ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags20p18
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT017367.1| Zea mays clone EL01N0324G06.c mRNA sequence 406 e-110
2gb|AY110953.1| Zea mays CL14140_1 mRNA sequence 297 3e-77
3dbj|AK059836.1| Oryza sativa (japonica cultivar-group) cDNA clon... 234 3e-58
4dbj|AK071563.1| Oryza sativa (japonica cultivar-group) cDNA clon... 226 8e-56
5dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 220 5e-54
6dbj|AP003539.3| Oryza sativa (japonica cultivar-group) genomic D... 220 5e-54
7dbj|AP003609.2| Oryza sativa (japonica cultivar-group) genomic D... 220 5e-54
8gb|AC164111.4| Mus musculus BAC clone RP23-267E11 from chromosom... 46 0.15
9gb|AC107868.9| Mus musculus chromosome 17, clone RP23-405A17, co... 46 0.15
10gb|AC140444.2| Mus musculus BAC clone RP23-57N5 from chromosome ... 46 0.15
11gb|AC122400.4| Mus musculus BAC clone RP24-103C10 from chromosom... 46 0.15
12emb|AL732621.11| Mouse DNA sequence from clone RP23-299D17 on ch... 46 0.15
13dbj|AK046306.1| Mus musculus adult male corpora quadrigemina cDN... 46 0.15
14gb|AC154544.2| Mus musculus BAC clone RP23-228G19 from chromosom... 46 0.15
15gb|AC157660.2| Mus musculus BAC clone RP23-263I16 from chromosom... 46 0.15
16gb|AC118591.7| Mus musculus chromosome 3, clone RP24-93G19, comp... 46 0.15
17emb|AL845497.10| Mouse DNA sequence from clone RP23-232K9 on chr... 46 0.15
18emb|AL731731.14| Mouse DNA sequence from clone RP23-331L13 on ch... 46 0.15
19emb|AL731820.14| Mouse DNA sequence from clone RP23-135H19 on ch... 46 0.15
20gb|AC166833.4| Mus musculus BAC clone RP23-146A22 from chromosom... 44 0.61
21gb|AC164095.4| Mus musculus BAC clone RP23-355A22 from chromosom... 44 0.61
22gb|AC154680.2| Mus musculus BAC clone RP24-313N16 from chromosom... 44 0.61
23gb|AC166493.6| Mus musculus chromosome 1, clone RP24-317E14, com... 44 0.61
24gb|AC121271.8| Mus musculus chromosome 7, clone RP24-554K14, com... 44 0.61
25gb|AC161534.5| Mus musculus chromosome 1, clone RP24-127D13, com... 44 0.61
26gb|AC147782.8| Mus musculus chromosome 12, clone RP24-284A21, co... 44 0.61
27gb|AC126403.7| Mus musculus chromosome 15, clone RP24-483E7, com... 44 0.61
28gb|AC100737.18| Mus musculus chromosome 7, clone RP24-360I22, co... 44 0.61
29gb|AC148991.2| Mus musculus BAC clone RP23-52N2 from chromosome ... 44 0.61
30gb|AC139347.4| Mus musculus BAC clone RP24-334F11 from chromosom... 44 0.61
31gb|AC099415.4| Mus musculus BAC clone RP23-122D8 from chromosome... 44 0.61
32gb|AC140201.3| Mus musculus BAC clone RP23-267F15 from chromosom... 44 0.61
33gb|AC129189.3| Mus musculus BAC clone RP24-67O22 from chromosome... 44 0.61
34gb|AC161111.2| Mus musculus chromosome 15, clone RP23-50B6, comp... 44 0.61
35gb|AC163498.3| Mus musculus chromosome 1, clone RP23-86J11, comp... 44 0.61
36gb|AC137979.6| Mus musculus chromosome 5, clone RP24-92M6, compl... 44 0.61
37gb|AC100708.10| Mus musculus chromosome 10, clone RP23-169I18, c... 44 0.61
38gb|AC079871.4| Mus musculus strain C57BL6/J chromosome 5 clone R... 44 0.61
39gb|AC164559.3| Mus musculus BAC clone RP23-198H17 from chromosom... 44 0.61
40gb|AC101830.7| Mus musculus chromosome 1, clone RP24-480B20, com... 44 0.61
41emb|CT010475.5| Mouse DNA sequence from clone RP23-386L14 on chr... 44 0.61
42gb|AC127564.4| Mus musculus BAC clone RP24-290E2 from chromosome... 44 0.61
43gb|AC138311.3| Mus musculus BAC clone RP23-61L14 from chromosome... 44 0.61
44gb|AC127336.4| Mus musculus BAC clone RP23-161G2 from chromosome... 44 0.61
45gb|AC125308.3| Mus musculus BAC clone RP24-481N17 from chromosom... 44 0.61
46gb|AC121608.3| Mus musculus BAC clone RP23-317M3 from chromosome... 44 0.61
47gb|AC121910.3| Mus musculus BAC clone RP24-180H14 from chromosom... 44 0.61
48gb|AC127267.3| Mus musculus BAC clone RP23-401H14 from chromosom... 44 0.61
49gb|AC079817.41| Mus musculus strain C57BL/6J clone rp23-247i11 m... 44 0.61
50ref|NG_004051.1| Mus musculus immunoglobulin lambda chain comple... 44 0.61
51gb|AC102876.31| Mus musculus chromosome 1, clone RP24-492P7, com... 44 0.61
52emb|AL683829.15| Mouse DNA sequence from clone RP23-64F17 on chr... 44 0.61
53gb|AC164623.4| Mus musculus 10 BAC RP24-401L24 (Roswell Park Can... 44 0.61
54emb|BX649539.6| Mouse DNA sequence from clone RP24-371A24 on chr... 44 0.61
55emb|BX537258.3| Mouse DNA sequence from clone RP23-152P13 on chr... 44 0.61
56emb|AL645686.10| Mouse DNA sequence from clone RP23-330D1 on chr... 44 0.61
57gb|AC101771.11| Mus musculus chromosome 15, clone RP24-104H19, c... 44 0.61
58emb|AL808013.9| Mouse DNA sequence from clone RP23-188N17 on chr... 44 0.61
59gb|AC109607.47| Mus musculus strain C57BL/6J clone rp23-146a22 m... 44 0.61
60gb|AC079273.5| Mus musculus strain C57BL/6J chromosome 12 clone ... 44 0.61
61gb|AC139995.7| Mus musculus chromosome 1, clone RP23-427L3, comp... 44 0.61
62gb|AC159191.2| Mus musculus BAC clone RP24-158G12 from chromosom... 44 0.61
63gb|AC117257.4| Mus musculus BAC clone RP24-484F21 from chromosom... 44 0.61
64emb|AL954835.4| Mouse DNA sequence from clone RP23-416L9 on chro... 44 0.61
65emb|BX890640.4| Mouse DNA sequence from clone RP23-12N7 on chrom... 44 0.61
66gb|AC073945.34| Mus musculus strain C57BL/6J chromosome 9 clone ... 44 0.61
67emb|BX546483.5| Mouse DNA sequence from clone RP24-121F2 on chro... 44 0.61
68emb|AL671889.6| Mouse DNA sequence from clone RP23-390M19 on chr... 44 0.61
69gb|AC119176.10| Mus musculus chromosome 1, clone RP24-359F24, co... 44 0.61
70gb|AC102279.18| Mus musculus chromosome 7, clone RP24-302P2, com... 44 0.61
71gb|AC121091.10| Mus musculus chromosome 1, clone RP24-191N24, co... 44 0.61
72gb|AC110518.20| Mus musculus chromosome 1, clone RP23-10P1, comp... 44 0.61
73tpe|BN000872.1| TPA: TPA_exp: Mus musculus immunoglobulin heavy ... 44 0.61
74emb|CT571245.12| Mouse DNA sequence from clone RP23-2N7 on chrom... 44 0.61
75gb|AC115689.22| Mus musculus chromosome 9, clone RP23-166A9, com... 44 0.61
76gb|AC102009.20| Mus musculus chromosome 10, clone RP24-512D20, c... 44 0.61
77emb|BX119995.6| Mouse DNA sequence from clone RP23-318H22 on chr... 44 0.61
78gb|AC157592.6| Mus musculus BAC clone RP23-331M13 from chromosom... 44 0.61
79gb|AC124990.16| Mus musculus chromosome 3, clone RP24-283J17, co... 44 0.61
80gb|AC111082.23| Mus musculus chromosome 17, clone RP23-140I9, co... 44 0.61
81gb|AC135085.3| Mus musculus BAC clone RP24-317P24 from 1, comple... 44 0.61
82emb|CR974472.7| Mouse DNA sequence from clone RP24-120D11 on chr... 44 0.61
83gb|AC132625.3| Mus musculus BAC clone RP23-101M7 from 1, complet... 44 0.61
84gb|AC148321.7| Mus musculus BAC clone RP24-512H17 from 19, compl... 44 0.61
85gb|AC173050.1| Mus musculus BAC clone RP23-55I3 from chromosome ... 44 0.61
86gb|AC164643.4| Mus musculus BAC clone RP23-254F23 from chromosom... 44 0.61
87gb|AC161495.3| Mus musculus chromosome 5, clone RP23-393A24, com... 44 0.61
88gb|AC171200.1| Mus musculus BAC clone RP24-423F5 from chromosome... 44 0.61
89gb|AC170803.2| Mus musculus BAC clone RP24-418J23 from chromosom... 44 0.61
90emb|X13049.1|MMPG14LH Murine DNA for cytoskeletal gamma-actin ps... 44 0.61
91gb|AC161259.2| Mus musculus BAC clone RP23-465D18 from chromosom... 44 0.61
92gb|AC163692.4| Mus musculus BAC clone RP24-68H1 from chromosome ... 44 0.61
93gb|AC165077.3| Mus musculus BAC clone RP24-369J8 from chromosome... 44 0.61
94emb|AL672208.11| Mouse DNA sequence from clone RP23-318H23 on ch... 44 0.61
95emb|AL645793.14| Mouse DNA sequence from clone RP23-480H2 on chr... 44 0.61
96gb|AC124405.4| Mus musculus BAC clone RP24-372I6 from chromosome... 42 2.4
97emb|AL109985.5|CNS018P2 Human chromosome 14 DNA sequence BAC R-3... 42 2.4
98ref|NM_053885.1| Rattus norvegicus arginine-glutamic acid dipept... 40 9.5
99gb|AC165367.5| Mus musculus BAC clone RP23-23P3 from chromosome ... 40 9.5
100gb|AC122869.4| Mus musculus BAC clone RP23-101O19 from chromosom... 40 9.5
101gb|AC156561.3| Mus musculus BAC clone RP24-264F22 from chromosom... 40 9.5
102gb|AC164085.3| Mus musculus BAC clone RP23-205G24 from chromosom... 40 9.5
103gb|AC154623.2| Mus musculus BAC clone RP23-327K7 from chromosome... 40 9.5
104gb|AC167199.2| Mus musculus BAC clone RP23-324E10 from chromosom... 40 9.5
105gb|AC149084.5| Mus musculus BAC clone RP23-173A12 from chromosom... 40 9.5
106gb|AC154788.2| Mus musculus BAC clone RP24-470E2 from chromosome... 40 9.5
107gb|AC104856.19| Mus musculus chromosome 5, clone RP23-53G23, com... 40 9.5
108gb|AC158594.12| Mus musculus 10 BAC RP23-197I5 (Roswell Park Can... 40 9.5
109gb|AC147263.3| Mus musculus BAC clone RP24-213I13 from chromosom... 40 9.5
110gb|BC016224.1| Mus musculus neurolysin (metallopeptidase M3 fami... 40 9.5
111gb|AC125189.4| Mus musculus BAC clone RP23-280K1 from chromosome... 40 9.5
112gb|AC111090.20| Mus musculus chromosome 5, clone RP23-161K8, com... 40 9.5
113gb|AC147564.2| Mus musculus BAC clone RP23-123H4 from chromosome... 40 9.5
114gb|AC127227.3| Mus musculus BAC clone RP24-505M10 from chromosom... 40 9.5
115gb|CP000080.1| Leishmania major strain Friedlin chromosome 29, c... 40 9.5
116gb|AC163494.3| Mus musculus chromosome 7, clone RP23-221O21, com... 40 9.5
117gb|AC110883.12| Mus musculus chromosome 8, clone RP23-200N24, co... 40 9.5
118gb|AC164084.5| Mus musculus BAC clone RP23-15P15 from chromosome... 40 9.5
119gb|AC165341.2| Mus musculus BAC clone RP24-105C4 from chromosome... 40 9.5
120gb|AC165287.2| Mus musculus BAC clone RP24-230H12 from chromosom... 40 9.5
121gb|AC154905.5| Mus musculus BAC clone RP23-369A18 from chromosom... 40 9.5
122gb|BC025520.1| Mus musculus neurolysin (metallopeptidase M3 fami... 40 9.5
123gb|AC145549.3| Mus musculus BAC clone RP23-21M23 from chromosome... 40 9.5
124gb|AC144861.3| Mus musculus BAC clone RP23-63D4 from chromosome ... 40 9.5
125gb|AC141926.3| Mus musculus BAC clone RP23-299D9 from chromosome... 40 9.5
126emb|CT025689.6| Mouse DNA sequence from clone RP24-236L7 on chro... 40 9.5
127gb|AC101818.9| Mus musculus chromosome 7, clone RP24-363I8, comp... 40 9.5
128gb|AC129327.4| Mus musculus BAC clone RP23-159J2 from chromosome... 40 9.5
129gb|AC122819.4| Mus musculus BAC clone RP23-197L11 from chromosom... 40 9.5
130gb|AC122286.4| Mus musculus BAC clone RP23-252F4 from chromosome... 40 9.5
131gb|AC124452.4| Mus musculus BAC clone RP24-219N2 from chromosome... 40 9.5
132gb|AC121923.3| Mus musculus BAC clone RP24-198O18 from chromosom... 40 9.5
133gb|AC121836.2| Mus musculus BAC clone RP24-73L11 from 8, complet... 40 9.5
134gb|AC159740.3| Mus musculus BAC clone RP23-427E11 from chromosom... 40 9.5
135gb|AC158615.6| Mus musculus 10 BAC RP23-256B24 (Roswell Park Can... 40 9.5
136gb|AC155276.3| Mus musculus BAC clone RP23-26E18 from chromosome... 40 9.5
137emb|BX005206.15| Mouse DNA sequence from clone RP23-384P3 on chr... 40 9.5
138gb|AC091988.3| Homo sapiens chromosome 5 clone RP11-73G8, comple... 40 9.5
139dbj|AK138399.1| Mus musculus adult male hypothalamus cDNA, RIKEN... 40 9.5
140dbj|AK146364.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 40 9.5
141gb|AC144923.7| Mus musculus chromosome 7, clone RP23-366A16, com... 40 9.5
142dbj|AK170508.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 40 9.5
143dbj|AK171432.1| Mus musculus B6-derived CD11 +ve dendritic cells... 40 9.5
144gb|AC156562.3| Mus musculus BAC clone RP24-286J19 from chromosom... 40 9.5
145dbj|AK079090.1| Mus musculus adult male diencephalon cDNA, RIKEN... 40 9.5
146gb|U44091.1|RNU44091 Rattus norvegicus atrophin-1 related protei... 40 9.5
147gb|AC083909.20|AC083909 Mus musculus 1 BAC RP23-424A2 (Roswell P... 40 9.5
148gb|AC026797.3|AC026797 Homo sapiens chromosome 5 clone CTD-2299N... 40 9.5
149gb|AC154226.3| Mus musculus BAC clone RP24-353J14 from chromosom... 40 9.5
150gb|AC130530.4| Mus musculus BAC clone RP23-153P2 from chromosome... 40 9.5
151gb|AC007391.3| Homo sapiens BAC clone RP11-429J10 from 2, comple... 40 9.5
152ref|NM_029447.1| Mus musculus neurolysin (metallopeptidase M3 fa... 40 9.5
153gb|AE014133.1| Streptococcus mutans UA159, complete genome 40 9.5
154gb|AC125465.4| Mus musculus BAC clone RP23-333A16 from chromosom... 40 9.5
155emb|BX119968.5| Mouse DNA sequence from clone RP23-375D12 on chr... 40 9.5
156gb|AC124754.5| Mus musculus BAC clone RP23-285C16 from 5, comple... 40 9.5
157gb|AC153642.7| Mus musculus 6 BAC RP23-334E23 (Roswell Park Canc... 40 9.5
158gb|AC153933.3| Mus musculus 10 BAC RP24-282I24 (Roswell Park Can... 40 9.5
159gb|AC153520.3| Mus musculus 10 BAC RP23-144O19 (Roswell Park Can... 40 9.5
160gb|AC113061.9| Mus musculus chromosome 14, clone RP23-255H22, co... 40 9.5
161emb|BX284680.6| Mouse DNA sequence from clone RP23-260E20 on chr... 40 9.5
162emb|AL772352.8| Mouse DNA sequence from clone RP23-147F6 on chro... 40 9.5
163gb|AC170878.4| Mus musculus BAC clone RP24-226F17 from chromosom... 40 9.5
164gb|AC154216.1| Mus musculus BAC clone RP24-354I21 from 13, compl... 40 9.5
165gb|AC133196.6| Mus musculus BAC clone RP23-173B14 from 5, comple... 40 9.5
166gb|AC133199.3| Mus musculus BAC clone RP23-263B18 from 6, comple... 40 9.5
167gb|AC112264.6| Mus musculus BAC clone RP23-421E18 from 1, comple... 40 9.5
168gb|AC132383.5| Mus musculus BAC clone RP23-434M19 from 10, compl... 40 9.5
169gb|AC173342.1| Mus musculus BAC clone RP23-429O4 from chromosome... 40 9.5
170gb|AC171682.2| Mus musculus BAC clone RP24-101E7 from chromosome... 40 9.5
171gb|AC112976.8| Mus musculus chromosome 7, clone RP24-475E2, comp... 40 9.5
172gb|AC169123.3| Mus musculus BAC clone RP23-99L11 from chromosome... 40 9.5
173emb|AL805901.6| Mouse DNA sequence from clone RP23-24K4 on chrom... 40 9.5
174emb|AL807399.5| Mouse DNA sequence from clone RP23-382O11 on chr... 40 9.5
175emb|AL731810.20| Mouse DNA sequence from clone RP23-465B20 on ch... 40 9.5
176emb|AL929054.5| Mouse DNA sequence from clone RP23-454A14 on chr... 40 9.5
177gb|AC162924.5| Mus musculus BAC clone RP23-292J21 from chromosom... 40 9.5

>gb|BT017367.1| Zea mays clone EL01N0324G06.c mRNA sequence
          Length = 1216

 Score =  406 bits (205), Expect = e-110
 Identities = 387/444 (87%), Gaps = 3/444 (0%)
 Strand = Plus / Minus

                                                                       
Query: 228 atgttgccgagccagaacagcatcgggaactgcacgaccgccaggaagagcagaaagtag 287
           ||||||||||||||||||||||| ||||| ||||||||||||| ||||| ||| ||||||
Sbjct: 877 atgttgccgagccagaacagcatggggaattgcacgaccgccaagaagatcaggaagtag 818

                                                                       
Query: 288 tggtttcgactcagatgccgctcgtagctccttggtccacccagaagaaccctcttcatg 347
           ||||  || |   | || | ||||||||||||||| || |||||||||||||||||||||
Sbjct: 817 tggtcccggccggggtgtctctcgtagctccttggcccgcccagaagaaccctcttcatg 758

                                                                       
Query: 348 gtcttcacaaggaacacgccagtgcagagacagaaccatggcatgatgaagtagtataag 407
           |||||||||||||| || || |||||||| ||||||||||||||||||||||| || | |
Sbjct: 757 gtcttcacaaggaagactcccgtgcagaggcagaaccatggcatgatgaagtaatacagg 698

                                                                       
Query: 408 tagctccagaagatgcgggccagcatcgcaagagatgtgccagcaaatccatacccagca 467
           |||||||||||||||||||||| ||| ||||| || |||||||| || ||||| ||||||
Sbjct: 697 tagctccagaagatgcgggccaccattgcaagggaagtgccagcgaagccatatccagca 638

                                                                       
Query: 468 tacgccacaatgtctagcaatggtgcttcaccactgcccagggagtacagcaaacctttg 527
           |||||||| ||||| ||||| || |||||||| || |||||||||||||||| |||||||
Sbjct: 637 tacgccacgatgtccagcaagggagcttcaccgcttcccagggagtacagcagacctttg 578

                                                                       
Query: 528 atgaggacgacttgcagaaaccagccaactagacctcttgtgaactgtaggggtcagtgc 587
           ||||||||||||||||||||||| |||| ||  ||| | |  ||||||| ||||||||||
Sbjct: 577 atgaggacgacttgcagaaaccacccaagtatccctttagaaaactgta-gggtcagtgc 519

                                                                       
Query: 588 ctcangggtaaaccttccaagaac-tccaatgcgtatccagcaatgacaatggtaggtgc 646
           |||| |||||||||||||||||||  |||| || || ||||||   ||||| ||||||||
Sbjct: 518 ctcaggggtaaaccttccaagaacacccaaggcatacccagcagctacaat-gtaggtgc 460

                                   
Query: 647 caaaggccatcaaagggatgtaca 670
           |||| |||||||||||||||||||
Sbjct: 459 caaatgccatcaaagggatgtaca 436



to top

>gb|AY110953.1| Zea mays CL14140_1 mRNA sequence
          Length = 616

 Score =  297 bits (150), Expect = 3e-77
 Identities = 283/328 (86%), Gaps = 7/328 (2%)
 Strand = Plus / Minus

                                                                       
Query: 228 atgttgccgagccagaacagcatcgggaactgcacgaccgccaggaagagcagaaagtag 287
           ||||||||||||||||||||||| ||||| |||||||| |||| ||||| ||| ||||||
Sbjct: 325 atgttgccgagccagaacagcatggggaattgcacgactgccaagaagatcaggaagtag 266

                                                                       
Query: 288 tggtttcgactcagatgccgctcgtagctccttggtccacccagaagaaccctcttcatg 347
           ||||| || |   | || | ||||||||||||||| || |||||||||||||||||||||
Sbjct: 265 tggttccggccggggtgtctctcgtagctccttggcccgcccagaagaaccctcttcatg 206

                                                                       
Query: 348 gtcttcacaaggaacacgccagtgcagagacagaaccatggcatgatgaagtagtataag 407
           |||||||||||||| || || |||||||| ||||||||||||||||||||||| || | |
Sbjct: 205 gtcttcacaaggaagactcccgtgcagaggcagaaccatggcatgatgaagtaataaagg 146

                                                                       
Query: 408 tagctccagaagatgcgggccagcatcgcaagagatgtgccagcaaatccatacccagca 467
           |||||||||||||||||||||| ||| ||||| || |||||||| || ||||| |||   
Sbjct: 145 tagctccagaagatgcgggccaccattgcaagggaagtgccagcgaagccatatcca--- 89

                                                                       
Query: 468 tacgccacaatgtctagcaatggtgcttcaccactgcccagggagtacagcaaacctttg 527
               |||| ||||| ||||| || |||||||| || |||||||||||||||| |||||||
Sbjct: 88  ----ccacgatgtccagcaagggagcttcaccgcttcccagggagtacagcagacctttg 33

                                       
Query: 528 atgaggacgacttgcagaaaccagccaa 555
           ||||||||||||||||||||||| ||||
Sbjct: 32  atgaggacgacttgcagaaaccacccaa 5



to top

>dbj|AK059836.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-206-C05, full
           insert sequence
          Length = 1229

 Score =  234 bits (118), Expect = 3e-58
 Identities = 341/413 (82%), Gaps = 2/413 (0%)
 Strand = Plus / Minus

                                                                       
Query: 225 ctgatgttgccgagccagaacagcatcgggaactgcacgaccgccaggaagagcagaaag 284
           ||||||||||| |||||||| ||||| || || ||||| ||||| ||||| || ||||||
Sbjct: 895 ctgatgttgcctagccagaagagcatgggaaattgcacaaccgcgaggaaaagaagaaag 836

                                                                       
Query: 285 tagtggtttcgactcagatgccgctcgtagctccttggtccacccagaagaaccctcttc 344
           ||||| || || ||  | || | ||| |||||||||||| | ||||||||||||||||||
Sbjct: 835 tagtgattccggctggggtgtctctcatagctccttggtgcgcccagaagaaccctcttc 776

                                                                       
Query: 345 atggtcttcacaaggaacacgccagtgcagagacagaaccatggcatgatgaagtagtat 404
           || ||||| |||||||| || || |||||||   ||||||||||||  |  || || |||
Sbjct: 775 atcgtcttgacaaggaaaactccggtgcagattgagaaccatggcagtacaaaataatat 716

                                                                       
Query: 405 aagtagctccagaagatgcgggccagcatcgcaagagatgtgccagcaaatccataccca 464
            |   ||||||||||| |||| | ||||| ||||| ||||| ||||||||||||||||||
Sbjct: 715 gacgggctccagaagacgcggacaagcattgcaagtgatgtaccagcaaatccataccca 656

                                                                       
Query: 465 gcatacgccacaatgtctagcaatggtgcttcaccactgcccagggagtacagcaaacct 524
           ||||| ||||||||||| |||||||| ||||||||||| ||||| | |||||| | | ||
Sbjct: 655 gcataggccacaatgtccagcaatggcgcttcaccacttcccagcgtgtacagtagaact 596

                                                                       
Query: 525 ttgatgaggacgacttgcagaaaccagccaactagacctcttgtgaactgtaggggtcag 584
            |||| ||||  ||||||||||||||||||| ||  ||| |||||||||||| | || ||
Sbjct: 595 ctgatcaggattacttgcagaaaccagccaagtaatccttttgtgaactgta-gagtgag 537

                                                                
Query: 585 tgcctcangggtaaaccttccaagaac-tccaatgcgtatccagcaatgacaa 636
           ||||||  |||||||||| ||||||||  |||| || ||||||||||| ||||
Sbjct: 536 tgcctctggggtaaacctcccaagaacacccaaagcatatccagcaattacaa 484



to top

>dbj|AK071563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023104M14, full
           insert sequence
          Length = 1358

 Score =  226 bits (114), Expect = 8e-56
 Identities = 340/413 (82%), Gaps = 2/413 (0%)
 Strand = Plus / Minus

                                                                       
Query: 225 ctgatgttgccgagccagaacagcatcgggaactgcacgaccgccaggaagagcagaaag 284
           ||||||||||| |||||||| ||||| || || ||||| ||||| ||||| || || |||
Sbjct: 882 ctgatgttgcctagccagaagagcatgggaaattgcacaaccgcgaggaaaagaaggaag 823

                                                                       
Query: 285 tagtggtttcgactcagatgccgctcgtagctccttggtccacccagaagaaccctcttc 344
           ||||| || || ||  | || | ||| |||||||||||| | ||||||||||||||||||
Sbjct: 822 tagtgattccggctggggtgtctctcatagctccttggtgcgcccagaagaaccctcttc 763

                                                                       
Query: 345 atggtcttcacaaggaacacgccagtgcagagacagaaccatggcatgatgaagtagtat 404
           || ||||| |||||||| || || |||||||   ||||||||||||  |  || || |||
Sbjct: 762 atcgtcttgacaaggaaaactccggtgcagattgagaaccatggcagtacaaaataatat 703

                                                                       
Query: 405 aagtagctccagaagatgcgggccagcatcgcaagagatgtgccagcaaatccataccca 464
            |   ||||||||||| |||| | ||||| ||||| ||||| ||||||||||||||||||
Sbjct: 702 gacgggctccagaagacgcggacaagcattgcaagtgatgtaccagcaaatccataccca 643

                                                                       
Query: 465 gcatacgccacaatgtctagcaatggtgcttcaccactgcccagggagtacagcaaacct 524
           ||||| ||||||||||| |||||||| ||||||||||| ||||| | |||||| | | ||
Sbjct: 642 gcataggccacaatgtccagcaatggcgcttcaccacttcccagcgtgtacagtagaact 583

                                                                       
Query: 525 ttgatgaggacgacttgcagaaaccagccaactagacctcttgtgaactgtaggggtcag 584
            |||| ||||  ||||||||||||||||||| ||  ||| |||||||||||| | || ||
Sbjct: 582 ctgatcaggattacttgcagaaaccagccaagtaatccttttgtgaactgta-gagtgag 524

                                                                
Query: 585 tgcctcangggtaaaccttccaagaac-tccaatgcgtatccagcaatgacaa 636
           ||||||  |||||||||| ||||||||  |||| || ||||||||||| ||||
Sbjct: 523 tgcctctggggtaaacctcccaagaacacccaaagcatatccagcaattacaa 471



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  220 bits (111), Expect = 5e-54
 Identities = 312/378 (82%), Gaps = 1/378 (0%)
 Strand = Plus / Plus

                                                                            
Query: 225      ctgatgttgccgagccagaacagcatcgggaactgcacgaccgccaggaagagcagaaag 284
                ||||||||||| |||||||| ||||| || || ||||| ||||| ||||| || ||||||
Sbjct: 24533956 ctgatgttgcctagccagaagagcatgggaaattgcacaaccgcgaggaaaagaagaaag 24534015

                                                                            
Query: 285      tagtggtttcgactcagatgccgctcgtagctccttggtccacccagaagaaccctcttc 344
                ||||| || || ||  | || | ||| |||||||||||| | ||||||||||||||||||
Sbjct: 24534016 tagtgattccggctggggtgtctctcatagctccttggtgcgcccagaagaaccctcttc 24534075

                                                                            
Query: 345      atggtcttcacaaggaacacgccagtgcagagacagaaccatggcatgatgaagtagtat 404
                || ||||| |||||||| || || |||||||   ||||||||||||  |  || || |||
Sbjct: 24534076 atcgtcttgacaaggaaaactccggtgcagattgagaaccatggcagtacaaaataatat 24534135

                                                                            
Query: 405      aagtagctccagaagatgcgggccagcatcgcaagagatgtgccagcaaatccataccca 464
                 |   ||||||||||| |||| | ||||| ||||| ||||| ||||||||||||||||||
Sbjct: 24534136 gacgggctccagaagacgcggacaagcattgcaagtgatgtaccagcaaatccataccca 24534195

                                                                            
Query: 465      gcatacgccacaatgtctagcaatggtgcttcaccactgcccagggagtacagcaaacct 524
                ||||| ||||||||||| |||||||| ||||||||||| ||||| | |||||| | | ||
Sbjct: 24534196 gcataggccacaatgtccagcaatggcgcttcaccacttcccagcgtgtacagtagaact 24534255

                                                                            
Query: 525      ttgatgaggacgacttgcagaaaccagccaactagacctcttgtgaactgtaggggtcag 584
                 |||| ||||  ||||||||||||||||||| ||  ||| |||||||||||| | || ||
Sbjct: 24534256 ctgatcaggattacttgcagaaaccagccaagtaatccttttgtgaactgta-gagtgag 24534314

                                  
Query: 585      tgcctcangggtaaacct 602
                ||||||  ||||||||||
Sbjct: 24534315 tgcctctggggtaaacct 24534332



to top

>dbj|AP003539.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0040H10
          Length = 173301

 Score =  220 bits (111), Expect = 5e-54
 Identities = 312/378 (82%), Gaps = 1/378 (0%)
 Strand = Plus / Plus

                                                                         
Query: 225   ctgatgttgccgagccagaacagcatcgggaactgcacgaccgccaggaagagcagaaag 284
             ||||||||||| |||||||| ||||| || || ||||| ||||| ||||| || ||||||
Sbjct: 17149 ctgatgttgcctagccagaagagcatgggaaattgcacaaccgcgaggaaaagaagaaag 17208

                                                                         
Query: 285   tagtggtttcgactcagatgccgctcgtagctccttggtccacccagaagaaccctcttc 344
             ||||| || || ||  | || | ||| |||||||||||| | ||||||||||||||||||
Sbjct: 17209 tagtgattccggctggggtgtctctcatagctccttggtgcgcccagaagaaccctcttc 17268

                                                                         
Query: 345   atggtcttcacaaggaacacgccagtgcagagacagaaccatggcatgatgaagtagtat 404
             || ||||| |||||||| || || |||||||   ||||||||||||  |  || || |||
Sbjct: 17269 atcgtcttgacaaggaaaactccggtgcagattgagaaccatggcagtacaaaataatat 17328

                                                                         
Query: 405   aagtagctccagaagatgcgggccagcatcgcaagagatgtgccagcaaatccataccca 464
              |   ||||||||||| |||| | ||||| ||||| ||||| ||||||||||||||||||
Sbjct: 17329 gacgggctccagaagacgcggacaagcattgcaagtgatgtaccagcaaatccataccca 17388

                                                                         
Query: 465   gcatacgccacaatgtctagcaatggtgcttcaccactgcccagggagtacagcaaacct 524
             ||||| ||||||||||| |||||||| ||||||||||| ||||| | |||||| | | ||
Sbjct: 17389 gcataggccacaatgtccagcaatggcgcttcaccacttcccagcgtgtacagtagaact 17448

                                                                         
Query: 525   ttgatgaggacgacttgcagaaaccagccaactagacctcttgtgaactgtaggggtcag 584
              |||| ||||  ||||||||||||||||||| ||  ||| |||||||||||| | || ||
Sbjct: 17449 ctgatcaggattacttgcagaaaccagccaagtaatccttttgtgaactgta-gagtgag 17507

                               
Query: 585   tgcctcangggtaaacct 602
             ||||||  ||||||||||
Sbjct: 17508 tgcctctggggtaaacct 17525



to top

>dbj|AP003609.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0012B02
          Length = 149807

 Score =  220 bits (111), Expect = 5e-54
 Identities = 312/378 (82%), Gaps = 1/378 (0%)
 Strand = Plus / Plus

                                                                          
Query: 225    ctgatgttgccgagccagaacagcatcgggaactgcacgaccgccaggaagagcagaaag 284
              ||||||||||| |||||||| ||||| || || ||||| ||||| ||||| || ||||||
Sbjct: 145429 ctgatgttgcctagccagaagagcatgggaaattgcacaaccgcgaggaaaagaagaaag 145488

                                                                          
Query: 285    tagtggtttcgactcagatgccgctcgtagctccttggtccacccagaagaaccctcttc 344
              ||||| || || ||  | || | ||| |||||||||||| | ||||||||||||||||||
Sbjct: 145489 tagtgattccggctggggtgtctctcatagctccttggtgcgcccagaagaaccctcttc 145548

                                                                          
Query: 345    atggtcttcacaaggaacacgccagtgcagagacagaaccatggcatgatgaagtagtat 404
              || ||||| |||||||| || || |||||||   ||||||||||||  |  || || |||
Sbjct: 145549 atcgtcttgacaaggaaaactccggtgcagattgagaaccatggcagtacaaaataatat 145608

                                                                          
Query: 405    aagtagctccagaagatgcgggccagcatcgcaagagatgtgccagcaaatccataccca 464
               |   ||||||||||| |||| | ||||| ||||| ||||| ||||||||||||||||||
Sbjct: 145609 gacgggctccagaagacgcggacaagcattgcaagtgatgtaccagcaaatccataccca 145668

                                                                          
Query: 465    gcatacgccacaatgtctagcaatggtgcttcaccactgcccagggagtacagcaaacct 524
              ||||| ||||||||||| |||||||| ||||||||||| ||||| | |||||| | | ||
Sbjct: 145669 gcataggccacaatgtccagcaatggcgcttcaccacttcccagcgtgtacagtagaact 145728

                                                                          
Query: 525    ttgatgaggacgacttgcagaaaccagccaactagacctcttgtgaactgtaggggtcag 584
               |||| ||||  ||||||||||||||||||| ||  ||| |||||||||||| | || ||
Sbjct: 145729 ctgatcaggattacttgcagaaaccagccaagtaatccttttgtgaactgta-gagtgag 145787

                                
Query: 585    tgcctcangggtaaacct 602
              ||||||  ||||||||||
Sbjct: 145788 tgcctctggggtaaacct 145805



to top

>gb|AC164111.4| Mus musculus BAC clone RP23-267E11 from chromosome 6, complete sequence
          Length = 179265

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 153   ccaccgagtgtatcctgcacagg 175
             |||||||||||||||||||||||
Sbjct: 64942 ccaccgagtgtatcctgcacagg 64920



to top

>gb|AC107868.9| Mus musculus chromosome 17, clone RP23-405A17, complete sequence
          Length = 193624

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 153   ccaccgagtgtatcctgcacagg 175
             |||||||||||||||||||||||
Sbjct: 27868 ccaccgagtgtatcctgcacagg 27846



to top

>gb|AC140444.2| Mus musculus BAC clone RP23-57N5 from chromosome 5, complete sequence
          Length = 174306

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 152    accaccgagtgtatcctgcacag 174
              |||||||||||||||||||||||
Sbjct: 125661 accaccgagtgtatcctgcacag 125683



to top

>gb|AC122400.4| Mus musculus BAC clone RP24-103C10 from chromosome 7, complete sequence
          Length = 166252

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 153   ccaccgagtgtatcctgcacagg 175
             |||||||||||||||||||||||
Sbjct: 60442 ccaccgagtgtatcctgcacagg 60464



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 60600 ccaccgagtgtatcctgcacag 60621



to top

>emb|AL732621.11| Mouse DNA sequence from clone RP23-299D17 on chromosome 11 Contains
             part of the Asb3 gene for ankyrin repeat and SOCS
             box-containing protein 3 and a Cpg island, complete
             sequence
          Length = 94738

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 153   ccaccgagtgtatcctgcacagg 175
             |||||||||||||||||||||||
Sbjct: 12876 ccaccgagtgtatcctgcacagg 12854



to top

>dbj|AK046306.1| Mus musculus adult male corpora quadrigemina cDNA, RIKEN
           full-length enriched library, clone:B230367P09
           product:unclassifiable, full insert sequence
          Length = 2570

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 153 ccaccgagtgtatcctgcacagg 175
           |||||||||||||||||||||||
Sbjct: 886 ccaccgagtgtatcctgcacagg 908



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 153  ccaccgagtgtatcctgcacag 174
            ||||||||||||||||||||||
Sbjct: 1044 ccaccgagtgtatcctgcacag 1065



to top

>gb|AC154544.2| Mus musculus BAC clone RP23-228G19 from chromosome 17, complete sequence
          Length = 183626

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 153    ccaccgagtgtatcctgcacagg 175
              |||||||||||||||||||||||
Sbjct: 168862 ccaccgagtgtatcctgcacagg 168840



to top

>gb|AC157660.2| Mus musculus BAC clone RP23-263I16 from chromosome 1, complete sequence
          Length = 192026

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 153    ccaccgagtgtatcctgcacagg 175
              |||||||||||||||||||||||
Sbjct: 161862 ccaccgagtgtatcctgcacagg 161884



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 161748 ccgagtgtatcctgcacagg 161767



to top

>gb|AC118591.7| Mus musculus chromosome 3, clone RP24-93G19, complete sequence
          Length = 208878

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 153    ccaccgagtgtatcctgcacagg 175
              |||||||||||||||||||||||
Sbjct: 111408 ccaccgagtgtatcctgcacagg 111386



to top

>emb|AL845497.10| Mouse DNA sequence from clone RP23-232K9 on chromosome 2, complete
              sequence
          Length = 157619

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 153    ccaccgagtgtatcctgcacagg 175
              |||||||||||||||||||||||
Sbjct: 119101 ccaccgagtgtatcctgcacagg 119123



to top

>emb|AL731731.14| Mouse DNA sequence from clone RP23-331L13 on chromosome X, complete
             sequence
          Length = 151603

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 153   ccaccgagtgtatcctgcacagg 175
             |||||||||||||||||||||||
Sbjct: 96034 ccaccgagtgtatcctgcacagg 96056



to top

>emb|AL731820.14| Mouse DNA sequence from clone RP23-135H19 on chromosome X, complete
             sequence
          Length = 168773

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 153   ccaccgagtgtatcctgcacagg 175
             |||||||||||||||||||||||
Sbjct: 37629 ccaccgagtgtatcctgcacagg 37651



to top

>gb|AC166833.4| Mus musculus BAC clone RP23-146A22 from chromosome 8, complete sequence
          Length = 200720

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 79688 ccaccgagtgtatcctgcacag 79709



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 79808 ccgagtgtatcctgcacagg 79827



to top

>gb|AC164095.4| Mus musculus BAC clone RP23-355A22 from chromosome 7, complete sequence
          Length = 184356

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 26259 ccaccgagtgtatcctgcacag 26238



to top

>gb|AC154680.2| Mus musculus BAC clone RP24-313N16 from chromosome 13, complete
             sequence
          Length = 167328

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 11282 ccaccgagtgtatcctgcacag 11261



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 11007 ccaccgagtgtatcctgcacag 10986



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 11162 ccgagtgtatcctgcacagg 11143



to top

>gb|AC166493.6| Mus musculus chromosome 1, clone RP24-317E14, complete sequence
          Length = 178538

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 72985 ccaccgagtgtatcctgcacag 72964



to top

>gb|AC121271.8| Mus musculus chromosome 7, clone RP24-554K14, complete sequence
          Length = 179901

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 80821 ccaccgagtgtatcctgcacag 80842



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 80945 ccgagtgtatcctgcacagg 80964



to top

>gb|AC161534.5| Mus musculus chromosome 1, clone RP24-127D13, complete sequence
          Length = 137652

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 153    ccaccgagtgtatcctgcacag 174
              ||||||||||||||||||||||
Sbjct: 128345 ccaccgagtgtatcctgcacag 128324



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 128617 ccgagtgtatcctgcacagg 128598



to top

>gb|AC147782.8| Mus musculus chromosome 12, clone RP24-284A21, complete sequence
          Length = 155158

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 86861 ccaccgagtgtatcctgcacag 86840



to top

>gb|AC126403.7| Mus musculus chromosome 15, clone RP24-483E7, complete sequence
          Length = 152384

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 153    ccaccgagtgtatcctgcacag 174
              ||||||||||||||||||||||
Sbjct: 115489 ccaccgagtgtatcctgcacag 115468



to top

>gb|AC100737.18| Mus musculus chromosome 7, clone RP24-360I22, complete sequence
          Length = 148090

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 153  ccaccgagtgtatcctgcacag 174
            ||||||||||||||||||||||
Sbjct: 7129 ccaccgagtgtatcctgcacag 7108



to top

>gb|AC148991.2| Mus musculus BAC clone RP23-52N2 from chromosome 19, complete sequence
          Length = 221043

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 28114 ccaccgagtgtatcctgcacag 28135



to top

>gb|AC139347.4| Mus musculus BAC clone RP24-334F11 from chromosome 16, complete
             sequence
          Length = 193398

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 98787 ccaccgagtgtatcctgcacag 98766



to top

>gb|AC099415.4| Mus musculus BAC clone RP23-122D8 from chromosome 8, complete sequence
          Length = 215488

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 153    ccaccgagtgtatcctgcacag 174
              ||||||||||||||||||||||
Sbjct: 166789 ccaccgagtgtatcctgcacag 166810



to top

>gb|AC140201.3| Mus musculus BAC clone RP23-267F15 from chromosome 16, complete
             sequence
          Length = 166079

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 28080 ccaccgagtgtatcctgcacag 28059



to top

>gb|AC129189.3| Mus musculus BAC clone RP24-67O22 from chromosome 15, complete sequence
          Length = 152947

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 153    ccaccgagtgtatcctgcacag 174
              ||||||||||||||||||||||
Sbjct: 119211 ccaccgagtgtatcctgcacag 119232



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 153    ccaccgagtgtatcctgcacag 174
              ||||||||||||||||||||||
Sbjct: 118936 ccaccgagtgtatcctgcacag 118957



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 119056 ccgagtgtatcctgcacagg 119075



to top

>gb|AC161111.2| Mus musculus chromosome 15, clone RP23-50B6, complete sequence
          Length = 200074

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 55943 ccaccgagtgtatcctgcacag 55922



to top

>gb|AC163498.3| Mus musculus chromosome 1, clone RP23-86J11, complete sequence
          Length = 192061

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 153    ccaccgagtgtatcctgcacag 174
              ||||||||||||||||||||||
Sbjct: 178072 ccaccgagtgtatcctgcacag 178051



to top

>gb|AC137979.6| Mus musculus chromosome 5, clone RP24-92M6, complete sequence
          Length = 170969

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 153    ccaccgagtgtatcctgcacag 174
              ||||||||||||||||||||||
Sbjct: 108738 ccaccgagtgtatcctgcacag 108759



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 108858 ccgagtgtatcctgcacagg 108877



to top

>gb|AC100708.10| Mus musculus chromosome 10, clone RP23-169I18, complete sequence
          Length = 196776

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 153    ccaccgagtgtatcctgcacag 174
              ||||||||||||||||||||||
Sbjct: 124221 ccaccgagtgtatcctgcacag 124200



to top

>gb|AC079871.4| Mus musculus strain C57BL6/J chromosome 5 clone RP23-128P4, complete
              sequence
          Length = 125209

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 153    ccaccgagtgtatcctgcacag 174
              ||||||||||||||||||||||
Sbjct: 113207 ccaccgagtgtatcctgcacag 113186



to top

>gb|AC164559.3| Mus musculus BAC clone RP23-198H17 from chromosome 6, complete sequence
          Length = 194636

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 65771 ccaccgagtgtatcctgcacag 65792



to top

>gb|AC101830.7| Mus musculus chromosome 1, clone RP24-480B20, complete sequence
          Length = 158825

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 153    ccaccgagtgtatcctgcacag 174
              ||||||||||||||||||||||
Sbjct: 138124 ccaccgagtgtatcctgcacag 138145



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 138010 ccgagtgtatcctgcacagg 138029



to top

>emb|CT010475.5| Mouse DNA sequence from clone RP23-386L14 on chromosome 13, complete
              sequence
          Length = 202971

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 153    ccaccgagtgtatcctgcacag 174
              ||||||||||||||||||||||
Sbjct: 182694 ccaccgagtgtatcctgcacag 182673



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 153    ccaccgagtgtatcctgcacag 174
              ||||||||||||||||||||||
Sbjct: 182419 ccaccgagtgtatcctgcacag 182398



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 182574 ccgagtgtatcctgcacagg 182555



to top

>gb|AC127564.4| Mus musculus BAC clone RP24-290E2 from chromosome 5, complete sequence
          Length = 157220

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 153    ccaccgagtgtatcctgcacag 174
              ||||||||||||||||||||||
Sbjct: 115953 ccaccgagtgtatcctgcacag 115974



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 116073 ccgagtgtatcctgcacagg 116092



to top

>gb|AC138311.3| Mus musculus BAC clone RP23-61L14 from chromosome 7, complete sequence
          Length = 181340

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 153    ccaccgagtgtatcctgcacag 174
              ||||||||||||||||||||||
Sbjct: 100384 ccaccgagtgtatcctgcacag 100363



to top

>gb|AC127336.4| Mus musculus BAC clone RP23-161G2 from chromosome 7, complete sequence
          Length = 222059

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 79303 ccaccgagtgtatcctgcacag 79324



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 79148 ccgagtgtatcctgcacagg 79167



to top

>gb|AC125308.3| Mus musculus BAC clone RP24-481N17 from chromosome 5, complete sequence
          Length = 128910

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 64021 ccaccgagtgtatcctgcacag 64000



to top

>gb|AC121608.3| Mus musculus BAC clone RP23-317M3 from chromosome 9, complete sequence
          Length = 207820

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 67206 ccaccgagtgtatcctgcacag 67227



to top

>gb|AC121910.3| Mus musculus BAC clone RP24-180H14 from chromosome 13, complete sequence
          Length = 143473

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 153    ccaccgagtgtatcctgcacag 174
              ||||||||||||||||||||||
Sbjct: 108207 ccaccgagtgtatcctgcacag 108186



to top

>gb|AC127267.3| Mus musculus BAC clone RP23-401H14 from chromosome 6, complete sequence
          Length = 186704

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 17065 ccaccgagtgtatcctgcacag 17086



to top

>gb|AC079817.41| Mus musculus strain C57BL/6J clone rp23-247i11 map 16, complete
             sequence
          Length = 197346

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 94360 ccaccgagtgtatcctgcacag 94339



to top

>ref|NG_004051.1| Mus musculus immunoglobulin lambda chain complex (Igl) on chromosome 16
          Length = 234987

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 153    ccaccgagtgtatcctgcacag 174
              ||||||||||||||||||||||
Sbjct: 178307 ccaccgagtgtatcctgcacag 178328



to top

>gb|AC102876.31| Mus musculus chromosome 1, clone RP24-492P7, complete sequence
          Length = 185929

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 153    ccaccgagtgtatcctgcacag 174
              ||||||||||||||||||||||
Sbjct: 173334 ccaccgagtgtatcctgcacag 173355



to top

>emb|AL683829.15| Mouse DNA sequence from clone RP23-64F17 on chromosome 4 Contains two
             novel genes, the gene for a novel major urinary protein
             (Mup) family member, the Zfp37 gene for zinc finger
             protein 37, the Slc31a2 gene for solute carrier family 31
             member 2 and two CpG islands, complete sequence
          Length = 223133

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 79854 ccaccgagtgtatcctgcacag 79875



to top

>gb|AC164623.4| Mus musculus 10 BAC RP24-401L24 (Roswell Park Cancer Institute
            (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 172657

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 153  ccaccgagtgtatcctgcacag 174
            ||||||||||||||||||||||
Sbjct: 2779 ccaccgagtgtatcctgcacag 2758



to top

>emb|BX649539.6| Mouse DNA sequence from clone RP24-371A24 on chromosome 4 Contains a
             ribosomal protein S2 (Rps2) pseudogene, complete sequence
          Length = 198964

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 92573 ccaccgagtgtatcctgcacag 92552



to top

>emb|BX537258.3| Mouse DNA sequence from clone RP23-152P13 on chromosome 4 Contains a
             eukaryotic translation initiation factor 4E (Eif4e)
             pseudogene and a eukaryotic translation initiation factor
             4A (Eif4a) pseudogene, complete sequence
          Length = 188776

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 35814 ccaccgagtgtatcctgcacag 35835



to top

>emb|AL645686.10| Mouse DNA sequence from clone RP23-330D1 on chromosome 13, complete
             sequence
          Length = 137782

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 18075 ccaccgagtgtatcctgcacag 18096



to top

>gb|AC101771.11| Mus musculus chromosome 15, clone RP24-104H19, complete sequence
          Length = 153992

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 78862 ccaccgagtgtatcctgcacag 78883



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 78587 ccaccgagtgtatcctgcacag 78608



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 78707 ccgagtgtatcctgcacagg 78726



to top

>emb|AL808013.9| Mouse DNA sequence from clone RP23-188N17 on chromosome X, complete
             sequence
          Length = 173481

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 78785 ccaccgagtgtatcctgcacag 78806



to top

>gb|AC109607.47| Mus musculus strain C57BL/6J clone rp23-146a22 map 8, complete sequence
          Length = 200759

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 79683 ccaccgagtgtatcctgcacag 79704



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 79803 ccgagtgtatcctgcacagg 79822



to top

>gb|AC079273.5| Mus musculus strain C57BL/6J chromosome 12 clone RP23-373N04, complete
             sequence
          Length = 175987

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 58712 ccaccgagtgtatcctgcacag 58691



to top

>gb|AC139995.7| Mus musculus chromosome 1, clone RP23-427L3, complete sequence
          Length = 165802

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 153    ccaccgagtgtatcctgcacag 174
              ||||||||||||||||||||||
Sbjct: 136119 ccaccgagtgtatcctgcacag 136098



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 136233 ccgagtgtatcctgcacagg 136214



to top

>gb|AC159191.2| Mus musculus BAC clone RP24-158G12 from chromosome 13, complete
             sequence
          Length = 176738

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 12894 ccaccgagtgtatcctgcacag 12915



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 12619 ccaccgagtgtatcctgcacag 12640



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 12739 ccgagtgtatcctgcacagg 12758



to top

>gb|AC117257.4| Mus musculus BAC clone RP24-484F21 from chromosome 17, complete sequence
          Length = 187399

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 153    ccaccgagtgtatcctgcacag 174
              ||||||||||||||||||||||
Sbjct: 184948 ccaccgagtgtatcctgcacag 184969



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 153    ccaccgagtgtatcctgcacag 174
              ||||||||||||||||||||||
Sbjct: 178265 ccaccgagtgtatcctgcacag 178286



to top

>emb|AL954835.4| Mouse DNA sequence from clone RP23-416L9 on chromosome 2, complete
            sequence
          Length = 141405

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 153  ccaccgagtgtatcctgcacag 174
            ||||||||||||||||||||||
Sbjct: 5471 ccaccgagtgtatcctgcacag 5492



to top

>emb|BX890640.4| Mouse DNA sequence from clone RP23-12N7 on chromosome 2, complete
            sequence
          Length = 52972

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 153  ccaccgagtgtatcctgcacag 174
            ||||||||||||||||||||||
Sbjct: 5479 ccaccgagtgtatcctgcacag 5500



to top

>gb|AC073945.34| Mus musculus strain C57BL/6J chromosome 9 clone rp23-171e18, complete
              sequence
          Length = 203394

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 153    ccaccgagtgtatcctgcacag 174
              ||||||||||||||||||||||
Sbjct: 184012 ccaccgagtgtatcctgcacag 184033



to top

>emb|BX546483.5| Mouse DNA sequence from clone RP24-121F2 on chromosome X, complete
             sequence
          Length = 74439

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 67602 ccaccgagtgtatcctgcacag 67581



to top

>emb|AL671889.6| Mouse DNA sequence from clone RP23-390M19 on chromosome X, complete
             sequence
          Length = 195748

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 87893 ccaccgagtgtatcctgcacag 87914



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 88013 ccgagtgtatcctgcacagg 88032



to top

>gb|AC119176.10| Mus musculus chromosome 1, clone RP24-359F24, complete sequence
          Length = 208009

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 153    ccaccgagtgtatcctgcacag 174
              ||||||||||||||||||||||
Sbjct: 188708 ccaccgagtgtatcctgcacag 188729



to top

>gb|AC102279.18| Mus musculus chromosome 7, clone RP24-302P2, complete sequence
          Length = 170100

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 83852 ccaccgagtgtatcctgcacag 83831



to top

>gb|AC121091.10| Mus musculus chromosome 1, clone RP24-191N24, complete sequence
          Length = 150109

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 153  ccaccgagtgtatcctgcacag 174
            ||||||||||||||||||||||
Sbjct: 2548 ccaccgagtgtatcctgcacag 2527



to top

>gb|AC110518.20| Mus musculus chromosome 1, clone RP23-10P1, complete sequence
          Length = 198526

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 153    ccaccgagtgtatcctgcacag 174
              ||||||||||||||||||||||
Sbjct: 195296 ccaccgagtgtatcctgcacag 195275



to top

>tpe|BN000872.1| TPA: TPA_exp: Mus musculus immunoglobulin heavy chain variable region
               locus, strain C57BL/6
          Length = 2500000

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 153     ccaccgagtgtatcctgcacag 174
               ||||||||||||||||||||||
Sbjct: 2199108 ccaccgagtgtatcctgcacag 2199129



to top

>emb|CT571245.12| Mouse DNA sequence from clone RP23-2N7 on chromosome 12, complete
             sequence
          Length = 198268

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 23321 ccaccgagtgtatcctgcacag 23300



to top

>gb|AC115689.22| Mus musculus chromosome 9, clone RP23-166A9, complete sequence
          Length = 221548

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 153    ccaccgagtgtatcctgcacag 174
              ||||||||||||||||||||||
Sbjct: 118250 ccaccgagtgtatcctgcacag 118229



to top

>gb|AC102009.20| Mus musculus chromosome 10, clone RP24-512D20, complete sequence
          Length = 172721

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 27440 ccaccgagtgtatcctgcacag 27419



to top

>emb|BX119995.6| Mouse DNA sequence from clone RP23-318H22 on chromosome X, complete
             sequence
          Length = 142284

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 35928 ccaccgagtgtatcctgcacag 35907



to top

>gb|AC157592.6| Mus musculus BAC clone RP23-331M13 from chromosome 7, complete sequence
          Length = 220809

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 87196 ccaccgagtgtatcctgcacag 87175



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 87351 ccgagtgtatcctgcacagg 87332



to top

>gb|AC124990.16| Mus musculus chromosome 3, clone RP24-283J17, complete sequence
          Length = 190156

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 44977 ccaccgagtgtatcctgcacag 44998



to top

>gb|AC111082.23| Mus musculus chromosome 17, clone RP23-140I9, complete sequence
          Length = 171550

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 33379 ccaccgagtgtatcctgcacag 33400



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 26696 ccaccgagtgtatcctgcacag 26717



to top

>gb|AC135085.3| Mus musculus BAC clone RP24-317P24 from 1, complete sequence
          Length = 214594

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 55078 ccaccgagtgtatcctgcacag 55057



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 55350 ccgagtgtatcctgcacagg 55331



to top

>emb|CR974472.7| Mouse DNA sequence from clone RP24-120D11 on chromosome 17, complete
             sequence
          Length = 192085

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 72497 ccaccgagtgtatcctgcacag 72518



to top

>gb|AC132625.3| Mus musculus BAC clone RP23-101M7 from 1, complete sequence
          Length = 183691

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 90300 ccaccgagtgtatcctgcacag 90321



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 90145 ccgagtgtatcctgcacagg 90164



to top

>gb|AC148321.7| Mus musculus BAC clone RP24-512H17 from 19, complete sequence
          Length = 210790

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 153    ccaccgagtgtatcctgcacag 174
              ||||||||||||||||||||||
Sbjct: 161838 ccaccgagtgtatcctgcacag 161859



to top

>gb|AC173050.1| Mus musculus BAC clone RP23-55I3 from chromosome 7, complete sequence
          Length = 266043

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 153    ccaccgagtgtatcctgcacag 174
              ||||||||||||||||||||||
Sbjct: 136123 ccaccgagtgtatcctgcacag 136144



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 135968 ccgagtgtatcctgcacagg 135987



to top

>gb|AC164643.4| Mus musculus BAC clone RP23-254F23 from chromosome 7, complete sequence
          Length = 232098

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 59942 ccaccgagtgtatcctgcacag 59963



to top

>gb|AC161495.3| Mus musculus chromosome 5, clone RP23-393A24, complete sequence
          Length = 194459

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 52086 ccaccgagtgtatcctgcacag 52107



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 52206 ccgagtgtatcctgcacagg 52225



to top

>gb|AC171200.1| Mus musculus BAC clone RP24-423F5 from chromosome 13, complete sequence
          Length = 170621

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 16282 ccaccgagtgtatcctgcacag 16261



to top

>gb|AC170803.2| Mus musculus BAC clone RP24-418J23 from chromosome 7, complete sequence
          Length = 208499

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 153    ccaccgagtgtatcctgcacag 174
              ||||||||||||||||||||||
Sbjct: 154818 ccaccgagtgtatcctgcacag 154839



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 154663 ccgagtgtatcctgcacagg 154682



to top

>emb|X13049.1|MMPG14LH Murine DNA for cytoskeletal gamma-actin pseudogene and L1Md-14LH
            repetitive sequence
          Length = 5638

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 153  ccaccgagtgtatcctgcacag 174
            ||||||||||||||||||||||
Sbjct: 2299 ccaccgagtgtatcctgcacag 2320



to top

>gb|AC161259.2| Mus musculus BAC clone RP23-465D18 from chromosome 9, complete sequence
          Length = 175659

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 84157 ccaccgagtgtatcctgcacag 84136



to top

>gb|AC163692.4| Mus musculus BAC clone RP24-68H1 from chromosome 14, complete sequence
          Length = 224333

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 153    ccaccgagtgtatcctgcacag 174
              ||||||||||||||||||||||
Sbjct: 121207 ccaccgagtgtatcctgcacag 121228



to top

>gb|AC165077.3| Mus musculus BAC clone RP24-369J8 from chromosome 7, complete sequence
          Length = 179228

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 16080 ccaccgagtgtatcctgcacag 16059



to top

>emb|AL672208.11| Mouse DNA sequence from clone RP23-318H23 on chromosome 9, complete
             sequence
          Length = 117535

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 15955 ccaccgagtgtatcctgcacag 15934



to top

>emb|AL645793.14| Mouse DNA sequence from clone RP23-480H2 on chromosome 1, complete
             sequence
          Length = 93900

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 153   ccaccgagtgtatcctgcacag 174
             ||||||||||||||||||||||
Sbjct: 30493 ccaccgagtgtatcctgcacag 30514



to top

>gb|AC124405.4| Mus musculus BAC clone RP24-372I6 from chromosome 6, complete sequence
          Length = 153417

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 155   accgagtgtatcctgcacagg 175
             |||||||||||||||||||||
Sbjct: 13686 accgagtgtatcctgcacagg 13666



to top

>emb|AL109985.5|CNS018P2 Human chromosome 14 DNA sequence BAC R-370E23 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 186548

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 270   aggaagagcagaaagtagtggtttc 294
             |||||||||||||||||| ||||||
Sbjct: 31759 aggaagagcagaaagtaggggtttc 31735



to top

>ref|NM_053885.1| Rattus norvegicus arginine-glutamic acid dipeptide (RE) repeats
           (Rere), mRNA
          Length = 6659

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 265 ccgccaggaagagcagaaag 284
           ||||||||||||||||||||
Sbjct: 793 ccgccaggaagagcagaaag 812



to top

>gb|AC165367.5| Mus musculus BAC clone RP23-23P3 from chromosome 5, complete sequence
          Length = 234584

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 68334 ccgagtgtatcctgcacagg 68353



to top

>gb|AC122869.4| Mus musculus BAC clone RP23-101O19 from chromosome 7, complete sequence
          Length = 198531

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 190949 ccgagtgtatcctgcacagg 190968



to top

>gb|AC156561.3| Mus musculus BAC clone RP24-264F22 from chromosome 14, complete
             sequence
          Length = 170677

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 15184 ccgagtgtatcctgcacagg 15203



to top

>gb|AC164085.3| Mus musculus BAC clone RP23-205G24 from chromosome 5, complete sequence
          Length = 235124

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 187211 ccgagtgtatcctgcacagg 187230



to top

>gb|AC154623.2| Mus musculus BAC clone RP23-327K7 from chromosome 13, complete sequence
          Length = 190884

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 203    catacgacgggaagatcaac 222
              ||||||||||||||||||||
Sbjct: 165541 catacgacgggaagatcaac 165522



to top

>gb|AC167199.2| Mus musculus BAC clone RP23-324E10 from chromosome 7, complete sequence
          Length = 203123

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 13984 ccgagtgtatcctgcacagg 13965



to top

>gb|AC149084.5| Mus musculus BAC clone RP23-173A12 from chromosome 19, complete sequence
          Length = 188848

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 179853 ccgagtgtatcctgcacagg 179834



to top

>gb|AC154788.2| Mus musculus BAC clone RP24-470E2 from chromosome 13, complete sequence
          Length = 158761

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 144505 ccgagtgtatcctgcacagg 144486



to top

>gb|AC104856.19| Mus musculus chromosome 5, clone RP23-53G23, complete sequence
          Length = 169800

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 156  ccgagtgtatcctgcacagg 175
            ||||||||||||||||||||
Sbjct: 7335 ccgagtgtatcctgcacagg 7316



to top

>gb|AC158594.12| Mus musculus 10 BAC RP23-197I5 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 218257

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 36578 ccgagtgtatcctgcacagg 36597



to top

>gb|AC147263.3| Mus musculus BAC clone RP24-213I13 from chromosome 13, complete
             sequence
          Length = 182371

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 97995 ccgagtgtatcctgcacagg 98014



to top

>gb|BC016224.1| Mus musculus neurolysin (metallopeptidase M3 family), mRNA (cDNA
            clone MGC:28773 IMAGE:4486941), complete cds
          Length = 3991

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 203  catacgacgggaagatcaac 222
            ||||||||||||||||||||
Sbjct: 1183 catacgacgggaagatcaac 1202



to top

>gb|AC125189.4| Mus musculus BAC clone RP23-280K1 from chromosome 7, complete sequence
          Length = 192628

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 19032 ccgagtgtatcctgcacagg 19051



to top

>gb|AC111090.20| Mus musculus chromosome 5, clone RP23-161K8, complete sequence
          Length = 204356

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 30455 ccgagtgtatcctgcacagg 30474



to top

>gb|AC147564.2| Mus musculus BAC clone RP23-123H4 from chromosome 7, complete sequence
          Length = 201977

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 109574 ccgagtgtatcctgcacagg 109555



to top

>gb|AC127227.3| Mus musculus BAC clone RP24-505M10 from chromosome 7, complete sequence
          Length = 151643

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 43574 ccgagtgtatcctgcacagg 43593



to top

>gb|CP000080.1| Leishmania major strain Friedlin chromosome 29, complete sequence
          Length = 1212674

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 349   tcttcacaaggaacacgccagtgc 372
             |||||||||| |||||||||||||
Sbjct: 10951 tcttcacaagaaacacgccagtgc 10928



to top

>gb|AC163494.3| Mus musculus chromosome 7, clone RP23-221O21, complete sequence
          Length = 193210

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 99741 ccgagtgtatcctgcacagg 99722



to top

>gb|AC110883.12| Mus musculus chromosome 8, clone RP23-200N24, complete sequence
          Length = 293104

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 242899 ccgagtgtatcctgcacagg 242880



to top

>gb|AC164084.5| Mus musculus BAC clone RP23-15P15 from chromosome 5, complete sequence
          Length = 199368

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 187210 ccgagtgtatcctgcacagg 187229



to top

>gb|AC165341.2| Mus musculus BAC clone RP24-105C4 from chromosome 5, complete sequence
          Length = 186765

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 48321 ccgagtgtatcctgcacagg 48340



to top

>gb|AC165287.2| Mus musculus BAC clone RP24-230H12 from chromosome 14, complete sequence
          Length = 161004

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 158054 ccgagtgtatcctgcacagg 158073



to top

>gb|AC154905.5| Mus musculus BAC clone RP23-369A18 from chromosome 7, complete sequence
          Length = 213905

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 125957 ccgagtgtatcctgcacagg 125938



to top

>gb|BC025520.1| Mus musculus neurolysin (metallopeptidase M3 family), mRNA (cDNA
           clone IMAGE:5322307), partial cds
          Length = 1382

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 203 catacgacgggaagatcaac 222
           ||||||||||||||||||||
Sbjct: 69  catacgacgggaagatcaac 88



to top

>gb|AC145549.3| Mus musculus BAC clone RP23-21M23 from chromosome 19, complete sequence
          Length = 247655

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 238612 ccgagtgtatcctgcacagg 238593



to top

>gb|AC144861.3| Mus musculus BAC clone RP23-63D4 from chromosome 18, complete sequence
          Length = 176312

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 59881 ccgagtgtatcctgcacagg 59900



to top

>gb|AC141926.3| Mus musculus BAC clone RP23-299D9 from chromosome 5, complete sequence
          Length = 204518

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 161729 ccgagtgtatcctgcacagg 161710



to top

>emb|CT025689.6| Mouse DNA sequence from clone RP24-236L7 on chromosome 14, complete
             sequence
          Length = 177482

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 60308 ccgagtgtatcctgcacagg 60289



to top

>gb|AC101818.9| Mus musculus chromosome 7, clone RP24-363I8, complete sequence
          Length = 137430

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 44935 ccgagtgtatcctgcacagg 44954



to top

>gb|AC129327.4| Mus musculus BAC clone RP23-159J2 from chromosome 13, complete sequence
          Length = 184475

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 144673 ccgagtgtatcctgcacagg 144654



to top

>gb|AC122819.4| Mus musculus BAC clone RP23-197L11 from chromosome 7, complete sequence
          Length = 201354

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 120515 ccgagtgtatcctgcacagg 120496



to top

>gb|AC122286.4| Mus musculus BAC clone RP23-252F4 from chromosome 6, complete
            sequence
          Length = 178633

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 156  ccgagtgtatcctgcacagg 175
            ||||||||||||||||||||
Sbjct: 2719 ccgagtgtatcctgcacagg 2700



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 156  ccgagtgtatcctgcacagg 175
            ||||||||||||||||||||
Sbjct: 2602 ccgagtgtatcctgcacagg 2583



to top

>gb|AC124452.4| Mus musculus BAC clone RP24-219N2 from chromosome 7, complete sequence
          Length = 177600

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 155664 ccgagtgtatcctgcacagg 155683



to top

>gb|AC121923.3| Mus musculus BAC clone RP24-198O18 from chromosome 8, complete sequence
          Length = 172772

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 110163 ccgagtgtatcctgcacagg 110182



to top

>gb|AC121836.2| Mus musculus BAC clone RP24-73L11 from 8, complete sequence
          Length = 195192

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 144986 ccgagtgtatcctgcacagg 144967



to top

>gb|AC159740.3| Mus musculus BAC clone RP23-427E11 from chromosome 7, complete sequence
          Length = 186935

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 28503 ccgagtgtatcctgcacagg 28522



to top

>gb|AC158615.6| Mus musculus 10 BAC RP23-256B24 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 217393

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 210972 ccgagtgtatcctgcacagg 210991



to top

>gb|AC155276.3| Mus musculus BAC clone RP23-26E18 from chromosome 8, complete sequence
          Length = 234359

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 229579 ccgagtgtatcctgcacagg 229598



to top

>emb|BX005206.15| Mouse DNA sequence from clone RP23-384P3 on chromosome X, complete
             sequence
          Length = 202812

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 29997 ccgagtgtatcctgcacagg 30016



to top

>gb|AC091988.3| Homo sapiens chromosome 5 clone RP11-73G8, complete sequence
          Length = 148263

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 241   agaacagcatcgggaactgc 260
             ||||||||||||||||||||
Sbjct: 15755 agaacagcatcgggaactgc 15736



to top

>dbj|AK138399.1| Mus musculus adult male hypothalamus cDNA, RIKEN full-length enriched
            library, clone:A230093D09 product:neurolysin
            (metallopeptidase M3 family), full insert sequence
          Length = 2487

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 203  catacgacgggaagatcaac 222
            ||||||||||||||||||||
Sbjct: 1183 catacgacgggaagatcaac 1202



to top

>dbj|AK146364.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
            clone:I730061N04 product:neurolysin (metallopeptidase M3
            family), full insert sequence
          Length = 4111

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 203  catacgacgggaagatcaac 222
            ||||||||||||||||||||
Sbjct: 1159 catacgacgggaagatcaac 1178



to top

>gb|AC144923.7| Mus musculus chromosome 7, clone RP23-366A16, complete sequence
          Length = 177745

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 142418 ccgagtgtatcctgcacagg 142437



to top

>dbj|AK170508.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
            full-length enriched library, clone:F630106E01
            product:neurolysin (metallopeptidase M3 family), full
            insert sequence
          Length = 2519

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 203  catacgacgggaagatcaac 222
            ||||||||||||||||||||
Sbjct: 1211 catacgacgggaagatcaac 1230



to top

>dbj|AK171432.1| Mus musculus B6-derived CD11 +ve dendritic cells cDNA, RIKEN
            full-length enriched library, clone:F730215F23
            product:neurolysin (metallopeptidase M3 family), full
            insert sequence
          Length = 2519

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 203  catacgacgggaagatcaac 222
            ||||||||||||||||||||
Sbjct: 1211 catacgacgggaagatcaac 1230



to top

>gb|AC156562.3| Mus musculus BAC clone RP24-286J19 from chromosome 14, complete
             sequence
          Length = 149578

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 58537 ccgagtgtatcctgcacagg 58556



to top

>dbj|AK079090.1| Mus musculus adult male diencephalon cDNA, RIKEN full-length enriched
            library, clone:9330168G16 product:NEUROLYSIN,
            MITOCHONDRIAL PRECURSOR (EC 3.4.24.16) (NEUROTENSIN
            ENDOPEPTIDASE) (MITOCHONDRIAL OLIGOPEPTIDASE M)
            (MICROSOMAL ENDOPEPTIDASE) (MEP) homolog [Rattus
            norvegicus], full insert sequence
          Length = 3781

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 203  catacgacgggaagatcaac 222
            ||||||||||||||||||||
Sbjct: 1211 catacgacgggaagatcaac 1230



to top

>gb|U44091.1|RNU44091 Rattus norvegicus atrophin-1 related protein (rARP) mRNA, complete
           cds
          Length = 6659

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 265 ccgccaggaagagcagaaag 284
           ||||||||||||||||||||
Sbjct: 793 ccgccaggaagagcagaaag 812



to top

>gb|AC083909.20|AC083909 Mus musculus 1 BAC RP23-424A2 (Roswell Park Cancer Institute Mouse BAC
             Library) complete sequence
          Length = 204857

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 89464 ccgagtgtatcctgcacagg 89483



to top

>gb|AC026797.3|AC026797 Homo sapiens chromosome 5 clone CTD-2299N12, complete sequence
          Length = 172043

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 241   agaacagcatcgggaactgc 260
             ||||||||||||||||||||
Sbjct: 49546 agaacagcatcgggaactgc 49565



to top

>gb|AC154226.3| Mus musculus BAC clone RP24-353J14 from chromosome 13, complete sequence
          Length = 196991

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 179001 ccgagtgtatcctgcacagg 179020



to top

>gb|AC130530.4| Mus musculus BAC clone RP23-153P2 from chromosome 7, complete sequence
          Length = 202012

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 16565 ccgagtgtatcctgcacagg 16584



to top

>gb|AC007391.3| Homo sapiens BAC clone RP11-429J10 from 2, complete sequence
          Length = 183991

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 3     tatcctaagtgaccatagtt 22
             ||||||||||||||||||||
Sbjct: 34498 tatcctaagtgaccatagtt 34517



to top

>ref|NM_029447.1| Mus musculus neurolysin (metallopeptidase M3 family) (Nln), mRNA
          Length = 3991

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 203  catacgacgggaagatcaac 222
            ||||||||||||||||||||
Sbjct: 1183 catacgacgggaagatcaac 1202



to top

>gb|AE014133.1| Streptococcus mutans UA159, complete genome
          Length = 2030921

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 515     cagcaaacctttgatgagga 534
               ||||||||||||||||||||
Sbjct: 1828805 cagcaaacctttgatgagga 1828786



to top

>gb|AC125465.4| Mus musculus BAC clone RP23-333A16 from chromosome unknown, complete
             sequence
          Length = 207988

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 51259 ccgagtgtatcctgcacagg 51278



to top

>emb|BX119968.5| Mouse DNA sequence from clone RP23-375D12 on chromosome X, complete
             sequence
          Length = 190433

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 31157 ccgagtgtatcctgcacagg 31138



to top

>gb|AC124754.5| Mus musculus BAC clone RP23-285C16 from 5, complete sequence
          Length = 183009

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 101833 ccgagtgtatcctgcacagg 101814



to top

>gb|AC153642.7| Mus musculus 6 BAC RP23-334E23 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 227781

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 172909 ccgagtgtatcctgcacagg 172890



to top

>gb|AC153933.3| Mus musculus 10 BAC RP24-282I24 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 179847

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 100460 ccgagtgtatcctgcacagg 100479



to top

>gb|AC153520.3| Mus musculus 10 BAC RP23-144O19 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 207519

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 178587 ccgagtgtatcctgcacagg 178606



to top

>gb|AC113061.9| Mus musculus chromosome 14, clone RP23-255H22, complete sequence
          Length = 190623

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 72911 ccgagtgtatcctgcacagg 72930



to top

>emb|BX284680.6| Mouse DNA sequence from clone RP23-260E20 on chromosome X, complete
              sequence
          Length = 168173

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 155    accgagtgtatcctgcacag 174
              ||||||||||||||||||||
Sbjct: 164097 accgagtgtatcctgcacag 164116



to top

>emb|AL772352.8| Mouse DNA sequence from clone RP23-147F6 on chromosome 2, complete
             sequence
          Length = 204438

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 71410 ccgagtgtatcctgcacagg 71391



to top

>gb|AC170878.4| Mus musculus BAC clone RP24-226F17 from chromosome 19, complete sequence
          Length = 148454

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 117593 ccgagtgtatcctgcacagg 117574



to top

>gb|AC154216.1| Mus musculus BAC clone RP24-354I21 from 13, complete sequence
          Length = 209934

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 203    catacgacgggaagatcaac 222
              ||||||||||||||||||||
Sbjct: 202577 catacgacgggaagatcaac 202596



to top

>gb|AC133196.6| Mus musculus BAC clone RP23-173B14 from 5, complete sequence
          Length = 201514

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 33878 ccgagtgtatcctgcacagg 33897



to top

>gb|AC133199.3| Mus musculus BAC clone RP23-263B18 from 6, complete sequence
          Length = 185278

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 49146 ccgagtgtatcctgcacagg 49165



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 49029 ccgagtgtatcctgcacagg 49048



to top

>gb|AC112264.6| Mus musculus BAC clone RP23-421E18 from 1, complete sequence
          Length = 185468

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 69742 ccgagtgtatcctgcacagg 69723



to top

>gb|AC132383.5| Mus musculus BAC clone RP23-434M19 from 10, complete sequence
          Length = 212242

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 172280 ccgagtgtatcctgcacagg 172261



to top

>gb|AC173342.1| Mus musculus BAC clone RP23-429O4 from chromosome 7, complete sequence
          Length = 202474

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 92400 ccgagtgtatcctgcacagg 92381



to top

>gb|AC171682.2| Mus musculus BAC clone RP24-101E7 from chromosome 7, complete sequence
          Length = 228837

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 172095 ccgagtgtatcctgcacagg 172114



to top

>gb|AC112976.8| Mus musculus chromosome 7, clone RP24-475E2, complete sequence
          Length = 167823

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 151   aaccaccgagtgtatcctgcacag 174
             |||| |||||||||||||||||||
Sbjct: 44822 aaccgccgagtgtatcctgcacag 44799



to top

>gb|AC169123.3| Mus musculus BAC clone RP23-99L11 from chromosome 7, complete sequence
          Length = 205496

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 69231 ccgagtgtatcctgcacagg 69250



to top

>emb|AL805901.6| Mouse DNA sequence from clone RP23-24K4 on chromosome X, complete
             sequence
          Length = 243012

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 23711 ccgagtgtatcctgcacagg 23692



to top

>emb|AL807399.5| Mouse DNA sequence from clone RP23-382O11 on chromosome 4, complete
              sequence
          Length = 181004

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 156    ccgagtgtatcctgcacagg 175
              ||||||||||||||||||||
Sbjct: 134543 ccgagtgtatcctgcacagg 134562



to top

>emb|AL731810.20| Mouse DNA sequence from clone RP23-465B20 on chromosome 4, complete
             sequence
          Length = 173609

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 70244 ccgagtgtatcctgcacagg 70263



to top

>emb|AL929054.5| Mouse DNA sequence from clone RP23-454A14 on chromosome 2, complete
             sequence
          Length = 198497

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 81926 ccgagtgtatcctgcacagg 81945



to top

>gb|AC162924.5| Mus musculus BAC clone RP23-292J21 from chromosome 6, complete sequence
          Length = 179209

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   ccgagtgtatcctgcacagg 175
             ||||||||||||||||||||
Sbjct: 63414 ccgagtgtatcctgcacagg 63433


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,966,849
Number of Sequences: 3902068
Number of extensions: 4966849
Number of successful extensions: 85823
Number of sequences better than 10.0: 177
Number of HSP's better than 10.0 without gapping: 177
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 85149
Number of HSP's gapped (non-prelim): 667
length of query: 693
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 670
effective length of database: 17,143,297,704
effective search space: 11486009461680
effective search space used: 11486009461680
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top