| Clone Name | rbags21d13 |
|---|---|
| Clone Library Name | barley_pub |
>emb|CR762497.17| Zebrafish DNA sequence from clone DKEY-162B3 in linkage group 13, complete sequence Length = 258636 Score = 42.1 bits (21), Expect = 0.66 Identities = 21/21 (100%) Strand = Plus / Minus Query: 59 acattaacagttcagcaactt 79 ||||||||||||||||||||| Sbjct: 202672 acattaacagttcagcaactt 202652
>emb|BX001007.6| Zebrafish DNA sequence from clone DKEY-97C13, complete sequence Length = 113198 Score = 42.1 bits (21), Expect = 0.66 Identities = 21/21 (100%) Strand = Plus / Minus Query: 59 acattaacagttcagcaactt 79 ||||||||||||||||||||| Sbjct: 73895 acattaacagttcagcaactt 73875
>ref|XM_475671.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 366 Score = 40.1 bits (20), Expect = 2.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 128 ccgacacggtacaccaatgccaca 151 |||| ||||||||||||||||||| Sbjct: 132 ccgaaacggtacaccaatgccaca 109
>gb|AC130601.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0108E17, complete sequence Length = 139829 Score = 40.1 bits (20), Expect = 2.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 128 ccgacacggtacaccaatgccaca 151 |||| ||||||||||||||||||| Sbjct: 69596 ccgaaacggtacaccaatgccaca 69619
>emb|CR388161.7| Zebrafish DNA sequence from clone CH211-288B17 in linkage group 18, complete sequence Length = 80508 Score = 40.1 bits (20), Expect = 2.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 52 aacaaagacattaacagttc 71 |||||||||||||||||||| Sbjct: 7268 aacaaagacattaacagttc 7249
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 40.1 bits (20), Expect = 2.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 128 ccgacacggtacaccaatgccaca 151 |||| ||||||||||||||||||| Sbjct: 25000743 ccgaaacggtacaccaatgccaca 25000766
>gb|AC135673.5| Mus musculus BAC clone RP24-279A17 from 16, complete sequence Length = 173965 Score = 40.1 bits (20), Expect = 2.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 96 acacacccaaacaaaacagc 115 |||||||||||||||||||| Sbjct: 100954 acacacccaaacaaaacagc 100935
>gb|AC140983.4| Mus musculus BAC clone RP23-167M17 from 18, complete sequence Length = 193004 Score = 40.1 bits (20), Expect = 2.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 50 ccaacaaagacattaacagt 69 |||||||||||||||||||| Sbjct: 149728 ccaacaaagacattaacagt 149709 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,712,290 Number of Sequences: 3902068 Number of extensions: 1712290 Number of successful extensions: 103900 Number of sequences better than 10.0: 8 Number of HSP's better than 10.0 without gapping: 8 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 103858 Number of HSP's gapped (non-prelim): 42 length of query: 206 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 184 effective length of database: 17,147,199,772 effective search space: 3155084758048 effective search space used: 3155084758048 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)