>ref|XM_465742.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 932

 Score = 48.1 bits (24), Expect = 0.008
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 115 gctgtggcacccttgcccttcttnttctggagctt 149
           |||| ||||||||||||||||||  ||||||||||
Sbjct: 744 gctgaggcacccttgcccttcttcctctggagctt 710

>ref|XM_506804.1| PREDICTED Oryza sativa (japonica cultivar-group), P0483C08.42 mRNA
          Length = 942

 Score = 48.1 bits (24), Expect = 0.008
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 115 gctgtggcacccttgcccttcttnttctggagctt 149
           |||| ||||||||||||||||||  ||||||||||
Sbjct: 746 gctgaggcacccttgcccttcttcctctggagctt 712

>gb|AC171266.22| Medicago truncatula clone mth2-14o4, complete sequence
          Length = 137052

 Score = 48.1 bits (24), Expect = 0.008
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 120   ggcacccttgcccttcttnttctggag 146
             |||||||||||||||||| ||||||||
Sbjct: 56155 ggcacccttgcccttcttcttctggag 56129

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 48.1 bits (24), Expect = 0.008
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                   
Query: 115      gctgtggcacccttgcccttcttnttctggagctt 149
                |||| ||||||||||||||||||  ||||||||||
Sbjct: 17137681 gctgaggcacccttgcccttcttcctctggagctt 17137647

>dbj|AP004837.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0483C08
          Length = 143855

 Score = 48.1 bits (24), Expect = 0.008
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                 
Query: 115    gctgtggcacccttgcccttcttnttctggagctt 149
              |||| ||||||||||||||||||  ||||||||||
Sbjct: 119054 gctgaggcacccttgcccttcttcctctggagctt 119020

>dbj|AP004864.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
            clone:OSJNBa0048K16
          Length = 159891

 Score = 48.1 bits (24), Expect = 0.008
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 115  gctgtggcacccttgcccttcttnttctggagctt 149
            |||| ||||||||||||||||||  ||||||||||
Sbjct: 8448 gctgaggcacccttgcccttcttcctctggagctt 8414

>dbj|AK102757.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033107B18, full
           insert sequence
          Length = 932

 Score = 48.1 bits (24), Expect = 0.008
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 115 gctgtggcacccttgcccttcttnttctggagctt 149
           |||| ||||||||||||||||||  ||||||||||
Sbjct: 744 gctgaggcacccttgcccttcttcctctggagctt 710

>dbj|AK102402.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033092J19, full
           insert sequence
          Length = 940

 Score = 48.1 bits (24), Expect = 0.008
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 115 gctgtggcacccttgcccttcttnttctggagctt 149
           |||| ||||||||||||||||||  ||||||||||
Sbjct: 744 gctgaggcacccttgcccttcttcctctggagctt 710

>dbj|D38010.1|RICRPS8 Oryza sativa (japonica cultivar-group) mRNA for ribosomal protein
           S8, complete cds
          Length = 849

 Score = 48.1 bits (24), Expect = 0.008
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 115 gctgtggcacccttgcccttcttnttctggagctt 149
           |||| ||||||||||||||||||  ||||||||||
Sbjct: 714 gctgaggcacccttgcccttcttcctctggagctt 680

>gb|AY643843.1|AY643842S2 Hordeum vulgare subsp. vulgare clones BAC 519K7 and 799C8 hardness
             locus region
          Length = 129099

 Score = 46.1 bits (23), Expect = 0.030
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 115   gctgtggcacccttgcccttctt 137
             |||||||||||||||||||||||
Sbjct: 74208 gctgtggcacccttgcccttctt 74230

>ref|NM_122036.2| Arabidopsis thaliana structural constituent of ribosome AT5G20290
           mRNA, complete cds
          Length = 934

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 121 gcacccttgcccttcttnttctgga 145
           ||||||||||||||||| |||||||
Sbjct: 713 gcacccttgcccttcttcttctgga 689

>gb|AY091172.1| Arabidopsis thaliana unknown protein (At5g20290) mRNA, complete cds
          Length = 700

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 121 gcacccttgcccttcttnttctgga 145
           ||||||||||||||||| |||||||
Sbjct: 662 gcacccttgcccttcttcttctgga 638

>gb|AY050937.1| Arabidopsis thaliana unknown protein (At5g20290) mRNA, complete cds
          Length = 940

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 121 gcacccttgcccttcttnttctgga 145
           ||||||||||||||||| |||||||
Sbjct: 703 gcacccttgcccttcttcttctgga 679

>gb|AY061909.1| Arabidopsis thaliana AT5g20290/F5O24_180 mRNA, complete cds
          Length = 669

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 121 gcacccttgcccttcttnttctgga 145
           ||||||||||||||||| |||||||
Sbjct: 662 gcacccttgcccttcttcttctgga 638

>dbj|AK220812.1| Arabidopsis thaliana mRNA for hypothetical protein, partial cds,
           clone: RAFL22-30-P17
          Length = 373

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 121 gcacccttgcccttcttnttctgga 145
           ||||||||||||||||| |||||||
Sbjct: 181 gcacccttgcccttcttcttctgga 157

>gb|AY052338.1| Arabidopsis thaliana AT5g20290/F5O24_180 mRNA, complete cds
          Length = 895

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 121 gcacccttgcccttcttnttctgga 145
           ||||||||||||||||| |||||||
Sbjct: 713 gcacccttgcccttcttcttctgga 689

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                             
Query: 121      gcacccttgcccttcttnttctggagctt 149
                |||||||||||||||||  ||||||||||
Sbjct: 16659496 gcacccttgcccttcttcctctggagctt 16659524

>emb|BX830341.1|CNS0A1HO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB74ZD08 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 660

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 121 gcacccttgcccttcttnttctgga 145
           ||||||||||||||||| |||||||
Sbjct: 475 gcacccttgcccttcttcttctgga 451

>emb|BX829884.1|CNS0A1CS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB43ZC05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 881

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 121 gcacccttgcccttcttnttctgga 145
           ||||||||||||||||| |||||||
Sbjct: 697 gcacccttgcccttcttcttctgga 673

>emb|BX829620.1|CNS0A1JH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB25ZC11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 881

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 121 gcacccttgcccttcttnttctgga 145
           ||||||||||||||||| |||||||
Sbjct: 697 gcacccttgcccttcttcttctgga 673

>emb|BX831734.1|CNS0A135 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH26ZH03 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 867

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 121 gcacccttgcccttcttnttctgga 145
           ||||||||||||||||| |||||||
Sbjct: 683 gcacccttgcccttcttcttctgga 659

>gb|AY086963.1| Arabidopsis thaliana clone 29997 mRNA, complete sequence
          Length = 895

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 121 gcacccttgcccttcttnttctgga 145
           ||||||||||||||||| |||||||
Sbjct: 713 gcacccttgcccttcttcttctgga 689

>gb|AF296825.1|F5O24 Arabidopsis thaliana BAC F5O24
          Length = 101458

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 121   gcacccttgcccttcttnttctgga 145
             ||||||||||||||||| |||||||
Sbjct: 56105 gcacccttgcccttcttcttctgga 56129

>dbj|AK068316.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013151C04, full
           insert sequence
          Length = 1022

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 121 gcacccttgcccttcttnttctggagctt 149
           |||||||||||||||||  ||||||||||
Sbjct: 754 gcacccttgcccttcttcctctggagctt 726

>gb|BT016841.1| Zea mays clone Contig674 mRNA sequence
          Length = 989

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 122 cacccttgcccttcttnttctggagctt 149
           ||||||||||||||||  ||||||||||
Sbjct: 756 cacccttgcccttcttcctctggagctt 729

>gb|AY105565.1| Zea mays PCO103958 mRNA sequence
          Length = 1091

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 122 cacccttgcccttcttnttctggagctt 149
           ||||||||||||||||  ||||||||||
Sbjct: 775 cacccttgcccttcttcctctggagctt 748

>ref|XM_764787.1| Giardia lamblia ATCC 50803 hypothetical protein
           (GLP_741_48438_49151) partial mRNA
          Length = 714

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 73  agaaaacccaacgaggtaa 91
           |||||||||||||||||||
Sbjct: 239 agaaaacccaacgaggtaa 221

>ref|XM_764788.1| Giardia lamblia ATCC 50803 hypothetical protein
           (GLP_741_49021_48566) partial mRNA
          Length = 456

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 73  agaaaacccaacgaggtaa 91
           |||||||||||||||||||
Sbjct: 346 agaaaacccaacgaggtaa 364


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 508,127
Number of Sequences: 3902068
Number of extensions: 508127
Number of successful extensions: 27981
Number of sequences better than 10.0: 28
Number of HSP's better than 10.0 without gapping: 28
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 27931
Number of HSP's gapped (non-prelim): 50
length of query: 153
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 132
effective length of database: 17,151,101,840
effective search space: 2263945442880
effective search space used: 2263945442880
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)