Sbjct: 93  gcgcccgtgcccggccgacacgtggccgcgcttcttccggttcttcttgaagcgcgttgt 34

              
Query: 590 cat 592
           |||
Sbjct: 33  cat 31

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  470 bits (237), Expect = e-129
 Identities = 378/423 (89%), Gaps = 4/423 (0%)
 Strand = Plus / Minus

                                                                            
Query: 173      gcgccgccggcggccttgatcttcttctcggcgatcttggagatgagcttggccttgacg 232
                |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 16599921 gcgccgccggcggccttgatcttcttctcggcgaccttggagatgagcttggccttgacg 16599862

                                                                            
Query: 233      acgatgggcttctccggc---agcatccccttgccgagcaccttgaagtagccgaactgc 289
                ||||||||| ||| |||    ||||||||||||||||||||||||  |||||||||||| 
Sbjct: 16599861 acgatgggcctctgcgggggaagcatccccttgccgagcaccttggtgtagccgaactgg 16599802

                                                                            
Query: 290      gagacgtcgacgacgggggccttgtcgccgccggcctccgcggccttgtcggacggcacc 349
                | |||||||| ||||||||||||| || |||||||||| |||||||||||||  ||||||
Sbjct: 16599801 gtgacgtcgatgacgggggccttgccggcgccggcctcggcggccttgtcggtgggcacc 16599742

                                                                            
Query: 350      atggaccagagcctctcgacgttgacggtcggggtgtagaacctgttgctgagcttgtgg 409
                ||||||||||| | ||||||||||||||  |||  || ||||||||||||||||||||||
Sbjct: 16599741 atggaccagaggcgctcgacgttgacggcggggcagtggaacctgttgctgagcttgtgg 16599682

                                                                            
Query: 410      aagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcg 469
                ||||| | ||| ||||| ||| ||||||||||| || |||||||||||||| ||||| ||
Sbjct: 16599681 aagtagcgcatgccgaccttg-ccgaagtagcccgggtggtacttgtcgaacaggatccg 16599623

                                                                            
Query: 470      gtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcccac 529
                |||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | 
Sbjct: 16599622 gtggtggtgcatccctccggcgttaccgcggcctccggggtgcttgcggtgcttcccgat 16599563

                                                                            
Query: 530      acgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttcttgaggcgggtcgt 589
                 |||||||||||||| || ||||||||||||||||| ||||||||||||| ||| || ||
Sbjct: 16599562 gcgcccgtgcccggccgacacgtggccgcgcttcttccggttcttcttgaagcgcgttgt 16599503

                   
Query: 590      cat 592
                |||
Sbjct: 16599502 cat 16599500



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 312      tgtcgccgccggcctccgcg 331
                ||||||||||||||||||||
Sbjct: 11143411 tgtcgccgccggcctccgcg 11143430



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 315     cgccgccggcctccgcggcc 334
               ||||||||||||||||||||
Sbjct: 1959636 cgccgccggcctccgcggcc 1959655

---

>gb|AC135559.4| Oryza sativa chromosome 3 BAC OSJNBa0030J19 genomic sequence, complete
             sequence
          Length = 133843

 Score =  470 bits (237), Expect = e-129
 Identities = 378/423 (89%), Gaps = 4/423 (0%)
 Strand = Plus / Plus

                                                                         
Query: 173   gcgccgccggcggccttgatcttcttctcggcgatcttggagatgagcttggccttgacg 232
             |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 54122 gcgccgccggcggccttgatcttcttctcggcgaccttggagatgagcttggccttgacg 54181

                                                                         
Query: 233   acgatgggcttctccggc---agcatccccttgccgagcaccttgaagtagccgaactgc 289
             ||||||||| ||| |||    ||||||||||||||||||||||||  |||||||||||| 
Sbjct: 54182 acgatgggcctctgcgggggaagcatccccttgccgagcaccttggtgtagccgaactgg 54241

                                                                         
Query: 290   gagacgtcgacgacgggggccttgtcgccgccggcctccgcggccttgtcggacggcacc 349
             | |||||||| ||||||||||||| || |||||||||| |||||||||||||  ||||||
Sbjct: 54242 gtgacgtcgatgacgggggccttgccggcgccggcctcggcggccttgtcggtgggcacc 54301

                                                                         
Query: 350   atggaccagagcctctcgacgttgacggtcggggtgtagaacctgttgctgagcttgtgg 409
             ||||||||||| | ||||||||||||||  |||  || ||||||||||||||||||||||
Sbjct: 54302 atggaccagaggcgctcgacgttgacggcggggcagtggaacctgttgctgagcttgtgg 54361

                                                                         
Query: 410   aagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcg 469
             ||||| | ||| ||||| ||| ||||||||||| || |||||||||||||| ||||| ||
Sbjct: 54362 aagtagcgcatgccgaccttg-ccgaagtagcccgggtggtacttgtcgaacaggatccg 54420

                                                                         
Query: 470   gtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcccac 529
             |||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | 
Sbjct: 54421 gtggtggtgcatccctccggcgttaccgcggcctccggggtgcttgcggtgcttcccgat 54480

                                                                         
Query: 530   acgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttcttgaggcgggtcgt 589
              |||||||||||||| || ||||||||||||||||| ||||||||||||| ||| || ||
Sbjct: 54481 gcgcccgtgcccggccgacacgtggccgcgcttcttccggttcttcttgaagcgcgttgt 54540

                
Query: 590   cat 592
             |||
Sbjct: 54541 cat 54543

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  470 bits (237), Expect = e-129
 Identities = 378/423 (89%), Gaps = 4/423 (0%)
 Strand = Plus / Minus

                                                                            
Query: 173      gcgccgccggcggccttgatcttcttctcggcgatcttggagatgagcttggccttgacg 232
                |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 16593554 gcgccgccggcggccttgatcttcttctcggcgaccttggagatgagcttggccttgacg 16593495

                                                                            
Query: 233      acgatgggcttctccggc---agcatccccttgccgagcaccttgaagtagccgaactgc 289
                ||||||||| ||| |||    ||||||||||||||||||||||||  |||||||||||| 
Sbjct: 16593494 acgatgggcctctgcgggggaagcatccccttgccgagcaccttggtgtagccgaactgg 16593435

                                                                            
Query: 290      gagacgtcgacgacgggggccttgtcgccgccggcctccgcggccttgtcggacggcacc 349
                | |||||||| ||||||||||||| || |||||||||| |||||||||||||  ||||||
Sbjct: 16593434 gtgacgtcgatgacgggggccttgccggcgccggcctcggcggccttgtcggtgggcacc 16593375

                                                                            
Query: 350      atggaccagagcctctcgacgttgacggtcggggtgtagaacctgttgctgagcttgtgg 409
                ||||||||||| | ||||||||||||||  |||  || ||||||||||||||||||||||
Sbjct: 16593374 atggaccagaggcgctcgacgttgacggcggggcagtggaacctgttgctgagcttgtgg 16593315

                                                                            
Query: 410      aagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcg 469
                ||||| | ||| ||||| ||| ||||||||||| || |||||||||||||| ||||| ||
Sbjct: 16593314 aagtagcgcatgccgaccttg-ccgaagtagcccgggtggtacttgtcgaacaggatccg 16593256

                                                                            
Query: 470      gtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcccac 529
                |||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | 
Sbjct: 16593255 gtggtggtgcatccctccggcgttaccgcggcctccggggtgcttgcggtgcttcccgat 16593196

                                                                            
Query: 530      acgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttcttgaggcgggtcgt 589
                 |||||||||||||| || ||||||||||||||||| ||||||||||||| ||| || ||
Sbjct: 16593195 gcgcccgtgcccggccgacacgtggccgcgcttcttccggttcttcttgaagcgcgttgt 16593136

                   
Query: 590      cat 592
                |||
Sbjct: 16593135 cat 16593133



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 312      tgtcgccgccggcctccgcg 331
                ||||||||||||||||||||
Sbjct: 11140174 tgtcgccgccggcctccgcg 11140193



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 315     cgccgccggcctccgcggcc 334
               ||||||||||||||||||||
Sbjct: 1959634 cgccgccggcctccgcggcc 1959653

---

>gb|AY103571.1| Zea mays PCO153825 mRNA sequence
          Length = 725

 Score =  466 bits (235), Expect = e-128
 Identities = 395/447 (88%), Gaps = 1/447 (0%)
 Strand = Plus / Minus

                                                                       
Query: 153 cctaggcgacgagcacgacagcgccgccggcggccttgatcttcttctcggcgatcttgg 212
           ||||||||  ||||||||| || ||||| || |||||||||||||||||||||| |||||
Sbjct: 505 cctaggcggtgagcacgacggccccgcctgctgccttgatcttcttctcggcgaccttgg 446

                                                                       
Query: 213 agatgagcttggccttgacgacgatgggcttctccggcagcatccccttgccgagcacct 272
           |||||||||||||||||||||| ||||||||   |||||||| |||||| ||||||||||
Sbjct: 445 agatgagcttggccttgacgacaatgggcttgggcggcagcacccccttcccgagcacct 386

                                                                       
Query: 273 tgaagtagccgaactgcgagacgtcgacgacgggggccttgtcgccgccggcctccgcgg 332
           |||||||||||||||||| ||||||||     ||||||||||||  |||||||||||| |
Sbjct: 385 tgaagtagccgaactgcgtgacgtcgatctgcggggccttgtcgaggccggcctccgccg 326

                                                                       
Query: 333 ccttgtcggacggcaccatggaccagagcctctcgacgttgacggtcggggtgtagaacc 392
           |||| ||||  |||||||| |||||||| | ||||| |||||| |  |||  ||||||| 
Sbjct: 325 ccttttcggcgggcaccatcgaccagaggcgctcgatgttgaccgcggggcagtagaact 266

                                                                       
Query: 393 tgttgctgagcttgtggaagtacctcataccgactttgcccgaagtagccgggatggtac 452
           |||||| ||||||||||||||| | ||| ||||| || || |||||||||||||||||||
Sbjct: 265 tgttgcggagcttgtggaagtagcgcatgccgaccttacc-gaagtagccgggatggtac 207

                                                                       
Query: 453 ttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgc 512
           |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||
Sbjct: 206 ttgtcgaagaggatgcggtggtggtgcatgccaccggcgttaccgcgacctccgggatgc 147

                                                                       
Query: 513 ttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggttc 572
           || ||||||||||| |  || |||||||||||||| ||||||||||||||||||||||||
Sbjct: 146 ttccggtgcttgccgatgcggccgtgcccggcggacacgtggccgcgcttcttgcggttc 87

                                      
Query: 573 ttcttgaggcgggtcgtcatcgccgcc 599
           ||||||| ||| |||||||||||||||
Sbjct: 86  ttcttgaagcgcgtcgtcatcgccgcc 60

---

>gb|BT017787.1| Zea mays clone EL01N0504C04.c mRNA sequence
          Length = 711

 Score =  442 bits (223), Expect = e-121
 Identities = 392/447 (87%), Gaps = 1/447 (0%)
 Strand = Plus / Minus

                                                                       
Query: 153 cctaggcgacgagcacgacagcgccgccggcggccttgatcttcttctcggcgatcttgg 212
           ||||||||  ||||||||| |||||||| || |||||||||||||||||||||| |||||
Sbjct: 497 cctaggcggtgagcacgacggcgccgcctgctgccttgatcttcttctcggcgaccttgg 438

                                                                       
Query: 213 agatgagcttggccttgacgacgatgggcttctccggcagcatccccttgccgagcacct 272
           |||||||||||||||||||||| ||||||||   |||||||| |||||| ||||||||||
Sbjct: 437 agatgagcttggccttgacgacaatgggctttggcggcagcacccccttcccgagcacct 378

                                                                       
Query: 273 tgaagtagccgaactgcgagacgtcgacgacgggggccttgtcgccgccggcctccgcgg 332
           |||||||||||||||||| ||||||||     |||||||||||||||||||||||||| |
Sbjct: 377 tgaagtagccgaactgcgtgacgtcgatctgcggggccttgtcgccgccggcctccgccg 318

                                                                       
Query: 333 ccttgtcggacggcaccatggaccagagcctctcgacgttgacggtcggggtgtagaacc 392
           |||||||||  |||||||| |||||||| | ||||| |||||| |  |||  ||||||| 
Sbjct: 317 ccttgtcggtgggcaccatcgaccagaggcgctcgatgttgaccgcggggcagtagaact 258

                                                                       
Query: 393 tgttgctgagcttgtggaagtacctcataccgactttgcccgaagtagccgggatggtac 452
           |||||| |||||| |||||||| | ||| || || ||||| ||||||||| |||||||||
Sbjct: 257 tgttgcggagcttatggaagtaacgcatgccaaccttgcc-gaagtagcccggatggtac 199

                                                                       
Query: 453 ttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgc 512
           |||||||||||||| ||||||||||||||||| |||||||||||||| ||||| || |||
Sbjct: 198 ttgtcgaagaggatacggtggtggtgcatgccaccggcgttaccgcgacctcccgggtgc 139

                                                                       
Query: 513 ttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggttc 572
           || | ||||||||| |  || |||||||||||||| ||||||||||||||||||||||||
Sbjct: 138 ttcctgtgcttgccgatgcggccgtgcccggcggacacgtggccgcgcttcttgcggttc 79

                                      
Query: 573 ttcttgaggcgggtcgtcatcgccgcc 599
           ||||||| ||| || ||||||||||||
Sbjct: 78  ttcttgaagcgcgttgtcatcgccgcc 52

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  434 bits (219), Expect = e-118
 Identities = 396/453 (87%), Gaps = 4/453 (0%)
 Strand = Plus / Plus

                                                                            
Query: 150      aaccctaggcgacgagcacgacagcgccgccggcggccttgatcttcttctcggcgatct 209
                |||||||||||  ||||||||| |||||||||||||||||||||||||||||||||| ||
Sbjct: 25183371 aaccctaggcggtgagcacgacggcgccgccggcggccttgatcttcttctcggcgacct 25183430

                                                                            
Query: 210      tggagatgagcttggccttgacgacgatgggcttctccggcagcatccccttgccgagca 269
                |||||||||||||||||||||||||||||||||||||||||||||  ||||| |||||||
Sbjct: 25183431 tggagatgagcttggccttgacgacgatgggcttctccggcagcagacccttcccgagca 25183490

                                                                            
Query: 270      ccttgaagtagccgaactgcgagacgtcgacgacgggggcctt---gtcgccgccggcct 326
                |||||||||||||||||||||  ||||| |  | ||| |||||   | ||||| ||||||
Sbjct: 25183491 ccttgaagtagccgaactgcgtcacgtccagcaggggcgccttgccggcgccggcggcct 25183550

                                                                            
Query: 327      ccgcggccttgtcggacggcaccatggaccagagcctctcgacgttgacggtcggggtgt 386
                |||| ||||  ||||  |||||||| |||||||||| ||| ||||| || | ||||| ||
Sbjct: 25183551 ccgccgcctgctcggcgggcaccatcgaccagagccgctccacgttcaccgccggggagt 25183610

                                                                            
Query: 387      agaacctgttgctgagcttgtggaagtacctcataccgactttgcccgaagtagccggga 446
                ||||| |||||| |||| |||||||||| | ||| ||||| ||| ||||||||||| || 
Sbjct: 25183611 agaacttgttgcggagcctgtggaagtagcgcatgccgaccttg-ccgaagtagcccggg 25183669

                                                                            
Query: 447      tggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccg 506
                ||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| 
Sbjct: 25183670 tggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttgccccggcctccc 25183729

                                                                            
Query: 507      ggatgcttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttg 566
                || ||||| |||||||| || |  || ||||| |||||||| ||||||||||||||||||
Sbjct: 25183730 gggtgcttccggtgcttcccgatgcggccgtggccggcggacacgtggccgcgcttcttg 25183789

                                                 
Query: 567      cggttcttcttgaggcgggtcgtcatcgccgcc 599
                ||||||||| | ||||  |||||||||||||||
Sbjct: 25183790 cggttcttcctcaggctcgtcgtcatcgccgcc 25183822

---

>dbj|AP005198.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7,
           PAC clone:P0616D06
          Length = 153800

 Score =  434 bits (219), Expect = e-118
 Identities = 396/453 (87%), Gaps = 4/453 (0%)
 Strand = Plus / Plus

                                                                       
Query: 150 aaccctaggcgacgagcacgacagcgccgccggcggccttgatcttcttctcggcgatct 209
           |||||||||||  ||||||||| |||||||||||||||||||||||||||||||||| ||
Sbjct: 42  aaccctaggcggtgagcacgacggcgccgccggcggccttgatcttcttctcggcgacct 101

                                                                       
Query: 210 tggagatgagcttggccttgacgacgatgggcttctccggcagcatccccttgccgagca 269
           |||||||||||||||||||||||||||||||||||||||||||||  ||||| |||||||
Sbjct: 102 tggagatgagcttggccttgacgacgatgggcttctccggcagcagacccttcccgagca 161

                                                                       
Query: 270 ccttgaagtagccgaactgcgagacgtcgacgacgggggcctt---gtcgccgccggcct 326
           |||||||||||||||||||||  ||||| |  | ||| |||||   | ||||| ||||||
Sbjct: 162 ccttgaagtagccgaactgcgtcacgtccagcaggggcgccttgccggcgccggcggcct 221

                                                                       
Query: 327 ccgcggccttgtcggacggcaccatggaccagagcctctcgacgttgacggtcggggtgt 386
           |||| ||||  ||||  |||||||| |||||||||| ||| ||||| || | ||||| ||
Sbjct: 222 ccgccgcctgctcggcgggcaccatcgaccagagccgctccacgttcaccgccggggagt 281

                                                                       
Query: 387 agaacctgttgctgagcttgtggaagtacctcataccgactttgcccgaagtagccggga 446
           ||||| |||||| |||| |||||||||| | ||| ||||| ||| ||||||||||| || 
Sbjct: 282 agaacttgttgcggagcctgtggaagtagcgcatgccgaccttg-ccgaagtagcccggg 340

                                                                       
Query: 447 tggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccg 506
           ||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| 
Sbjct: 341 tggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttgccccggcctccc 400

                                                                       
Query: 507 ggatgcttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttg 566
           || ||||| |||||||| || |  || ||||| |||||||| ||||||||||||||||||
Sbjct: 401 gggtgcttccggtgcttcccgatgcggccgtggccggcggacacgtggccgcgcttcttg 460

                                            
Query: 567 cggttcttcttgaggcgggtcgtcatcgccgcc 599
           ||||||||| | ||||  |||||||||||||||
Sbjct: 461 cggttcttcctcaggctcgtcgtcatcgccgcc 493

---

>dbj|AP003700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OJ1003_H02
          Length = 124043

 Score =  434 bits (219), Expect = e-118
 Identities = 396/453 (87%), Gaps = 4/453 (0%)
 Strand = Plus / Plus

                                                                          
Query: 150    aaccctaggcgacgagcacgacagcgccgccggcggccttgatcttcttctcggcgatct 209
              |||||||||||  ||||||||| |||||||||||||||||||||||||||||||||| ||
Sbjct: 103858 aaccctaggcggtgagcacgacggcgccgccggcggccttgatcttcttctcggcgacct 103917

                                                                          
Query: 210    tggagatgagcttggccttgacgacgatgggcttctccggcagcatccccttgccgagca 269
              |||||||||||||||||||||||||||||||||||||||||||||  ||||| |||||||
Sbjct: 103918 tggagatgagcttggccttgacgacgatgggcttctccggcagcagacccttcccgagca 103977

                                                                          
Query: 270    ccttgaagtagccgaactgcgagacgtcgacgacgggggcctt---gtcgccgccggcct 326
              |||||||||||||||||||||  ||||| |  | ||| |||||   | ||||| ||||||
Sbjct: 103978 ccttgaagtagccgaactgcgtcacgtccagcaggggcgccttgccggcgccggcggcct 104037

                                                                          
Query: 327    ccgcggccttgtcggacggcaccatggaccagagcctctcgacgttgacggtcggggtgt 386
              |||| ||||  ||||  |||||||| |||||||||| ||| ||||| || | ||||| ||
Sbjct: 104038 ccgccgcctgctcggcgggcaccatcgaccagagccgctccacgttcaccgccggggagt 104097

                                                                          
Query: 387    agaacctgttgctgagcttgtggaagtacctcataccgactttgcccgaagtagccggga 446
              ||||| |||||| |||| |||||||||| | ||| ||||| ||| ||||||||||| || 
Sbjct: 104098 agaacttgttgcggagcctgtggaagtagcgcatgccgaccttg-ccgaagtagcccggg 104156

                                                                          
Query: 447    tggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccg 506
              ||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| 
Sbjct: 104157 tggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttgccccggcctccc 104216

                                                                          
Query: 507    ggatgcttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttg 566
              || ||||| |||||||| || |  || ||||| |||||||| ||||||||||||||||||
Sbjct: 104217 gggtgcttccggtgcttcccgatgcggccgtggccggcggacacgtggccgcgcttcttg 104276

                                               
Query: 567    cggttcttcttgaggcgggtcgtcatcgccgcc 599
              ||||||||| | ||||  |||||||||||||||
Sbjct: 104277 cggttcttcctcaggctcgtcgtcatcgccgcc 104309

---

>gb|BT016384.1| Zea mays clone Contig217 mRNA sequence
          Length = 696

 Score =  426 bits (215), Expect = e-116
 Identities = 390/447 (87%), Gaps = 1/447 (0%)
 Strand = Plus / Minus

                                                                       
Query: 153 cctaggcgacgagcacgacagcgccgccggcggccttgatcttcttctcggcgatcttgg 212
           ||||||||  ||||||||| |||||||| || |||||||||||||||||||||| |||||
Sbjct: 483 cctaggcggtgagcacgacggcgccgcctgctgccttgatcttcttctcggcgaccttgg 424

                                                                       
Query: 213 agatgagcttggccttgacgacgatgggcttctccggcagcatccccttgccgagcacct 272
           |||||||||||||||||||||| ||||||||   |||||||| |||||| ||||||||||
Sbjct: 423 agatgagcttggccttgacgacaatgggctttggcggcagcacccccttcccgagcacct 364

                                                                       
Query: 273 tgaagtagccgaactgcgagacgtcgacgacgggggccttgtcgccgccggcctccgcgg 332
           |||||||||||||||||| ||||||||     |||||||||||||||||||||||||| |
Sbjct: 363 tgaagtagccgaactgcgtgacgtcgatctgcggggccttgtcgccgccggcctccgccg 304

                                                                       
Query: 333 ccttgtcggacggcaccatggaccagagcctctcgacgttgacggtcggggtgtagaacc 392
           |||||||||  |||||||| |||||||| | ||||| |||||| |  |||  ||||||| 
Sbjct: 303 ccttgtcggtgggcaccatcgaccagaggcgctcgatgttgaccgcggggcagtagaact 244

                                                                       
Query: 393 tgttgctgagcttgtggaagtacctcataccgactttgcccgaagtagccgggatggtac 452
           |||||| |||||| |||||||| | ||| || || ||||| ||||||||| |||||||||
Sbjct: 243 tgttgcggagcttatggaagtaacgcatgccaaccttgcc-gaagtagcccggatggtac 185

                                                                       
Query: 453 ttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgc 512
           ||||||  |||||| ||||||||||||||||| |||||||||||||| ||||| || |||
Sbjct: 184 ttgtcgccgaggatacggtggtggtgcatgccaccggcgttaccgcgacctcccgggtgc 125

                                                                       
Query: 513 ttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggttc 572
           || | ||||||||| |  || |||||||||||||| ||||||||||||||||||||||||
Sbjct: 124 ttcctgtgcttgccgatgcggccgtgcccggcggacacgtggccgcgcttcttgcggttc 65

                                      
Query: 573 ttcttgaggcgggtcgtcatcgccgcc 599
           ||||||| ||| || ||||||||||||
Sbjct: 64  ttcttgaagcgcgttgtcatcgccgcc 38

---

>ref|XM_479144.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 441

 Score =  412 bits (208), Expect = e-112
 Identities = 385/442 (87%), Gaps = 4/442 (0%)
 Strand = Plus / Minus

                                                                       
Query: 154 ctaggcgacgagcacgacagcgccgccggcggccttgatcttcttctcggcgatcttgga 213
           |||||||  ||||||||| |||||||||||||||||||||||||||||||||| ||||||
Sbjct: 441 ctaggcggtgagcacgacggcgccgccggcggccttgatcttcttctcggcgaccttgga 382

                                                                       
Query: 214 gatgagcttggccttgacgacgatgggcttctccggcagcatccccttgccgagcacctt 273
           |||||||||||||||||||||||||||||||||||||||||  ||||| |||||||||||
Sbjct: 381 gatgagcttggccttgacgacgatgggcttctccggcagcagacccttcccgagcacctt 322

                                                                       
Query: 274 gaagtagccgaactgcgagacgtcgacgacgggggcctt---gtcgccgccggcctccgc 330
           |||||||||||||||||  ||||| |  | ||| |||||   | ||||| ||||||||||
Sbjct: 321 gaagtagccgaactgcgtcacgtccagcaggggcgccttgccggcgccggcggcctccgc 262

                                                                       
Query: 331 ggccttgtcggacggcaccatggaccagagcctctcgacgttgacggtcggggtgtagaa 390
            ||||  ||||  |||||||| |||||||||| ||| ||||| || | ||||| ||||||
Sbjct: 261 cgcctgctcggcgggcaccatcgaccagagccgctccacgttcaccgccggggagtagaa 202

                                                                       
Query: 391 cctgttgctgagcttgtggaagtacctcataccgactttgcccgaagtagccgggatggt 450
           | |||||| |||| |||||||||| | ||| ||||| ||| ||||||||||| || ||||
Sbjct: 201 cttgttgcggagcctgtggaagtagcgcatgccgaccttg-ccgaagtagcccgggtggt 143

                                                                       
Query: 451 acttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggat 510
           ||||||||||||||||||||||||||||||||||||||||||| || |||||||| || |
Sbjct: 142 acttgtcgaagaggatgcggtggtggtgcatgcctccggcgttgccccggcctcccgggt 83

                                                                       
Query: 511 gcttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggt 570
           |||| |||||||| || |  || ||||| |||||||| ||||||||||||||||||||||
Sbjct: 82  gcttccggtgcttcccgatgcggccgtggccggcggacacgtggccgcgcttcttgcggt 23

                                 
Query: 571 tcttcttgaggcgggtcgtcat 592
           ||||| | ||||  ||||||||
Sbjct: 22  tcttcctcaggctcgtcgtcat 1

---

>gb|AY103771.1| Zea mays PCO152633 mRNA sequence
          Length = 740

 Score =  391 bits (197), Expect = e-105
 Identities = 380/439 (86%), Gaps = 4/439 (0%)
 Strand = Plus / Minus

                                                                       
Query: 164 agcacgacagcgccgccggcggccttgatcttcttctcggcgatcttggagatgagcttg 223
           |||| ||| ||||| ||||| |||||||||||||||||||||| ||||||||||||||||
Sbjct: 499 agcaggacggcgcctccggcagccttgatcttcttctcggcgaccttggagatgagcttg 440

                                                                       
Query: 224 gccttgacgacgatgggcttctccggcagcatccccttgccgagcaccttgaagtagccg 283
           |||||||||||||||||| |   |||||||||||||||||||||||||||||||||||||
Sbjct: 439 gccttgacgacgatgggcctggacggcagcatccccttgccgagcaccttgaagtagccg 380

                                                                       
Query: 284 aactgcgagacgtcgacgacgggggccttgt---cgccgccggcctccgcggccttgtcg 340
           |||||||  ||||||||||  ||||||| ||   ||||| | ||||||||||||||| ||
Sbjct: 379 aactgcgtcacgtcgacgagcggggcctggtccgcgccggccgcctccgcggccttgccg 320

                                                                       
Query: 341 gacggcaccatggaccagagcctctcgacgttgacggtcggggtgtagaacctgttgctg 400
           |  |||||||| |||||||||| ||| |||||||| | ||||  || |||| |||||| |
Sbjct: 319 gcgggcaccatcgaccagagccgctccacgttgaccgacgggcagtggaacttgttgcgg 260

                                                                       
Query: 401 agcttgtggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaa 460
           ||| |||||||||| | ||| || || ||| ||||||||||| || |||||||| |||||
Sbjct: 259 agcctgtggaagtagcgcatgcccaccttg-ccgaagtagcccgggtggtacttatcgaa 201

                                                                       
Query: 461 gaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtg 520
           |||||||||||||||||||||||| |||||||| ||||||||||| || ||||| |||||
Sbjct: 200 gaggatgcggtggtggtgcatgccgccggcgttgccgcggcctcccgggtgcttccggtg 141

                                                                       
Query: 521 cttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttcttgag 580
           |||||| |  || |||||||| || || ||||| ||||||||||| ||||||||||| ||
Sbjct: 140 cttgccgatgcggccgtgccccgccgacacgtgcccgcgcttcttccggttcttcttcag 81

                              
Query: 581 gcgggtcgtcatcgccgcc 599
           ||  |||||||||||||||
Sbjct: 80  gctcgtcgtcatcgccgcc 62

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score =  365 bits (184), Expect = 1e-97
 Identities = 356/410 (86%), Gaps = 10/410 (2%)
 Strand = Plus / Minus

                                                                           
Query: 173     gcgccgccggcggccttgatcttcttctcggcgatcttggagatgagcttggccttgacg 232
               |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 4135369 gcgccgccggcggccttgatcttcttctcggcgaccttggagatgagcttggccttgacg 4135310

                                                                           
Query: 233     acgatgggcttctccggc---agcatccccttgccgagcaccttgaagtagccgaactgc 289
               ||||||||| |||| ||    ||||||||||||||||||||||||  |||||||||||||
Sbjct: 4135309 acgatgggcctctctggggggagcatccccttgccgagcaccttggtgtagccgaactgc 4135250

                                                                           
Query: 290     gagacgtcgacgacgggggccttgtcgccgccggcctccgcggccttgtcggacggcacc 349
               | |||||||| ||||||||||||| || |||||||  |   ||||| | |||   |||||
Sbjct: 4135249 gtgacgtcgatgacgggggccttgccggcgccggcgcc---ggcctcggcgg---gcacc 4135196

                                                                           
Query: 350     atggaccagagcctctcgacgttgacggtcggggtgtagaacctgttgctgagcttgtgg 409
               ||||||||||| | ||||||||||||||  |||  || |||||||||||||||| |||||
Sbjct: 4135195 atggaccagaggcgctcgacgttgacggcggggcagtggaacctgttgctgagcctgtgg 4135136

                                                                           
Query: 410     aagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcg 469
               ||||| | ||| ||||| ||||| ||||||||| || |||||||||||||| ||||||||
Sbjct: 4135135 aagtagcgcatcccgaccttgcc-gaagtagcccgggtggtacttgtcgaacaggatgcg 4135077

                                                                           
Query: 470     gtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcccac 529
               |||||||||||| || |||||||| ||||| ||||| || ||||| |||||||| || | 
Sbjct: 4135076 gtggtggtgcatcccgccggcgttcccgcgccctcccgggtgcttccggtgcttcccgat 4135017

                                                                 
Query: 530     acgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttcttga 579
                |||||||||||||| || ||||| ||||||||||| |||||||||||||
Sbjct: 4135016 ccgcccgtgcccggccgacacgtgcccgcgcttcttccggttcttcttga 4134967



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 312     tgtcgccgccggcctccgcg 331
               ||||||||||||||||||||
Sbjct: 8040518 tgtcgccgccggcctccgcg 8040499

---

>dbj|AP003992.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1077_E05
          Length = 116305

 Score =  365 bits (184), Expect = 1e-97
 Identities = 356/410 (86%), Gaps = 10/410 (2%)
 Strand = Plus / Minus

                                                                         
Query: 173   gcgccgccggcggccttgatcttcttctcggcgatcttggagatgagcttggccttgacg 232
             |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 45383 gcgccgccggcggccttgatcttcttctcggcgaccttggagatgagcttggccttgacg 45324

                                                                         
Query: 233   acgatgggcttctccggc---agcatccccttgccgagcaccttgaagtagccgaactgc 289
             ||||||||| |||| ||    ||||||||||||||||||||||||  |||||||||||||
Sbjct: 45323 acgatgggcctctctggggggagcatccccttgccgagcaccttggtgtagccgaactgc 45264

                                                                         
Query: 290   gagacgtcgacgacgggggccttgtcgccgccggcctccgcggccttgtcggacggcacc 349
             | |||||||| ||||||||||||| || |||||||  |   ||||| | |||   |||||
Sbjct: 45263 gtgacgtcgatgacgggggccttgccggcgccggcgcc---ggcctcggcgg---gcacc 45210

                                                                         
Query: 350   atggaccagagcctctcgacgttgacggtcggggtgtagaacctgttgctgagcttgtgg 409
             ||||||||||| | ||||||||||||||  |||  || |||||||||||||||| |||||
Sbjct: 45209 atggaccagaggcgctcgacgttgacggcggggcagtggaacctgttgctgagcctgtgg 45150

                                                                         
Query: 410   aagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcg 469
             ||||| | ||| ||||| ||||| ||||||||| || |||||||||||||| ||||||||
Sbjct: 45149 aagtagcgcatcccgaccttgcc-gaagtagcccgggtggtacttgtcgaacaggatgcg 45091

                                                                         
Query: 470   gtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcccac 529
             |||||||||||| || |||||||| ||||| ||||| || ||||| |||||||| || | 
Sbjct: 45090 gtggtggtgcatcccgccggcgttcccgcgccctcccgggtgcttccggtgcttcccgat 45031

                                                               
Query: 530   acgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttcttga 579
              |||||||||||||| || ||||| ||||||||||| |||||||||||||
Sbjct: 45030 ccgcccgtgcccggccgacacgtgcccgcgcttcttccggttcttcttga 44981

---

>dbj|AK121069.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023061G23, full
           insert sequence
          Length = 727

 Score =  365 bits (184), Expect = 1e-97
 Identities = 356/410 (86%), Gaps = 10/410 (2%)
 Strand = Plus / Minus

                                                                       
Query: 173 gcgccgccggcggccttgatcttcttctcggcgatcttggagatgagcttggccttgacg 232
           |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 471 gcgccgccggcggccttgatcttcttctcggcgaccttggagatgagcttggccttgacg 412

                                                                       
Query: 233 acgatgggcttctccggc---agcatccccttgccgagcaccttgaagtagccgaactgc 289
           ||||||||| |||| ||    ||||||||||||||||||||||||  |||||||||||||
Sbjct: 411 acgatgggcctctctggggggagcatccccttgccgagcaccttggtgtagccgaactgc 352

                                                                       
Query: 290 gagacgtcgacgacgggggccttgtcgccgccggcctccgcggccttgtcggacggcacc 349
           | |||||||| ||||||||||||| || |||||||  |   ||||| | |||   |||||
Sbjct: 351 gtgacgtcgatgacgggggccttgccggcgccggcgcc---ggcctcggcgg---gcacc 298

                                                                       
Query: 350 atggaccagagcctctcgacgttgacggtcggggtgtagaacctgttgctgagcttgtgg 409
           ||||||||||| | ||||||||||||||  |||  || |||||||||||||||| |||||
Sbjct: 297 atggaccagaggcgctcgacgttgacggcggggcagtggaacctgttgctgagcctgtgg 238

                                                                       
Query: 410 aagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcg 469
           ||||| | ||| ||||| ||||| ||||||||| || |||||||||||||| ||||||||
Sbjct: 237 aagtagcgcatcccgaccttgcc-gaagtagcccgggtggtacttgtcgaacaggatgcg 179

                                                                       
Query: 470 gtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcccac 529
           |||||||||||| || |||||||| ||||| ||||| || ||||| |||||||| || | 
Sbjct: 178 gtggtggtgcatcccgccggcgttcccgcgccctcccgggtgcttccggtgcttcccgat 119

                                                             
Query: 530 acgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttcttga 579
            |||||||||||||| || ||||| ||||||||||| |||||||||||||
Sbjct: 118 ccgcccgtgcccggccgacacgtgcccgcgcttcttccggttcttcttga 69

---

>dbj|AB077113.1| Prunus persica mRNA, microsatellite marker M9a
          Length = 630

 Score =  238 bits (120), Expect = 2e-59
 Identities = 211/240 (87%), Gaps = 1/240 (0%)
 Strand = Plus / Minus

                                                                       
Query: 353 gaccagagcctctcgacgttgacggtcggggtgtagaacctgttgctgagcttgtggaag 412
           ||||||||| | |||||||||||| | |||  ||||||| |||||| |||||||||||||
Sbjct: 289 gaccagagcttgtcgacgttgacgatggggcagtagaacttgttgcggagcttgtggaag 230

                                                                       
Query: 413 tacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtg 472
           || | |||||| ||||| ||  || || || |||||||||||||||||||||||||||||
Sbjct: 229 tagcgcataccaactttaccaaaa-taccccggatggtacttgtcgaagaggatgcggtg 171

                                                                       
Query: 473 gtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcccacacg 532
           ||||||||||||||||||||||||||| ||||| |||||||||||||||||||| | |||
Sbjct: 170 gtggtgcatgcctccggcgttaccgcgacctccaggatgcttgcggtgcttgccgatacg 111

                                                                       
Query: 533 cccgtgcccggcggagacgtggccgcgcttcttgcggttcttcttgaggcgggtcgtcat 592
            || |||||||||  ||||||||| | ||||||||||||||||||||  |||||||||||
Sbjct: 110 accatgcccggcgctgacgtggcctctcttcttgcggttcttcttgaatcgggtcgtcat 51



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 43/46 (93%)
 Strand = Plus / Minus

                                                         
Query: 186 ccttgatcttcttctcggcgatcttggagatgagcttggccttgac 231
           |||||||||||||||| ||  |||||||||||||||||||||||||
Sbjct: 459 ccttgatcttcttctcagctgtcttggagatgagcttggccttgac 414

---

>dbj|AP006094.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT39H01, TM0172,
             complete sequence
          Length = 127731

 Score =  206 bits (104), Expect = 6e-50
 Identities = 207/240 (86%), Gaps = 1/240 (0%)
 Strand = Plus / Plus

                                                                         
Query: 353   gaccagagcctctcgacgttgacggtcggggtgtagaacctgttgctgagcttgtggaag 412
             ||||||||| | |||| ||||||||| |||    |||||  ||||| |||||||||||||
Sbjct: 97486 gaccagagcttgtcgatgttgacggtggggcaaaagaactggttgcggagcttgtggaag 97545

                                                                         
Query: 413   tacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtg 472
             || | |||||| || ||||| |||||| ||||||||||||||||||||||||||||||||
Sbjct: 97546 tagcgcataccaaccttgcc-gaagtaaccgggatggtacttgtcgaagaggatgcggtg 97604

                                                                         
Query: 473   gtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcccacacg 532
             ||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |  ||
Sbjct: 97605 gtggtgcatgcctccggcgttaccgcgacctcctggatgcttgcggtgcttgccgattcg 97664

                                                                         
Query: 533   cccgtgcccggcggagacgtggccgcgcttcttgcggttcttcttgaggcgggtcgtcat 592
              ||||| ||||||  ||||||||| | |||||| | |||||||||||  | |||||||||
Sbjct: 97665 accgtggccggcgctgacgtggcctctcttcttcctgttcttcttgaatctggtcgtcat 97724



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                        
Query: 186   ccttgatcttcttctcggcgatcttggagatgagcttggcctt 228
             |||||||||||||||| || ||||| || |||||||| |||||
Sbjct: 97310 ccttgatcttcttctcagcaatcttcgaaatgagcttcgcctt 97352

---

>gb|BT016406.1| Zea mays clone Contig239 mRNA sequence
          Length = 1257

 Score =  194 bits (98), Expect = 2e-46
 Identities = 152/170 (89%)
 Strand = Plus / Plus

                                                                       
Query: 153 cctaggcgacgagcacgacagcgccgccggcggccttgatcttcttctcggcgatcttgg 212
           ||||||||  ||||||||| |||||||| || |||||||||||||||||||||| |||||
Sbjct: 199 cctaggcggtgagcacgacggcgccgcctgctgccttgatcttcttctcggcgaccttgg 258

                                                                       
Query: 213 agatgagcttggccttgacgacgatgggcttctccggcagcatccccttgccgagcacct 272
           |||||||||||||||||||||| ||||||||   |||||||| |||||| ||||||||||
Sbjct: 259 agatgagcttggccttgacgacaatgggctttggcggcagcacccccttcccgagcacct 318

                                                             
Query: 273 tgaagtagccgaactgcgagacgtcgacgacgggggccttgtcgccgccg 322
           |||||||||||||||||| ||||||||     ||||||||||||||||||
Sbjct: 319 tgaagtagccgaactgcgtgacgtcgatctgcggggccttgtcgccgccg 368

---

>gb|AC126783.33| Medicago truncatula clone mth2-15k17, complete sequence
          Length = 117437

 Score =  161 bits (81), Expect = 3e-36
 Identities = 166/193 (86%), Gaps = 1/193 (0%)
 Strand = Plus / Minus

                                                                        
Query: 400  gagcttgtggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcga 459
            ||||||||| ||||| | |||||| ||||| || |||||| || ||||||||||||||||
Sbjct: 7081 gagcttgtgaaagtaacgcataccaactttacc-gaagtaacctggatggtacttgtcga 7023

                                                                        
Query: 460  agaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggt 519
            |||||||||| ||||| ||||| |||||||||||||| || |||||||||||||||||||
Sbjct: 7022 agaggatgcgatggtgatgcatacctccggcgttaccacgacctccgggatgcttgcggt 6963

                                                                        
Query: 520  gcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttcttga 579
            | || || | ||| ||||| |||||   |||||||||||||||||| | |||||||||||
Sbjct: 6962 gttttccgatacgaccgtgaccggcactgacgtggccgcgcttcttcctgttcttcttga 6903

                         
Query: 580  ggcgggtcgtcat 592
              ||||| |||||
Sbjct: 6902 atcgggttgtcat 6890

---

>gb|AC147877.10| Medicago truncatula clone mth2-9b13, complete sequence
          Length = 122251

 Score =  139 bits (70), Expect = 1e-29
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                          
Query: 432    ccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcg 491
              |||||||| || ||||| ||||||||||||||||| || ||||||||||| |||||||||
Sbjct: 105867 ccgaagtaacctggatgatacttgtcgaagaggatacgatggtggtgcattcctccggcg 105926

                                                                          
Query: 492    ttaccgcggcctccgggatgcttgcggtgcttgcccacacgcccgtgcccggcggagacg 551
              ||||| || ||||||||||||||||| ||||| || | ||| ||||| ||||||   |||
Sbjct: 105927 ttaccacgacctccgggatgcttgcgatgctttccgatacgaccgtgaccggcgctcacg 105986

                                                        
Query: 552    tggccgcgcttcttgcggttcttcttgaggcgggtcgtcatc 593
              || || | |||||| | ||||||||||| |||||||||||||
Sbjct: 105987 tgacctctcttcttcctgttcttcttgaagcgggtcgtcatc 106028

---

>emb|CT573365.4| M.truncatula DNA sequence from clone MTH2-89E15 on chromosome 3,
             complete sequence
          Length = 123679

 Score =  139 bits (70), Expect = 1e-29
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                         
Query: 432   ccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcg 491
             |||||||| || ||||| ||||||||||||||||| || ||||||||||| |||||||||
Sbjct: 18949 ccgaagtaacctggatgatacttgtcgaagaggatacgatggtggtgcattcctccggcg 19008

                                                                         
Query: 492   ttaccgcggcctccgggatgcttgcggtgcttgcccacacgcccgtgcccggcggagacg 551
             ||||| || ||||||||||||||||| ||||| || | ||| ||||| ||||||   |||
Sbjct: 19009 ttaccacgacctccgggatgcttgcgatgctttccgatacgaccgtgaccggcgctcacg 19068

                                                       
Query: 552   tggccgcgcttcttgcggttcttcttgaggcgggtcgtcatc 593
             || || | |||||| | ||||||||||| |||||||||||||
Sbjct: 19069 tgacctctcttcttcctgttcttcttgaagcgggtcgtcatc 19110

---

>ref|NM_105728.2| Arabidopsis thaliana structural constituent of ribosome AT1G70600
           mRNA, complete cds
          Length = 737

 Score =  137 bits (69), Expect = 5e-29
 Identities = 163/193 (84%), Gaps = 1/193 (0%)
 Strand = Plus / Minus

                                                                       
Query: 387 agaacctgttgctgagcttgtggaagtacctcataccgactttgcccgaagtagccggga 446
           ||||| |||| || ||||||||||| ||||||||||| ||||| || |||||| || |||
Sbjct: 256 agaacttgttcctcagcttgtggaaatacctcataccaactttacc-gaagtaacctgga 198

                                                                       
Query: 447 tggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccg 506
           |||||||||||||||||||| | |||||| ||||| ||||| |||||||| || ||||||
Sbjct: 197 tggtacttgtcgaagaggatcctgtggtgatgcatacctccagcgttaccacgacctccg 138

                                                                       
Query: 507 ggatgcttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttg 566
           |||||||| |||||||| || | ||| || || ||||||  |||||| || | |||||| 
Sbjct: 137 ggatgcttacggtgcttaccgatacgtccatgtccggcgctgacgtgacctctcttcttc 78

                        
Query: 567 cggttcttcttga 579
           | |||||||||||
Sbjct: 77  ctgttcttcttga 65

---

>gb|AY091706.1| Arabidopsis thaliana At1g70600/F5A18_22 mRNA, complete cds
          Length = 441

 Score =  137 bits (69), Expect = 5e-29
 Identities = 163/193 (84%), Gaps = 1/193 (0%)
 Strand = Plus / Minus

                                                                       
Query: 387 agaacctgttgctgagcttgtggaagtacctcataccgactttgcccgaagtagccggga 446
           ||||| |||| || ||||||||||| ||||||||||| ||||| || |||||| || |||
Sbjct: 205 agaacttgttcctcagcttgtggaaatacctcataccaactttacc-gaagtaacctgga 147

                                                                       
Query: 447 tggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccg 506
           |||||||||||||||||||| | |||||| ||||| ||||| |||||||| || ||||||
Sbjct: 146 tggtacttgtcgaagaggatcctgtggtgatgcatacctccagcgttaccacgacctccg 87

                                                                       
Query: 507 ggatgcttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttg 566
           |||||||| |||||||| || | ||| || || ||||||  |||||| || | |||||| 
Sbjct: 86  ggatgcttacggtgcttaccgatacgtccatgtccggcgctgacgtgacctctcttcttc 27

                        
Query: 567 cggttcttcttga 579
           | |||||||||||
Sbjct: 26  ctgttcttcttga 14

---

>gb|AY048228.1| Arabidopsis thaliana At1g70600/F5A18_22 mRNA, complete cds
          Length = 665

 Score =  137 bits (69), Expect = 5e-29
 Identities = 163/193 (84%), Gaps = 1/193 (0%)
 Strand = Plus / Minus

                                                                       
Query: 387 agaacctgttgctgagcttgtggaagtacctcataccgactttgcccgaagtagccggga 446
           ||||| |||| || ||||||||||| ||||||||||| ||||| || |||||| || |||
Sbjct: 254 agaacttgttcctcagcttgtggaaatacctcataccaactttacc-gaagtaacctgga 196

                                                                       
Query: 447 tggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccg 506
           |||||||||||||||||||| | |||||| ||||| ||||| |||||||| || ||||||
Sbjct: 195 tggtacttgtcgaagaggatcctgtggtgatgcatacctccagcgttaccacgacctccg 136

                                                                       
Query: 507 ggatgcttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttg 566
           |||||||| |||||||| || | ||| || || ||||||  |||||| || | |||||| 
Sbjct: 135 ggatgcttacggtgcttaccgatacgtccatgtccggcgctgacgtgacctctcttcttc 76

                        
Query: 567 cggttcttcttga 579
           | |||||||||||
Sbjct: 75  ctgttcttcttga 63

---

>gb|AY039519.1| Arabidopsis thaliana At1g70600/F5A18_22 mRNA, complete cds
          Length = 644

 Score =  137 bits (69), Expect = 5e-29
 Identities = 163/193 (84%), Gaps = 1/193 (0%)
 Strand = Plus / Minus

                                                                       
Query: 387 agaacctgttgctgagcttgtggaagtacctcataccgactttgcccgaagtagccggga 446
           ||||| |||| || ||||||||||| ||||||||||| ||||| || |||||| || |||
Sbjct: 254 agaacttgttcctcagcttgtggaaatacctcataccaactttacc-gaagtaacctgga 196

                                                                       
Query: 447 tggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccg 506
           |||||||||||||||||||| | |||||| ||||| ||||| |||||||| || ||||||
Sbjct: 195 tggtacttgtcgaagaggatcctgtggtgatgcatacctccagcgttaccacgacctccg 136

                                                                       
Query: 507 ggatgcttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttg 566
           |||||||| |||||||| || | ||| || || ||||||  |||||| || | |||||| 
Sbjct: 135 ggatgcttacggtgcttaccgatacgtccatgtccggcgctgacgtgacctctcttcttc 76

                        
Query: 567 cggttcttcttga 579
           | |||||||||||
Sbjct: 75  ctgttcttcttga 63

---

>emb|BX813428.1|CNS0AARB Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB17ZA01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 682

 Score =  137 bits (69), Expect = 5e-29
 Identities = 163/193 (84%), Gaps = 1/193 (0%)
 Strand = Plus / Minus

                                                                       
Query: 387 agaacctgttgctgagcttgtggaagtacctcataccgactttgcccgaagtagccggga 446
           ||||| |||| || ||||||||||| ||||||||||| ||||| || |||||| || |||
Sbjct: 248 agaacttgttcctcagcttgtggaaatacctcataccaactttacc-gaagtaacctgga 190

                                                                       
Query: 447 tggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccg 506
           |||||||||||||||||||| | |||||| ||||| ||||| |||||||| || ||||||
Sbjct: 189 tggtacttgtcgaagaggatcctgtggtgatgcatacctccagcgttaccacgacctccg 130

                                                                       
Query: 507 ggatgcttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttg 566
           |||||||| |||||||| || | ||| || || ||||||  |||||| || | |||||| 
Sbjct: 129 ggatgcttacggtgcttaccgatacgtccatgtccggcgctgacgtgacctctcttcttc 70

                        
Query: 567 cggttcttcttga 579
           | |||||||||||
Sbjct: 69  ctgttcttcttga 57

---

>emb|BX827775.1|CNS0A4FW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH20ZA08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 633

 Score =  137 bits (69), Expect = 5e-29
 Identities = 163/193 (84%), Gaps = 1/193 (0%)
 Strand = Plus / Plus

                                                                       
Query: 387 agaacctgttgctgagcttgtggaagtacctcataccgactttgcccgaagtagccggga 446
           ||||| |||| || ||||||||||| ||||||||||| ||||| || |||||| || |||
Sbjct: 394 agaacttgttcctcagcttgtggaaatacctcataccaactttacc-gaagtaacctgga 452

                                                                       
Query: 447 tggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccg 506
           |||||||||||||||||||| | |||||| ||||| ||||| |||||||| || ||||||
Sbjct: 453 tggtacttgtcgaagaggatcctgtggtgatgcatacctccagcgttaccacgacctccg 512

                                                                       
Query: 507 ggatgcttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttg 566
           |||||||| |||||||| || | ||| || || ||||||  |||||| || | |||||| 
Sbjct: 513 ggatgcttacggtgcttaccgatacgtccatgtccggcgctgacgtgacctctcttcttc 572

                        
Query: 567 cggttcttcttga 579
           | |||||||||||
Sbjct: 573 ctgttcttcttga 585

---

>gb|AC010796.7|AC010796 Arabidopsis thaliana chromosome 1 BAC F24J13 genomic sequence, complete
             sequence
          Length = 87400

 Score =  137 bits (69), Expect = 5e-29
 Identities = 163/193 (84%), Gaps = 1/193 (0%)
 Strand = Plus / Plus

                                                                         
Query: 387   agaacctgttgctgagcttgtggaagtacctcataccgactttgcccgaagtagccggga 446
             ||||| |||| || ||||||||||| ||||||||||| ||||| || |||||| || |||
Sbjct: 71317 agaacttgttcctcagcttgtggaaatacctcataccaactttacc-gaagtaacctgga 71375

                                                                         
Query: 447   tggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccg 506
             |||||||||||||||||||| | |||||| ||||| ||||| |||||||| || ||||||
Sbjct: 71376 tggtacttgtcgaagaggatcctgtggtgatgcatacctccagcgttaccacgacctccg 71435

                                                                         
Query: 507   ggatgcttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttg 566
             |||||||| |||||||| || | ||| || || ||||||  |||||| || | |||||| 
Sbjct: 71436 ggatgcttacggtgcttaccgatacgtccatgtccggcgctgacgtgacctctcttcttc 71495

                          
Query: 567   cggttcttcttga 579
             | |||||||||||
Sbjct: 71496 ctgttcttcttga 71508

---

>gb|AC011663.7|AC011663 Arabidopsis thaliana chromosome 1 BAC F5A18 genomic sequence, complete
             sequence
          Length = 108582

 Score =  137 bits (69), Expect = 5e-29
 Identities = 163/193 (84%), Gaps = 1/193 (0%)
 Strand = Plus / Minus

                                                                         
Query: 387   agaacctgttgctgagcttgtggaagtacctcataccgactttgcccgaagtagccggga 446
             ||||| |||| || ||||||||||| ||||||||||| ||||| || |||||| || |||
Sbjct: 83185 agaacttgttcctcagcttgtggaaatacctcataccaactttacc-gaagtaacctgga 83127

                                                                         
Query: 447   tggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccg 506
             |||||||||||||||||||| | |||||| ||||| ||||| |||||||| || ||||||
Sbjct: 83126 tggtacttgtcgaagaggatcctgtggtgatgcatacctccagcgttaccacgacctccg 83067

                                                                         
Query: 507   ggatgcttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttg 566
             |||||||| |||||||| || | ||| || || ||||||  |||||| || | |||||| 
Sbjct: 83066 ggatgcttacggtgcttaccgatacgtccatgtccggcgctgacgtgacctctcttcttc 83007

                          
Query: 567   cggttcttcttga 579
             | |||||||||||
Sbjct: 83006 ctgttcttcttga 82994

---

>gb|AY085573.1| Arabidopsis thaliana clone 15789 mRNA, complete sequence
          Length = 628

 Score =  137 bits (69), Expect = 5e-29
 Identities = 163/193 (84%), Gaps = 1/193 (0%)
 Strand = Plus / Minus

                                                                       
Query: 387 agaacctgttgctgagcttgtggaagtacctcataccgactttgcccgaagtagccggga 446
           ||||| |||| || ||||||||||| ||||||||||| ||||| || |||||| || |||
Sbjct: 256 agaacttgttcctcagcttgtggaaatacctcataccaactttacc-gaagtaacctgga 198

                                                                       
Query: 447 tggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccg 506
           |||||||||||||||||||| | |||||| ||||| ||||| |||||||| || ||||||
Sbjct: 197 tggtacttgtcgaagaggatcctgtggtgatgcatacctccagcgttaccacgacctccg 138

                                                                       
Query: 507 ggatgcttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttg 566
           |||||||| |||||||| || | ||| || || ||||||  |||||| || | |||||| 
Sbjct: 137 ggatgcttacggtgcttaccgatacgtccatgtccggcgctgacgtgacctctcttcttc 78

                        
Query: 567 cggttcttcttga 579
           | |||||||||||
Sbjct: 77  ctgttcttcttga 65

---

>emb|X91959.1|AT60SRL27 A.thaliana mRNA for 60S ribosomal protein L27a
          Length = 641

 Score =  137 bits (69), Expect = 5e-29
 Identities = 163/193 (84%), Gaps = 1/193 (0%)
 Strand = Plus / Minus

                                                                       
Query: 387 agaacctgttgctgagcttgtggaagtacctcataccgactttgcccgaagtagccggga 446
           ||||| |||| || ||||||||||| ||||||||||| ||||| || |||||| || |||
Sbjct: 237 agaacttgttcctcagcttgtggaaatacctcataccaactttacc-gaagtaacctgga 179

                                                                       
Query: 447 tggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccg 506
           |||||||||||||||||||| | |||||| ||||| ||||| |||||||| || ||||||
Sbjct: 178 tggtacttgtcgaagaggatcctgtggtgatgcatacctccagcgttaccacgacctccg 119

                                                                       
Query: 507 ggatgcttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttg 566
           |||||||| |||||||| || | ||| || || ||||||  |||||| || | |||||| 
Sbjct: 118 ggatgcttacggtgcttaccgatacgtccatgtccggcgctgacgtgacctctcttcttc 59

                        
Query: 567 cggttcttcttga 579
           | |||||||||||
Sbjct: 58  ctgttcttcttga 46

---

>gb|AY804547.1| Drosophila yakuba strain Tai18 ribosomal protein L27A (RpL27A)
           gene, partial cds
          Length = 866

 Score =  135 bits (68), Expect = 2e-28
 Identities = 108/120 (90%), Gaps = 1/120 (0%)
 Strand = Plus / Minus

                                                                       
Query: 407 tggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggat 466
           ||||||| |||||||||||| ||||| |||||| || |||||||| |||||||||  |||
Sbjct: 407 tggaagttcctcataccgaccttgcc-gaagtaaccaggatggtatttgtcgaagttgat 349

                                                                       
Query: 467 gcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           ||||||||||||||| || || ||||||||||| ||||||||||||||||||||||||||
Sbjct: 348 gcggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 289

---

>gb|AY804546.1| Drosophila santomea strain STO.4 ribosomal protein L27A (RpL27A)
           gene, partial cds
          Length = 862

 Score =  135 bits (68), Expect = 2e-28
 Identities = 108/120 (90%), Gaps = 1/120 (0%)
 Strand = Plus / Minus

                                                                       
Query: 407 tggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggat 466
           ||||||| |||||||||||| ||||| |||||| || |||||||| |||||||||  |||
Sbjct: 403 tggaagttcctcataccgaccttgcc-gaagtaaccaggatggtatttgtcgaagttgat 345

                                                                       
Query: 467 gcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           ||||||||||||||| || || ||||||||||| ||||||||||||||||||||||||||
Sbjct: 344 gcggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 285

---

>gb|AY804956.1| Drosophila yakuba isolate 1250_4 RpL27A gene, partial sequence
          Length = 822

 Score =  135 bits (68), Expect = 2e-28
 Identities = 108/120 (90%), Gaps = 1/120 (0%)
 Strand = Plus / Minus

                                                                       
Query: 407 tggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggat 466
           ||||||| |||||||||||| ||||| |||||| || |||||||| |||||||||  |||
Sbjct: 409 tggaagttcctcataccgaccttgcc-gaagtaaccaggatggtatttgtcgaagttgat 351

                                                                       
Query: 467 gcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           ||||||||||||||| || || ||||||||||| ||||||||||||||||||||||||||
Sbjct: 350 gcggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 291

---

>gb|AY804955.1| Drosophila yakuba isolate 1250_3 RpL27A gene, partial sequence
          Length = 822

 Score =  135 bits (68), Expect = 2e-28
 Identities = 108/120 (90%), Gaps = 1/120 (0%)
 Strand = Plus / Minus

                                                                       
Query: 407 tggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggat 466
           ||||||| |||||||||||| ||||| |||||| || |||||||| |||||||||  |||
Sbjct: 409 tggaagttcctcataccgaccttgcc-gaagtaaccaggatggtatttgtcgaagttgat 351

                                                                       
Query: 467 gcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           ||||||||||||||| || || ||||||||||| ||||||||||||||||||||||||||
Sbjct: 350 gcggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 291

---

>gb|AY804953.1| Drosophila yakuba isolate 1250_1 RpL27A gene, partial sequence
          Length = 822

 Score =  135 bits (68), Expect = 2e-28
 Identities = 108/120 (90%), Gaps = 1/120 (0%)
 Strand = Plus / Minus

                                                                       
Query: 407 tggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggat 466
           ||||||| |||||||||||| ||||| |||||| || |||||||| |||||||||  |||
Sbjct: 409 tggaagttcctcataccgaccttgcc-gaagtaaccaggatggtatttgtcgaagttgat 351

                                                                       
Query: 467 gcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           ||||||||||||||| || || ||||||||||| ||||||||||||||||||||||||||
Sbjct: 350 gcggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 291

---

>gb|AY804952.1| Drosophila santomea isolate 1250_3 RpL27A gene, partial sequence
          Length = 822

 Score =  135 bits (68), Expect = 2e-28
 Identities = 108/120 (90%), Gaps = 1/120 (0%)
 Strand = Plus / Minus

                                                                       
Query: 407 tggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggat 466
           ||||||| |||||||||||| ||||| |||||| || |||||||| |||||||||  |||
Sbjct: 409 tggaagttcctcataccgaccttgcc-gaagtaaccaggatggtatttgtcgaagttgat 351

                                                                       
Query: 467 gcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           ||||||||||||||| || || ||||||||||| ||||||||||||||||||||||||||
Sbjct: 350 gcggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 291

---

>gb|AY804951.1| Drosophila santomea isolate 1250_2 RpL27A gene, partial sequence
          Length = 822

 Score =  135 bits (68), Expect = 2e-28
 Identities = 108/120 (90%), Gaps = 1/120 (0%)
 Strand = Plus / Minus

                                                                       
Query: 407 tggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggat 466
           ||||||| |||||||||||| ||||| |||||| || |||||||| |||||||||  |||
Sbjct: 409 tggaagttcctcataccgaccttgcc-gaagtaaccaggatggtatttgtcgaagttgat 351

                                                                       
Query: 467 gcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           ||||||||||||||| || || ||||||||||| ||||||||||||||||||||||||||
Sbjct: 350 gcggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 291

---

>gb|AY804950.1| Drosophila santomea isolate 1250_1 RpL27A gene, partial sequence
          Length = 822

 Score =  135 bits (68), Expect = 2e-28
 Identities = 108/120 (90%), Gaps = 1/120 (0%)
 Strand = Plus / Minus

                                                                       
Query: 407 tggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggat 466
           ||||||| |||||||||||| ||||| |||||| || |||||||| |||||||||  |||
Sbjct: 409 tggaagttcctcataccgaccttgcc-gaagtaaccaggatggtatttgtcgaagttgat 351

                                                                       
Query: 467 gcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           ||||||||||||||| || || ||||||||||| ||||||||||||||||||||||||||
Sbjct: 350 gcggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 291

---

>gb|AY804949.1| Drosophila santomea isolate 1566_4 RpL27A gene, partial sequence
          Length = 822

 Score =  135 bits (68), Expect = 2e-28
 Identities = 108/120 (90%), Gaps = 1/120 (0%)
 Strand = Plus / Minus

                                                                       
Query: 407 tggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggat 466
           ||||||| |||||||||||| ||||| |||||| || |||||||| |||||||||  |||
Sbjct: 409 tggaagttcctcataccgaccttgcc-gaagtaaccaggatggtatttgtcgaagttgat 351

                                                                       
Query: 467 gcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           ||||||||||||||| || || ||||||||||| ||||||||||||||||||||||||||
Sbjct: 350 gcggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 291

---

>gb|AY804948.1| Drosophila santomea isolate 1566_3 RpL27A gene, partial sequence
          Length = 822

 Score =  135 bits (68), Expect = 2e-28
 Identities = 108/120 (90%), Gaps = 1/120 (0%)
 Strand = Plus / Minus

                                                                       
Query: 407 tggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggat 466
           ||||||| |||||||||||| ||||| |||||| || |||||||| |||||||||  |||
Sbjct: 409 tggaagttcctcataccgaccttgcc-gaagtaaccaggatggtatttgtcgaagttgat 351

                                                                       
Query: 467 gcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           ||||||||||||||| || || ||||||||||| ||||||||||||||||||||||||||
Sbjct: 350 gcggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 291

---

>gb|AY804947.1| Drosophila santomea isolate 1566_2 RpL27A gene, partial sequence
          Length = 822

 Score =  135 bits (68), Expect = 2e-28
 Identities = 108/120 (90%), Gaps = 1/120 (0%)
 Strand = Plus / Minus

                                                                       
Query: 407 tggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggat 466
           ||||||| |||||||||||| ||||| |||||| || |||||||| |||||||||  |||
Sbjct: 409 tggaagttcctcataccgaccttgcc-gaagtaaccaggatggtatttgtcgaagttgat 351

                                                                       
Query: 467 gcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           ||||||||||||||| || || ||||||||||| ||||||||||||||||||||||||||
Sbjct: 350 gcggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 291

---

>gb|AY804946.1| Drosophila santomea isolate 1566_1 RpL27A gene, partial sequence
          Length = 822

 Score =  135 bits (68), Expect = 2e-28
 Identities = 108/120 (90%), Gaps = 1/120 (0%)
 Strand = Plus / Minus

                                                                       
Query: 407 tggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggat 466
           ||||||| |||||||||||| ||||| |||||| || |||||||| |||||||||  |||
Sbjct: 409 tggaagttcctcataccgaccttgcc-gaagtaaccaggatggtatttgtcgaagttgat 351

                                                                       
Query: 467 gcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           ||||||||||||||| || || ||||||||||| ||||||||||||||||||||||||||
Sbjct: 350 gcggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 291

---

>gb|AY804944.1| Drosophila yakuba isolate SaoT_2 RpL27A gene, partial sequence
          Length = 822

 Score =  135 bits (68), Expect = 2e-28
 Identities = 108/120 (90%), Gaps = 1/120 (0%)
 Strand = Plus / Minus

                                                                       
Query: 407 tggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggat 466
           ||||||| |||||||||||| ||||| |||||| || |||||||| |||||||||  |||
Sbjct: 409 tggaagttcctcataccgaccttgcc-gaagtaaccaggatggtatttgtcgaagttgat 351

                                                                       
Query: 467 gcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           ||||||||||||||| || || ||||||||||| ||||||||||||||||||||||||||
Sbjct: 350 gcggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 291

---

>gb|AY804943.1| Drosophila yakuba isolate SaoT_1 RpL27A gene, partial sequence
          Length = 822

 Score =  135 bits (68), Expect = 2e-28
 Identities = 108/120 (90%), Gaps = 1/120 (0%)
 Strand = Plus / Minus

                                                                       
Query: 407 tggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggat 466
           ||||||| |||||||||||| ||||| |||||| || |||||||| |||||||||  |||
Sbjct: 409 tggaagttcctcataccgaccttgcc-gaagtaaccaggatggtatttgtcgaagttgat 351

                                                                       
Query: 467 gcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           ||||||||||||||| || || ||||||||||| ||||||||||||||||||||||||||
Sbjct: 350 gcggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 291

---

>gb|AY232080.1| Drosophila yakuba clone yak-ad_RpL27A mRNA sequence
          Length = 432

 Score =  135 bits (68), Expect = 2e-28
 Identities = 108/120 (90%), Gaps = 1/120 (0%)
 Strand = Plus / Minus

                                                                       
Query: 407 tggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggat 466
           ||||||| |||||||||||| ||||| |||||| || |||||||| |||||||||  |||
Sbjct: 173 tggaagttcctcataccgaccttgcc-gaagtaaccaggatggtatttgtcgaagttgat 115

                                                                       
Query: 467 gcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           ||||||||||||||| || || ||||||||||| ||||||||||||||||||||||||||
Sbjct: 114 gcggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 55

---

>gb|AY231794.1| Drosophila yakuba clone yak-em_RpL27A mRNA sequence
          Length = 444

 Score =  135 bits (68), Expect = 2e-28
 Identities = 108/120 (90%), Gaps = 1/120 (0%)
 Strand = Plus / Minus

                                                                       
Query: 407 tggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggat 466
           ||||||| |||||||||||| ||||| |||||| || |||||||| |||||||||  |||
Sbjct: 185 tggaagttcctcataccgaccttgcc-gaagtaaccaggatggtatttgtcgaagttgat 127

                                                                       
Query: 467 gcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           ||||||||||||||| || || ||||||||||| ||||||||||||||||||||||||||
Sbjct: 126 gcggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 67

---

>gb|AY804954.1| Drosophila yakuba isolate 1250_2 RpL27A gene, partial sequence
          Length = 822

 Score =  131 bits (66), Expect = 3e-27
 Identities = 107/120 (89%), Gaps = 1/120 (0%)
 Strand = Plus / Minus

                                                                       
Query: 407 tggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggat 466
           ||||||| |||||||||||| ||||| |||||| || |||||||| ||||| |||  |||
Sbjct: 409 tggaagttcctcataccgaccttgcc-gaagtaaccaggatggtatttgtcraagttgat 351

                                                                       
Query: 467 gcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           ||||||||||||||| || || ||||||||||| ||||||||||||||||||||||||||
Sbjct: 350 gcggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 291

---

>gb|AY804945.1| Drosophila yakuba isolate SaoT_3 RpL27A gene, partial sequence
          Length = 822

 Score =  131 bits (66), Expect = 3e-27
 Identities = 107/120 (89%), Gaps = 1/120 (0%)
 Strand = Plus / Minus

                                                                       
Query: 407 tggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggat 466
           ||||||| |||||||||||| ||||| |||||| || |||||||| |||||||||  |||
Sbjct: 409 tggaagttcctcataccgaccttgcc-gaagtaaccaggatggtatttgtcgaagttgat 351

                                                                       
Query: 467 gcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           ||||||||||||||| || || ||||||||||| ||||||||||||||||||||||| ||
Sbjct: 350 gcggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttrcc 291

---

>ref|NM_102178.2| Arabidopsis thaliana RPL27A (RIBOSOMAL PROTEIN L27A); structural
           constituent of ribosome AT1G23290 (RPL27A) mRNA,
           complete cds
          Length = 604

 Score =  129 bits (65), Expect = 1e-26
 Identities = 150/177 (84%), Gaps = 1/177 (0%)
 Strand = Plus / Minus

                                                                       
Query: 401 agcttgtggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaa 460
           ||||||||||| ||||||||||| ||||| ||||||||| || |||||||||||||||||
Sbjct: 214 agcttgtggaaatacctcataccaacttt-cccgaagtaacctggatggtacttgtcgaa 156

                                                                       
Query: 461 gaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtg 520
           |||||| | |||||| ||||| ||||| ||||| || || |||||||||||||| |||||
Sbjct: 155 gaggatcctgtggtgatgcatacctcctgcgtttccacgacctccgggatgcttacggtg 96

                                                                    
Query: 521 cttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttctt 577
           ||| || | ||| || || ||||||  |||||| || | |||||| | |||||||||
Sbjct: 95  cttaccgatacgtccatgtccggcgctgacgtgacctctcttctttctgttcttctt 39

---

>gb|AF349525.1| Arabidopsis thaliana putative 60s ribosomal protein l27a
           (At1g23290) mRNA, complete cds
          Length = 491

 Score =  129 bits (65), Expect = 1e-26
 Identities = 150/177 (84%), Gaps = 1/177 (0%)
 Strand = Plus / Minus

                                                                       
Query: 401 agcttgtggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaa 460
           ||||||||||| ||||||||||| ||||| ||||||||| || |||||||||||||||||
Sbjct: 191 agcttgtggaaatacctcataccaacttt-cccgaagtaacctggatggtacttgtcgaa 133

                                                                       
Query: 461 gaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtg 520
           |||||| | |||||| ||||| ||||| ||||| || || |||||||||||||| |||||
Sbjct: 132 gaggatcctgtggtgatgcatacctcctgcgtttccacgacctccgggatgcttacggtg 73

                                                                    
Query: 521 cttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttctt 577
           ||| || | ||| || || ||||||  |||||| || | |||||| | |||||||||
Sbjct: 72  cttaccgatacgtccatgtccggcgctgacgtgacctctcttctttctgttcttctt 16

---

>gb|AF324716.2| Arabidopsis thaliana At1g23290 (At1g23290/F26F24_23) mRNA, complete
           cds
          Length = 572

 Score =  129 bits (65), Expect = 1e-26
 Identities = 150/177 (84%), Gaps = 1/177 (0%)
 Strand = Plus / Minus

                                                                       
Query: 401 agcttgtggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaa 460
           ||||||||||| ||||||||||| ||||| ||||||||| || |||||||||||||||||
Sbjct: 215 agcttgtggaaatacctcataccaacttt-cccgaagtaacctggatggtacttgtcgaa 157

                                                                       
Query: 461 gaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtg 520
           |||||| | |||||| ||||| ||||| ||||| || || |||||||||||||| |||||
Sbjct: 156 gaggatcctgtggtgatgcatacctcctgcgtttccacgacctccgggatgcttacggtg 97

                                                                    
Query: 521 cttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttctt 577
           ||| || | ||| || || ||||||  |||||| || | |||||| | |||||||||
Sbjct: 96  cttaccgatacgtccatgtccggcgctgacgtgacctctcttctttctgttcttctt 40

---

>emb|BX817859.1|CNS0AEEA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL45ZD07 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 646

 Score =  129 bits (65), Expect = 1e-26
 Identities = 120/137 (87%), Gaps = 1/137 (0%)
 Strand = Plus / Minus

                                                                       
Query: 387 agaacctgttgctgagcttgtggaagtacctcataccgactttgcccgaagtagccggga 446
           ||||| |||| || ||||||||||| ||||||||||| ||||| || |||||| || |||
Sbjct: 243 agaacttgttcctcagcttgtggaaatacctcataccaactttacc-gaagtaacctgga 185

                                                                       
Query: 447 tggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccg 506
           |||||||||||||||||||| | |||||| ||||| ||||| |||||||| || ||||||
Sbjct: 184 tggtacttgtcgaagaggatcctgtggtgatgcatacctccagcgttaccacgacctccg 125

                            
Query: 507 ggatgcttgcggtgctt 523
           |||||||| ||||||||
Sbjct: 124 ggatgcttacggtgctt 108

---

>emb|BX814201.1|CNS0AC9G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB60ZF02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 568

 Score =  129 bits (65), Expect = 1e-26
 Identities = 150/177 (84%), Gaps = 1/177 (0%)
 Strand = Plus / Minus

                                                                       
Query: 401 agcttgtggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaa 460
           ||||||||||| ||||||||||| ||||| ||||||||| || |||||||||||||||||
Sbjct: 196 agcttgtggaaatacctcataccaacttt-cccgaagtaacctggatggtacttgtcgaa 138

                                                                       
Query: 461 gaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtg 520
           |||||| | |||||| ||||| ||||| ||||| || || |||||||||||||| |||||
Sbjct: 137 gaggatcctgtggtgatgcatacctcctgcgtttccacgacctccgggatgcttacggtg 78

                                                                    
Query: 521 cttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttctt 577
           ||| || | ||| || || ||||||  |||||| || | |||||| | |||||||||
Sbjct: 77  cttaccgatacgtccatgtccggcgctgacgtgacctctcttctttctgttcttctt 21

---

>emb|BX814197.1|CNS0AC79 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB60ZD12 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 568

 Score =  129 bits (65), Expect = 1e-26
 Identities = 150/177 (84%), Gaps = 1/177 (0%)
 Strand = Plus / Minus

                                                                       
Query: 401 agcttgtggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaa 460
           ||||||||||| ||||||||||| ||||| ||||||||| || |||||||||||||||||
Sbjct: 196 agcttgtggaaatacctcataccaacttt-cccgaagtaacctggatggtacttgtcgaa 138

                                                                       
Query: 461 gaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtg 520
           |||||| | |||||| ||||| ||||| ||||| || || |||||||||||||| |||||
Sbjct: 137 gaggatcctgtggtgatgcatacctcctgcgtttccacgacctccgggatgcttacggtg 78

                                                                    
Query: 521 cttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttctt 577
           ||| || | ||| || || ||||||  |||||| || | |||||| | |||||||||
Sbjct: 77  cttaccgatacgtccatgtccggcgctgacgtgacctctcttctttctgttcttctt 21

---

>emb|BX814930.1|CNS0ABGE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS19ZG02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 545

 Score =  129 bits (65), Expect = 1e-26
 Identities = 150/177 (84%), Gaps = 1/177 (0%)
 Strand = Plus / Minus

                                                                       
Query: 401 agcttgtggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaa 460
           ||||||||||| ||||||||||| ||||| ||||||||| || |||||||||||||||||
Sbjct: 203 agcttgtggaaatacctcataccaacttt-cccgaagtaacctggatggtacttgtcgaa 145

                                                                       
Query: 461 gaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtg 520
           |||||| | |||||| ||||| ||||| ||||| || || |||||||||||||| |||||
Sbjct: 144 gaggatcctgtggtgatgcatacctcctgcgtttccacgacctccgggatgcttacggtg 85

                                                                    
Query: 521 cttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttctt 577
           ||| || | ||| || || ||||||  |||||| || | |||||| | |||||||||
Sbjct: 84  cttaccgatacgtccatgtccggcgctgacgtgacctctcttctttctgttcttctt 28

---

>gb|AC005292.4|AC005292 Genomic sequence for Arabidopsis thaliana BAC F26F24 from chromosome I,
             complete sequence
          Length = 99053

 Score =  129 bits (65), Expect = 1e-26
 Identities = 150/177 (84%), Gaps = 1/177 (0%)
 Strand = Plus / Minus

                                                                         
Query: 401   agcttgtggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaa 460
             ||||||||||| ||||||||||| ||||| ||||||||| || |||||||||||||||||
Sbjct: 39553 agcttgtggaaatacctcataccaacttt-cccgaagtaacctggatggtacttgtcgaa 39495

                                                                         
Query: 461   gaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtg 520
             |||||| | |||||| ||||| ||||| ||||| || || |||||||||||||| |||||
Sbjct: 39494 gaggatcctgtggtgatgcatacctcctgcgtttccacgacctccgggatgcttacggtg 39435

                                                                      
Query: 521   cttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttctt 577
             ||| || | ||| || || ||||||  |||||| || | |||||| | |||||||||
Sbjct: 39434 cttaccgatacgtccatgtccggcgctgacgtgacctctcttctttctgttcttctt 39378

---

>gb|DQ191629.1| Solanum tuberosum ribosomal protein L27a-like protein mRNA,
           complete cds
          Length = 649

 Score =  125 bits (63), Expect = 2e-25
 Identities = 151/179 (84%), Gaps = 1/179 (0%)
 Strand = Plus / Minus

                                                                       
Query: 401 agcttgtggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaa 460
           ||||||||||| || | |||||| ||||| || |||||| || |||||||||||||||||
Sbjct: 243 agcttgtggaaataacgcatacctactttacc-gaagtaaccaggatggtacttgtcgaa 185

                                                                       
Query: 461 gaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtg 520
            ||||| | ||| |||||||| |||||||||||||| |  ||||| |||||||| | |||
Sbjct: 184 aaggatcctgtgatggtgcatacctccggcgttacctcttcctcctggatgcttcctgtg 125

                                                                      
Query: 521 cttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttcttga 579
           ||| |||||||| || || ||||||  ||||||||| |||||||| | |||||||||||
Sbjct: 124 ctttcccacacgaccatgtccggcgctgacgtggccacgcttcttcctgttcttcttga 66

---

>gb|BT000542.1| Arabidopsis thaliana 60s ribosomal protein l27a.
           (At1g23290/F26F24_23) mRNA, complete cds
          Length = 441

 Score =  125 bits (63), Expect = 2e-25
 Identities = 109/123 (88%), Gaps = 1/123 (0%)
 Strand = Plus / Minus

                                                                       
Query: 401 agcttgtggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaa 460
           ||||||||||| ||||||||||| ||||| ||||||||| || |||||||||||||||||
Sbjct: 191 agcttgtggaaatacctcataccaacttt-cccgaagtaacctggatggtacttgtcgaa 133

                                                                       
Query: 461 gaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtg 520
           |||||| | |||||| ||||| ||||| ||||| || || |||||||||||||| |||||
Sbjct: 132 gaggatcctgtggtgatgcatacctcctgcgtttccacgacctccgggatgcttacggtg 73

              
Query: 521 ctt 523
           |||
Sbjct: 72  ctt 70

---

>gb|AF410280.1|AF410280 Arabidopsis thaliana At1g23290/F26F24_23 mRNA, complete cds
          Length = 571

 Score =  125 bits (63), Expect = 2e-25
 Identities = 109/123 (88%), Gaps = 1/123 (0%)
 Strand = Plus / Minus

                                                                       
Query: 401 agcttgtggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaa 460
           ||||||||||| ||||||||||| ||||| ||||||||| || |||||||||||||||||
Sbjct: 215 agcttgtggaaatacctcataccaacttt-cccgaagtaacctggatggtacttgtcgaa 157

                                                                       
Query: 461 gaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtg 520
           |||||| | |||||| ||||| ||||| ||||| || || |||||||||||||| |||||
Sbjct: 156 gaggatcctgtggtgatgcatacctcctgcgtttccacgacctccgggatgcttacggtg 97

              
Query: 521 ctt 523
           |||
Sbjct: 96  ctt 94

---

>gb|AY086256.1| Arabidopsis thaliana clone 23092 mRNA, complete sequence
          Length = 570

 Score =  125 bits (63), Expect = 2e-25
 Identities = 109/123 (88%), Gaps = 1/123 (0%)
 Strand = Plus / Minus

                                                                       
Query: 401 agcttgtggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaa 460
           ||||||||||| ||||||||||| ||||| ||||||||| || |||||||||||||||||
Sbjct: 216 agcttgtggaaatacctcataccaacttt-cccgaagtaacctggatggtacttgtcgaa 158

                                                                       
Query: 461 gaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtg 520
           |||||| | |||||| ||||| ||||| ||||| || || |||||||||||||| |||||
Sbjct: 157 gaggatcctgtggtgatgcatacctcctgcgtttccacgacctccgggatgcttacggtg 98

              
Query: 521 ctt 523
           |||
Sbjct: 97  ctt 95

---

>gb|AF459726.1| Elaeocarpus angustifolius clone scu22Eg microsatellite sequence
          Length = 229

 Score =  123 bits (62), Expect = 7e-25
 Identities = 122/142 (85%)
 Strand = Plus / Plus

                                                                       
Query: 451 acttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggat 510
           |||||||||||||||| | |||||||||||| ||||||||||||||||| ||||| ||||
Sbjct: 1   acttgtcgaagaggatcctgtggtggtgcatacctccggcgttaccgcgacctcctggat 60

                                                                       
Query: 511 gcttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggt 570
           | || ||||||||||| | ||| ||||| || |||   ||||| ||||||||||| ||||
Sbjct: 61  gttttcggtgcttgccgatacgaccgtgtcctgcgctcacgtgcccgcgcttcttacggt 120

                                 
Query: 571 tcttcttgaggcgggtcgtcat 592
           |||||||||  ||||| |||||
Sbjct: 121 tcttcttgaaacgggttgtcat 142

---

>dbj|AB042856.1| Panax ginseng mRNA for 60S ribosomal protein L27a, complete cds
          Length = 590

 Score =  121 bits (61), Expect = 3e-24
 Identities = 137/161 (85%), Gaps = 1/161 (0%)
 Strand = Plus / Minus

                                                                       
Query: 385 gtagaacctgttgctgagcttgtggaagtacctcataccgactttgcccgaagtagccgg 444
           ||||||| |||||| |||| | ||||| |||||||| || || || ||| || || || |
Sbjct: 223 gtagaacttgttgcggagcctatggaaatacctcattcccacctt-cccaaaataacccg 165

                                                                       
Query: 445 gatggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctc 504
           |||||||||||||||| | ||| |||||||||||||| ||||||||||| ||||| ||||
Sbjct: 164 gatggtacttgtcgaacaagatccggtggtggtgcattcctccggcgtttccgcgacctc 105

                                                    
Query: 505 cgggatgcttgcggtgcttgcccacacgcccgtgcccggcg 545
           |||||||||| ||||||||||| | ||| ||||| ||||||
Sbjct: 104 cgggatgcttacggtgcttgccgatacggccgtgaccggcg 64



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 186 ccttgatcttcttctcggcgatcttggagatgagcttggccttgacgacgat 237
           |||||||||||||||| ||  ||||||| | |||||||||||| || |||||
Sbjct: 425 ccttgatcttcttctccgcagtcttggacacgagcttggccttcacaacgat 374

---

>gb|BT022137.2| Drosophila melanogaster IP01552 full insert cDNA
          Length = 2992

 Score =  119 bits (60), Expect = 1e-23
 Identities = 106/120 (88%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 407 tggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggat 466
           ||||||| |||||| || || ||||| |||||| || |||||||| |||||||||  |||
Sbjct: 407 tggaagttcctcatgcccaccttgcc-gaagtaaccaggatggtatttgtcgaagttgat 465

                                                                       
Query: 467 gcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||||| ||||||||||| || ||||||||||| ||||||||||||||||||||||||||
Sbjct: 466 gcggtgatggtgcatgccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 525

---

>ref|NM_057615.3| Drosophila melanogaster Ribosomal protein L27A CG15442-RA (RpL27A),
           mRNA
          Length = 643

 Score =  119 bits (60), Expect = 1e-23
 Identities = 106/120 (88%), Gaps = 1/120 (0%)
 Strand = Plus / Minus

                                                                       
Query: 407 tggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggat 466
           ||||||| |||||| || || ||||| |||||| || |||||||| |||||||||  |||
Sbjct: 261 tggaagttcctcatgcccaccttgcc-gaagtaaccaggatggtatttgtcgaagttgat 203

                                                                       
Query: 467 gcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||||| ||||||||||| || ||||||||||| ||||||||||||||||||||||||||
Sbjct: 202 gcggtgatggtgcatgccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 143

---

>gb|AY071144.1| Drosophila melanogaster RE17991 full length cDNA
          Length = 649

 Score =  119 bits (60), Expect = 1e-23
 Identities = 106/120 (88%), Gaps = 1/120 (0%)
 Strand = Plus / Minus

                                                                       
Query: 407 tggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggat 466
           ||||||| |||||| || || ||||| |||||| || |||||||| |||||||||  |||
Sbjct: 261 tggaagttcctcatgcccaccttgcc-gaagtaaccaggatggtatttgtcgaagttgat 203

                                                                       
Query: 467 gcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||||| ||||||||||| || ||||||||||| ||||||||||||||||||||||||||
Sbjct: 202 gcggtgatggtgcatgccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 143

---

>gb|AC092232.1|AC092232 Drosophila melanogaster, chromosome 2L, region 24E-24F, BAC clone
             BACR28K16, complete sequence
          Length = 182897

 Score =  119 bits (60), Expect = 1e-23
 Identities = 106/120 (88%), Gaps = 1/120 (0%)
 Strand = Plus / Minus

                                                                         
Query: 407   tggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggat 466
             ||||||| |||||| || || ||||| |||||| || |||||||| |||||||||  |||
Sbjct: 71046 tggaagttcctcatgcccaccttgcc-gaagtaaccaggatggtatttgtcgaagttgat 70988

                                                                         
Query: 467   gcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
             |||||| ||||||||||| || ||||||||||| ||||||||||||||||||||||||||
Sbjct: 70987 gcggtgatggtgcatgccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 70928

---

>gb|AE003576.5| Drosophila melanogaster chromosome 2L, section 15 of 83 of the complete
              sequence
          Length = 289893

 Score =  119 bits (60), Expect = 1e-23
 Identities = 106/120 (88%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                          
Query: 407    tggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggat 466
              ||||||| |||||| || || ||||| |||||| || |||||||| |||||||||  |||
Sbjct: 136621 tggaagttcctcatgcccaccttgcc-gaagtaaccaggatggtatttgtcgaagttgat 136679

                                                                          
Query: 467    gcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
              |||||| ||||||||||| || ||||||||||| ||||||||||||||||||||||||||
Sbjct: 136680 gcggtgatggtgcatgccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 136739

---

>gb|U66357.1|DMU66357 Drosophila melanogaster ribosomal protein RpL27a gene, complete cds
          Length = 1099

 Score =  119 bits (60), Expect = 1e-23
 Identities = 106/120 (88%), Gaps = 1/120 (0%)
 Strand = Plus / Minus

                                                                       
Query: 407 tggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggat 466
           ||||||| |||||| || || ||||| |||||| || |||||||| |||||||||  |||
Sbjct: 431 tggaagttcctcatgcccaccttgcc-gaagtaaccaggatggtatttgtcgaagttgat 373

                                                                       
Query: 467 gcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||||| ||||||||||| || ||||||||||| ||||||||||||||||||||||||||
Sbjct: 372 gcggtgatggtgcatgccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 313

---

>gb|U66358.1|DMU66358 Drosophila melanogaster ribosomal protein L27a homolog mRNA,
           complete cds
          Length = 565

 Score =  119 bits (60), Expect = 1e-23
 Identities = 106/120 (88%), Gaps = 1/120 (0%)
 Strand = Plus / Minus

                                                                       
Query: 407 tggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggat 466
           ||||||| |||||| || || ||||| |||||| || |||||||| |||||||||  |||
Sbjct: 201 tggaagttcctcatgcccaccttgcc-gaagtaaccaggatggtatttgtcgaagttgat 143

                                                                       
Query: 467 gcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||||| ||||||||||| || ||||||||||| ||||||||||||||||||||||||||
Sbjct: 142 gcggtgatggtgcatgccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 83

---

>gb|AC004267.1|AC004267 Drosophila melanogaster DNA sequence (P1 DS07968 (D117)), complete
             sequence
          Length = 31557

 Score =  119 bits (60), Expect = 1e-23
 Identities = 106/120 (88%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                         
Query: 407   tggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggat 466
             ||||||| |||||| || || ||||| |||||| || |||||||| |||||||||  |||
Sbjct: 10842 tggaagttcctcatgcccaccttgcc-gaagtaaccaggatggtatttgtcgaagttgat 10900

                                                                         
Query: 467   gcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
             |||||| ||||||||||| || ||||||||||| ||||||||||||||||||||||||||
Sbjct: 10901 gcggtgatggtgcatgccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 10960

---

>gb|DQ191661.1| Solanum tuberosum ribosomal protein L27a-like protein mRNA,
           complete cds
          Length = 665

 Score =  117 bits (59), Expect = 4e-23
 Identities = 150/179 (83%), Gaps = 1/179 (0%)
 Strand = Plus / Minus

                                                                       
Query: 401 agcttgtggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaa 460
           ||||||||||| || | |||||| ||||| || |||||| || |||||||||||||||||
Sbjct: 240 agcttgtggaaataacgcatacctactttacc-gaagtaaccaggatggtacttgtcgaa 182

                                                                       
Query: 461 gaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtg 520
            ||||| | ||| |||||||| |||||||||||||| |  ||||| |||||||| | |||
Sbjct: 181 aaggatcctgtgatggtgcatacctccggcgttacctcttcctcctggatgcttcctgtg 122

                                                                      
Query: 521 cttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttcttga 579
           ||| || ||||| || || ||||||  ||||||||| |||||||| | |||||||||||
Sbjct: 121 ctttccgacacgaccatgtccggcgctgacgtggccacgcttcttcctgttcttcttga 63

---

>emb|X74484.1|DMRPL27A D.melanogaster mRNA for ribosomal protein L27a
          Length = 456

 Score =  103 bits (52), Expect = 7e-19
 Identities = 104/120 (86%), Gaps = 1/120 (0%)
 Strand = Plus / Minus

                                                                       
Query: 407 tggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagaggat 466
           ||||||| |||||| || || ||||| |||||| || |||||||| |||||||||  |||
Sbjct: 188 tggaagttcctcatgcccaccttgcc-gaagtaaccaggatggtatttgtcgaagttgat 130

                                                                       
Query: 467 gcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||||| ||||||||||| ||   ||||||||| ||||||||||||||||||||||||||
Sbjct: 129 gcggtgatggtgcatgccacccaggttaccgcgacctccgggatgcttgcggtgcttgcc 70

---

>gb|AY432710.1| Aedes aegypti ASAP ID: 34035 cytosolic large ribosomal subunit L27A
           mRNA sequence
          Length = 658

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 104/121 (85%), Gaps = 1/121 (0%)
 Strand = Plus / Minus

                                                                       
Query: 406 gtggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagagga 465
           |||||||| |||||||||||| ||||| |||||| || || ||||| |||||||||  ||
Sbjct: 273 gtggaagttcctcataccgaccttgcc-gaagtatccagggtggtatttgtcgaagttga 215

                                                                       
Query: 466 tgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgc 525
           ||||||| ||||||||||| || ||||||||||| || || || ||||| ||||||||||
Sbjct: 214 tgcggtgatggtgcatgccaccagcgttaccgcgaccaccagggtgcttacggtgcttgc 155

            
Query: 526 c 526
           |
Sbjct: 154 c 154

---

>gb|DQ440054.1| Aedes aegypti clone AE-306 60S ribosomal protein L15/L27 mRNA,
           complete cds
          Length = 450

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 104/121 (85%), Gaps = 1/121 (0%)
 Strand = Plus / Minus

                                                                       
Query: 406 gtggaagtacctcataccgactttgcccgaagtagccgggatggtacttgtcgaagagga 465
           |||||||| |||||||||||| ||||| |||||| || || ||||| |||||||||  ||
Sbjct: 192 gtggaagttcctcataccgaccttgcc-gaagtatccagggtggtatttgtcgaagttga 134

                                                                       
Query: 466 tgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgc 525
           ||||||| ||||||||||| || ||||||||||| || || || ||||| ||||||||||
Sbjct: 133 tgcggtgatggtgcatgccaccagcgttaccgcgaccaccagggtgcttacggtgcttgc 74

            
Query: 526 c 526
           |
Sbjct: 73  c 73

---

>gb|AY961477.1| Phytophthora infestans clone MY-19-H-09 ribosomal protein L27 mRNA,
           complete cds
          Length = 545

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 119/143 (83%)
 Strand = Plus / Minus

                                                                       
Query: 432 ccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcg 491
           |||||||| || || ||| ||||||| |  ||||| ||||||||||||  ||| ||||||
Sbjct: 168 ccgaagtaaccagggtggaacttgtccataaggatacggtggtggtgctggccaccggcg 109

                                                                       
Query: 492 ttaccgcggcctccgggatgcttgcggtgcttgcccacacgcccgtgcccggcggagacg 551
           |||||||| || || || ||||||||||||||||| | ||| ||||| ||||||   |||
Sbjct: 108 ttaccgcgaccacccgggtgcttgcggtgcttgccgatacgaccgtggccggcgctcacg 49

                                  
Query: 552 tggccgcgcttcttgcggttctt 574
           || ||||| ||||||||||||||
Sbjct: 48  tgtccgcgtttcttgcggttctt 26



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 257 cccttgccgagcaccttgaagtagccg 283
           |||||||||||||||||||||||||||
Sbjct: 351 cccttgccgagcaccttgaagtagccg 325

---

>emb|BX005667.1|CNS08CJB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA1BA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 222

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 93/109 (85%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 128 cataccgaccttgccggaagtaacccggatggtatttgtcgaagttgatacggtgatggt 69

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 68  gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 20

---

>gb|BC064441.1| Danio rerio zgc:77235, mRNA (cDNA clone MGC:77235 IMAGE:6963142),
           complete cds
          Length = 505

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Minus

                                                                       
Query: 431 cccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtgcatgcctccggc 490
           ||||||||| || || || || |||||||||  |||||||||||||||||  ||||||||
Sbjct: 169 cccgaagtaccctgggtgatatttgtcgaagttgatgcggtggtggtgcagtcctccggc 110

                                                           
Query: 491 gttaccgcggcctccgggatgcttgcggtgcttgcccacacgcccgtg 538
           ||||||||| || ||||| ||||| |||||||| ||||| || |||||
Sbjct: 109 gttaccgcgtccaccggggtgcttccggtgctttcccacgcggccgtg 62



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 248 ggcagcatccccttgccgagcaccttgaagtagcc 282
           |||||| |||||||||| |||||||||||||||||
Sbjct: 360 ggcagcttccccttgcccagcaccttgaagtagcc 326

---

>ref|NM_200030.1| Danio rerio zgc:77235 (zgc:77235), mRNA
          Length = 505

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Minus

                                                                       
Query: 431 cccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtgcatgcctccggc 490
           ||||||||| || || || || |||||||||  |||||||||||||||||  ||||||||
Sbjct: 169 cccgaagtaccctgggtgatatttgtcgaagttgatgcggtggtggtgcagtcctccggc 110

                                                           
Query: 491 gttaccgcggcctccgggatgcttgcggtgcttgcccacacgcccgtg 538
           ||||||||| || ||||| ||||| |||||||| ||||| || |||||
Sbjct: 109 gttaccgcgtccaccggggtgcttccggtgctttcccacgcggccgtg 62



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 248 ggcagcatccccttgccgagcaccttgaagtagcc 282
           |||||| |||||||||| |||||||||||||||||
Sbjct: 360 ggcagcttccccttgcccagcaccttgaagtagcc 326

---

>emb|BX071844.1|CNS09RLK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 615 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 673

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 674 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 722

---

>emb|BX071644.1|CNS09RG0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 265 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 207

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 206 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 158

---

>emb|BX071615.1|CNS09RF7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9AH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 625 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 683

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 684 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 732

---

>emb|BX071614.1|CNS09RF6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 249 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 191

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 190 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 142

---

>emb|BX071463.1|CNS09RAZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 260 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 202

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 201 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 153

---

>emb|BX071150.1|CNS09R2A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8CC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 763

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 631 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 689

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 690 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 738

---

>emb|BX071149.1|CNS09R29 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 238 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 180

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 179 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 131

---

>emb|BX071048.1|CNS09QZG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 616 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 674

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 675 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 723

---

>emb|BX071325.1|CNS09R75 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8DC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 899

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 608 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 666

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 667 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 715

---

>emb|BX071324.1|CNS09R74 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 243 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 185

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 184 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 136

---

>emb|BX070859.1|CNS09QU7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 264 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 206

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 205 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 157

---

>emb|BX070688.1|CNS09QPG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 907

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 604 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 662

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 663 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 711

---

>emb|BX070687.1|CNS09QPF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 246 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 188

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 187 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 139

---

>emb|BX070669.1|CNS09QOX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 247 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 189

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 188 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 140

---

>emb|BX070195.1|CNS09QBR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7AG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 252 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 194

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 193 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 145

---

>emb|BX070000.1|CNS09Q6C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 637 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 695

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 696 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 744

---

>emb|BX069999.1|CNS09Q6B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 936

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 246 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 188

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 187 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 139

---

>emb|BX069998.1|CNS09Q6A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6DE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 879

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 618 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 676

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 677 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 725

---

>emb|BX069997.1|CNS09Q69 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 282 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 224

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 223 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 175

---

>emb|BX069926.1|CNS09Q4A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 634

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 260 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 202

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 201 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 153

---

>emb|BX069763.1|CNS09PZR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 931

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 245 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 187

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 186 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 138

---

>emb|BX069694.1|CNS09PXU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 442

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 257 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 199

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 198 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 150

---

>emb|BX069346.1|CNS09PO6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 277 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 219

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 218 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 170

---

>emb|BX069225.1|CNS09PKT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 765

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 554 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 612

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 613 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 661

---

>emb|BX069118.1|CNS09PHU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 246 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 188

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 187 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 139

---

>emb|BX069067.1|CNS09PGF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 923

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 625 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 683

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 684 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 732

---

>emb|BX069066.1|CNS09PGE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 935

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 259 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 201

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 200 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 152

---

>emb|BX068786.1|CNS09P8M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 261 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 203

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 202 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 154

---

>emb|BX068729.1|CNS09P71 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 252 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 194

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 193 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 145

---

>emb|BX068402.1|CNS09OXY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52CD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 856

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 639 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 697

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 698 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 746

---

>emb|BX068401.1|CNS09OXX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52CD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 331 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 273

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 272 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 224

---

>emb|BX068341.1|CNS09OW9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52BH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 942

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 642 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 700

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 701 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 749

---

>emb|BX068158.1|CNS09OR6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 253 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 195

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 194 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 146

---

>emb|BX067962.1|CNS09OLQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51DF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 884

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 241 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 183

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 182 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 134

---

>emb|BX067750.1|CNS09OFU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 383

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 267 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 209

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 208 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 160

---

>emb|BX067375.1|CNS09O5F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51AB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 864

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 618 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 676

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 677 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 725

---

>emb|BX067374.1|CNS09O5E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 918

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 245 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 187

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 186 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 138

---

>emb|BX067204.1|CNS09O0O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 617 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 675

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 676 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 724

---

>emb|BX067203.1|CNS09O0N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 250 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 192

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 191 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 143

---

>emb|BX066717.1|CNS09NN5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 246 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 188

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 187 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 139

---

>emb|BX066486.1|CNS09NGQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 610 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 668

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 669 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 717

---

>emb|BX066485.1|CNS09NGP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 918

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 251 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 193

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 192 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 144

---

>emb|BX066475.1|CNS09NGF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 610 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 668

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 669 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 717

---

>emb|BX066474.1|CNS09NGE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 248 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 190

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 189 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 141

---

>emb|BX066450.1|CNS09NFQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 621 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 679

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 680 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 728

---

>emb|BX066388.1|CNS09NE0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 263 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 205

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 204 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 156

---

>emb|BX065859.1|CNS09MZB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 577

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 256 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 198

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 197 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 149

---

>emb|BX065576.1|CNS09MRG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49CB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 807

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 127 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 69

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 68  gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 20

---

>emb|BX065497.1|CNS09MP9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 252 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 194

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 193 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 145

---

>emb|BX064955.1|CNS09MA7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48CE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 615 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 673

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 674 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 722

---

>emb|BX064954.1|CNS09MA6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 278 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 220

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 219 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 171

---

>emb|BX064810.1|CNS09M66 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 229

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 127 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 69

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 68  gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 20

---

>emb|BX064779.1|CNS09M5B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 858

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 607 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 665

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 666 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 714

---

>emb|BX064778.1|CNS09M5A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 877

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 215 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 157

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 156 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 108

---

>emb|BX064611.1|CNS09M0N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46DH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 552

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 247 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 189

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 188 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 140

---

>emb|BX064509.1|CNS09LXT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46DC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 633 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 691

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 692 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 740

---

>emb|BX064049.1|CNS09LL1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 247 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 189

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 188 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 140

---

>emb|BX063943.1|CNS09LI3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46AB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 643 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 701

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 702 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 750

---

>emb|BX063942.1|CNS09LI2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 288 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 230

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 229 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 181

---

>emb|BX063825.1|CNS09LET Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45DE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 594

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 412 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 470

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 471 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 519

---

>emb|BX063744.1|CNS09LCK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45DA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 724

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 267 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 209

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 208 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 160

---

>emb|BX063729.1|CNS09LC5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45DA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 895

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 255 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 197

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 196 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 148

---

>emb|BX063616.1|CNS09L90 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45CC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 248 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 190

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 189 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 141

---

>emb|BX063581.1|CNS09L81 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45CA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 892

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 245 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 187

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 186 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 138

---

>emb|BX063323.1|CNS09L0V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 634 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 692

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 693 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 741

---

>emb|BX062743.1|CNS09KKR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44AG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 840

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 380 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 322

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 321 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 273

---

>emb|BX062645.1|CNS09KI1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44AB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 238 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 180

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 179 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 131

---

>emb|BX062417.1|CNS09KBP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 628 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 686

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 687 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 735

---

>emb|BX062386.1|CNS09KAU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 636 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 694

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 695 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 743

---

>emb|BX061846.1|CNS09JVU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 251 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 193

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 192 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 144

---

>emb|BX061653.1|CNS09JQH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 906

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 606 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 664

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 665 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 713

---

>emb|BX061652.1|CNS09JQG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 902

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 244 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 186

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 185 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 137

---

>emb|BX061533.1|CNS09JN5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 935

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 243 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 185

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 184 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 136

---

>emb|BX061500.1|CNS09JM8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 250 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 192

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 191 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 143

---

>emb|BX061418.1|CNS09JJY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42AH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 241 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 183

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 182 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 134

---

>emb|BX061372.1|CNS09JIO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 871

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 586 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 644

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 645 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 693

---

>emb|BX061371.1|CNS09JIN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 873

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 225 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 167

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 166 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 118

---

>emb|BX060850.1|CNS09J46 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 629

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 258 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 200

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 199 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 151

---

>emb|BX060762.1|CNS09J1Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 257 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 199

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 198 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 150

---

>emb|BX060638.1|CNS09IYA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 846

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 242 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 184

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 183 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 135

---

>emb|BX060485.1|CNS09IU1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 611 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 669

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 670 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 718

---

>emb|BX060484.1|CNS09IU0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 239 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 181

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 180 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 132

---

>emb|BX060483.1|CNS09ITZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 768

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 617 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 675

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 676 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 724

---

>emb|BX060482.1|CNS09ITY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 914

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 244 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 186

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 185 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 137

---

>emb|BX060103.1|CNS09IJF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 258 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 200

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 199 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 151

---

>emb|BX060038.1|CNS09IHM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 247 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 189

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 188 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 140

---

>emb|BX059961.1|CNS09IFH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 256 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 198

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 197 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 149

---

>emb|BX059617.1|CNS09I5X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 294

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 251 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 193

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 192 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 144

---

>emb|BX059580.1|CNS09I4W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 264 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 206

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 205 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 157

---

>emb|BX059462.1|CNS09I1M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 617 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 675

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 676 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 724

---

>emb|BX059461.1|CNS09I1L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 256 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 198

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 197 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 149

---

>emb|BX059340.1|CNS09HY8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4AE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 265 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 207

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 206 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 158

---

>emb|BX059085.1|CNS09HR5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 247 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 189

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 188 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 140

---

>emb|BX058666.1|CNS09HFI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39AG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 239 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 181

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 180 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 132

---

>emb|BX058616.1|CNS09HE4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 889

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 597 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 655

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 656 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 704

---

>emb|BX058582.1|CNS09HD6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39AC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 268 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 210

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 209 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 161

---

>emb|BX058544.1|CNS09HC4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39AA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 902

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 631 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 689

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 690 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 738

---

>emb|BX058454.1|CNS09H9M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38DE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 600

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 263 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 205

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 204 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 156

---

>emb|BX058452.1|CNS09H9K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 834

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 618 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 676

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 677 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 725

---

>emb|BX058451.1|CNS09H9J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 895

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 257 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 199

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 198 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 150

---

>emb|BX058229.1|CNS09H3D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 269 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 211

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 210 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 162

---

>emb|BX056605.1|CNS09FU9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36AB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 850

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 608 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 666

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 667 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 715

---

>emb|BX056604.1|CNS09FU8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36AB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 903

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 249 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 191

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 190 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 142

---

>emb|BX057878.1|CNS09GTM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38AB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 609 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 667

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 668 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 716

---

>emb|BX057784.1|CNS09GR0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 593

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 266 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 208

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 207 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 159

---

>emb|BX057633.1|CNS09GMT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37CG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 618

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 253 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 195

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 194 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 146

---

>emb|BX057505.1|CNS09GJ9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37CA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 537

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 257 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 199

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 198 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 150

---

>emb|BX057495.1|CNS09GIZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 469

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 248 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 190

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 189 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 141

---

>emb|BX055833.1|CNS09F8T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 824

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 271 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 213

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 212 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 164

---

>emb|BX055484.1|CNS09EZ4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 257 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 199

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 198 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 150

---

>emb|BX053216.1|CNS09D84 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 240 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 182

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 181 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 133

---

>emb|BX053162.1|CNS09D6M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30CG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 851

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 188 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 130

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 129 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 81

---

>emb|BX053144.1|CNS09D64 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 863

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 189 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 131

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 130 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 82

---

>emb|BX055141.1|CNS09EPL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33CF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 783

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 248 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 190

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 189 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 141

---

>emb|BX054882.1|CNS09EIE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 885

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 212 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 154

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 153 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 105

---

>emb|BX053068.1|CNS09D40 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30CA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 863

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 187 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 129

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 128 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 80

---

>emb|BX054081.1|CNS09DW5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32AD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 931

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 250 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 192

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 191 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 143

---

>emb|BX053881.1|CNS09DQL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 942

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 269 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 211

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 210 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 162

---

>emb|BX053707.1|CNS09DLR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31CB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 788

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 643 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 701

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 702 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 750

---

>emb|BX053706.1|CNS09DLQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31CB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 269 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 211

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 210 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 162

---

>emb|BX053663.1|CNS09DKJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31BH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 421

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 250 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 192

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 191 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 143

---

>emb|BX052674.1|CNS09CT2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 835

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 253 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 195

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 194 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 146

---

>emb|BX052301.1|CNS09CIP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3BD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 908

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 244 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 186

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 185 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 137

---

>emb|BX051916.1|CNS09C80 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC29CF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 818

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 609 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 667

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 668 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 716

---

>emb|BX051464.1|CNS09BVG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28DC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 252 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 194

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 193 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 145

---

>emb|BX051169.1|CNS09BN9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28BC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 266

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 127 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 69

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 68  gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 20

---

>emb|BX050918.1|CNS09BGA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27DB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 312

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 127 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 69

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 68  gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 20

---

>emb|BX050847.1|CNS09BEB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC27CD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 869

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 618 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 676

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 677 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 725

---

>emb|BX050846.1|CNS09BEA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27CD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 231 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 173

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 172 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 124

---

>emb|BX050735.1|CNS09BB7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27BE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 260 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 202

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 201 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 153

---

>emb|BX050637.1|CNS09B8H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27BA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 899

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 231 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 173

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 172 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 124

---

>emb|BX050473.1|CNS09B3X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 662

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 264 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 206

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 205 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 157

---

>emb|BX050285.1|CNS09AYP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 414

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 127 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 69

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 68  gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 20

---

>emb|BX049853.1|CNS09AMP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC26AA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 854

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 610 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 668

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 669 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 717

---

>emb|BX049852.1|CNS09AMO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26AA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 876

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 229 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 171

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 170 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 122

---

>emb|BX049352.1|CNS09A8S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 610

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 264 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 206

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 205 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 157

---

>emb|BX049279.1|CNS09A6R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC25AD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 767

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 629 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 687

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 688 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 736

---

>emb|BX049134.1|CNS09A2Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24DD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 521

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 257 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 199

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 198 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 150

---

>emb|BX048838.1|CNS099UI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 547

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 242 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 184

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 183 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 135

---

>emb|BX048660.1|CNS099PK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 908

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 244 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 186

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 185 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 137

---

>emb|BX046531.1|CNS0982F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20AH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 908

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 247 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 189

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 188 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 140

---

>emb|BX046527.1|CNS0982B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20AH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 251 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 193

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 192 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 144

---

>emb|BX048302.1|CNS099FM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23BF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 272 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 214

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 213 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 165

---

>emb|BX048147.1|CNS099BB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC23AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 774

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 645 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 703

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 704 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 752

---

>emb|BX048146.1|CNS099BA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 876

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 270 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 212

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 211 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 163

---

>emb|BX048050.1|CNS0998M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC22DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 699

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 290 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 232

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 231 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 183

---

>emb|BX047926.1|CNS09956 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC22DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 645

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 247 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 189

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 188 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 140

---

>emb|BX047906.1|CNS0994M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC22CH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 244 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 186

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 185 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 137

---

>emb|BX047760.1|CNS0990K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC22BH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 267

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 208 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 150

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 149 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 101

---

>emb|BX047689.1|CNS098YL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC22BD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 766

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 252 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 194

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 193 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 145

---

>emb|BX047677.1|CNS098Y9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC22BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 815

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 665 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 723

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 724 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 772

---

>emb|BX047676.1|CNS098Y8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC22BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 267 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 209

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 208 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 160

---

>emb|BX047547.1|CNS098UN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC22AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 700

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 160 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 102

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 101 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 53

---

>emb|BX047520.1|CNS098TW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21DG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 738

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 274 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 216

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 215 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 167

---

>emb|BX047255.1|CNS098MJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 290

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 127 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 69

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 68  gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 20

---

>emb|BX047102.1|CNS098IA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21AE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 264 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 206

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 205 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 157

---

>emb|BX046950.1|CNS098E2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 967

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 276 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 218

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 217 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 169

---

>emb|BX046739.1|CNS09887 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20CA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 248 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 190

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 189 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 141

---

>emb|BX046675.1|CNS0986F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 915

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 248 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 190

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 189 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 141

---

>emb|BX046022.1|CNS097OA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC2BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 630 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 688

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 689 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 737

---

>emb|BX046021.1|CNS097O9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 271 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 213

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 212 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 164

---

>emb|BX045808.1|CNS097IC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2AE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 248 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 190

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 189 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 141

---

>emb|BX045791.1|CNS097HV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2AD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 883

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 255 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 197

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 196 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 148

---

>emb|BX045765.1|CNS097H5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC2AC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 626 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 684

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 685 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 733

---

>emb|BX045764.1|CNS097H4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2AC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 254 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 196

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 195 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 147

---

>emb|BX045565.1|CNS097BL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC19DB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 798

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 288 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 230

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 229 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 181

---

>emb|BX043029.1|CNS095D5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 940

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 267 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 209

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 208 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 160

---

>emb|BX044717.1|CNS096O1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC18CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 632 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 690

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 691 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 739

---

>emb|BX044716.1|CNS096O0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 935

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 268 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 210

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 209 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 161

---

>emb|BX044419.1|CNS096FR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18AC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 243 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 185

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 184 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 136

---

>emb|BX044308.1|CNS096CO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC17DD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 791

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 93/109 (85%), Gaps = 1/109 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 cataccgactttgcccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggt 477
           ||||||||| ||||| |||||| || |||||||| |||||||||  ||| ||||| ||||
Sbjct: 236 cataccgaccttgcc-gaagtaacccggatggtatttgtcgaagttgatacggtgatggt 178

                                                            
Query: 478 gcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 526
           |||| || || ||||||||||| || || |||||||| |||||||||||
Sbjct: 177 gcataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 129


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,038,588
Number of Sequences: 3902068
Number of extensions: 4038588
Number of successful extensions: 169324
Number of sequences better than 10.0: 751
Number of HSP's better than 10.0 without gapping: 752
Number of HSP's successfully gapped in prelim test: 7
Number of HSP's that attempted gapping in prelim test: 165287
Number of HSP's gapped (non-prelim): 3943
length of query: 599
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 576
effective length of database: 17,143,297,704
effective search space: 9874539477504
effective search space used: 9874539477504
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---