| Clone Name | rbags20o13 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AB181482.1| Bromus inermis BiRP1 mRNA for ribosomal protein, complete cds Length = 1053 Score = 930 bits (469), Expect = 0.0 Identities = 615/657 (93%), Gaps = 5/657 (0%) Strand = Plus / Minus Query: 25 taaacatccacattacatctagcagcatccatgggttcgcaaatcaacaaacatcaggca 84 ||||||||||||||||||||||||||| |||||||||| ||| ||||||||||||||||| Sbjct: 1036 taaacatccacattacatctagcagcaaccatgggttcacaattcaacaaacatcaggca 977 Query: 85 aaacttaaaaaagatggttccaggaacatagttctatatccttgcagataactggctata 144 ||| ||||||| ||||||||||| ||||||||||||||||||| |||||||||||||||| Sbjct: 976 aaatttaaaaacgatggttccagaaacatagttctatatcctt-cagataactggctata 918 Query: 145 gcaaaacgactcaatgcctcagaatcaggccttggcagcagcctgagctgcggcatccct 204 ||||||||| |||| |||||||||||||||||||||||| ||||| || ||||||||||| Sbjct: 917 gcaaaacgaatcaacgcctcagaatcaggccttggcagctgcctgggcagcggcatccct 858 Query: 205 cttcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcaccca 264 |||||||||||||||||||||||| ||||||||||| ||||||||||||||| ||||||| Sbjct: 857 cttcctctgctcctcaatgatggtcagcttgatacctttgcccttggggagggtcaccca 798 Query: 265 aggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggtgacc 324 ||||||||||||||||| ||||||||||| ||||| ||||||||||| ||||||||||| Sbjct: 797 cggcttggtgcccttgccgatggtgaacacattgcctagacgggtggcgaactggtgacc 738 Query: 325 ctgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgat 384 ||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 737 ctgagcatcctcaacgtggatggtctcgaaggttcccttatgcttctccctgttcttgat 678 Query: 385 cacaccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaa 444 |||||||||||| |||||||| ||||||||||| |||||||| || ||| || || |||| Sbjct: 677 cacaccaacacggccagtgttacgcccaccagtaaccatgacaacattg-ccaacatcaa 619 Query: 445 acttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgttggcct 504 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Sbjct: 618 acttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcattggcct 559 Query: 505 tgatgagtgggtctgggtagcggatggtgcggccatcattaggtgttcaggtatgggatg 564 ||||||||||||| ||||||||||||||||| |||||||| |||||| ||||||||||| Sbjct: 558 tgatgagtgggtcagggtagcggatggtgcgaccatcatt-ggtgttgaggtatgggata 500 Query: 565 cccttctggccgaactggacagacctgaccttgcagagcttgaacttagcatcctcatcc 624 ||||||||||| |||||||||||||||||||||||||||||| |||| |||||||||||| Sbjct: 499 cccttctggccaaactggacagacctgaccttgcagagcttgtacttggcatcctcatcc 440 Query: 625 ctgacagagtgaaggcggaagcggccctttggtgtcatacagaagccctgtagttct 681 ||||||||||| ||||||||||||||| ||||||||||||||||| ||||||||||| Sbjct: 439 ctgacagagtgcaggcggaagcggccc-ttggtgtcatacagaag-cctgtagttct 385
>dbj|AK103949.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B09, full insert sequence Length = 1016 Score = 543 bits (274), Expect = e-151 Identities = 452/506 (89%), Gaps = 4/506 (0%) Strand = Plus / Minus Query: 176 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 235 |||||||||||||| || || ||||||| |||||| |||||||| |||||| |||||||| Sbjct: 886 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 827 Query: 236 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 295 || |||||||||||||| |||||||||||||||||| |||||||||||||||||||||| Sbjct: 826 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 767 Query: 296 ttgcccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaag 355 ||||||||||||||||| || ||||| ||| ||||||||||||||||||||||||| ||| Sbjct: 766 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 707 Query: 356 gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 415 | || ||||||||||||||||||||||||||||||||||| || ||||| | || ||| Sbjct: 706 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 647 Query: 416 gtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaacaatcttgttggtctc 475 ||||||||||| || ||| || || ||||||||||||||||| ||||||||||||||||| Sbjct: 646 gtcaccatgacaacattg-ccaacatcaaacttgatgaagtcgacaatcttgttggtctc 588 Query: 476 caggtcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcg 535 ||| |||| |||||| |||||||| |||||||||| ||||| ||||||||||||||||| Sbjct: 587 cagatcgatcttgattgtgtcgtttgccttgatgatcgggtcagggtagcggatggtgcg 528 Query: 536 gccatcattaggtgttcaggtatgggatgcccttctggccgaactggacagacctgacct 595 |||||| |||||||||||||| ||||| ||||||||||| ||||| ||||||| |||| Sbjct: 527 accatca-taggtgttcaggtaggggattcccttctggccaaactgcacagaccgaacct 469 Query: 596 tgcagagcttgaacttagcatcctcatccctgacagagtgaaggcggaagcggccctttg 655 |||| |||||||||||||||||||||||| ||||||| ||||||||||| || ||| ||| Sbjct: 468 tgcaaagcttgaacttagcatcctcatccttgacagactgaaggcggaaacgtccc-ttg 410 Query: 656 gtgtcatacagaagccctgtagttct 681 ||||| |||||||| ||||||||||| Sbjct: 409 gtgtcgtacagaag-cctgtagttct 385 Score = 56.0 bits (28), Expect = 2e-04 Identities = 37/40 (92%) Strand = Plus / Minus Query: 112 atagttctatatccttgcagataactggctatagcaaaac 151 ||||||||||||||||||| | |||| ||||||||||||| Sbjct: 957 atagttctatatccttgcaaacaactcgctatagcaaaac 918
>dbj|AK102423.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033093E13, full insert sequence Length = 1157 Score = 543 bits (274), Expect = e-151 Identities = 452/506 (89%), Gaps = 4/506 (0%) Strand = Plus / Minus Query: 176 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 235 |||||||||||||| || || ||||||| |||||| |||||||| |||||| |||||||| Sbjct: 890 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 831 Query: 236 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 295 || |||||||||||||| |||||||||||||||||| |||||||||||||||||||||| Sbjct: 830 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 771 Query: 296 ttgcccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaag 355 ||||||||||||||||| || ||||| ||| ||||||||||||||||||||||||| ||| Sbjct: 770 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 711 Query: 356 gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 415 | || ||||||||||||||||||||||||||||||||||| || ||||| | || ||| Sbjct: 710 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 651 Query: 416 gtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaacaatcttgttggtctc 475 ||||||||||| || ||| || || ||||||||||||||||| ||||||||||||||||| Sbjct: 650 gtcaccatgacaacattg-ccaacatcaaacttgatgaagtcgacaatcttgttggtctc 592 Query: 476 caggtcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcg 535 ||| |||| |||||| |||||||| |||||||||| ||||| ||||||||||||||||| Sbjct: 591 cagatcgatcttgattgtgtcgtttgccttgatgatcgggtcagggtagcggatggtgcg 532 Query: 536 gccatcattaggtgttcaggtatgggatgcccttctggccgaactggacagacctgacct 595 |||||| |||||||||||||| ||||| ||||||||||| ||||| ||||||| |||| Sbjct: 531 accatca-taggtgttcaggtaggggattcccttctggccaaactgcacagaccgaacct 473 Query: 596 tgcagagcttgaacttagcatcctcatccctgacagagtgaaggcggaagcggccctttg 655 |||| |||||||||||||||||||||||| ||||||| ||||||||||| || ||| ||| Sbjct: 472 tgcaaagcttgaacttagcatcctcatccttgacagactgaaggcggaaacgtccc-ttg 414 Query: 656 gtgtcatacagaagccctgtagttct 681 ||||| |||||||| ||||||||||| Sbjct: 413 gtgtcgtacagaag-cctgtagttct 389 Score = 56.0 bits (28), Expect = 2e-04 Identities = 37/40 (92%) Strand = Plus / Minus Query: 112 atagttctatatccttgcagataactggctatagcaaaac 151 ||||||||||||||||||| | |||| ||||||||||||| Sbjct: 961 atagttctatatccttgcaaacaactcgctatagcaaaac 922
>dbj|AK061776.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D06, full insert sequence Length = 1079 Score = 535 bits (270), Expect = e-149 Identities = 451/506 (89%), Gaps = 4/506 (0%) Strand = Plus / Minus Query: 176 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 235 |||||||||||||| || || ||||||| |||||| |||||||| |||||| |||||||| Sbjct: 882 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 823 Query: 236 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 295 || |||||||||||||| |||||||||||||||||| ||||||||||||||||||||| Sbjct: 822 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaaa 763 Query: 296 ttgcccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaag 355 ||||||||||||||||| || ||||| ||| ||||||||||||||||||||||||| ||| Sbjct: 762 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 703 Query: 356 gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 415 | || ||||||||||||||||||||||||||||||||||| || ||||| | || ||| Sbjct: 702 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 643 Query: 416 gtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaacaatcttgttggtctc 475 ||||||||||| || ||| || || ||||||||||||||||| ||||||||||||||||| Sbjct: 642 gtcaccatgacaacattg-ccaacatcaaacttgatgaagtcgacaatcttgttggtctc 584 Query: 476 caggtcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcg 535 ||| |||| |||||| |||||||| |||||||||| ||||| ||||||||||||||||| Sbjct: 583 cagatcgatcttgattgtgtcgtttgccttgatgatcgggtcagggtagcggatggtgcg 524 Query: 536 gccatcattaggtgttcaggtatgggatgcccttctggccgaactggacagacctgacct 595 |||||| |||||||||||||| ||||| ||||||||||| ||||| ||||||| |||| Sbjct: 523 accatca-taggtgttcaggtaggggattcccttctggccaaactgcacagaccgaacct 465 Query: 596 tgcagagcttgaacttagcatcctcatccctgacagagtgaaggcggaagcggccctttg 655 |||| |||||||||||||||||||||||| ||||||| ||||||||||| || ||| ||| Sbjct: 464 tgcaaagcttgaacttagcatcctcatccttgacagactgaaggcggaaacgtccc-ttg 406 Query: 656 gtgtcatacagaagccctgtagttct 681 ||||| |||||||| ||||||||||| Sbjct: 405 gtgtcgtacagaag-cctgtagttct 381 Score = 56.0 bits (28), Expect = 2e-04 Identities = 37/40 (92%) Strand = Plus / Minus Query: 112 atagttctatatccttgcagataactggctatagcaaaac 151 ||||||||||||||||||| | |||| ||||||||||||| Sbjct: 953 atagttctatatccttgcaaacaactcgctatagcaaaac 914
>gb|AF015522.1|AF015522 Zea mays ribsomal protein S4 (rps4) mRNA, complete cds Length = 1090 Score = 498 bits (251), Expect = e-137 Identities = 423/475 (89%), Gaps = 4/475 (0%) Strand = Plus / Minus Query: 207 tcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaag 266 ||||||||||||| |||||| ||||||||||||||||||||||||| ||||||||||| | Sbjct: 844 tcctctgctcctcgatgatgctgagcttgatacccttgcccttgggcaggctcacccacg 785 Query: 267 gcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggtgaccct 326 ||||| |||||||||| ||||||||||||||||||| |||||||| |||||||| ||| Sbjct: 784 gcttgttgcccttgccgatggtgaacacgttgcccatgcgggtggcgaactggtggccca 725 Query: 327 gggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgatca 386 || ||||| ||||||||||| || ||| ||||| |||||||||||||||||||||| Sbjct: 724 tggagtcctcgacgtggatggtatcgaagccgcccttgtgcttctccctgttcttgatca 665 Query: 387 caccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaac 446 |||| |||||||| ||||| | ||| || ||||||||||| |||||| |||||||||||| Sbjct: 664 cacctacacgcccggtgttcctcccgccggtcaccatgaccacgttg-ccgacgtcaaac 606 Query: 447 ttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgttggccttg 506 ||||||||||| | ||||||||||||||||| |||| |||||||||||||||||||||| Sbjct: 605 ttgatgaagtccatgatcttgttggtctccagatcgatcttgatggtgtcgttggccttg 546 Query: 507 atgagtgggtctgggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcc 566 ||||| ||||| |||||||||||||||||||| || |||||||||||||| |||||||| Sbjct: 545 atgagcgggtcggggtagcggatggtgcggccgtc-gtaggtgttcaggtaggggatgcc 487 Query: 567 cttctggccgaactggacagacctgaccttgcagagcttgaacttagcatcctcatccct 626 ||||||||| ||||| |||||||| |||||||||||||||||||| |||||||||||||| Sbjct: 486 cttctggccaaactgaacagacctcaccttgcagagcttgaacttggcatcctcatccct 427 Query: 627 gacagagtgaaggcggaagcggccctttggtgtcatacagaagccctgtagttct 681 || | |||||| |||||||||||| ||||||||||| || || ||||||||||| Sbjct: 426 gattgggtgaagacggaagcggccc-ttggtgtcataaagcag-cctgtagttct 374
>gb|AF013487.1|AF013487 Zea mays ribosomal protein S4 type I (rps4) mRNA, complete cds Length = 1013 Score = 496 bits (250), Expect = e-137 Identities = 423/478 (88%), Gaps = 2/478 (0%) Strand = Plus / Minus Query: 176 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 235 |||||||||||||| || |||||||||| |||||| ||||| || |||||| | |||||| Sbjct: 864 ttggcagcagcctgggcagcggcatcccgcttcctttgctcttctatgatgctcagcttg 805 Query: 236 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 295 || |||||||||||||| ||||||||||| ||||| | |||||||| |||||||||||| Sbjct: 804 attcccttgcccttgggcaggctcacccacggcttattacccttgccgatggtgaacacg 745 Query: 296 ttgcccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaag 355 ||||||| ||||||||| |||||||| ||| ||| ||||| ||||| |||||||||||| Sbjct: 744 ttgcccatacgggtggcgaactggtggcccagggagtcctccacgtgaatggtctcaaag 685 Query: 356 gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 415 | ||||| |||||||||||||||||||| ||||| || || |||||||| | || ||| Sbjct: 684 ctgcccttgtgcttctccctgttcttgataacacccacgcggccagtgttccttccgcca 625 Query: 416 gtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaacaatcttgttggtctc 475 |||||||||||||||||| || || ||||||||||||||||| ||||||||||||||||| Sbjct: 624 gtcaccatgacgacgttg-ccaacatcaaacttgatgaagtccacaatcttgttggtctc 566 Query: 476 caggtcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcg 535 ||| |||| ||||||||||||||||||||||||||| ||||| ||||||||||||||||| Sbjct: 565 cagatcgatcttgatggtgtcgttggccttgatgagggggtcagggtagcggatggtgcg 506 Query: 536 gccatcattaggtgttcaggtatgggatgcccttctggccgaactggacagacctgacct 595 ||| ||| || |||||||| || |||||||||||||| || ||||| |||||||| |||| Sbjct: 505 gccgtca-tacgtgttcagataagggatgcccttctgcccaaactgaacagacctaacct 447 Query: 596 tgcagagcttgaacttagcatcctcatccctgacagagtgaaggcggaagcggccctt 653 |||| |||||||||||||||||||||||||||| | ||||||||||||||||||||| Sbjct: 446 tgcaaagcttgaacttagcatcctcatccctgattgggtgaaggcggaagcggccctt 389 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 108 gaacatagttctatatccttgcaga 132 |||||| |||||||||||||||||| Sbjct: 936 gaacattgttctatatccttgcaga 912
>gb|BT016261.1| Zea mays clone Contig94 mRNA sequence Length = 1116 Score = 482 bits (243), Expect = e-133 Identities = 421/475 (88%), Gaps = 4/475 (0%) Strand = Plus / Minus Query: 207 tcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaag 266 ||||||||||||| |||||| ||||||||||||||||||||||||| ||||||||||| | Sbjct: 865 tcctctgctcctcgatgatgctgagcttgatacccttgcccttgggcaggctcacccacg 806 Query: 267 gcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggtgaccct 326 ||||| |||||||||| ||||||||||||||||||| |||||||| |||||||| ||| Sbjct: 805 gcttgttgcccttgccgatggtgaacacgttgcccatgcgggtggcgaactggtggccca 746 Query: 327 gggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgatca 386 || ||||| ||||||||||| || ||| ||||| |||||||||||||||||||||| Sbjct: 745 tggagtcctcgacgtggatggtatcgaagccgcccttgtgcttctccctgttcttgatca 686 Query: 387 caccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaac 446 |||| |||||||| ||||| | ||| || ||||||||||| |||||| |||||||||||| Sbjct: 685 cacctacacgcccggtgttcctcccgccggtcaccatgaccacgttg-ccgacgtcaaac 627 Query: 447 ttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgttggccttg 506 ||||||||||| | ||||||||||||||||| |||| |||||||||||||||||||||| Sbjct: 626 ttgatgaagtccatgatcttgttggtctccagatcgatcttgatggtgtcgttggccttg 567 Query: 507 atgagtgggtctgggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcc 566 ||||| ||||| |||||||||||||| ||||| || |||||||||||||| |||||||| Sbjct: 566 atgagcgggtcggggtagcggatggtacggccgtc-gtaggtgttcaggtaggggatgcc 508 Query: 567 cttctggccgaactggacagacctgaccttgcagagcttgaacttagcatcctcatccct 626 ||||||||| ||||| || ||||| |||||||||||||||||||| |||||||||||||| Sbjct: 507 cttctggccaaactgaacggacctcaccttgcagagcttgaacttggcatcctcatccct 448 Query: 627 gacagagtgaaggcggaagcggccctttggtgtcatacagaagccctgtagttct 681 || | |||||| |||||||||||| ||||||||||| || || ||||||||||| Sbjct: 447 gattgggtgaagacggaagcggccc-ttggtgtcataaagcag-cctgtagttct 395
>gb|AY525608.1| Zea mays ribosomal protein S4 mRNA, complete cds Length = 1037 Score = 480 bits (242), Expect = e-132 Identities = 421/478 (88%), Gaps = 2/478 (0%) Strand = Plus / Minus Query: 176 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 235 |||||||||||||| || |||||||||| |||||| ||||| || |||||| | |||||| Sbjct: 862 ttggcagcagcctgggcagcggcatcccgcttcctttgctcttctatgatgctcagcttg 803 Query: 236 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 295 || |||||||||||||| ||||||||||| ||||| | |||||||| |||||||||||| Sbjct: 802 attcccttgcccttgggcaggctcacccacggcttattacccttgccgatggtgaacacg 743 Query: 296 ttgcccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaag 355 ||||||| ||||||||| |||||||| ||| ||| ||||| ||||| |||||||||| | Sbjct: 742 ttgcccatacgggtggcgaactggtggcccagggagtcctccacgtgaatggtctcaagg 683 Query: 356 gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 415 | ||||| |||||||||||||||||||| ||||| ||||| |||||||| | || ||| Sbjct: 682 ctgcccttgtgcttctccctgttcttgataacacccacacggccagtgttccttccgcca 623 Query: 416 gtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaacaatcttgttggtctc 475 ||||||||||| |||||| || || ||||||||||||||||| ||||| ||||||||||| Sbjct: 622 gtcaccatgacaacgttg-ccaacatcaaacttgatgaagtccacaattttgttggtctc 564 Query: 476 caggtcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcg 535 ||| |||| ||||||||||||||||||||||||| | ||||| ||||||||||||||||| Sbjct: 563 cagatcgatcttgatggtgtcgttggccttgatgggcgggtcagggtagcggatggtgcg 504 Query: 536 gccatcattaggtgttcaggtatgggatgcccttctggccgaactggacagacctgacct 595 ||| ||| || ||||||||||| |||||||||||||| || ||||| |||||||| |||| Sbjct: 503 gccgtca-tacgtgttcaggtacgggatgcccttctgcccaaactgaacagacctaacct 445 Query: 596 tgcagagcttgaacttagcatcctcatccctgacagagtgaaggcggaagcggccctt 653 |||| |||||||||||||||||||||||||||| | ||||||||||||||||||||| Sbjct: 444 tgcaaagcttgaacttagcatcctcatccctgattgggtgaaggcggaagcggccctt 387 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 108 gaacatagttctatatccttgcaga 132 |||||| |||||||||||||||||| Sbjct: 934 gaacattgttctatatccttgcaga 910
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 474 bits (239), Expect = e-130 Identities = 388/435 (89%), Gaps = 2/435 (0%) Strand = Plus / Plus Query: 176 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 235 |||||||||||||| || || ||||||| |||||| |||||||| |||||| |||||||| Sbjct: 316967 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 317026 Query: 236 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 295 || |||||||||||||| |||||||||||||||||| |||||||||||||||||||||| Sbjct: 317027 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 317086 Query: 296 ttgcccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaag 355 ||||||||||||||||| || ||||| ||| ||||||||||||||||||||||||| ||| Sbjct: 317087 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 317146 Query: 356 gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 415 | || ||||||||||||||||||||||||||||||||||| || ||||| | || ||| Sbjct: 317147 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 317206 Query: 416 gtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaacaatcttgttggtctc 475 ||||||||||| || ||| || || ||||||||||||||||| ||||||||||||||||| Sbjct: 317207 gtcaccatgacaacattg-ccaacatcaaacttgatgaagtcgacaatcttgttggtctc 317265 Query: 476 caggtcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcg 535 ||| |||| |||||| |||||||| |||||||||| ||||| ||||||||||||||||| Sbjct: 317266 cagatcgatcttgattgtgtcgtttgccttgatgatcgggtcagggtagcggatggtgcg 317325 Query: 536 gccatcattaggtgttcaggtatgggatgcccttctggccgaactggacagacctgacct 595 |||||| |||||||||||||| ||||| ||||||||||| ||||| ||||||| |||| Sbjct: 317326 accatca-taggtgttcaggtaggggattcccttctggccaaactgcacagaccgaacct 317384 Query: 596 tgcagagcttgaact 610 |||| |||||||||| Sbjct: 317385 tgcaaagcttgaact 317399 Score = 73.8 bits (37), Expect = 7e-10 Identities = 66/73 (90%), Gaps = 2/73 (2%) Strand = Plus / Plus Query: 609 cttagcatcctcatccctgacagagtgaaggcggaagcggccctttggtgtcatacagaa 668 |||||||||||||||| ||||||| ||||||||||| || ||| |||||||| ||||||| Sbjct: 317647 cttagcatcctcatccttgacagactgaaggcggaaacgtccc-ttggtgtcgtacagaa 317705 Query: 669 gccctgtagttct 681 | ||||||||||| Sbjct: 317706 g-cctgtagttct 317717 Score = 56.0 bits (28), Expect = 2e-04 Identities = 37/40 (92%) Strand = Plus / Plus Query: 112 atagttctatatccttgcagataactggctatagcaaaac 151 ||||||||||||||||||| | |||| ||||||||||||| Sbjct: 316896 atagttctatatccttgcaaacaactcgctatagcaaaac 316935
>dbj|AP004851.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1359_D06 Length = 146805 Score = 474 bits (239), Expect = e-130 Identities = 388/435 (89%), Gaps = 2/435 (0%) Strand = Plus / Plus Query: 176 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 235 |||||||||||||| || || ||||||| |||||| |||||||| |||||| |||||||| Sbjct: 45751 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 45810 Query: 236 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 295 || |||||||||||||| |||||||||||||||||| |||||||||||||||||||||| Sbjct: 45811 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 45870 Query: 296 ttgcccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaag 355 ||||||||||||||||| || ||||| ||| ||||||||||||||||||||||||| ||| Sbjct: 45871 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 45930 Query: 356 gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 415 | || ||||||||||||||||||||||||||||||||||| || ||||| | || ||| Sbjct: 45931 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 45990 Query: 416 gtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaacaatcttgttggtctc 475 ||||||||||| || ||| || || ||||||||||||||||| ||||||||||||||||| Sbjct: 45991 gtcaccatgacaacattg-ccaacatcaaacttgatgaagtcgacaatcttgttggtctc 46049 Query: 476 caggtcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcg 535 ||| |||| |||||| |||||||| |||||||||| ||||| ||||||||||||||||| Sbjct: 46050 cagatcgatcttgattgtgtcgtttgccttgatgatcgggtcagggtagcggatggtgcg 46109 Query: 536 gccatcattaggtgttcaggtatgggatgcccttctggccgaactggacagacctgacct 595 |||||| |||||||||||||| ||||| ||||||||||| ||||| ||||||| |||| Sbjct: 46110 accatca-taggtgttcaggtaggggattcccttctggccaaactgcacagaccgaacct 46168 Query: 596 tgcagagcttgaact 610 |||| |||||||||| Sbjct: 46169 tgcaaagcttgaact 46183 Score = 73.8 bits (37), Expect = 7e-10 Identities = 66/73 (90%), Gaps = 2/73 (2%) Strand = Plus / Plus Query: 609 cttagcatcctcatccctgacagagtgaaggcggaagcggccctttggtgtcatacagaa 668 |||||||||||||||| ||||||| ||||||||||| || ||| |||||||| ||||||| Sbjct: 46431 cttagcatcctcatccttgacagactgaaggcggaaacgtccc-ttggtgtcgtacagaa 46489 Query: 669 gccctgtagttct 681 | ||||||||||| Sbjct: 46490 g-cctgtagttct 46501 Score = 56.0 bits (28), Expect = 2e-04 Identities = 37/40 (92%) Strand = Plus / Plus Query: 112 atagttctatatccttgcagataactggctatagcaaaac 151 ||||||||||||||||||| | |||| ||||||||||||| Sbjct: 45680 atagttctatatccttgcaaacaactcgctatagcaaaac 45719
>gb|BT017558.1| Zea mays clone EL01N0424H12.c mRNA sequence Length = 1145 Score = 464 bits (234), Expect = e-127 Identities = 419/478 (87%), Gaps = 2/478 (0%) Strand = Plus / Plus Query: 176 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 235 |||||||||||||| || || ||||||| |||||| ||||| || |||||| | |||||| Sbjct: 178 ttggcagcagcctgggcagcagcatcccgcttcctttgctcttctatgatgctcagcttg 237 Query: 236 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 295 || ||||| |||||||| ||||||||||| ||||| | |||||||| |||||||||||| Sbjct: 238 attcccttacccttgggcaggctcacccacggcttattacccttgccgatggtgaacacg 297 Query: 296 ttgcccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaag 355 ||||||| ||||||||| |||||||| ||| ||| ||||| ||||| || ||||||||| Sbjct: 298 ttgcccatacgggtggcgaactggtggcccagggagtcctccacgtgaatagtctcaaag 357 Query: 356 gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 415 | ||||| |||||||||||||||||||| ||||| ||||| ||||||| | || ||| Sbjct: 358 ctgcccttgtgcttctccctgttcttgataacacccacacgggcagtgttccttccccca 417 Query: 416 gtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaacaatcttgttggtctc 475 |||||||||||||||||| || || ||||||||||||||||| |||||||||||||| || Sbjct: 418 gtcaccatgacgacgttg-ccaacatcaaacttgatgaagtccacaatcttgttggtatc 476 Query: 476 caggtcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcg 535 ||| |||| ||||||||||||||||||||||||||| ||||| ||||||||||||||||| Sbjct: 477 cagatcgatcttgatggtgtcgttggccttgatgagggggtcagggtagcggatggtgcg 536 Query: 536 gccatcattaggtgttcaggtatgggatgcccttctggccgaactggacagacctgacct 595 ||| ||| || |||||||| || |||||||||||||| || ||||| |||||||| |||| Sbjct: 537 gccgtca-tacgtgttcagataagggatgcccttctgcccaaactgaacagacctaacct 595 Query: 596 tgcagagcttgaacttagcatcctcatccctgacagagtgaaggcggaagcggccctt 653 |||| |||||||||||||||||||||||||||| | ||||||||||||||||||||| Sbjct: 596 tgcaaagcttgaacttagcatcctcatccctgattgggtgaaggcggaagcggccctt 653 Score = 44.1 bits (22), Expect = 0.60 Identities = 25/26 (96%) Strand = Plus / Plus Query: 107 ggaacatagttctatatccttgcaga 132 ||||||| |||||||||||||||||| Sbjct: 105 ggaacattgttctatatccttgcaga 130
>dbj|AK061826.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-C06, full insert sequence Length = 1035 Score = 379 bits (191), Expect = e-102 Identities = 429/503 (85%), Gaps = 4/503 (0%) Strand = Plus / Minus Query: 179 gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttgata 238 |||||||||||||| || ||||| | ||||||||| ||||| |||||| ||||||||||| Sbjct: 875 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 816 Query: 239 cccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttg 298 ||||||||||| ||||| |||||| |||||| |||||||||| ||||||||||| ||| Sbjct: 815 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 756 Query: 299 cccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaaggtt 358 |||||||||||||| || || ||| || ||||| || |||||||||||||| | Sbjct: 755 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 696 Query: 359 cccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccaccagtc 418 ||||| ||||||||||||||||| || || |||||||| |||||||| | ||| || || Sbjct: 695 cccttgtgcttctccctgttcttaattactccaacacgaccagtgttcctccctcctgtg 636 Query: 419 accatgacgacgttgcccgacgtcaaacttgatgaagtcaacaatcttgttggtctccag 478 ||||| ||||| |||||| || ||||||||||||||||||||||||||||||||||| || Sbjct: 635 accataacgacattgccc-acatcaaacttgatgaagtcaacaatcttgttggtctcaag 577 Query: 479 gtcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcggcc 538 || | |||||| |||||||| ||||| || | ||||| ||||||||||||||||| || Sbjct: 576 atcaatcttgattgtgtcgttagccttaatcaaagggtccgggtagcggatggtgcgtcc 517 Query: 539 atcattaggtgttcaggtatgggatgcccttctggccgaactggacagacctgaccttgc 598 |||| ||||||||||| || || ||||||||||| || ||||||||||||| || |||| Sbjct: 516 atca-taggtgttcagatagggaatgcccttctgtccaaactggacagaccgaactttgc 458 Query: 599 agagcttgaacttagcatcctcatccctgacagagtgaaggcggaagcggccctttggtg 658 | ||||||||||| |||||||||||| |||| || |||||||||||||| ||| |||||| Sbjct: 457 aaagcttgaacttggcatcctcatccttgacggactgaaggcggaagcgaccc-ttggtg 399 Query: 659 tcatacagaagccctgtagttct 681 ||||| ||||| ||||||||||| Sbjct: 398 tcatagagaag-cctgtagttct 377
>ref|XM_475130.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 738 Score = 343 bits (173), Expect = 5e-91 Identities = 395/465 (84%), Gaps = 3/465 (0%) Strand = Plus / Minus Query: 205 cttcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcaccca 264 ||||||| ||||||||||||| |||||||||| ||||||||||||||||| ||||| Sbjct: 708 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 649 Query: 265 aggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggtgacc 324 ||||| | ||||||| |||||||| |||||||||| || || || |||||||| || Sbjct: 648 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 589 Query: 325 ctgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgat 384 |||||||||| || ||||||||||||||| | ||||| |||||||||||| ||||||| Sbjct: 588 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 529 Query: 385 cacaccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaa 444 ||| || || ||||| ||||| | |||||| |||||||| |||| ||| || || |||| Sbjct: 528 caccccgacgcgccccgtgttcctcccaccggtcaccatcacgatgtttcca-acatcaa 470 Query: 445 acttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgttggcct 504 ||||||||||||| || |||||||||||||||| ||| | |||||||||||||||||||| Sbjct: 469 acttgatgaagtccacgatcttgttggtctccaagtcaatcttgatggtgtcgttggcct 410 Query: 505 tgatgagtgggtctgggtagcggatggtgcggccatcattaggtgttcaggtatgggatg 564 ||||||||||||||||||||||||| ||||| || || || |||||||||| | || || Sbjct: 409 tgatgagtgggtctgggtagcggatcgtgcgcccgtcgtt-ggtgttcaggaaaggaata 351 Query: 565 cccttctggccgaactggacagacctgaccttgcagagcttgaacttagcatcctcatcc 624 |||||||| || ||||| ||||||| |||||||||||||||||||||||| ||||||||| Sbjct: 350 cccttctgtccaaactgtacagaccggaccttgcagagcttgaacttagcgtcctcatcc 291 Query: 625 ctgacagagtgaaggcggaagcggccctttggtgtcatacagaag 669 ||| ||| || |||||||| ||| ||||||||||||||||| Sbjct: 290 ttgatgctgtggagacggaagcgaccc-ttggtgtcatacagaag 247
>dbj|AK071862.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023123J20, full insert sequence Length = 1162 Score = 343 bits (173), Expect = 5e-91 Identities = 395/465 (84%), Gaps = 3/465 (0%) Strand = Plus / Minus Query: 205 cttcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcaccca 264 ||||||| ||||||||||||| |||||||||| ||||||||||||||||| ||||| Sbjct: 860 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 801 Query: 265 aggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggtgacc 324 ||||| | ||||||| |||||||| |||||||||| || || || |||||||| || Sbjct: 800 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 741 Query: 325 ctgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgat 384 |||||||||| || ||||||||||||||| | ||||| |||||||||||| ||||||| Sbjct: 740 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 681 Query: 385 cacaccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaa 444 ||| || || ||||| ||||| | |||||| |||||||| |||| ||| || || |||| Sbjct: 680 caccccgacgcgccccgtgttcctcccaccggtcaccatcacgatgtttcca-acatcaa 622 Query: 445 acttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgttggcct 504 ||||||||||||| || |||||||||||||||| ||| | |||||||||||||||||||| Sbjct: 621 acttgatgaagtccacgatcttgttggtctccaagtcaatcttgatggtgtcgttggcct 562 Query: 505 tgatgagtgggtctgggtagcggatggtgcggccatcattaggtgttcaggtatgggatg 564 ||||||||||||||||||||||||| ||||| || || || |||||||||| | || || Sbjct: 561 tgatgagtgggtctgggtagcggatcgtgcgcccgtcgtt-ggtgttcaggaaaggaata 503 Query: 565 cccttctggccgaactggacagacctgaccttgcagagcttgaacttagcatcctcatcc 624 |||||||| || ||||| ||||||| |||||||||||||||||||||||| ||||||||| Sbjct: 502 cccttctgtccaaactgtacagaccggaccttgcagagcttgaacttagcgtcctcatcc 443 Query: 625 ctgacagagtgaaggcggaagcggccctttggtgtcatacagaag 669 ||| ||| || |||||||| ||| ||||||||||||||||| Sbjct: 442 ttgatgctgtggagacggaagcgaccc-ttggtgtcatacagaag 399
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 317 bits (160), Expect = 3e-83 Identities = 366/432 (84%), Gaps = 2/432 (0%) Strand = Plus / Minus Query: 179 gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttgata 238 |||||||||||||| || ||||| | ||||||||| ||||| |||||| ||||||||||| Sbjct: 14497969 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 14497910 Query: 239 cccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttg 298 ||||||||||| ||||| |||||| |||||| |||||||||| ||||||||||| ||| Sbjct: 14497909 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 14497850 Query: 299 cccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaaggtt 358 |||||||||||||| || || ||| || ||||| || |||||||||||||| | Sbjct: 14497849 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 14497790 Query: 359 cccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccaccagtc 418 ||||| ||||||||||||||||| || || |||||||| |||||||| | ||| || || Sbjct: 14497789 cccttgtgcttctccctgttcttaattactccaacacgaccagtgttcctccctcctgtg 14497730 Query: 419 accatgacgacgttgcccgacgtcaaacttgatgaagtcaacaatcttgttggtctccag 478 ||||| ||||| |||||| || ||||||||||||||||||||||||||||||||||| || Sbjct: 14497729 accataacgacattgccc-acatcaaacttgatgaagtcaacaatcttgttggtctcaag 14497671 Query: 479 gtcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcggcc 538 || | |||||| |||||||| ||||| || | ||||| ||||||||||||||||| || Sbjct: 14497670 atcaatcttgattgtgtcgttagccttaatcaaagggtccgggtagcggatggtgcgtcc 14497611 Query: 539 atcattaggtgttcaggtatgggatgcccttctggccgaactggacagacctgaccttgc 598 |||| ||||||||||| || || ||||||||||| || ||||||||||||| || |||| Sbjct: 14497610 atca-taggtgttcagatagggaatgcccttctgtccaaactggacagaccgaactttgc 14497552 Query: 599 agagcttgaact 610 | |||||||||| Sbjct: 14497551 aaagcttgaact 14497540 Score = 65.9 bits (33), Expect = 2e-07 Identities = 62/69 (89%), Gaps = 2/69 (2%) Strand = Plus / Minus Query: 613 gcatcctcatccctgacagagtgaaggcggaagcggccctttggtgtcatacagaagccc 672 |||||||||||| |||| || |||||||||||||| ||| ||||||||||| ||||| || Sbjct: 14497441 gcatcctcatccttgacggactgaaggcggaagcgaccc-ttggtgtcatagagaag-cc 14497384 Query: 673 tgtagttct 681 ||||||||| Sbjct: 14497383 tgtagttct 14497375
>dbj|AP003275.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0514H03 Length = 167230 Score = 317 bits (160), Expect = 3e-83 Identities = 366/432 (84%), Gaps = 2/432 (0%) Strand = Plus / Minus Query: 179 gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttgata 238 |||||||||||||| || ||||| | ||||||||| ||||| |||||| ||||||||||| Sbjct: 57282 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 57223 Query: 239 cccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttg 298 ||||||||||| ||||| |||||| |||||| |||||||||| ||||||||||| ||| Sbjct: 57222 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 57163 Query: 299 cccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaaggtt 358 |||||||||||||| || || ||| || ||||| || |||||||||||||| | Sbjct: 57162 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 57103 Query: 359 cccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccaccagtc 418 ||||| ||||||||||||||||| || || |||||||| |||||||| | ||| || || Sbjct: 57102 cccttgtgcttctccctgttcttaattactccaacacgaccagtgttcctccctcctgtg 57043 Query: 419 accatgacgacgttgcccgacgtcaaacttgatgaagtcaacaatcttgttggtctccag 478 ||||| ||||| |||||| || ||||||||||||||||||||||||||||||||||| || Sbjct: 57042 accataacgacattgccc-acatcaaacttgatgaagtcaacaatcttgttggtctcaag 56984 Query: 479 gtcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcggcc 538 || | |||||| |||||||| ||||| || | ||||| ||||||||||||||||| || Sbjct: 56983 atcaatcttgattgtgtcgttagccttaatcaaagggtccgggtagcggatggtgcgtcc 56924 Query: 539 atcattaggtgttcaggtatgggatgcccttctggccgaactggacagacctgaccttgc 598 |||| ||||||||||| || || ||||||||||| || ||||||||||||| || |||| Sbjct: 56923 atca-taggtgttcagatagggaatgcccttctgtccaaactggacagaccgaactttgc 56865 Query: 599 agagcttgaact 610 | |||||||||| Sbjct: 56864 aaagcttgaact 56853 Score = 65.9 bits (33), Expect = 2e-07 Identities = 62/69 (89%), Gaps = 2/69 (2%) Strand = Plus / Minus Query: 613 gcatcctcatccctgacagagtgaaggcggaagcggccctttggtgtcatacagaagccc 672 |||||||||||| |||| || |||||||||||||| ||| ||||||||||| ||||| || Sbjct: 56754 gcatcctcatccttgacggactgaaggcggaagcgaccc-ttggtgtcatagagaag-cc 56697 Query: 673 tgtagttct 681 ||||||||| Sbjct: 56696 tgtagttct 56688
>gb|AC104279.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1393_A07, complete sequence Length = 159932 Score = 313 bits (158), Expect = 4e-82 Identities = 346/406 (85%), Gaps = 2/406 (0%) Strand = Plus / Minus Query: 205 cttcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcaccca 264 ||||||| ||||||||||||| |||||||||| ||||||||||||||||| ||||| Sbjct: 81033 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 80974 Query: 265 aggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggtgacc 324 ||||| | ||||||| |||||||| |||||||||| || || || |||||||| || Sbjct: 80973 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 80914 Query: 325 ctgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgat 384 |||||||||| || ||||||||||||||| | ||||| |||||||||||| ||||||| Sbjct: 80913 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 80854 Query: 385 cacaccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaa 444 ||| || || ||||| ||||| | |||||| |||||||| |||| ||| || || |||| Sbjct: 80853 caccccgacgcgccccgtgttcctcccaccggtcaccatcacgatgtttcca-acatcaa 80795 Query: 445 acttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgttggcct 504 ||||||||||||| || |||||||||||||||| ||| | |||||||||||||||||||| Sbjct: 80794 acttgatgaagtccacgatcttgttggtctccaagtcaatcttgatggtgtcgttggcct 80735 Query: 505 tgatgagtgggtctgggtagcggatggtgcggccatcattaggtgttcaggtatgggatg 564 ||||||||||||||||||||||||| ||||| || || || |||||||||| | || || Sbjct: 80734 tgatgagtgggtctgggtagcggatcgtgcgcccgtcgtt-ggtgttcaggaaaggaata 80676 Query: 565 cccttctggccgaactggacagacctgaccttgcagagcttgaact 610 |||||||| || ||||| ||||||| |||||||||||||||||||| Sbjct: 80675 cccttctgtccaaactgtacagaccggaccttgcagagcttgaact 80630
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 313 bits (158), Expect = 4e-82 Identities = 346/406 (85%), Gaps = 2/406 (0%) Strand = Plus / Minus Query: 205 cttcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcaccca 264 ||||||| ||||||||||||| |||||||||| ||||||||||||||||| ||||| Sbjct: 17551228 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 17551169 Query: 265 aggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggtgacc 324 ||||| | ||||||| |||||||| |||||||||| || || || |||||||| || Sbjct: 17551168 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 17551109 Query: 325 ctgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgat 384 |||||||||| || ||||||||||||||| | ||||| |||||||||||| ||||||| Sbjct: 17551108 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 17551049 Query: 385 cacaccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaa 444 ||| || || ||||| ||||| | |||||| |||||||| |||| ||| || || |||| Sbjct: 17551048 caccccgacgcgccccgtgttcctcccaccggtcaccatcacgatgtttcca-acatcaa 17550990 Query: 445 acttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgttggcct 504 ||||||||||||| || |||||||||||||||| ||| | |||||||||||||||||||| Sbjct: 17550989 acttgatgaagtccacgatcttgttggtctccaagtcaatcttgatggtgtcgttggcct 17550930 Query: 505 tgatgagtgggtctgggtagcggatggtgcggccatcattaggtgttcaggtatgggatg 564 ||||||||||||||||||||||||| ||||| || || || |||||||||| | || || Sbjct: 17550929 tgatgagtgggtctgggtagcggatcgtgcgcccgtcgtt-ggtgttcaggaaaggaata 17550871 Query: 565 cccttctggccgaactggacagacctgaccttgcagagcttgaact 610 |||||||| || ||||| ||||||| |||||||||||||||||||| Sbjct: 17550870 cccttctgtccaaactgtacagaccggaccttgcagagcttgaact 17550825
>ref|NM_193994.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 768 Score = 289 bits (146), Expect = 6e-75 Identities = 334/394 (84%), Gaps = 2/394 (0%) Strand = Plus / Minus Query: 179 gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttgata 238 |||||||||||||| || ||||| | ||||||||| ||||| |||||| ||||||||||| Sbjct: 758 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 699 Query: 239 cccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttg 298 ||||||||||| ||||| |||||| |||||| |||||||||| ||||||||||| ||| Sbjct: 698 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 639 Query: 299 cccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaaggtt 358 |||||||||||||| || || ||| || ||||| || |||||||||||||| | Sbjct: 638 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 579 Query: 359 cccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccaccagtc 418 ||||| ||||||||||||||||| || || |||||||| |||||||| | ||| || || Sbjct: 578 cccttgtgcttctccctgttcttaattactccaacacgaccagtgttcctccctcctgtg 519 Query: 419 accatgacgacgttgcccgacgtcaaacttgatgaagtcaacaatcttgttggtctccag 478 ||||| ||||| |||||| || ||||||||||||||||||||||||||||||||||| || Sbjct: 518 accataacgacattgccc-acatcaaacttgatgaagtcaacaatcttgttggtctcaag 460 Query: 479 gtcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcggcc 538 || | |||||| |||||||| ||||| || | ||||| ||||||||||||||||| || Sbjct: 459 atcaatcttgattgtgtcgttagccttaatcaaagggtccgggtagcggatggtgcgtcc 400 Query: 539 atcattaggtgttcaggtatgggatgcccttctg 572 |||| ||||||||||| || || ||||||||||| Sbjct: 399 atca-taggtgttcagatagggaatgcccttctg 367 Score = 69.9 bits (35), Expect = 1e-08 Identities = 67/75 (89%), Gaps = 2/75 (2%) Strand = Plus / Minus Query: 607 aacttagcatcctcatccctgacagagtgaaggcggaagcggccctttggtgtcatacag 666 ||||| |||||||||||| |||| || |||||||||||||| ||| ||||||||||| || Sbjct: 362 aacttggcatcctcatccttgacggactgaaggcggaagcgaccc-ttggtgtcatagag 304 Query: 667 aagccctgtagttct 681 ||| ||||||||||| Sbjct: 303 aag-cctgtagttct 290
>gb|AF528526.1| Glycine max 40S ribosomal S4 protein mRNA, complete cds Length = 1054 Score = 266 bits (134), Expect = 9e-68 Identities = 335/398 (84%), Gaps = 3/398 (0%) Strand = Plus / Minus Query: 266 ggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggtgaccc 325 ||||| |||||||||||||| |||||||| ||||||| || || ||||| | || || Sbjct: 798 ggctttgtgcccttgccaatagtgaacacattgcccatgcgagtagcaaattcatgtcca 739 Query: 326 tgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgatc 385 || ||||| ||||| || ||||||||| | ||||||||||||||||||||||||||| Sbjct: 738 gtggaatcctgcacgtgaattgtctcaaagctacccttatgcttctccctgttcttgatc 679 Query: 386 acaccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaa 445 || ||||||||||| |||| | |||||| || ||||| || || || ||| || ||||| Sbjct: 678 actccaacacgccccctgtttctcccacctgttaccataactacatt-cccaacatcaaa 620 Query: 446 cttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgttggcctt 505 ||||| || |||||||||||||| |||||| || ||||| ||||||||||||||| | Sbjct: 619 tttgataaaatcaacaatcttgttttcctccagatccagcttaatggtgtcgttggccct 560 Query: 506 gatgagtgggtctgggtagcggatggtgcggccatcattaggtgttcaggtatgggatgc 565 |||||| ||||||||||| ||||||||||| ||||||| ||||||||||||||||||| | Sbjct: 559 gatgagagggtctgggtaacggatggtgcgaccatcat-aggtgttcaggtatgggatac 501 Query: 566 ccttctggccgaactggacagacctgaccttgcagagcttgaacttagcatcctcatccc 625 | |||||||| ||||| || ||||| |||||||||||||||||||| || || ||||||| Sbjct: 500 ctttctggccaaactgcactgacctaaccttgcagagcttgaactttgcctcatcatccc 441 Query: 626 tgacagagtgaaggcggaagcggccctttggtgtcata 663 ||||||| || || ||||| ||| ||||| |||||||| Sbjct: 440 tgacagaatggagacggaatcgg-cctttagtgtcata 404
>gb|AF071891.1|AF071891 Prunus armeniaca 40S ribosomal protein S4 (RPS4) mRNA, complete cds Length = 1086 Score = 234 bits (118), Expect = 3e-58 Identities = 336/406 (82%), Gaps = 2/406 (0%) Strand = Plus / Minus Query: 218 tcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggtgccc 277 |||| |||||| ||||||||||| || |||||||| || ||||||||| || || ||| Sbjct: 783 tcaaggatggttagcttgatacctttccccttgggaagagacacccaaggttttgtaccc 724 Query: 278 ttgccaatggtgaacacgttgcccagacgggtggcaaactggtgaccctgggcatcctca 337 ||||||||||||||||| || || || || || ||||||| |||||| |||||||| | Sbjct: 723 ttgccaatggtgaacacattaccaagccgagtagcaaactcgtgaccagtggcatcctga 664 Query: 338 acgtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 397 |||||||||||||||||| ||||||||||||||||||||||||| || || |||||||| Sbjct: 663 acgtggatggtctcaaagcttcccttatgcttctccctgttcttaatgactccaacacga 604 Query: 398 ccagtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtc 457 || |||| | ||||||||||||||||| || || || || |||||||| |||||||| Sbjct: 603 cctctgtttcttccaccagtcaccatgacaacatt-tccaacatcaaacttaatgaagtc 545 Query: 458 aacaatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtc 517 |||||||| ||||||| ||| |||||||| ||||| |||||||||||||| ||||| Sbjct: 544 ggtgatcttgtttgtctccaagtccagcttgatagtgtcattggccttgatgagggggtc 485 Query: 518 tgggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccga 577 |||||||| ||||| | || ||| || ||||| | || |||||||||||||| || | Sbjct: 484 agggtagcgaatggttctcccgtca-taagtgttaatataggggatgcccttctgcccaa 426 Query: 578 actggacagacctgaccttgcagagcttgaacttagcatcctcatc 623 |||| || |||| |||||||| ||||||||||||| |||||||| Sbjct: 425 actgcactgaccgaaccttgcatagcttgaacttagactcctcatc 380
>emb|Y15009.1|OSY15009 Oryza sativa mRNA for ribosomal protein S4 Length = 1148 Score = 224 bits (113), Expect = 3e-55 Identities = 194/217 (89%), Gaps = 3/217 (1%) Strand = Plus / Minus Query: 176 ttggcagcagcctgagctgcggcatccctcttcctctgctcct-caatgatggtgagctt 234 |||||||||||||| || || || |||| |||||| ||||||| | |||||| ||||||| Sbjct: 865 ttggcagcagcctgggcggccgc-tcccgcttcctttgctccttcgatgatgctgagctt 807 Query: 235 gatacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacac 294 ||| |||||||||||||| |||||||||||||||||| |||||||||||||||||||||| Sbjct: 806 gatgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacac 747 Query: 295 gttgcccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaa 354 ||||||||||||||||| || ||||| ||| ||||||||||||||||||||||||| || Sbjct: 746 attgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaa 687 Query: 355 ggttcccttatgcttctccctgttcttgatcacacca 391 | | |||| |||||||||||||| |||||||||||| Sbjct: 686 -gctgccttttgcttctccctgttgttgatcacacca 651 Score = 147 bits (74), Expect = 6e-32 Identities = 124/138 (89%), Gaps = 2/138 (1%) Strand = Plus / Minus Query: 544 taggtgttcaggtatgggatgcccttctggccgaactggacagacctgaccttgcagagc 603 |||||||||||||| || || ||||||||||| ||||||||||||| |||||||| ||| Sbjct: 490 taggtgttcaggtagggaattcccttctggccaaactggacagaccgaaccttgcaaagc 431 Query: 604 ttgaacttagcatcctcatccctgacagagtgaaggcggaagcggccctttggtgtcata 663 ||||||||||||||||||||| ||||||| ||||||||||| || ||| |||||||| || Sbjct: 430 ttgaacttagcatcctcatccttgacagactgaaggcggaaacgtccc-ttggtgtcgta 372 Query: 664 cagaagccctgtagttct 681 |||||| ||||||||||| Sbjct: 371 cagaag-cctgtagttct 355 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 446 cttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgttggcct 504 |||||||||||| | |||||||||||||||| |||| |||||| |||||||| |||| Sbjct: 600 cttgatgaagtcgcaattcttgttggtctccagatcgatcttgattgtgtcgtttgcct 542 Score = 42.1 bits (21), Expect = 2.4 Identities = 37/41 (90%), Gaps = 1/41 (2%) Strand = Plus / Minus Query: 112 atagttctatatcc-ttgcagataactggctatagcaaaac 151 |||||||||||||| ||||| | |||| ||||||||||||| Sbjct: 937 atagttctatatcctttgcaaacaactcgctatagcaaaac 897
>ref|NM_001036769.1| Arabidopsis thaliana structural constituent of ribosome AT5G07090 transcript variant AT5G07090.2 mRNA, complete cds Length = 1174 Score = 218 bits (110), Expect = 2e-53 Identities = 265/314 (84%), Gaps = 2/314 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||||| Sbjct: 739 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 680 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || ||||||||||| || ||||| ||| ||||||||||||||||| |||| Sbjct: 679 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 621 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||| ||| ||||| |||||||||||||| || | ||||||||| ||||| | Sbjct: 620 caatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcag 561 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 |||| ||||||||||| |||||| || |||||||||||||| || |||||||| || ||| Sbjct: 560 ggtaacggatggtgcgaccatca-taagtgttcaggtatggaattcccttctgaccaaac 502 Query: 580 tggacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaagg 639 |||| ||| || |||||||| ||||||||||| || ||||||||| ||| ||||| || Sbjct: 501 tggatagatctaaccttgcaaagcttgaactttgcttcctcatccttgatggagtggaga 442 Query: 640 cggaagcggccctt 653 ||||| || ||||| Sbjct: 441 cggaaacgtccctt 428 Score = 46.1 bits (23), Expect = 0.15 Identities = 32/35 (91%) Strand = Plus / Minus Query: 215 tcctcaatgatggtgagcttgatacccttgccctt 249 |||||||||||||| ||||| ||||| |||||||| Sbjct: 864 tcctcaatgatggtcagcttaatacctttgccctt 830
>ref|NM_120791.2| Arabidopsis thaliana structural constituent of ribosome AT5G07090 transcript variant AT5G07090.1 mRNA, complete cds Length = 1088 Score = 218 bits (110), Expect = 2e-53 Identities = 265/314 (84%), Gaps = 2/314 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||||| Sbjct: 654 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 595 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || ||||||||||| || ||||| ||| ||||||||||||||||| |||| Sbjct: 594 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 536 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||| ||| ||||| |||||||||||||| || | ||||||||| ||||| | Sbjct: 535 caatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcag 476 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 |||| ||||||||||| |||||| || |||||||||||||| || |||||||| || ||| Sbjct: 475 ggtaacggatggtgcgaccatca-taagtgttcaggtatggaattcccttctgaccaaac 417 Query: 580 tggacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaagg 639 |||| ||| || |||||||| ||||||||||| || ||||||||| ||| ||||| || Sbjct: 416 tggatagatctaaccttgcaaagcttgaactttgcttcctcatccttgatggagtggaga 357 Query: 640 cggaagcggccctt 653 ||||| || ||||| Sbjct: 356 cggaaacgtccctt 343 Score = 46.1 bits (23), Expect = 0.15 Identities = 32/35 (91%) Strand = Plus / Minus Query: 215 tcctcaatgatggtgagcttgatacccttgccctt 249 |||||||||||||| ||||| ||||| |||||||| Sbjct: 779 tcctcaatgatggtcagcttaatacctttgccctt 745
>gb|AY079417.1| Arabidopsis thaliana putative 40S ribosomal protein S4 (At5g07090) mRNA, complete cds Length = 820 Score = 218 bits (110), Expect = 2e-53 Identities = 265/314 (84%), Gaps = 2/314 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||||| Sbjct: 627 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 568 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || ||||||||||| || ||||| ||| ||||||||||||||||| |||| Sbjct: 567 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 509 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||| ||| ||||| |||||||||||||| || | ||||||||| ||||| | Sbjct: 508 caatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcag 449 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 |||| ||||||||||| |||||| || |||||||||||||| || |||||||| || ||| Sbjct: 448 ggtaacggatggtgcgaccatca-taagtgttcaggtatggaattcccttctgaccaaac 390 Query: 580 tggacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaagg 639 |||| ||| || |||||||| ||||||||||| || ||||||||| ||| ||||| || Sbjct: 389 tggatagatctaaccttgcaaagcttgaactttgcttcctcatccttgatggagtggaga 330 Query: 640 cggaagcggccctt 653 ||||| || ||||| Sbjct: 329 cggaaacgtccctt 316 Score = 46.1 bits (23), Expect = 0.15 Identities = 32/35 (91%) Strand = Plus / Minus Query: 215 tcctcaatgatggtgagcttgatacccttgccctt 249 |||||||||||||| ||||| ||||| |||||||| Sbjct: 752 tcctcaatgatggtcagcttaatacctttgccctt 718
>gb|AY050933.1| Arabidopsis thaliana putative 40S ribosomal protein S4 (At5g07090) mRNA, complete cds Length = 1059 Score = 218 bits (110), Expect = 2e-53 Identities = 265/314 (84%), Gaps = 2/314 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||||| Sbjct: 651 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 592 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || ||||||||||| || ||||| ||| ||||||||||||||||| |||| Sbjct: 591 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 533 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||| ||| ||||| |||||||||||||| || | ||||||||| ||||| | Sbjct: 532 caatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcag 473 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 |||| ||||||||||| |||||| || |||||||||||||| || |||||||| || ||| Sbjct: 472 ggtaacggatggtgcgaccatca-taagtgttcaggtatggaattcccttctgaccaaac 414 Query: 580 tggacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaagg 639 |||| ||| || |||||||| ||||||||||| || ||||||||| ||| ||||| || Sbjct: 413 tggatagatctaaccttgcaaagcttgaactttgcttcctcatccttgatggagtggaga 354 Query: 640 cggaagcggccctt 653 ||||| || ||||| Sbjct: 353 cggaaacgtccctt 340 Score = 46.1 bits (23), Expect = 0.15 Identities = 32/35 (91%) Strand = Plus / Minus Query: 215 tcctcaatgatggtgagcttgatacccttgccctt 249 |||||||||||||| ||||| ||||| |||||||| Sbjct: 776 tcctcaatgatggtcagcttaatacctttgccctt 742
>gb|AY093715.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, complete cds Length = 789 Score = 218 bits (110), Expect = 2e-53 Identities = 265/314 (84%), Gaps = 2/314 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||||| Sbjct: 627 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 568 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || ||||||||||| || ||||| ||| ||||||||||||||||| |||| Sbjct: 567 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 509 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||| ||| ||||| |||||||||||||| || | ||||||||| ||||| | Sbjct: 508 caatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcag 449 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 |||| ||||||||||| |||||| || |||||||||||||| || |||||||| || ||| Sbjct: 448 ggtaacggatggtgcgaccatca-taagtgttcaggtatggaattcccttctgaccaaac 390 Query: 580 tggacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaagg 639 |||| ||| || |||||||| ||||||||||| || ||||||||| ||| ||||| || Sbjct: 389 tggatagatctaaccttgcaaagcttgaactttgcttcctcatccttgatggagtggaga 330 Query: 640 cggaagcggccctt 653 ||||| || ||||| Sbjct: 329 cggaaacgtccctt 316 Score = 46.1 bits (23), Expect = 0.15 Identities = 32/35 (91%) Strand = Plus / Minus Query: 215 tcctcaatgatggtgagcttgatacccttgccctt 249 |||||||||||||| ||||| ||||| |||||||| Sbjct: 752 tcctcaatgatggtcagcttaatacctttgccctt 718
>gb|AY070769.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, complete cds Length = 1008 Score = 218 bits (110), Expect = 2e-53 Identities = 265/314 (84%), Gaps = 2/314 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||||| Sbjct: 651 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 592 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || ||||||||||| || ||||| ||| ||||||||||||||||| |||| Sbjct: 591 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 533 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||| ||| ||||| |||||||||||||| || | ||||||||| ||||| | Sbjct: 532 caatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcag 473 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 |||| ||||||||||| |||||| || |||||||||||||| || |||||||| || ||| Sbjct: 472 ggtaacggatggtgcgaccatca-taagtgttcaggtatggaattcccttctgaccaaac 414 Query: 580 tggacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaagg 639 |||| ||| || |||||||| ||||||||||| || ||||||||| ||| ||||| || Sbjct: 413 tggatagatctaaccttgcaaagcttgaactttgcttcctcatccttgatggagtggaga 354 Query: 640 cggaagcggccctt 653 ||||| || ||||| Sbjct: 353 cggaaacgtccctt 340 Score = 46.1 bits (23), Expect = 0.15 Identities = 32/35 (91%) Strand = Plus / Minus Query: 215 tcctcaatgatggtgagcttgatacccttgccctt 249 |||||||||||||| ||||| ||||| |||||||| Sbjct: 776 tcctcaatgatggtcagcttaatacctttgccctt 742
>emb|BX832664.1|CNS09ZT5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH87ZG07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 976 Score = 218 bits (110), Expect = 2e-53 Identities = 265/314 (84%), Gaps = 2/314 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||||| Sbjct: 621 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 562 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || ||||||||||| || ||||| ||| ||||||||||||||||| |||| Sbjct: 561 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 503 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||| ||| ||||| |||||||||||||| || | ||||||||| ||||| | Sbjct: 502 caatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcag 443 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 |||| ||||||||||| |||||| || |||||||||||||| || |||||||| || ||| Sbjct: 442 ggtaacggatggtgcgaccatca-taagtgttcaggtatggaattcccttctgaccaaac 384 Query: 580 tggacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaagg 639 |||| ||| || |||||||| ||||||||||| || ||||||||| ||| ||||| || Sbjct: 383 tggatagatctaaccttgcaaagcttgaactttgcttcctcatccttgatggagtggaga 324 Query: 640 cggaagcggccctt 653 ||||| || ||||| Sbjct: 323 cggaaacgtccctt 310 Score = 46.1 bits (23), Expect = 0.15 Identities = 32/35 (91%) Strand = Plus / Minus Query: 215 tcctcaatgatggtgagcttgatacccttgccctt 249 |||||||||||||| ||||| ||||| |||||||| Sbjct: 746 tcctcaatgatggtcagcttaatacctttgccctt 712
>emb|BX832452.1|CNS09ZTE Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH74ZD04 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 942 Score = 218 bits (110), Expect = 2e-53 Identities = 265/314 (84%), Gaps = 2/314 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||||| Sbjct: 625 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 566 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || ||||||||||| || ||||| ||| ||||||||||||||||| |||| Sbjct: 565 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 507 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||| ||| ||||| |||||||||||||| || | ||||||||| ||||| | Sbjct: 506 caatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcag 447 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 |||| ||||||||||| |||||| || |||||||||||||| || |||||||| || ||| Sbjct: 446 ggtaacggatggtgcgaccatca-taagtgttcaggtatggaattcccttctgaccaaac 388 Query: 580 tggacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaagg 639 |||| ||| || |||||||| ||||||||||| || ||||||||| ||| ||||| || Sbjct: 387 tggatagatctaaccttgcaaagcttgaactttgcttcctcatccttgatggagtggaga 328 Query: 640 cggaagcggccctt 653 ||||| || ||||| Sbjct: 327 cggaaacgtccctt 314 Score = 46.1 bits (23), Expect = 0.15 Identities = 32/35 (91%) Strand = Plus / Minus Query: 215 tcctcaatgatggtgagcttgatacccttgccctt 249 |||||||||||||| ||||| ||||| |||||||| Sbjct: 750 tcctcaatgatggtcagcttaatacctttgccctt 716
>emb|BX832253.1|CNS09ZUO Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH61ZB04 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 945 Score = 218 bits (110), Expect = 2e-53 Identities = 265/314 (84%), Gaps = 2/314 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 |||||| ||||||||||||||||||||||| || | |||||| |||||||| |||||||| Sbjct: 625 gtggattgtctcaaaggttcccttatgcttttcacggttcttaatcacacccacacgccc 566 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || ||||||||||| || ||||| ||| ||||||||||||||||| |||| Sbjct: 565 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 507 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||| ||| ||||| |||||||||||||| || | ||||||||| ||||| | Sbjct: 506 caatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcag 447 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 |||| ||||||||||| |||||| || || ||||||||||| || |||||||| || ||| Sbjct: 446 ggtaacggatggtgcgaccatca-taagttttcaggtatggaattcccttctgaccaaac 388 Query: 580 tggacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaagg 639 |||| ||| || |||||||| ||||||||||| || ||||||||| ||| ||||| || Sbjct: 387 tggatagatctaaccttgcaaagcttgaactttgcttcctcatccttgatggagtggaga 328 Query: 640 cggaagcggccctt 653 ||||| || ||||| Sbjct: 327 cggaaacgtccctt 314
>gb|AY085205.1| Arabidopsis thaliana clone 13813 mRNA, complete sequence Length = 1011 Score = 218 bits (110), Expect = 2e-53 Identities = 265/314 (84%), Gaps = 2/314 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||||| Sbjct: 654 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 595 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || ||||||||||| || ||||| ||| ||||||||||||||||| |||| Sbjct: 594 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 536 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||| ||| ||||| |||||||||||||| || | ||||||||| ||||| | Sbjct: 535 caatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcag 476 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 |||| ||||||||||| |||||| || |||||||||||||| || |||||||| || ||| Sbjct: 475 ggtaacggatggtgcgaccatca-taagtgttcaggtatggaattcccttctgaccaaac 417 Query: 580 tggacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaagg 639 |||| ||| || |||||||| ||||||||||| || ||||||||| ||| ||||| || Sbjct: 416 tggatagatctaaccttgcaaagcttgaactttgcttcctcatccttgatggagtggaga 357 Query: 640 cggaagcggccctt 653 ||||| || ||||| Sbjct: 356 cggaaacgtccctt 343 Score = 46.1 bits (23), Expect = 0.15 Identities = 32/35 (91%) Strand = Plus / Minus Query: 215 tcctcaatgatggtgagcttgatacccttgccctt 249 |||||||||||||| ||||| ||||| |||||||| Sbjct: 779 tcctcaatgatggtcagcttaatacctttgccctt 745
>emb|AL163652.1|ATT28J14 Arabidopsis thaliana DNA chromosome 5, BAC clone T28J14 (ESSA project) Length = 104607 Score = 204 bits (103), Expect = 3e-49 Identities = 231/271 (85%), Gaps = 2/271 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||||| Sbjct: 7896 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 7837 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || ||||||||||| || ||||| ||| ||||||||||||||||| |||| Sbjct: 7836 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 7778 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||| ||| ||||| |||||||||||||| || | ||||||||| ||||| | Sbjct: 7777 caatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcag 7718 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 |||| ||||||||||| |||||| || |||||||||||||| || |||||||| || ||| Sbjct: 7717 ggtaacggatggtgcgaccatca-taagtgttcaggtatggaattcccttctgaccaaac 7659 Query: 580 tggacagacctgaccttgcagagcttgaact 610 |||| ||| || |||||||| |||||||||| Sbjct: 7658 tggatagatctaaccttgcaaagcttgaact 7628 Score = 46.1 bits (23), Expect = 0.15 Identities = 32/35 (91%) Strand = Plus / Minus Query: 215 tcctcaatgatggtgagcttgatacccttgccctt 249 |||||||||||||| ||||| ||||| |||||||| Sbjct: 8021 tcctcaatgatggtcagcttaatacctttgccctt 7987
>emb|BX824247.1|CNS0A6X1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH32ZH05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1168 Score = 204 bits (103), Expect = 3e-49 Identities = 231/271 (85%), Gaps = 2/271 (0%) Strand = Plus / Plus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||||| Sbjct: 354 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 413 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || ||||||||||| || ||||| ||| ||||||||||||||||| |||| Sbjct: 414 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 472 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||| ||| ||||| |||||||||||||| || | ||||||||| ||||| | Sbjct: 473 caatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcag 532 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 |||| ||||||||||| |||||| || |||||||||||||| || |||||||| || ||| Sbjct: 533 ggtaacggatggtgcgaccatca-taagtgttcaggtatggaattcccttctgaccaaac 591 Query: 580 tggacagacctgaccttgcagagcttgaact 610 |||| ||| || |||||||| |||||||||| Sbjct: 592 tggatagatctaaccttgcaaagcttgaact 622 Score = 46.1 bits (23), Expect = 0.15 Identities = 32/35 (91%) Strand = Plus / Plus Query: 215 tcctcaatgatggtgagcttgatacccttgccctt 249 |||||||||||||| ||||| ||||| |||||||| Sbjct: 229 tcctcaatgatggtcagcttaatacctttgccctt 263
>dbj|AB010697.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOJ9 Length = 86380 Score = 204 bits (103), Expect = 3e-49 Identities = 231/271 (85%), Gaps = 2/271 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||||| Sbjct: 82619 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 82560 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || ||||||||||| || ||||| ||| ||||||||||||||||| |||| Sbjct: 82559 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 82501 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||| ||| ||||| |||||||||||||| || | ||||||||| ||||| | Sbjct: 82500 caatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcag 82441 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 |||| ||||||||||| |||||| || |||||||||||||| || |||||||| || ||| Sbjct: 82440 ggtaacggatggtgcgaccatca-taagtgttcaggtatggaattcccttctgaccaaac 82382 Query: 580 tggacagacctgaccttgcagagcttgaact 610 |||| ||| || |||||||| |||||||||| Sbjct: 82381 tggatagatctaaccttgcaaagcttgaact 82351 Score = 46.1 bits (23), Expect = 0.15 Identities = 32/35 (91%) Strand = Plus / Minus Query: 215 tcctcaatgatggtgagcttgatacccttgccctt 249 |||||||||||||| ||||| ||||| |||||||| Sbjct: 82744 tcctcaatgatggtcagcttaatacctttgccctt 82710
>emb|X76651.1|STRPS4 S.tuberosum (Desiree) mRNA for ribosomal protein S4 Length = 966 Score = 202 bits (102), Expect = 1e-48 Identities = 323/394 (81%), Gaps = 2/394 (0%) Strand = Plus / Minus Query: 260 acccaaggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactgg 319 ||||| ||||| || ||||| |||| |||||||| || |||| ||| || ||||| | Sbjct: 756 acccacggcttagtacccttaccaagagtgaacacatttcccaaacgtgtagcaaattca 697 Query: 320 tgaccctgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttc 379 |||||||| | ||||| || ||||| |||||||||| | ||||||||||||||||||||| Sbjct: 696 tgaccctgtgaatcctgaatgtggagggtctcaaagctacccttatgcttctccctgttc 637 Query: 380 ttgatcacaccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgcccgac 439 || || |||||||| || || |||| | || ||||||||||| || || || ||| || Sbjct: 636 ttaataacaccaactcgtcccctgtttctacctccagtcaccatcacaacatt-cccaac 578 Query: 440 gtcaaacttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgtt 499 ||||||||||||||| ||||||||||| |||| |||| ||| ||||| ||||| ||||| Sbjct: 577 gtcaaacttgatgaaatcaacaatcttattggattccaagtccagctttatggtatcgtt 518 Query: 500 ggccttgatgagtgggtctgggtagcggatggtgcggccatcattaggtgttcaggtatg 559 |||||||||||| || || || |||||||| || | ||||| || ||||||||||||| Sbjct: 517 ggccttgatgagaggatcaggatagcggattgttcttccatc-gtaagtgttcaggtatg 459 Query: 560 ggatgcccttctggccgaactggacagacctgaccttgcagagcttgaacttagcatcct 619 |||| |||||||| || ||||| ||||| | ||||||||| ||||| ||||| | |||| Sbjct: 458 ggatccccttctgaccaaactgcacagagcggaccttgcaaagcttaaacttggattcct 399 Query: 620 catccctgacagagtgaaggcggaagcggccctt 653 | ||||||| |||||||| ||||| |||||||| Sbjct: 398 cgtccctgagcgagtgaagacggaatcggccctt 365
>emb|BX832256.1|CNS09ZVR Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH61ZC05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 952 Score = 196 bits (99), Expect = 7e-47 Identities = 263/314 (83%), Gaps = 4/314 (1%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||||| Sbjct: 614 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 555 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || ||||||||||| || ||||| ||| ||||||||||||||||| |||| Sbjct: 554 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 496 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||| ||| ||||| ||||||||||| | || | ||||||||| ||||| | Sbjct: 495 caatcttgttctcctcaaggtccagcttgatggt--catttggcttgatgagcgggtcag 438 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 |||| ||||||||||| ||||||| || ||||||||||||| || |||||||| || ||| Sbjct: 437 ggtaacggatggtgcgaccatcataag-tgttcaggtatggaattcccttctgaccaaac 379 Query: 580 tggacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaagg 639 |||| ||| || |||||||| ||||||||||| || ||||||||| ||| ||||| || Sbjct: 378 tggatagatctaaccttgcaaagcttgaactttgcttcctcatccttgatggagtggaga 319 Query: 640 cggaagcggccctt 653 ||||| || ||||| Sbjct: 318 cggaaacgtccctt 305 Score = 46.1 bits (23), Expect = 0.15 Identities = 32/35 (91%) Strand = Plus / Minus Query: 215 tcctcaatgatggtgagcttgatacccttgccctt 249 |||||||||||||| ||||| ||||| |||||||| Sbjct: 739 tcctcaatgatggtcagcttaatacctttgccctt 705
>gb|AC126779.19| Medicago truncatula clone mth2-34m14, complete sequence Length = 128856 Score = 194 bits (98), Expect = 3e-46 Identities = 316/386 (81%), Gaps = 2/386 (0%) Strand = Plus / Minus Query: 187 ctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttgatacccttgcc 246 ||||||||| ||| |||||||||| |||||||||| || | || |||||||| || Sbjct: 83725 ctgagctgcagcagccctcttcctagcttcctcaatgacagttaatttaatacccttacc 83666 Query: 247 cttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttgcccagacg 306 |||||| || ||||| ||||| || ||||||||||| |||||||| ||| ||||||| Sbjct: 83665 cttgggaagagatacccatggctttgtccccttgccaatagtgaacacattgaccagacg 83606 Query: 307 ggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaaggttcccttatg 366 || ||||||| ||||| |||||||| ||||||||| |||||||||||||||||||| Sbjct: 83605 agttgcaaactcatgaccagtggcatcctgaacgtggattgtctcaaaggttcccttatg 83546 Query: 367 cttctccctgttcttgatcacaccaacacgcccagtgttgcgcccaccagtcaccatgac 426 ||| || |||||||||||||| ||||||||||| | || |||||||| ||||| || Sbjct: 83545 cttttctctgttcttgatcactccaacacgccccctattcttaccaccagtaaccatcac 83486 Query: 427 gacgttgcccgacgtcaaacttgatgaagtcaacaatcttgttggtctccaggtcgagct 486 || || ||| || || || |||||||| || ||||||||||| ||| ||||| |||| Sbjct: 83485 tacatt-cccaacatcgaatttgatgaaatcgacaatcttgttttcctcaaggtccagct 83427 Query: 487 tgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcggccatcattag 546 |||| ||||| || ||| |||||| |||||| ||||||||||| ||||| |||||| ||| Sbjct: 83426 tgattgtgtcattagccctgatgactgggtcagggtagcggatagtgcgaccatca-tag 83368 Query: 547 gtgttcaggtatgggatgcccttctg 572 ||||||||||||||||| || ||||| Sbjct: 83367 gtgttcaggtatgggatacctttctg 83342
>gb|DQ268839.1| Solanum tuberosum clone 130D11 40S ribosomal protein S4-like protein mRNA, complete cds Length = 1052 Score = 194 bits (98), Expect = 3e-46 Identities = 322/394 (81%), Gaps = 2/394 (0%) Strand = Plus / Minus Query: 260 acccaaggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactgg 319 ||||| ||||| || ||||| |||| |||||||| || |||| ||| || ||||| | Sbjct: 739 acccacggcttagtacccttaccaagagtgaacacatttcccaaacgtgtagcaaattca 680 Query: 320 tgaccctgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttc 379 |||||||| | ||| | || ||||| |||||||||| | ||||||||||||||||||||| Sbjct: 679 tgaccctgtgaatcttgaatgtggagggtctcaaagctacccttatgcttctccctgttc 620 Query: 380 ttgatcacaccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgcccgac 439 || || |||||||| || || |||| | || ||||||||||| || || || ||| || Sbjct: 619 ttaataacaccaactcgtcccctgtttctacctccagtcaccatcacaacatt-cccaac 561 Query: 440 gtcaaacttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgtt 499 ||||||||||||||| ||||||||||| |||| |||| ||| ||||| ||||| ||||| Sbjct: 560 gtcaaacttgatgaaatcaacaatcttattggattccaagtccagctttatggtatcgtt 501 Query: 500 ggccttgatgagtgggtctgggtagcggatggtgcggccatcattaggtgttcaggtatg 559 |||||||||||| || || || |||||||| || | ||||| || ||||||||||||| Sbjct: 500 ggccttgatgagaggatcaggatagcggattgttcttccatc-gtaagtgttcaggtatg 442 Query: 560 ggatgcccttctggccgaactggacagacctgaccttgcagagcttgaacttagcatcct 619 |||| |||||||| || ||||| ||||| | ||||||||| ||||| ||||| | |||| Sbjct: 441 ggatccccttctgaccaaactgcacagagcggaccttgcaaagcttaaacttggattcct 382 Query: 620 catccctgacagagtgaaggcggaagcggccctt 653 | ||||||| |||||||| ||||| |||||||| Sbjct: 381 cgtccctgagcgagtgaagacggaatcggccctt 348
>dbj|AB232685.1| Panax ginseng mRNA for ribosomal protein S4, complete cds Length = 1105 Score = 188 bits (95), Expect = 2e-44 Identities = 349/431 (80%), Gaps = 2/431 (0%) Strand = Plus / Minus Query: 214 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 273 ||||||||||||||| | |||||||||||||||||||| || |||||| ||||| || Sbjct: 840 ctcctcaatgatggttaatttgatacccttgcccttgggaagagacacccatggctttgt 781 Query: 274 gcccttgccaatggtgaacacgttgcccagacgggtggcaaactggtgaccctgggcatc 333 || || || ||||| || || ||||| ||||| || ||||||| |||||| ||| ||| Sbjct: 780 accttttccgatggtaaaaacattgcctagacgagtagcaaactcgtgaccaagggaatc 721 Query: 334 ctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaac 393 || || ||| | ||||| ||| | |||||||| ||||||||||||||||| || ||||| Sbjct: 720 ctgaatgtgaacagtctcgaagctccccttatgtttctccctgttcttgataactccaac 661 Query: 394 acgcccagtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatga 453 |||||||| || | ||| |||||||||||||| || || || || || ||||| |||| Sbjct: 660 tcgcccagtattcctccccccagtcaccatgacaacatt-tccaacatcgaacttaatga 602 Query: 454 agtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtg 513 | ||| | |||||||| | ||||| ||| || ||||||||||| |||||||| ||||| | Sbjct: 601 aatcagctatcttgtttgcctccaagtcaagtttgatggtgtcattggccttaatgagcg 542 Query: 514 ggtctgggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctgg 573 ||||||| || ||||| || || |||||| ||||| || | ||| || ||||| ||||| Sbjct: 541 ggtctggataacggatagtacgcccatca-taggtattgatgtacggaatgcctttctga 483 Query: 574 ccgaactggacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagag 633 |||||||| || ||||| || ||||| | ||| ||||| || |||||||||||||| ||| Sbjct: 482 ccgaactgaactgacctaactttgcacaacttaaactttgcctcctcatccctgaccgag 423 Query: 634 tgaaggcggaa 644 || |||||||| Sbjct: 422 tgtaggcggaa 412
>dbj|D21302.1|RICSS536 Oryza sativa SS536 mRNA for ribosomal protein S4, partial sequence Length = 347 Score = 180 bits (91), Expect = 4e-42 Identities = 200/236 (84%), Gaps = 3/236 (1%) Strand = Plus / Minus Query: 446 cttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgttggcctt 505 |||||| ||| | | ||||||||||||||| || ||| ||||| ||| |||| ||||| Sbjct: 330 cttgatnaagncganaatcttgttggtctcnagancgatcttgantgtgccgtttgcctt 271 Query: 506 gatgagtgggtctgggtagcggatggtgcggccatcattaggtgttcaggtatgggatgc 565 ||||| ||||| ||||| ||||||||||| ||||||| |||||| |||||| ||||| | Sbjct: 270 gatgatcgggtcagggtancggatggtgcgaccatcat-aggtgtncaggtaggggattc 212 Query: 566 ccttctggccgaactggacagacctgaccttgcagagcttgaacttagcatcctcatccc 625 ||||||||| ||||| ||||||| |||||||| |||||||||||||||||||||||| Sbjct: 211 ccttctggcnaaactgcacagaccgaaccttgcaaagcttgaacttagcatcctcatcct 152 Query: 626 tgacagagtgaaggcggaagcggccctttggtgtcatacagaagccctgtagttct 681 ||||||| |||||| |||| || ||| |||||||| || ||||| ||||||||||| Sbjct: 151 tgacagactgaaggnggaaacgtccc-ttggtgtcgtanagaag-cctgtagttct 98
>ref|NM_125228.3| Arabidopsis thaliana structural constituent of ribosome AT5G58420 mRNA, complete cds Length = 1080 Score = 178 bits (90), Expect = 2e-41 Identities = 260/314 (82%), Gaps = 2/314 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||||||||| Sbjct: 720 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 661 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || || || ||||| || || ||||| || |||||||||||||| || | Sbjct: 660 tctgtttctacctcctgtaaccatcacaacattgcca-acatcaaacttgatgaactcga 602 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||||| ||| |||||||||||||||||||| || | ||||||||| ||||| | Sbjct: 601 caatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcag 542 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 |||| ||||||||||| ||||| || ||||||||||| || ||||| ||||| || ||| Sbjct: 541 ggtaacggatggtgcgaccatc-gtaagtgttcaggtaaggaatgcctttctgtccaaac 483 Query: 580 tggacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaagg 639 |||| ||| | |||||||| || |||||||| || ||||||||| ||| ||||| || Sbjct: 482 tggatagatcgaaccttgcaaagtttgaactttgcttcctcatccttgatggagtggaga 423 Query: 640 cggaagcggccctt 653 ||||| || ||||| Sbjct: 422 cggaaacgtccctt 409 Score = 58.0 bits (29), Expect = 4e-05 Identities = 68/81 (83%) Strand = Plus / Minus Query: 214 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 273 |||||| ||||| || ||||||||||| ||||||||||| || |||||| ||||| || Sbjct: 846 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 787 Query: 274 gcccttgccaatggtgaacac 294 || |||||||||||| |||| Sbjct: 786 tcctttgccaatggtgtacac 766
>gb|AY143834.1| Arabidopsis thaliana At5g58420/mqj2_10 mRNA, complete cds Length = 789 Score = 178 bits (90), Expect = 2e-41 Identities = 260/314 (82%), Gaps = 2/314 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||||||||| Sbjct: 627 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 568 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || || || ||||| || || ||||| || |||||||||||||| || | Sbjct: 567 tctgtttctacctcctgtaaccatcacaacattgcca-acatcaaacttgatgaactcga 509 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||||| ||| |||||||||||||||||||| || | ||||||||| ||||| | Sbjct: 508 caatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcag 449 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 |||| ||||||||||| ||||| || ||||||||||| || ||||| ||||| || ||| Sbjct: 448 ggtaacggatggtgcgaccatc-gtaagtgttcaggtaaggaatgcctttctgtccaaac 390 Query: 580 tggacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaagg 639 |||| ||| | |||||||| || |||||||| || ||||||||| ||| ||||| || Sbjct: 389 tggatagatcgaaccttgcaaagtttgaactttgcttcctcatccttgatggagtggaga 330 Query: 640 cggaagcggccctt 653 ||||| || ||||| Sbjct: 329 cggaaacgtccctt 316 Score = 58.0 bits (29), Expect = 4e-05 Identities = 68/81 (83%) Strand = Plus / Minus Query: 214 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 273 |||||| ||||| || ||||||||||| ||||||||||| || |||||| ||||| || Sbjct: 753 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 694 Query: 274 gcccttgccaatggtgaacac 294 || |||||||||||| |||| Sbjct: 693 tcctttgccaatggtgtacac 673
>gb|AY070467.1| Arabidopsis thaliana AT5g58420/mqj2_10 mRNA, complete cds Length = 995 Score = 178 bits (90), Expect = 2e-41 Identities = 260/314 (82%), Gaps = 2/314 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||||||||| Sbjct: 700 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 641 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || || || ||||| || || ||||| || |||||||||||||| || | Sbjct: 640 tctgtttctacctcctgtaaccatcacaacattgcca-acatcaaacttgatgaactcga 582 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||||| ||| |||||||||||||||||||| || | ||||||||| ||||| | Sbjct: 581 caatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcag 522 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 |||| ||||||||||| ||||| || ||||||||||| || ||||| ||||| || ||| Sbjct: 521 ggtaacggatggtgcgaccatc-gtaagtgttcaggtaaggaatgcctttctgtccaaac 463 Query: 580 tggacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaagg 639 |||| ||| | |||||||| || |||||||| || ||||||||| ||| ||||| || Sbjct: 462 tggatagatcgaaccttgcaaagtttgaactttgcttcctcatccttgatggagtggaga 403 Query: 640 cggaagcggccctt 653 ||||| || ||||| Sbjct: 402 cggaaacgtccctt 389 Score = 58.0 bits (29), Expect = 4e-05 Identities = 68/81 (83%) Strand = Plus / Minus Query: 214 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 273 |||||| ||||| || ||||||||||| ||||||||||| || |||||| ||||| || Sbjct: 826 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 767 Query: 274 gcccttgccaatggtgaacac 294 || |||||||||||| |||| Sbjct: 766 tcctttgccaatggtgtacac 746
>gb|AF428285.1|AF428285 Arabidopsis thaliana AT5g58420/mqj2_10 mRNA, complete cds Length = 1005 Score = 178 bits (90), Expect = 2e-41 Identities = 260/314 (82%), Gaps = 2/314 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||||||||| Sbjct: 711 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 652 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || || || ||||| || || ||||| || |||||||||||||| || | Sbjct: 651 tctgtttctacctcctgtaaccatcacaacattgcca-acatcaaacttgatgaactcga 593 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||||| ||| |||||||||||||||||||| || | ||||||||| ||||| | Sbjct: 592 caatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcag 533 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 |||| ||||||||||| ||||| || ||||||||||| || ||||| ||||| || ||| Sbjct: 532 ggtaacggatggtgcgaccatc-gtaagtgttcaggtaaggaatgcctttctgtccaaac 474 Query: 580 tggacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaagg 639 |||| ||| | |||||||| || |||||||| || ||||||||| ||| ||||| || Sbjct: 473 tggatagatcgaaccttgcaaagtttgaactttgcttcctcatccttgatggagtggaga 414 Query: 640 cggaagcggccctt 653 ||||| || ||||| Sbjct: 413 cggaaacgtccctt 400 Score = 58.0 bits (29), Expect = 4e-05 Identities = 68/81 (83%) Strand = Plus / Minus Query: 214 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 273 |||||| ||||| || ||||||||||| ||||||||||| || |||||| ||||| || Sbjct: 837 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 778 Query: 274 gcccttgccaatggtgaacac 294 || |||||||||||| |||| Sbjct: 777 tcctttgccaatggtgtacac 757
>emb|BX830283.1|CNS09ZZO Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB70ZD03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 988 Score = 178 bits (90), Expect = 2e-41 Identities = 260/314 (82%), Gaps = 2/314 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||||||||| Sbjct: 691 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 632 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || || || ||||| || || ||||| || |||||||||||||| || | Sbjct: 631 tctgtttctacctcctgtaaccatcacaacattgcca-acatcaaacttgatgaactcga 573 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||||| ||| |||||||||||||||||||| || | ||||||||| ||||| | Sbjct: 572 caatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcag 513 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 |||| ||||||||||| ||||| || ||||||||||| || ||||| ||||| || ||| Sbjct: 512 ggtaacggatggtgcgaccatc-gtaagtgttcaggtaaggaatgcctttctgtccaaac 454 Query: 580 tggacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaagg 639 |||| ||| | |||||||| || |||||||| || ||||||||| ||| ||||| || Sbjct: 453 tggatagatcgaaccttgcaaagtttgaactttgcttcctcatccttgatggagtggaga 394 Query: 640 cggaagcggccctt 653 ||||| || ||||| Sbjct: 393 cggaaacgtccctt 380 Score = 58.0 bits (29), Expect = 4e-05 Identities = 68/81 (83%) Strand = Plus / Minus Query: 214 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 273 |||||| ||||| || ||||||||||| ||||||||||| || |||||| ||||| || Sbjct: 817 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 758 Query: 274 gcccttgccaatggtgaacac 294 || |||||||||||| |||| Sbjct: 757 tcctttgccaatggtgtacac 737
>emb|BX830139.1|CNS09ZZ0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB61ZG04 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 737 Score = 178 bits (90), Expect = 2e-41 Identities = 260/314 (82%), Gaps = 2/314 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||||||||| Sbjct: 440 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 381 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || || || ||||| || || ||||| || |||||||||||||| || | Sbjct: 380 tctgtttctacctcctgtaaccatcacaacattgcca-acatcaaacttgatgaactcga 322 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||||| ||| |||||||||||||||||||| || | ||||||||| ||||| | Sbjct: 321 caatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcag 262 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 |||| ||||||||||| ||||| || ||||||||||| || ||||| ||||| || ||| Sbjct: 261 ggtaacggatggtgcgaccatc-gtaagtgttcaggtaaggaatgcctttctgtccaaac 203 Query: 580 tggacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaagg 639 |||| ||| | |||||||| || |||||||| || ||||||||| ||| ||||| || Sbjct: 202 tggatagatcgaaccttgcaaagtttgaactttgcttcctcatccttgatggagtggaga 143 Query: 640 cggaagcggccctt 653 ||||| || ||||| Sbjct: 142 cggaaacgtccctt 129 Score = 58.0 bits (29), Expect = 4e-05 Identities = 68/81 (83%) Strand = Plus / Minus Query: 214 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 273 |||||| ||||| || ||||||||||| ||||||||||| || |||||| ||||| || Sbjct: 566 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 507 Query: 274 gcccttgccaatggtgaacac 294 || |||||||||||| |||| Sbjct: 506 tcctttgccaatggtgtacac 486
>emb|BX832264.1|CNS09ZM6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH61ZG11 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 997 Score = 178 bits (90), Expect = 2e-41 Identities = 260/314 (82%), Gaps = 2/314 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||||||||| Sbjct: 700 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 641 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || || || ||||| || || ||||| || |||||||||||||| || | Sbjct: 640 tctgtttctacctcctgtaaccatcacaacattgcca-acatcaaacttgatgaactcga 582 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||||| ||| |||||||||||||||||||| || | ||||||||| ||||| | Sbjct: 581 caatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcag 522 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 |||| ||||||||||| ||||| || ||||||||||| || ||||| ||||| || ||| Sbjct: 521 ggtaacggatggtgcgaccatc-gtaagtgttcaggtaaggaatgcctttctgtccaaac 463 Query: 580 tggacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaagg 639 |||| ||| | |||||||| || |||||||| || ||||||||| ||| ||||| || Sbjct: 462 tggatagatcgaaccttgcaaagtttgaactttgcttcctcatccttgatggagtggaga 403 Query: 640 cggaagcggccctt 653 ||||| || ||||| Sbjct: 402 cggaaacgtccctt 389 Score = 58.0 bits (29), Expect = 4e-05 Identities = 68/81 (83%) Strand = Plus / Minus Query: 214 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 273 |||||| ||||| || ||||||||||| ||||||||||| || |||||| ||||| || Sbjct: 826 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 767 Query: 274 gcccttgccaatggtgaacac 294 || |||||||||||| |||| Sbjct: 766 tcctttgccaatggtgtacac 746
>gb|AY086206.1| Arabidopsis thaliana clone 22434 mRNA, complete sequence Length = 1010 Score = 178 bits (90), Expect = 2e-41 Identities = 260/314 (82%), Gaps = 2/314 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||||||||| Sbjct: 715 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 656 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || || || ||||| || || ||||| || |||||||||||||| || | Sbjct: 655 tctgtttctacctcctgtaaccatcacaacattgcca-acatcaaacttgatgaactcca 597 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||||| ||| |||||||||||||||||||| || | ||||||||| ||||| | Sbjct: 596 caatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcag 537 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 |||| ||||||||||| ||||| || ||||||||||| || ||||| ||||| || ||| Sbjct: 536 ggtaacggatggtgcgaccatc-gtaagtgttcaggtaaggaatgcctttctgtccaaac 478 Query: 580 tggacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaagg 639 |||| ||| | |||||||| || |||||||| || ||||||||| ||| ||||| || Sbjct: 477 tggatagatcgaaccttgcaaagtttgaactttgcttcctcatccttgatggagtggaga 418 Query: 640 cggaagcggccctt 653 ||||| || ||||| Sbjct: 417 cggaaacgtccctt 404 Score = 58.0 bits (29), Expect = 4e-05 Identities = 68/81 (83%) Strand = Plus / Minus Query: 214 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 273 |||||| ||||| || ||||||||||| ||||||||||| || |||||| ||||| || Sbjct: 841 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 782 Query: 274 gcccttgccaatggtgaacac 294 || |||||||||||| |||| Sbjct: 781 tcctttgccaatggtgtacac 761
>gb|AY084230.1| Arabidopsis thaliana clone 10042 mRNA, complete sequence Length = 1023 Score = 178 bits (90), Expect = 2e-41 Identities = 270/326 (82%), Gaps = 3/326 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 ||||||||| |||||| | ||||| || ||||| | |||||| ||||||||||||||||| Sbjct: 740 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 681 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || ||||| ||||| || ||||||||| || |||||||| ||||| || | Sbjct: 680 tctgtttcttcctccagtgaccataactacgttgccc-acatcaaacttaatgaactcca 622 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||| ||| ||||||||||||||||||||||| | ||||||||| ||||| | Sbjct: 621 caatcttgttctcctcaaggtcgagcttgatggtgtcgttaggcttgatgagcgggtcag 562 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 |||| ||||||||||| |||||| || ||||||| ||| || || |||||||| || || Sbjct: 561 ggtaacggatggtgcgaccatca-tatgtgttcaagtagggaatacccttctgaccaaat 503 Query: 580 tggacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaagg 639 |||| || || || ||||| |||||||||||||| ||||||||| ||| ||||| || Sbjct: 502 tggatcgatctcactttgcaaagcttgaacttagcctcctcatccttgatggagtggaga 443 Query: 640 cggaagcggccctttggtgtcataca 665 ||||| || ||| ||||||||||||| Sbjct: 442 cggaaacgtccc-ttggtgtcataca 418
>ref|NM_127291.2| Arabidopsis thaliana structural constituent of ribosome AT2G17360 mRNA, complete cds Length = 1074 Score = 170 bits (86), Expect = 4e-39 Identities = 269/326 (82%), Gaps = 3/326 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 ||||||||| |||||| | ||||| || ||||| | |||||| ||||||||||||||||| Sbjct: 740 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 681 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || ||||| ||||| || ||||||||| || |||||||| ||||| || | Sbjct: 680 tctgtttcttcctccagtgaccataactacgttgccc-acatcaaacttaatgaactcca 622 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||| ||| ||||||||||||||||||||||| | ||||||||| ||||| | Sbjct: 621 caatcttgttctcctcaaggtcgagcttgatggtgtcgttaggcttgatgagcgggtcag 562 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 | || ||||||||||| |||||| || ||||||| ||| || || |||||||| || || Sbjct: 561 gataacggatggtgcgaccatca-tatgtgttcaagtagggaatacccttctgaccaaat 503 Query: 580 tggacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaagg 639 |||| || || || ||||| |||||||||||||| ||||||||| ||| ||||| || Sbjct: 502 tggatcgatctcactttgcaaagcttgaacttagcctcctcatccttgatggagtggaga 443 Query: 640 cggaagcggccctttggtgtcataca 665 ||||| || ||| ||||||||||||| Sbjct: 442 cggaaacgtccc-ttggtgtcataca 418
>gb|AY062983.1| Arabidopsis thaliana putative ribosomal protein S4 (At2g17360) mRNA, complete cds Length = 817 Score = 170 bits (86), Expect = 4e-39 Identities = 269/326 (82%), Gaps = 3/326 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 ||||||||| |||||| | ||||| || ||||| | |||||| ||||||||||||||||| Sbjct: 627 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 568 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || ||||| ||||| || ||||||||| || |||||||| ||||| || | Sbjct: 567 tctgtttcttcctccagtgaccataactacgttgccc-acatcaaacttaatgaactcca 509 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||| ||| ||||||||||||||||||||||| | ||||||||| ||||| | Sbjct: 508 caatcttgttctcctcaaggtcgagcttgatggtgtcgttaggcttgatgagcgggtcag 449 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 | || ||||||||||| |||||| || ||||||| ||| || || |||||||| || || Sbjct: 448 gataacggatggtgcgaccatca-tatgtgttcaagtagggaatacccttctgaccaaat 390 Query: 580 tggacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaagg 639 |||| || || || ||||| |||||||||||||| ||||||||| ||| ||||| || Sbjct: 389 tggatcgatctcactttgcaaagcttgaacttagcctcctcatccttgatggagtggaga 330 Query: 640 cggaagcggccctttggtgtcataca 665 ||||| || ||| ||||||||||||| Sbjct: 329 cggaaacgtccc-ttggtgtcataca 305
>gb|AY035131.1| Arabidopsis thaliana putative ribosomal protein S4 (At2g17360) mRNA, complete cds Length = 1032 Score = 170 bits (86), Expect = 4e-39 Identities = 269/326 (82%), Gaps = 3/326 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 ||||||||| |||||| | ||||| || ||||| | |||||| ||||||||||||||||| Sbjct: 699 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 640 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || ||||| ||||| || ||||||||| || |||||||| ||||| || | Sbjct: 639 tctgtttcttcctccagtgaccataactacgttgccc-acatcaaacttaatgaactcca 581 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||| ||| ||||||||||||||||||||||| | ||||||||| ||||| | Sbjct: 580 caatcttgttctcctcaaggtcgagcttgatggtgtcgttaggcttgatgagcgggtcag 521 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 | || ||||||||||| |||||| || ||||||| ||| || || |||||||| || || Sbjct: 520 gataacggatggtgcgaccatca-tatgtgttcaagtagggaatacccttctgaccaaat 462 Query: 580 tggacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaagg 639 |||| || || || ||||| |||||||||||||| ||||||||| ||| ||||| || Sbjct: 461 tggatcgatctcactttgcaaagcttgaacttagcctcctcatccttgatggagtggaga 402 Query: 640 cggaagcggccctttggtgtcataca 665 ||||| || ||| ||||||||||||| Sbjct: 401 cggaaacgtccc-ttggtgtcataca 377
>gb|AY064625.1| Arabidopsis thaliana unknown protein mRNA, complete cds Length = 813 Score = 170 bits (86), Expect = 4e-39 Identities = 269/326 (82%), Gaps = 3/326 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 ||||||||| |||||| | ||||| || ||||| | |||||| ||||||||||||||||| Sbjct: 627 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 568 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || ||||| ||||| || ||||||||| || |||||||| ||||| || | Sbjct: 567 tctgtttcttcctccagtgaccataactacgttgccc-acatcaaacttaatgaactcca 509 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||| ||| ||||||||||||||||||||||| | ||||||||| ||||| | Sbjct: 508 caatcttgttctcctcaaggtcgagcttgatggtgtcgttaggcttgatgagcgggtcag 449 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 | || ||||||||||| |||||| || ||||||| ||| || || |||||||| || || Sbjct: 448 gataacggatggtgcgaccatca-tatgtgttcaagtagggaatacccttctgaccaaat 390 Query: 580 tggacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaagg 639 |||| || || || ||||| |||||||||||||| ||||||||| ||| ||||| || Sbjct: 389 tggatcgatctcactttgcaaagcttgaacttagcctcctcatccttgatggagtggaga 330 Query: 640 cggaagcggccctttggtgtcataca 665 ||||| || ||| ||||||||||||| Sbjct: 329 cggaaacgtccc-ttggtgtcataca 305
>gb|AF370469.1|AF370469 Arabidopsis thaliana Unknown protein mRNA, complete cds Length = 1034 Score = 170 bits (86), Expect = 4e-39 Identities = 269/326 (82%), Gaps = 3/326 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 ||||||||| |||||| | ||||| || ||||| | |||||| ||||||||||||||||| Sbjct: 700 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 641 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || ||||| ||||| || ||||||||| || |||||||| ||||| || | Sbjct: 640 tctgtttcttcctccagtgaccataactacgttgccc-acatcaaacttaatgaactcca 582 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||| ||| ||||||||||||||||||||||| | ||||||||| ||||| | Sbjct: 581 caatcttgttctcctcaaggtcgagcttgatggtgtcgttaggcttgatgagcgggtcag 522 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 | || ||||||||||| |||||| || ||||||| ||| || || |||||||| || || Sbjct: 521 gataacggatggtgcgaccatca-tatgtgttcaagtagggaatacccttctgaccaaat 463 Query: 580 tggacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaagg 639 |||| || || || ||||| |||||||||||||| ||||||||| ||| ||||| || Sbjct: 462 tggatcgatctcactttgcaaagcttgaacttagcctcctcatccttgatggagtggaga 403 Query: 640 cggaagcggccctttggtgtcataca 665 ||||| || ||| ||||||||||||| Sbjct: 402 cggaaacgtccc-ttggtgtcataca 378
>emb|BX818868.1|CNS0A8UP Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB21ZB04 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1007 Score = 170 bits (86), Expect = 4e-39 Identities = 269/326 (82%), Gaps = 3/326 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 ||||||||| |||||| | ||||| || ||||| | |||||| ||||||||||||||||| Sbjct: 692 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 633 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || ||||| ||||| || ||||||||| || |||||||| ||||| || | Sbjct: 632 tctgtttcttcctccagtgaccataactacgttgccc-acatcaaacttaatgaactcca 574 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||| ||| ||||||||||||||||||||||| | ||||||||| ||||| | Sbjct: 573 caatcttgttctcctcaaggtcgagcttgatggtgtcgttaggcttgatgagcgggtcag 514 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 | || ||||||||||| |||||| || ||||||| ||| || || |||||||| || || Sbjct: 513 gataacggatggtgcgaccatca-tatgtgttcaagtagggaatacccttctgaccaaat 455 Query: 580 tggacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaagg 639 |||| || || || ||||| |||||||||||||| ||||||||| ||| ||||| || Sbjct: 454 tggatcgatctcactttgcaaagcttgaacttagcctcctcatccttgatggagtggaga 395 Query: 640 cggaagcggccctttggtgtcataca 665 ||||| || ||| ||||||||||||| Sbjct: 394 cggaaacgtccc-ttggtgtcataca 370
>emb|BX832274.1|CNS09ZPH Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH62ZE09 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 978 Score = 165 bits (83), Expect = 2e-37 Identities = 260/315 (82%), Gaps = 3/315 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||||||||| Sbjct: 721 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 662 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || || || ||||| || || ||||| || |||||||||||||| || | Sbjct: 661 tctgtttctacctcctgtaaccatcacaacattgcca-acatcaaacttgatgaactcga 603 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||||| ||| |||||||||||||||||||| || | ||||||||| ||||| | Sbjct: 602 caatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcag 543 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgg-gatgcccttctggccgaa 578 |||| ||||||||||| ||||| || ||||||||||| || ||||| ||||| || || Sbjct: 542 ggtaacggatggtgcgaccatc-gtaagtgttcaggtaaggcaatgcctttctgtccaaa 484 Query: 579 ctggacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaag 638 ||||| ||| | |||||||| || |||||||| || ||||||||| ||| ||||| || Sbjct: 483 ctggatagatcgaaccttgcaaagtttgaactttgcttcctcatccttgatggagtggag 424 Query: 639 gcggaagcggccctt 653 ||||| || ||||| Sbjct: 423 acggaaacgtccctt 409 Score = 58.0 bits (29), Expect = 4e-05 Identities = 68/81 (83%) Strand = Plus / Minus Query: 214 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 273 |||||| ||||| || ||||||||||| ||||||||||| || |||||| ||||| || Sbjct: 847 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 788 Query: 274 gcccttgccaatggtgaacac 294 || |||||||||||| |||| Sbjct: 787 tcctttgccaatggtgtacac 767
>dbj|AB025632.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQJ2 Length = 51440 Score = 165 bits (83), Expect = 2e-37 Identities = 226/271 (83%), Gaps = 2/271 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||||||||| Sbjct: 6772 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 6713 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || || || ||||| || || ||||| || |||||||||||||| || | Sbjct: 6712 tctgtttctacctcctgtaaccatcacaacattgcca-acatcaaacttgatgaactcga 6654 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||||| ||| |||||||||||||||||||| || | ||||||||| ||||| | Sbjct: 6653 caatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcag 6594 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 |||| ||||||||||| ||||| || ||||||||||| || ||||| ||||| || ||| Sbjct: 6593 ggtaacggatggtgcgaccatc-gtaagtgttcaggtaaggaatgcctttctgtccaaac 6535 Query: 580 tggacagacctgaccttgcagagcttgaact 610 |||| ||| | |||||||| || ||||||| Sbjct: 6534 tggatagatcgaaccttgcaaagtttgaact 6504 Score = 58.0 bits (29), Expect = 4e-05 Identities = 68/81 (83%) Strand = Plus / Minus Query: 214 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 273 |||||| ||||| || ||||||||||| ||||||||||| || |||||| ||||| || Sbjct: 6898 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 6839 Query: 274 gcccttgccaatggtgaacac 294 || |||||||||||| |||| Sbjct: 6838 tcctttgccaatggtgtacac 6818
>emb|BX820506.1|CNS0A8QA Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH41ZE09 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1000 Score = 163 bits (82), Expect = 9e-37 Identities = 268/326 (82%), Gaps = 3/326 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 ||||||||| |||||| | ||||| || ||||| | |||||| ||||||||||||||||| Sbjct: 685 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 626 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || ||||| ||||| || ||||||||| || |||||||| ||||| || | Sbjct: 625 tctgtttcttcctccagttaccataactacgttgccc-acatcaaacttaatgaactcca 567 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||| ||| ||||||||||||||||||||||| | ||||||||| ||||| | Sbjct: 566 caatcttgttctcctcaaggtcgagcttgatggtgtcgttaggcttgatgagcgggtcag 507 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 | || ||||||||||| |||| | || ||||||| ||| || || |||||||| || || Sbjct: 506 gataacggatggtgcgaccat-aatatgtgttcaagtagggaatacccttctgaccaaat 448 Query: 580 tggacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaagg 639 |||| || || || ||||| |||||||||||||| ||||||||| ||| ||||| || Sbjct: 447 tggatcgatctcactttgcaaagcttgaacttagcctcctcatccttgatggagtggaga 388 Query: 640 cggaagcggccctttggtgtcataca 665 ||||| || ||| ||||||||||||| Sbjct: 387 cggaaacgtccc-ttggtgtcataca 363
>emb|BX833645.1|CNS0A1VP Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL68ZB07 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 984 Score = 161 bits (81), Expect = 4e-36 Identities = 236/285 (82%), Gaps = 2/285 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 |||||| ||||||| | ||||||||||||| || | |||||| |||||||| |||||||| Sbjct: 625 gtggattgtctcaaggcttcccttatgcttttcacggttcttaatcacacccacacgccc 566 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || || |||||||| || ||||| ||| ||||||||||||||||| || | Sbjct: 565 tctgtttctgcctccggtcaccatcacaacgttaccc-acgtcaaacttgatgaactcga 507 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||| ||| ||||| ||||||||||||| || | ||||||||| ||||| | Sbjct: 506 caatcttgttctcctcaaggtccggcttgatggtgtcttttggcttgatgagcgggtcag 447 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 |||| ||| ||||||| || ||| || ||||||||||||||||| |||||||| || ||| Sbjct: 446 ggtaacggttggtgcgaccgtca-taagtgttcaggtatgggattcccttctgaccaaac 388 Query: 580 tggacagacctgaccttgcagagcttgaacttagcatcctcatcc 624 |||| | || |||||||| ||||||||||| || ||||||||| Sbjct: 387 tggatggttctaaccttgcaaagcttgaactttgcttcctcatcc 343
>emb|BX831856.1|CNS09ZNQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH34ZE09 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 934 Score = 161 bits (81), Expect = 4e-36 Identities = 236/285 (82%), Gaps = 2/285 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 |||||| ||||||| | |||||||||||||||| | ||||| |||||||| |||||||| Sbjct: 625 gtggattgtctcaacgcttcccttatgcttctcacggttctgaatcacacccacacgccc 566 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || ||||||||||| || ||||| ||| ||||||||||| ||||| |||| Sbjct: 565 gctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttcatgaactcaa 507 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||| ||| ||||| ||||||||||||| || | ||| ||||| |||| | Sbjct: 506 caatcttgttctcctcaaggtccagcttgatggtgtgatttggcttcatgagcgggtgag 447 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 |||| ||||||||||| |||||| || |||| ||||||||| || |||||||| || ||| Sbjct: 446 ggtaacggatggtgcgaccatca-taagtgtgcaggtatggcattcccttctgaccaaac 388 Query: 580 tggacagacctgaccttgcagagcttgaacttagcatcctcatcc 624 |||| ||| || ||||||| ||||||||||| || ||||||||| Sbjct: 387 tggatagatctaaccttgcgaagcttgaactttgcttcctcatcc 343
>dbj|D25237.1|RICSS620B Oryza sativa SS620 mRNA for scar protein, partial cds Length = 293 Score = 161 bits (81), Expect = 4e-36 Identities = 143/161 (88%), Gaps = 2/161 (1%) Strand = Plus / Minus Query: 521 gtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaact 580 ||||||||||||||| ||||||| || |||||||||| |||| ||||||||||| |||| Sbjct: 293 gtagcggatggtgcgaccatcataagttgttcaggtagcggattcccttctggccaaact 234 Query: 581 ggacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaaggc 640 | ||||||| |||||||| |||||||||||||||||||||||| ||||||| ||||||| Sbjct: 233 gcacagaccgaaccttgcaaagcttgaacttagcatcctcatccttgacagactgaaggc 174 Query: 641 ggaagcggccctttggtgtcatacagaagccctgtagttct 681 |||| || ||| |||||||| |||||||| ||||||||||| Sbjct: 173 ggaaacgtccc-ttggtgtcgtacagaag-cctgtagttct 135
>emb|BX829418.1|CNS09ZZ4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB12ZD07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 566 Score = 157 bits (79), Expect = 6e-35 Identities = 225/271 (83%), Gaps = 2/271 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||||||||| Sbjct: 269 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 210 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || || || ||||| || || ||||| || |||||||||||||| || | Sbjct: 209 tctgtttctacctcctgtaaccatcacaacattgcca-acatcaaacttgatgaactcga 151 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||||| ||| |||||||||||||||||||| || | ||||||||| |||| | Sbjct: 150 caatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtgag 91 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 |||| ||||||||||| ||||| || ||||||||||| || ||||| ||||| || ||| Sbjct: 90 ggtaacggatggtgcgaccatc-gtaagtgttcaggtaaggaatgcctttctgtccaaac 32 Query: 580 tggacagacctgaccttgcagagcttgaact 610 |||| ||| | |||||||| || ||||||| Sbjct: 31 tggatagatcgaaccttgcaaagtttgaact 1 Score = 58.0 bits (29), Expect = 4e-05 Identities = 68/81 (83%) Strand = Plus / Minus Query: 214 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 273 |||||| ||||| || ||||||||||| ||||||||||| || |||||| ||||| || Sbjct: 395 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 336 Query: 274 gcccttgccaatggtgaacac 294 || |||||||||||| |||| Sbjct: 335 tcctttgccaatggtgtacac 315
>emb|BX832133.1|CNS09ZP1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH53ZH10 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 537 Score = 155 bits (78), Expect = 2e-34 Identities = 203/242 (83%), Gaps = 2/242 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||||||||| Sbjct: 240 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 181 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || || || ||||| || || ||||| || |||||||||||||| || | Sbjct: 180 tctgtttctacctcctgtaaccatcacaacattgcca-acatcaaacttgatgaactcga 122 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||||| ||| |||||||||||||||||||| || | ||||||||| ||||| | Sbjct: 121 caatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcag 62 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 |||| ||||||||||| ||||| || ||||||||||| || ||||| ||||| || ||| Sbjct: 61 ggtaacggatggtgcgaccatc-gtaagtgttcaggtaaggaatgcctttctgtccaaac 3 Query: 580 tg 581 || Sbjct: 2 tg 1 Score = 58.0 bits (29), Expect = 4e-05 Identities = 68/81 (83%) Strand = Plus / Minus Query: 214 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 273 |||||| ||||| || ||||||||||| ||||||||||| || |||||| ||||| || Sbjct: 366 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 307 Query: 274 gcccttgccaatggtgaacac 294 || |||||||||||| |||| Sbjct: 306 tcctttgccaatggtgtacac 286
>emb|X79300.1|GHRS4E G.hirsutum (DPL 62) mRNA for ribosomal protein small subunit 4e Length = 1090 Score = 143 bits (72), Expect = 9e-31 Identities = 221/268 (82%), Gaps = 2/268 (0%) Strand = Plus / Minus Query: 344 atggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccagtg 403 |||||||||||| | |||||||||||||||||||| || || || |||||||| || || Sbjct: 678 atggtctcaaagctacccttatgcttctccctgtttttaattactccaacacgacctctg 619 Query: 404 ttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaacaat 463 || | || || || |||||||| || || ||| ||||||||||||||||| || ||||| Sbjct: 618 ttccttcctccggtgaccatgacaacatt-cccaacgtcaaacttgatgaaatcgacaat 560 Query: 464 cttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgggta 523 ||||||| |||| ||||| ||||| |||||||| || |||||||| | ||||||||||| Sbjct: 559 cttgttgctctcaaggtccagcttaatggtgtcatttgccttgatcaaggggtctgggta 500 Query: 524 gcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaactgga 583 ||| || || || || || || |||||||||||||| |||||||||||||| || |||| Sbjct: 499 gcgaatagtacgcccgtc-gtatgtgttcaggtatggaatgcccttctggccaaattgga 441 Query: 584 cagacctgaccttgcagagcttgaactt 611 | || | |||||||| ||||| ||||| Sbjct: 440 cggatcgaaccttgcaaagcttaaactt 413
>gb|AC002329.2|AC002329 Arabidopsis thaliana chromosome II section 100 of 255 of the complete sequence. Sequence from clones T23A1, F5J6, MJB20 Length = 76170 Score = 141 bits (71), Expect = 3e-30 Identities = 223/271 (82%), Gaps = 2/271 (0%) Strand = Plus / Minus Query: 340 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 399 ||||||||| |||||| | ||||| || ||||| | |||||| ||||||||||||||||| Sbjct: 48796 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 48737 Query: 400 agtgttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaa 459 |||| | || ||||| ||||| || ||||||||| || |||||||| ||||| || | Sbjct: 48736 tctgtttcttcctccagtgaccataactacgttgccc-acatcaaacttaatgaactcca 48678 Query: 460 caatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctg 519 |||||||||| ||| ||||||||||||||||||||||| | ||||||||| ||||| | Sbjct: 48677 caatcttgttctcctcaaggtcgagcttgatggtgtcgttaggcttgatgagcgggtcag 48618 Query: 520 ggtagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaac 579 | || ||||||||||| |||||| || ||||||| ||| || || |||||||| || || Sbjct: 48617 gataacggatggtgcgaccatca-tatgtgttcaagtagggaatacccttctgaccaaat 48559 Query: 580 tggacagacctgaccttgcagagcttgaact 610 |||| || || || ||||| |||||||||| Sbjct: 48558 tggatcgatctcactttgcaaagcttgaact 48528
>gb|BT014201.1| Lycopersicon esculentum clone 133378R, mRNA sequence Length = 1292 Score = 133 bits (67), Expect = 8e-28 Identities = 294/367 (80%), Gaps = 2/367 (0%) Strand = Plus / Minus Query: 287 gtgaacacgttgcccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatg 346 |||||||| || |||| |||||| ||||||| || ||| ||| ||||| || ||| | Sbjct: 760 gtgaacacatttcccaaacgggtagcaaactcatgccccagggaatcctgaatgtgaact 701 Query: 347 gtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttg 406 ||||||||| | ||||| ||||||||||||||||| | | |||||||| || |||| Sbjct: 700 gtctcaaagctacccttgtgcttctccctgttcttaagaattccaacacgtcccctgttt 641 Query: 407 cgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaacaatctt 466 | |||||||||| ||| || || || || || |||||||||||||||||||||||||| Sbjct: 640 ctaccaccagtcaacataaccacattacca-acatcaaacttgatgaagtcaacaatctt 582 Query: 467 gttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcg 526 |||| || | ||| |||||||||||||| |||||||||||||| || || |||||||| Sbjct: 581 attggaatctaagtccagcttgatggtgtcattggccttgatgaggggatcggggtagcg 522 Query: 527 gatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaactggacag 586 ||| || | |||||| || ||||| || |||||||| |||||||| || ||||| || | Sbjct: 521 gattgttcttccatca-tacgtgttgagatatgggatacccttctgtccaaactgcactg 463 Query: 587 acctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaaggcggaagc 646 | | |||||||| || |||||||| || |||||||| |||| ||||| || ||||| | Sbjct: 462 atcgaaccttgcaaagtttgaacttggcttcctcatctctgagtgagtgtagacggaacc 403 Query: 647 ggccctt 653 | ||||| Sbjct: 402 gaccctt 396
>emb|BX818793.1|CNS0A8YY Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB13ZG07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 966 Score = 111 bits (56), Expect = 3e-21 Identities = 251/312 (80%), Gaps = 3/312 (0%) Strand = Plus / Minus Query: 343 gatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccagt 402 |||||| |||||| | ||||| | ||||| | |||||| ||||||||||||||||| | Sbjct: 689 gatggtttcaaagctacccttgtttttctcacggttcttaatcacaccaacacgccctct 630 Query: 403 gttgcgcccaccagtcaccatgacgacgttgcccgacgtcaaacttgatgaagtcaacaa 462 ||| | || ||||| ||||| || ||||||||| || |||||||| ||||| || |||| Sbjct: 629 gtttcttcctccagtgaccataactacgttgccc-acatcaaacttaatgaactccacaa 571 Query: 463 tcttgttggtctccaggtcgagcttgatggtg-tcgttggccttgatgagtgggtctggg 521 ||||||| ||| |||||||||||||||||| | ||| | ||||||||| |||| || Sbjct: 570 tcttgttctcctcaaggtcgagcttgatggtgtttgttaggcttgatgagcgggtgagga 511 Query: 522 tagcggatggtgcggccatcattaggtgttcaggtatgggatgcccttctggccgaactg 581 || ||||||||||| |||| | || ||||||| ||| || || |||||||| || || || Sbjct: 510 taacggatggtgcgaccatga-tatgtgttcaagtagggaatacccttctgaccaaattg 452 Query: 582 gacagacctgaccttgcagagcttgaacttagcatcctcatccctgacagagtgaaggcg 641 || || || || ||||| |||||||||||||| ||||||||| ||| ||||| || || Sbjct: 451 gatcgatctcactttgcaaagcttgaacttagcctcctcatccttgatggagtggagacg 392 Query: 642 gaagcggccctt 653 ||| || ||||| Sbjct: 391 gaaacgtccctt 380
>emb|CR712301.2|CNS0GCK9 Tetraodon nigroviridis full-length cDNA Length = 868 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 496 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 451
>emb|CR720218.2|CNS0GIO0 Tetraodon nigroviridis full-length cDNA Length = 845 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 471 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 426
>emb|CR720216.2|CNS0GINY Tetraodon nigroviridis full-length cDNA Length = 847 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430
>emb|CR722715.2|CNS0GKLD Tetraodon nigroviridis full-length cDNA Length = 848 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 476 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 431
>emb|CR721883.2|CNS0GJY9 Tetraodon nigroviridis full-length cDNA Length = 869 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452
>emb|CR720853.2|CNS0GJ5N Tetraodon nigroviridis full-length cDNA Length = 756 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 383 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 338
>emb|CR720472.2|CNS0GIV2 Tetraodon nigroviridis full-length cDNA Length = 842 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430
>emb|CR719441.2|CNS0GI2F Tetraodon nigroviridis full-length cDNA Length = 848 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 476 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 431
>emb|CR719306.2|CNS0GHYO Tetraodon nigroviridis full-length cDNA Length = 847 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430
>emb|CR717405.2|CNS0GGHV Tetraodon nigroviridis full-length cDNA Length = 869 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 497 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 452
>emb|CR717315.2|CNS0GGFD Tetraodon nigroviridis full-length cDNA Length = 587 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 475 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 430
>emb|CR716926.2|CNS0GG4N Tetraodon nigroviridis full-length cDNA Length = 574 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 462 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 417
>emb|CR711409.2|CNS0GBVH Tetraodon nigroviridis full-length cDNA Length = 610 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 498 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 453
>emb|CR714124.2|CNS0GDYW Tetraodon nigroviridis full-length cDNA Length = 610 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 498 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 453
>emb|CR714283.2|CNS0GE3B Tetraodon nigroviridis full-length cDNA Length = 610 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 498 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 453
>emb|CR712945.2|CNS0GD25 Tetraodon nigroviridis full-length cDNA Length = 847 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 475 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 430
>emb|CR713157.2|CNS0GD81 Tetraodon nigroviridis full-length cDNA Length = 847 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 475 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 430
>emb|CR710675.2|CNS0GBB3 Tetraodon nigroviridis full-length cDNA Length = 870 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 498 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 453
>emb|CR710088.2|CNS0GAUS Tetraodon nigroviridis full-length cDNA Length = 847 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 475 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 430
>emb|CR708708.2|CNS0G9SG Tetraodon nigroviridis full-length cDNA Length = 610 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 498 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 453
>emb|CR707417.2|CNS0G8SL Tetraodon nigroviridis full-length cDNA Length = 920 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 551 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 506
>emb|CR706939.2|CNS0G8FB Tetraodon nigroviridis full-length cDNA Length = 847 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 475 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 430
>emb|CR704562.2|CNS0G6LA Tetraodon nigroviridis full-length cDNA Length = 868 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452
>emb|CR704014.2|CNS0G662 Tetraodon nigroviridis full-length cDNA Length = 847 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430
>emb|CR703820.2|CNS0G60O Tetraodon nigroviridis full-length cDNA Length = 847 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430
>emb|CR703584.2|CNS0G5U4 Tetraodon nigroviridis full-length cDNA Length = 847 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430
>emb|CR703489.2|CNS0G5RH Tetraodon nigroviridis full-length cDNA Length = 870 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453
>emb|CR702840.2|CNS0G59G Tetraodon nigroviridis full-length cDNA Length = 870 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453
>emb|CR702635.2|CNS0G53R Tetraodon nigroviridis full-length cDNA Length = 871 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454
>emb|CR702209.2|CNS0G4RX Tetraodon nigroviridis full-length cDNA Length = 870 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453
>emb|CR702145.2|CNS0G4Q5 Tetraodon nigroviridis full-length cDNA Length = 868 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 496 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 451
>emb|CR700232.2|CNS0G390 Tetraodon nigroviridis full-length cDNA Length = 842 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430
>emb|CR697958.2|CNS0G1HU Tetraodon nigroviridis full-length cDNA Length = 870 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 498 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 453
>emb|CR697195.2|CNS0G0WN Tetraodon nigroviridis full-length cDNA Length = 871 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454
>emb|CR697018.2|CNS0G0RQ Tetraodon nigroviridis full-length cDNA Length = 828 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 474 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 429
>emb|CR696565.2|CNS0G0F5 Tetraodon nigroviridis full-length cDNA Length = 846 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430
>emb|CR696312.2|CNS0G084 Tetraodon nigroviridis full-length cDNA Length = 847 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430
>emb|CR694977.2|CNS0FZ71 Tetraodon nigroviridis full-length cDNA Length = 871 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453
>emb|CR694101.2|CNS0FYIP Tetraodon nigroviridis full-length cDNA Length = 847 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430
>emb|CR693396.2|CNS0FXZ4 Tetraodon nigroviridis full-length cDNA Length = 869 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452
>emb|CR691738.2|CNS0FWP2 Tetraodon nigroviridis full-length cDNA Length = 870 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 498 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 453
>emb|CR688407.2|CNS0FU4J Tetraodon nigroviridis full-length cDNA Length = 848 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 475 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 430
>emb|CR689769.2|CNS0FV6D Tetraodon nigroviridis full-length cDNA Length = 871 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454
>emb|CR687727.2|CNS0FTLN Tetraodon nigroviridis full-length cDNA Length = 870 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 498 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 453
>emb|CR686869.2|CNS0FSXT Tetraodon nigroviridis full-length cDNA Length = 868 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 496 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 451
>emb|CR685258.2|CNS0FRP2 Tetraodon nigroviridis full-length cDNA Length = 847 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454
>emb|CR685076.2|CNS0FRK0 Tetraodon nigroviridis full-length cDNA Length = 847 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430
>emb|CR684709.2|CNS0FR9T Tetraodon nigroviridis full-length cDNA Length = 869 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 497 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 452
>emb|CR684226.2|CNS0FQWE Tetraodon nigroviridis full-length cDNA Length = 872 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454
>emb|CR683325.2|CNS0FQ7D Tetraodon nigroviridis full-length cDNA Length = 868 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452
>emb|CR682942.2|CNS0FPWQ Tetraodon nigroviridis full-length cDNA Length = 763 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 391 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 346
>emb|CR682258.2|CNS0FPDQ Tetraodon nigroviridis full-length cDNA Length = 869 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452
>emb|CR681455.2|CNS0FORF Tetraodon nigroviridis full-length cDNA Length = 610 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453
>emb|CR681050.2|CNS0FOG6 Tetraodon nigroviridis full-length cDNA Length = 847 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430
>emb|CR680145.2|CNS0FNR1 Tetraodon nigroviridis full-length cDNA Length = 871 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454
>emb|CR676429.2|CNS0FKW9 Tetraodon nigroviridis full-length cDNA Length = 609 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452
>emb|CR675710.2|CNS0FKCK Tetraodon nigroviridis full-length cDNA Length = 835 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 476 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 431
>emb|CR673595.2|CNS0FIPT Tetraodon nigroviridis full-length cDNA Length = 847 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430
>emb|CR670866.2|CNS0FGM0 Tetraodon nigroviridis full-length cDNA Length = 847 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430
>emb|CR669893.2|CNS0FFUZ Tetraodon nigroviridis full-length cDNA Length = 871 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454
>emb|CR669083.2|CNS0FF8H Tetraodon nigroviridis full-length cDNA Length = 831 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 476 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 431
>emb|CR663251.2|CNS0FAQH Tetraodon nigroviridis full-length cDNA Length = 871 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454
>emb|CR659804.2|CNS0F82Q Tetraodon nigroviridis full-length cDNA Length = 871 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454
>emb|CR659262.2|CNS0F7NO Tetraodon nigroviridis full-length cDNA Length = 872 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454
>emb|CR658566.2|CNS0F74C Tetraodon nigroviridis full-length cDNA Length = 870 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453
>emb|CR657212.2|CNS0F62Q Tetraodon nigroviridis full-length cDNA Length = 847 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430
>emb|CR656191.2|CNS0F5AD Tetraodon nigroviridis full-length cDNA Length = 869 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452
>emb|CR655155.2|CNS0F4HL Tetraodon nigroviridis full-length cDNA Length = 610 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453
>emb|CR654105.2|CNS0F3OF Tetraodon nigroviridis full-length cDNA Length = 610 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453
>emb|CR652992.2|CNS0F2TI Tetraodon nigroviridis full-length cDNA Length = 871 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454
>emb|CR651314.2|CNS0F1IW Tetraodon nigroviridis full-length cDNA Length = 609 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452
>emb|CR647718.2|CNS0EYR0 Tetraodon nigroviridis full-length cDNA Length = 847 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430
>emb|CR646899.2|CNS0EY49 Tetraodon nigroviridis full-length cDNA Length = 870 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453
>emb|CR645541.2|CNS0EX2J Tetraodon nigroviridis full-length cDNA Length = 862 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452
>emb|CR644913.2|CNS0EWL3 Tetraodon nigroviridis full-length cDNA Length = 609 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452
>emb|CR642563.2|CNS0EURT Tetraodon nigroviridis full-length cDNA Length = 870 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453
>emb|CR642362.2|CNS0EUM8 Tetraodon nigroviridis full-length cDNA Length = 870 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453
>emb|CR641651.2|CNS0EU2H Tetraodon nigroviridis full-length cDNA Length = 870 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453
>emb|CR641329.2|CNS0ETTJ Tetraodon nigroviridis full-length cDNA Length = 870 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453
>emb|CR641017.2|CNS0ETKV Tetraodon nigroviridis full-length cDNA Length = 870 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453
>emb|CR639635.2|CNS0ESIH Tetraodon nigroviridis full-length cDNA Length = 847 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430
>emb|CR638530.2|CNS0ERNS Tetraodon nigroviridis full-length cDNA Length = 870 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453
>emb|CR637949.2|CNS0ER7N Tetraodon nigroviridis full-length cDNA Length = 870 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453
>emb|CR636021.2|CNS0EPQ3 Tetraodon nigroviridis full-length cDNA Length = 869 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452
>emb|CR634987.2|CNS0EOXD Tetraodon nigroviridis full-length cDNA Length = 871 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453
>emb|CR634338.2|CNS0EOFC Tetraodon nigroviridis full-length cDNA Length = 871 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454
>gb|AY769318.1| Bombyx mori ribosomal protein S4 (RpS4) mRNA, complete cds Length = 908 Score = 73.8 bits (37), Expect = 7e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 495 tcgttggccttgatgagtgggtctgggtagcggatggtgcggccatcat 543 |||||| | ||||| |||||||||||||||||||||||||||||||||| Sbjct: 541 tcgttgactttgataagtgggtctgggtagcggatggtgcggccatcat 493
>gb|AY190741.1| Pagrus major 40S ribosomal protein S4 mRNA, partial cds Length = 703 Score = 73.8 bits (37), Expect = 7e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 492 gtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 ||||||||| |||||||||| |||||||||||||||||||||||| Sbjct: 503 gtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 459
>emb|CR696954.2|CNS0G0PY Tetraodon nigroviridis full-length cDNA Length = 846 Score = 71.9 bits (36), Expect = 3e-09 Identities = 42/44 (95%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgc 534 |||||||||| |||||||||| |||||||||||||||||||||| Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgc 432
>gb|AY130367.1| Petromyzon marinus ribosomal protein S4-like mRNA, partial sequence Length = 715 Score = 69.9 bits (35), Expect = 1e-08 Identities = 56/63 (88%) Strand = Plus / Minus Query: 473 ctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggt 532 |||||||||||||| | |||||||||| |||||||||| || || |||||||||||||| Sbjct: 466 ctccaggtcgagctgcacggtgtcgttgaccttgatgaggggatcagggtagcggatggt 407 Query: 533 gcg 535 ||| Sbjct: 406 gcg 404
>emb|CR671087.2|CNS0FGS5 Tetraodon nigroviridis full-length cDNA Length = 871 Score = 67.9 bits (34), Expect = 4e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 536 |||||||||| || ||||||| |||||||||||||||||||||||| Sbjct: 499 ggtgtcgttgaccatgatgagggggtctgggtagcggatggtgcgg 454
>gb|AY110862.1| Zea mays CL1882_8 mRNA sequence Length = 728 Score = 67.9 bits (34), Expect = 4e-08 Identities = 46/50 (92%) Strand = Plus / Minus Query: 338 acgtggatggtctcaaaggttcccttatgcttctccctgttcttgatcac 387 |||||||||||||| ||| | ||||| ||||||||||||||||||||||| Sbjct: 491 acgtggatggtctcgaagctgcccttgtgcttctccctgttcttgatcac 442 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 367 cttctccctgttcttgatcacaccaacacgcccagtgtt 405 ||||||||||||||||||||| || |||||||| ||||| Sbjct: 429 cttctccctgttcttgatcactcctacacgcccggtgtt 391
>gb|DQ066214.1| Ixodes scapularis isolate ISUFL21 ribosomal protein S4 mRNA, complete cds Length = 789 Score = 65.9 bits (33), Expect = 2e-07 Identities = 54/61 (88%) Strand = Plus / Minus Query: 475 ccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgc 534 ||||||| | ||||| ||||||||| |||||||||| ||||| |||||||||||||||| Sbjct: 493 ccaggtccaccttgacggtgtcgttcaccttgatgagggggtccgggtagcggatggtgc 434 Query: 535 g 535 | Sbjct: 433 g 433
>gb|BC047994.1| Mus musculus RIKEN cDNA 1110033J19 gene, mRNA (cDNA clone MGC:59460 IMAGE:6518866), complete cds Length = 935 Score = 60.0 bits (30), Expect = 1e-05 Identities = 39/42 (92%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggt 532 |||||||||| |||||||||| ||||| |||||||||||||| Sbjct: 503 ggtgtcgttgaccttgatgagcgggtcagggtagcggatggt 462
>gb|AC126683.4| Mus musculus BAC clone RP23-62G15 from 6, complete sequence Length = 167297 Score = 60.0 bits (30), Expect = 1e-05 Identities = 39/42 (92%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggt 532 |||||||||| |||||||||| ||||| |||||||||||||| Sbjct: 3544 ggtgtcgttgaccttgatgagcgggtcagggtagcggatggt 3503
>dbj|AK132160.1| Mus musculus 17 days embryo head cDNA, RIKEN full-length enriched library, clone:3300002H24 product:Similar to ribosomal protein S4, X-linked, full insert sequence Length = 944 Score = 60.0 bits (30), Expect = 1e-05 Identities = 39/42 (92%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggt 532 |||||||||| |||||||||| ||||| |||||||||||||| Sbjct: 532 ggtgtcgttgaccttgatgagcgggtcagggtagcggatggt 491
>dbj|AK012382.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2700046B19 product:RIBOSOMAL PROTEIN S4X homolog [Cercopithecus aethiops], full insert sequence Length = 918 Score = 60.0 bits (30), Expect = 1e-05 Identities = 39/42 (92%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggt 532 |||||||||| |||||||||| ||||| |||||||||||||| Sbjct: 531 ggtgtcgttgaccttgatgagcgggtcagggtagcggatggt 490
>dbj|AK004068.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length enriched library, clone:1110033J19 product:Similar to ribosomal protein S4, X-linked, full insert sequence Length = 944 Score = 60.0 bits (30), Expect = 1e-05 Identities = 39/42 (92%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggt 532 |||||||||| |||||||||| ||||| |||||||||||||| Sbjct: 532 ggtgtcgttgaccttgatgagcgggtcagggtagcggatggt 491
>gb|BC028445.1| Mus musculus, clone IMAGE:963029, mRNA Length = 707 Score = 60.0 bits (30), Expect = 1e-05 Identities = 39/42 (92%) Strand = Plus / Plus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggt 532 |||||||||| |||||||||| ||||| |||||||||||||| Sbjct: 434 ggtgtcgttgaccttgatgagcgggtcagggtagcggatggt 475
>gb|AC142274.3| Mus musculus BAC clone RP23-251M14 from 6, complete sequence Length = 179732 Score = 60.0 bits (30), Expect = 1e-05 Identities = 39/42 (92%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggt 532 |||||||||| |||||||||| ||||| |||||||||||||| Sbjct: 150352 ggtgtcgttgaccttgatgagcgggtcagggtagcggatggt 150311
>ref|NM_025405.2| Mus musculus RIKEN cDNA 1110033J19 gene (1110033J19Rik), mRNA Length = 935 Score = 60.0 bits (30), Expect = 1e-05 Identities = 39/42 (92%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggt 532 |||||||||| |||||||||| ||||| |||||||||||||| Sbjct: 503 ggtgtcgttgaccttgatgagcgggtcagggtagcggatggt 462
>dbj|AB017068.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJG14 Length = 86121 Score = 58.0 bits (29), Expect = 4e-05 Identities = 54/61 (88%), Gaps = 1/61 (1%) Strand = Plus / Plus Query: 340 gtggatggtctcaaaggttcccttatgcttctcc-ctgttcttgatcacaccaacacgcc 398 |||||||||||||||| ||||||| || || | | | ||||||||||||||||||||||| Sbjct: 15623 gtggatggtctcaaagcttcccttttgttttttcacggttcttgatcacaccaacacgcc 15682 Query: 399 c 399 | Sbjct: 15683 c 15683
>ref|XM_366671.1| Magnaporthe grisea 70-15 chromosome VII hypothetical protein (MG02747.4) partial mRNA Length = 735 Score = 56.0 bits (28), Expect = 2e-04 Identities = 37/40 (92%) Strand = Plus / Minus Query: 213 gctcctcaatgatggtgagcttgatacccttgcccttggg 252 |||||||| |||||||||||||| ||||||||||||||| Sbjct: 697 gctcctcagcgatggtgagcttgacacccttgcccttggg 658 Score = 50.1 bits (25), Expect = 0.010 Identities = 37/41 (90%) Strand = Plus / Minus Query: 492 gtgtcgttggccttgatgagtgggtctgggtagcggatggt 532 ||||||||| ||||||| || ||||| |||||||||||||| Sbjct: 422 gtgtcgttgaccttgatcagagggtcggggtagcggatggt 382
>ref|XM_388890.1| Gibberella zeae PH-1 chromosome 2 conserved hypothetical protein (FG08714.1) partial mRNA Length = 732 Score = 56.0 bits (28), Expect = 2e-04 Identities = 37/40 (92%) Strand = Plus / Minus Query: 213 gctcctcaatgatggtgagcttgatacccttgcccttggg 252 |||||||| |||||||||||||| ||||||||||||||| Sbjct: 697 gctcctcagcgatggtgagcttgacacccttgcccttggg 658 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 381 tgatcacaccaacacgcccagtgttgcgcccaccagtcaccatgacgacg 430 |||| ||||||||||| || ||||||| |||||||| |||||||||||| Sbjct: 532 tgatgacaccaacacgacccatgttgcgaccaccagtgaccatgacgacg 483
>gb|AC084630.1|CBRG45E13 Caenorhabditis briggsae cosmid G45E13, complete sequence Length = 39246 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Plus Query: 489 atggtgtcgttggccttgatgagtgggtctgggtagcggatggt 532 |||||||||||| |||||| |||||||||||||||||||||| Sbjct: 29232 atggtgtcgttgaccttgacatgtgggtctgggtagcggatggt 29275 Score = 40.1 bits (20), Expect = 9.3 Identities = 26/28 (92%) Strand = Plus / Plus Query: 581 ggacagacctgaccttgcagagcttgaa 608 |||| ||| ||||||||||||||||||| Sbjct: 29323 ggaccgacttgaccttgcagagcttgaa 29350
>gb|AY850339.1| Magnaporthe grisea 40S ribosomal protein S4-A-like protein mRNA, complete cds Length = 1024 Score = 56.0 bits (28), Expect = 2e-04 Identities = 37/40 (92%) Strand = Plus / Minus Query: 213 gctcctcaatgatggtgagcttgatacccttgcccttggg 252 |||||||| |||||||||||||| ||||||||||||||| Sbjct: 766 gctcctcagcgatggtgagcttgacacccttgcccttggg 727 Score = 50.1 bits (25), Expect = 0.010 Identities = 37/41 (90%) Strand = Plus / Minus Query: 492 gtgtcgttggccttgatgagtgggtctgggtagcggatggt 532 ||||||||| ||||||| || ||||| |||||||||||||| Sbjct: 491 gtgtcgttgaccttgatcagagggtcggggtagcggatggt 451
>gb|AC024780.1| Caenorhabditis elegans cosmid Y43B11AR, complete sequence Length = 15768 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 489 atggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcg 535 ||||||||||| |||||| ||||||||||||||||||||||||| Sbjct: 13463 atggtgtcgttaaccttgacatgtgggtctgggtagcggatggtgcg 13509 Score = 48.1 bits (24), Expect = 0.038 Identities = 27/28 (96%) Strand = Plus / Plus Query: 581 ggacagacctgaccttgcagagcttgaa 608 |||||||| ||||||||||||||||||| Sbjct: 13554 ggacagacttgaccttgcagagcttgaa 13581
>gb|BT011369.1| Drosophila melanogaster RE57333 full insert cDNA Length = 992 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 266 ggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 312 |||||| |||||||||||||| ||||||||||| || ||||||||| Sbjct: 813 ggcttgttgcccttgccaatgatgaacacgttggtcaaacgggtggc 767
>ref|NM_168537.1| Drosophila melanogaster Ribosomal protein S4 CG11276-RA, transcript variant A (RpS4), mRNA Length = 983 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 266 ggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 312 |||||| |||||||||||||| ||||||||||| || ||||||||| Sbjct: 813 ggcttgttgcccttgccaatgatgaacacgttggtcaaacgggtggc 767
>ref|NM_079329.2| Drosophila melanogaster Ribosomal protein S4 CG11276-RB, transcript variant B (RpS4), mRNA Length = 969 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 266 ggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 312 |||||| |||||||||||||| ||||||||||| || ||||||||| Sbjct: 799 ggcttgttgcccttgccaatgatgaacacgttggtcaaacgggtggc 753
>gb|AC093546.2| Drosophila melanogaster 3L BAC RP98-8G7 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 207761 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 266 ggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 312 |||||| |||||||||||||| ||||||||||| || ||||||||| Sbjct: 141932 ggcttgttgcccttgccaatgatgaacacgttggtcaaacgggtggc 141886
>ref|NM_068702.2| Caenorhabditis elegans Ribosomal Protein, Small subunit family member (rps-4) (rps-4) mRNA, complete cds Length = 845 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 489 atggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcg 535 ||||||||||| |||||| ||||||||||||||||||||||||| Sbjct: 499 atggtgtcgttaaccttgacatgtgggtctgggtagcggatggtgcg 453 Score = 48.1 bits (24), Expect = 0.038 Identities = 27/28 (96%) Strand = Plus / Minus Query: 581 ggacagacctgaccttgcagagcttgaa 608 |||||||| ||||||||||||||||||| Sbjct: 408 ggacagacttgaccttgcagagcttgaa 381
>gb|AE003539.3| Drosophila melanogaster chromosome 3L, section 46 of 83 of the complete sequence Length = 272016 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 266 ggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 312 |||||| |||||||||||||| ||||||||||| || ||||||||| Sbjct: 169866 ggcttgttgcccttgccaatgatgaacacgttggtcaaacgggtggc 169820
>dbj|D16257.1|DRORPS4 Drosophila melanogaster rpS4 mRNA for ribosomal protein S4, complete cds Length = 870 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 266 ggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 312 |||||| |||||||||||||| ||||||||||| || ||||||||| Sbjct: 713 ggcttgttgcccttgccaatgatgaacacgttggtcaaacgggtggc 667
>gb|BC081584.1| Danio rerio ribosomal protein S4, X-linked, mRNA (cDNA clone MGC:92076 IMAGE:7046733), complete cds Length = 888 Score = 52.0 bits (26), Expect = 0.002 Identities = 47/54 (87%) Strand = Plus / Minus Query: 488 gatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcggccatc 541 ||||||||||||| ||||||| || || || ||||| |||||||||||| |||| Sbjct: 487 gatggtgtcgttgaccttgatcagaggatcagggtaacggatggtgcgggcatc 434 Score = 40.1 bits (20), Expect = 9.3 Identities = 26/28 (92%) Strand = Plus / Minus Query: 259 cacccaaggcttggtgcccttgccaatg 286 |||||| |||||| |||||||||||||| Sbjct: 715 cacccatggcttgttgcccttgccaatg 688
>ref|XM_521131.1| PREDICTED: Pan troglodytes similar to 40S ribosomal protein S4, X isoform (LOC465710), mRNA Length = 863 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 502 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 543 |||||||||| || || |||||||||||||||||| |||||| Sbjct: 475 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 434
>gb|AY389947.1| Latimeria chalumnae ribosomal protein S4 mRNA, partial cds Length = 715 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 502 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 543 |||||||||| |||||||| || |||||||||||| |||||| Sbjct: 437 ccttgatgagggggtctggataccggatggtgcgggcatcat 396
>gb|BC000472.2| Homo sapiens ribosomal protein S4, X-linked, mRNA (cDNA clone MGC:8636 IMAGE:2961540), complete cds Length = 889 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 502 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 543 |||||||||| || || |||||||||||||||||| |||||| Sbjct: 474 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 433
>gb|BC007308.1| Homo sapiens ribosomal protein S4, X-linked, mRNA (cDNA clone IMAGE:3352599), partial cds Length = 822 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 502 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 543 |||||||||| || || |||||||||||||||||| |||||| Sbjct: 406 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 365
>gb|BC000236.1| Homo sapiens translin-associated factor X, mRNA (cDNA clone IMAGE:3351964), **** WARNING: chimeric clone **** Length = 2323 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 502 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 543 |||||||||| || || |||||||||||||||||| |||||| Sbjct: 1891 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 1850
>ref|NM_001005589.1| Danio rerio ribosomal protein S4, X-linked (rps4x), mRNA Length = 888 Score = 52.0 bits (26), Expect = 0.002 Identities = 47/54 (87%) Strand = Plus / Minus Query: 488 gatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcggccatc 541 ||||||||||||| ||||||| || || || ||||| |||||||||||| |||| Sbjct: 487 gatggtgtcgttgaccttgatcagaggatcagggtaacggatggtgcgggcatc 434 Score = 40.1 bits (20), Expect = 9.3 Identities = 26/28 (92%) Strand = Plus / Minus Query: 259 cacccaaggcttggtgcccttgccaatg 286 |||||| |||||| |||||||||||||| Sbjct: 715 cacccatggcttgttgcccttgccaatg 688
>ref|NM_001007.3| Homo sapiens ribosomal protein S4, X-linked (RPS4X), mRNA Length = 977 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 502 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 543 |||||||||| || || |||||||||||||||||| |||||| Sbjct: 562 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 521
>gb|DQ445520.1| Graphocephala atropunctata isolate WHGA0585 putative ribosomal protein S4e mRNA, complete cds Length = 792 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 488 gatggtgtcgttggccttgatgagtgggtctgggtagcggat 529 ||||||||| ||| |||||||||| ||||| ||||||||||| Sbjct: 480 gatggtgtcattgaccttgatgagagggtcagggtagcggat 439 Score = 48.1 bits (24), Expect = 0.038 Identities = 30/32 (93%) Strand = Plus / Minus Query: 266 ggcttggtgcccttgccaatggtgaacacgtt 297 ||||||||||||||||||||| |||| ||||| Sbjct: 701 ggcttggtgcccttgccaatgatgaagacgtt 670
>gb|BC100904.1| Homo sapiens ribosomal protein S4, X-linked, mRNA (cDNA clone MGC:119099 IMAGE:40003601), complete cds Length = 792 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 502 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 543 |||||||||| || || |||||||||||||||||| |||||| Sbjct: 466 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 425
>gb|BC100903.1| Homo sapiens ribosomal protein S4, X-linked, mRNA (cDNA clone MGC:119098 IMAGE:40003600), complete cds Length = 792 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 502 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 543 |||||||||| || || |||||||||||||||||| |||||| Sbjct: 466 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 425
>emb|AL135749.3|HSN14 Homo sapiens chromosome X sequence from BAC CEPHB197N14 region PHKA1-DXS227 map Xq13, complete sequence Length = 156655 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 502 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 543 |||||||||| || || |||||||||||||||||| |||||| Sbjct: 87756 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 87797
>emb|CR601794.1| full-length cDNA clone CS0DI031YB06 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 858 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 502 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 543 |||||||||| || || |||||||||||||||||| |||||| Sbjct: 464 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 423
>emb|CR623958.1| full-length cDNA clone CS0DE004YB10 of Placenta of Homo sapiens (human) Length = 1896 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 502 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 543 |||||||||| || || |||||||||||||||||| |||||| Sbjct: 1544 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 1503
>emb|CR620411.1| full-length cDNA clone CS0DE011YG15 of Placenta of Homo sapiens (human) Length = 1386 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 502 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 543 |||||||||| || || |||||||||||||||||| |||||| Sbjct: 464 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 423
>dbj|AK097914.1| Homo sapiens cDNA FLJ40595 fis, clone THYMU2010705, highly similar to 40S RIBOSOMAL PROTEIN S4, X ISOFORM Length = 2747 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 502 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 543 |||||||||| || || |||||||||||||||||| |||||| Sbjct: 2363 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 2322
>emb|CR597791.1| full-length cDNA clone CS0DI068YM24 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 848 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 502 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 543 |||||||||| || || |||||||||||||||||| |||||| Sbjct: 464 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 423
>emb|CR595707.1| full-length cDNA clone CL0BB017ZH01 of Neuroblastoma of Homo sapiens (human) Length = 858 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 502 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 543 |||||||||| || || |||||||||||||||||| |||||| Sbjct: 464 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 423
>emb|CR456735.1| Homo sapiens full open reading frame cDNA clone RZPDo834G036D for gene RPS4X, ribosomal protein S4, X-linked; complete cds, incl. stopcodon Length = 792 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 502 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 543 |||||||||| || || |||||||||||||||||| |||||| Sbjct: 466 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 425
>emb|CR391662.1| Gallus gallus finished cDNA, clone ChEST418k16 Length = 856 Score = 52.0 bits (26), Expect = 0.002 Identities = 83/102 (81%) Strand = Plus / Minus Query: 440 gtcaaacttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgtt 499 |||||||||||||||||| |||||| ||||||||||| | || ||| || ||||| Sbjct: 536 gtcaaacttgatgaagtctgtgatcttgcccgtctccaggtcaatctggatcgtatcgtt 477 Query: 500 ggccttgatgagtgggtctgggtagcggatggtgcggccatc 541 |||||||||| || || || ||||||||||||||| |||| Sbjct: 476 caccttgatgaggggatccggatagcggatggtgcgggcatc 435
>dbj|AK222479.1| Homo sapiens mRNA for ribosomal protein S4, X-linked X isoform variant, clone: adKA01615 Length = 900 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 502 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 543 |||||||||| || || |||||||||||||||||| |||||| Sbjct: 491 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 450
>emb|BX934312.1| Gallus gallus finished cDNA, clone ChEST670k21 Length = 764 Score = 52.0 bits (26), Expect = 0.002 Identities = 83/102 (81%) Strand = Plus / Minus Query: 440 gtcaaacttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgtt 499 |||||||||||||||||| |||||| ||||||||||| | || ||| || ||||| Sbjct: 444 gtcaaacttgatgaagtctgtgatcttgcccgtctccaggtcaatctggatcgtatcgtt 385 Query: 500 ggccttgatgagtgggtctgggtagcggatggtgcggccatc 541 |||||||||| || || || ||||||||||||||| |||| Sbjct: 384 caccttgatgaggggatccggatagcggatggtgcgggcatc 343
>emb|BX930717.1| Gallus gallus finished cDNA, clone ChEST374l2 Length = 805 Score = 52.0 bits (26), Expect = 0.002 Identities = 83/102 (81%) Strand = Plus / Minus Query: 440 gtcaaacttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgtt 499 |||||||||||||||||| |||||| ||||||||||| | || ||| || ||||| Sbjct: 485 gtcaaacttgatgaagtctgtgatcttgcccgtctccaggtcaatctggatcgtatcgtt 426 Query: 500 ggccttgatgagtgggtctgggtagcggatggtgcggccatc 541 |||||||||| || || || ||||||||||||||| |||| Sbjct: 425 caccttgatgaggggatccggatagcggatggtgcgggcatc 384
>ref|NM_205108.1| Gallus gallus ribosomal protein S4 (LOC396001), mRNA Length = 852 Score = 52.0 bits (26), Expect = 0.002 Identities = 83/102 (81%) Strand = Plus / Minus Query: 440 gtcaaacttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgtt 499 |||||||||||||||||| |||||| ||||||||||| | || ||| || ||||| Sbjct: 532 gtcaaacttgatgaagtctgtgatcttgcccgtctccaggtcaatctggatcgtatcgtt 473 Query: 500 ggccttgatgagtgggtctgggtagcggatggtgcggccatc 541 |||||||||| || || || ||||||||||||||| |||| Sbjct: 472 caccttgatgaggggatccggatagcggatggtgcgggcatc 431
>gb|BC071662.1| Homo sapiens ribosomal protein S4, X-linked, mRNA (cDNA clone MGC:87857 IMAGE:5505465), complete cds Length = 905 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 502 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 543 |||||||||| || || |||||||||||||||||| |||||| Sbjct: 503 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 462
>gb|AF041428.1|AF041428 Homo sapiens ribosomal protein s4 X isoform gene, complete cds Length = 8542 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 502 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 543 |||||||||| || || |||||||||||||||||| |||||| Sbjct: 5195 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 5154
>gb|L24368.1|CHKRPS4A Gallus gallus (clone pDP1435) domesticus ribosomal protein S4 mRNA, complete cds Length = 852 Score = 52.0 bits (26), Expect = 0.002 Identities = 83/102 (81%) Strand = Plus / Minus Query: 440 gtcaaacttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgtt 499 |||||||||||||||||| |||||| ||||||||||| | || ||| || ||||| Sbjct: 532 gtcaaacttgatgaagtctgtgatcttgcccgtctccaggtcaatctggatcgtatcgtt 473 Query: 500 ggccttgatgagtgggtctgggtagcggatggtgcggccatc 541 |||||||||| || || || ||||||||||||||| |||| Sbjct: 472 caccttgatgaggggatccggatagcggatggtgcgggcatc 431
>gb|M58458.1|HUMRPS4X Human ribosomal protein S4 (RPS4X) isoform mRNA, complete cds Length = 888 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 502 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 543 |||||||||| || || |||||||||||||||||| |||||| Sbjct: 501 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 460
>gb|M22146.1|HUMSCAR Human scar protein mRNA, complete cds Length = 864 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 502 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 543 |||||||||| || || |||||||||||||||||| |||||| Sbjct: 471 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 430
>dbj|AB024285.1| Macaca fuscata mRNA for ribosomal protein S4X (RPS4X), complete cds Length = 853 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 502 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 543 |||||||||| || || |||||||||||||||||| |||||| Sbjct: 466 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 425
>dbj|D50104.1| Macaca fuscata mRNA for ribosomal protein S4, partial cds Length = 581 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 502 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 543 |||||||||| || || |||||||||||||||||| |||||| Sbjct: 409 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 368
>dbj|AB015610.1| Chlorocebus aethiops mRNA for ribosomal protein S4X, complete cds Length = 878 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 502 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 543 |||||||||| || || |||||||||||||||||| |||||| Sbjct: 489 ccttgatgaggggatcagggtagcggatggtgcgggcatcat 448
>ref|XM_502766.1| Yarrowia lipolytica CLIB122, YALI0D12903g predicted mRNA Length = 783 Score = 50.1 bits (25), Expect = 0.010 Identities = 28/29 (96%) Strand = Plus / Minus Query: 224 atggtgagcttgatacccttgcccttggg 252 |||| |||||||||||||||||||||||| Sbjct: 743 atggagagcttgatacccttgcccttggg 715
>emb|AL116727.1|CNS01DEN Botrytis cinerea strain T4 cDNA library Length = 720 Score = 50.1 bits (25), Expect = 0.010 Identities = 40/45 (88%) Strand = Plus / Minus Query: 485 cttgatggtgtcgttggccttgatgagtgggtctgggtagcggat 529 ||||| |||||||||| |||||||| |||||||||||| ||||| Sbjct: 522 cttgacggtgtcgttgaccttgatggatgggtctgggtaacggat 478
>emb|AL116316.1|CNS01D38 Botrytis cinerea strain T4 cDNA library Length = 540 Score = 50.1 bits (25), Expect = 0.010 Identities = 40/45 (88%) Strand = Plus / Minus Query: 485 cttgatggtgtcgttggccttgatgagtgggtctgggtagcggat 529 ||||| |||||||||| |||||||| |||||||||||| ||||| Sbjct: 108 cttgacggtgtcgttgaccttgatggatgggtctgggtaacggat 64
>emb|AL113012.1|CNS01AJG Botrytis cinerea strain T4 cDNA library Length = 660 Score = 50.1 bits (25), Expect = 0.010 Identities = 40/45 (88%) Strand = Plus / Minus Query: 485 cttgatggtgtcgttggccttgatgagtgggtctgggtagcggat 529 ||||| |||||||||| |||||||| |||||||||||| ||||| Sbjct: 211 cttgacggtgtcgttgaccttgatggatgggtctgggtaacggat 167
>gb|AF054511.1|AF054511 Yarrowia lipolytica ribosomal protein S7 (RPS7) mRNA, complete cds Length = 852 Score = 50.1 bits (25), Expect = 0.010 Identities = 28/29 (96%) Strand = Plus / Minus Query: 224 atggtgagcttgatacccttgcccttggg 252 |||| |||||||||||||||||||||||| Sbjct: 745 atggagagcttgatacccttgcccttggg 717
>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica Length = 3633272 Score = 50.1 bits (25), Expect = 0.010 Identities = 28/29 (96%) Strand = Plus / Plus Query: 224 atggtgagcttgatacccttgcccttggg 252 |||| |||||||||||||||||||||||| Sbjct: 1601891 atggagagcttgatacccttgcccttggg 1601919
>ref|XM_591678.2| PREDICTED: Bos taurus ribosomal protein S4, X-linked (RPS4X), mRNA Length = 899 Score = 48.1 bits (24), Expect = 0.038 Identities = 75/92 (81%) Strand = Plus / Minus Query: 444 aacttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgttggcc 503 ||||||||||| ||| ||||||| ||||||||| || | || |||||||| || || Sbjct: 538 aacttgatgaaatcagtaatcttgccggtctccagatcaatctgaatggtgtcattcacc 479 Query: 504 ttgatgagtgggtctgggtagcggatggtgcg 535 |||||||| || || ||||| ||||||||||| Sbjct: 478 ttgatgaggggatcagggtaacggatggtgcg 447
>ref|XM_783401.1| PREDICTED: Strongylocentrotus purpuratus similar to CG11276-PA, isoform A (LOC583495), partial mRNA Length = 285 Score = 48.1 bits (24), Expect = 0.038 Identities = 24/24 (100%) Strand = Plus / Minus Query: 290 aacacgttgcccagacgggtggca 313 |||||||||||||||||||||||| Sbjct: 179 aacacgttgcccagacgggtggca 156
>dbj|D50109.1| Equus caballus mRNA for ribosomal protein S4, partial cds Length = 581 Score = 48.1 bits (24), Expect = 0.038 Identities = 39/44 (88%) Strand = Plus / Minus Query: 489 atggtgtcgttggccttgatgagtgggtctgggtagcggatggt 532 |||||||| ||| |||||||||| || || |||||||||||||| Sbjct: 422 atggtgtcattgaccttgatgagaggatcagggtagcggatggt 379
>dbj|D50107.1| Bos taurus mRNA for ribosomal protein S4, partial cds Length = 581 Score = 48.1 bits (24), Expect = 0.038 Identities = 75/92 (81%) Strand = Plus / Minus Query: 444 aacttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgttggcc 503 ||||||||||| ||| ||||||| ||||||||| || | || |||||||| || || Sbjct: 467 aacttgatgaaatcagtaatcttgccggtctccagatcaatctgaatggtgtcattcacc 408 Query: 504 ttgatgagtgggtctgggtagcggatggtgcg 535 |||||||| || || ||||| ||||||||||| Sbjct: 407 ttgatgaggggatcagggtaacggatggtgcg 376
>ref|XM_753768.1| Ustilago maydis 521 hypothetical protein (UM02714.1) partial mRNA Length = 1161 Score = 46.1 bits (23), Expect = 0.15 Identities = 41/47 (87%) Strand = Plus / Minus Query: 492 gtgtcgttggccttgatgagtgggtctgggtagcggatggtgcggcc 538 ||||||||| |||||||| ||||| ||||| |||||||||||||| Sbjct: 842 gtgtcgttgaccttgatggccgggtcggggtatcggatggtgcggcc 796
>ref|XM_537399.2| PREDICTED: Canis familiaris similar to 40S ribosomal protein S4, X isoform (LOC480276), mRNA Length = 854 Score = 46.1 bits (23), Expect = 0.15 Identities = 41/47 (87%) Strand = Plus / Minus Query: 489 atggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcg 535 |||||||| || |||||||||| || ||||| |||||||||||||| Sbjct: 498 atggtgtcattcaccttgatgaggggatctggatagcggatggtgcg 452
>ref|XM_775416.1| PREDICTED: Strongylocentrotus purpuratus similar to 40S ribosomal protein S4, X isoform (LOC574997), mRNA Length = 825 Score = 46.1 bits (23), Expect = 0.15 Identities = 62/75 (82%) Strand = Plus / Minus Query: 239 cccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttg 298 |||||||||||||||||| || | | |||| || ||||||| ||| |||||||||| Sbjct: 770 cccttgcccttggggagggagacgtaggccttgttggccttgccgatgacgaacacgttg 711 Query: 299 cccagacgggtggca 313 || |||||||||||| Sbjct: 710 ccaagacgggtggca 696
>gb|AC008087.11| Homo sapiens chromosome 17, clone RP5-1127L24, complete sequence Length = 104726 Score = 46.1 bits (23), Expect = 0.15 Identities = 42/47 (89%), Gaps = 1/47 (2%) Strand = Plus / Plus Query: 489 atggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcg 535 |||||||| || |||||||||| ||||| ||||||||||||||||| Sbjct: 33567 atggtgtcattcaccttgatgag-gggtcagggtagcggatggtgcg 33612
>gb|AC027455.22| Homo sapiens chromosome 17, clone RP11-411G7, complete sequence Length = 145410 Score = 46.1 bits (23), Expect = 0.15 Identities = 42/47 (89%), Gaps = 1/47 (2%) Strand = Plus / Plus Query: 489 atggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcg 535 |||||||| || |||||||||| ||||| ||||||||||||||||| Sbjct: 80071 atggtgtcattcaccttgatgag-gggtcagggtagcggatggtgcg 80116
>gb|AY224232.1|AY224229S4 Pongo pygmaeus ribosomal protein S4 (RPS4Y) gene, exon 5 Length = 172 Score = 46.1 bits (23), Expect = 0.15 Identities = 29/31 (93%) Strand = Plus / Minus Query: 502 ccttgatgagtgggtctgggtagcggatggt 532 |||||||||| || ||||||||||||||||| Sbjct: 106 ccttgatgagaggatctgggtagcggatggt 76
>emb|BX067601.1|CNS09OBP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51BD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 862 Score = 44.1 bits (22), Expect = 0.60 Identities = 28/30 (93%) Strand = Plus / Plus Query: 268 cttggtgcccttgccaatggtgaacacgtt 297 |||||||| |||||| |||||||||||||| Sbjct: 282 cttggtgctcttgccgatggtgaacacgtt 311
>emb|BX067600.1|CNS09OBO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51BD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1037 Score = 44.1 bits (22), Expect = 0.60 Identities = 28/30 (93%) Strand = Plus / Minus Query: 268 cttggtgcccttgccaatggtgaacacgtt 297 |||||||| |||||| |||||||||||||| Sbjct: 712 cttggtgctcttgccgatggtgaacacgtt 683
>dbj|AB226297.1| Aspergillus oryzae cDNA, contig sequence: AoEST3159 Length = 1183 Score = 44.1 bits (22), Expect = 0.60 Identities = 37/42 (88%) Strand = Plus / Minus Query: 491 ggtgtcgttggccttgatgagtgggtctgggtagcggatggt 532 |||||||||| |||||||| ||||| |||||||||||||| Sbjct: 544 ggtgtcgttgaccttgatggcagggtcggggtagcggatggt 503
>gb|DQ362415.1| Shigella dysenteriae strain G1274 GcvT (gcvT) gene, partial cds Length = 416 Score = 44.1 bits (22), Expect = 0.60 Identities = 25/26 (96%) Strand = Plus / Plus Query: 58 ggttcgcaaatcaacaaacatcaggc 83 |||||||||||| ||||||||||||| Sbjct: 88 ggttcgcaaatcgacaaacatcaggc 113
>gb|AF429978.1| Spodoptera frugiperda ribosomal protein S4 mRNA, complete cds Length = 936 Score = 44.1 bits (22), Expect = 0.60 Identities = 25/26 (96%) Strand = Plus / Minus Query: 507 atgagtgggtctgggtagcggatggt 532 ||||||||||| |||||||||||||| Sbjct: 491 atgagtgggtcggggtagcggatggt 466
>gb|AY439895.1| Armigeres subalbatus ASAP ID: 38941 cytosolic small ribosomal subunit S4 mRNA sequence Length = 960 Score = 42.1 bits (21), Expect = 2.4 Identities = 39/45 (86%) Strand = Plus / Minus Query: 268 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 312 ||||||| ||||||| ||| |||||||||| |||||||||||| Sbjct: 729 cttggtggccttgccgatgatgaacacgttagtcagacgggtggc 685
>gb|AY433736.1| Aedes aegypti ASAP ID: 34407 cytosolic small ribosomal subunit S4 mRNA sequence Length = 755 Score = 42.1 bits (21), Expect = 2.4 Identities = 39/45 (86%) Strand = Plus / Minus Query: 268 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 312 ||||||| |||| |||||| |||| |||||| |||||||||||| Sbjct: 444 cttggtggccttaccaatgatgaaaacgttggtcagacgggtggc 400
>gb|DQ440018.1| Aedes aegypti clone AE-221 40S ribosomal protein S4 mRNA, complete cds Length = 789 Score = 42.1 bits (21), Expect = 2.4 Identities = 39/45 (86%) Strand = Plus / Minus Query: 268 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 312 ||||||| |||| |||||| |||| |||||| |||||||||||| Sbjct: 699 cttggtggccttaccaatgatgaaaacgttggtcagacgggtggc 655
>gb|AC148078.2| Mus musculus BAC clone RP24-186K12 from chromosome 13, complete sequence Length = 149455 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 246 ccttggggaggctcacccaag 266 ||||||||||||||||||||| Sbjct: 134897 ccttggggaggctcacccaag 134877
>ref|XM_657306.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN4794.2), mRNA Length = 720 Score = 42.1 bits (21), Expect = 2.4 Identities = 27/29 (93%) Strand = Plus / Minus Query: 224 atggtgagcttgatacccttgcccttggg 252 |||| |||||||| ||||||||||||||| Sbjct: 674 atggagagcttgacacccttgcccttggg 646
>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome Length = 5178466 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 318 ggtgaccctgggcatcctcaacgtg 342 ||||||||||||||| ||||||||| Sbjct: 4589196 ggtgaccctgggcatgctcaacgtg 4589172
>ref|XM_749829.1| Aspergillus fumigatus Af293 cytosolic small ribosomal subunit S4 (Afu3g06840) partial mRNA Length = 786 Score = 42.1 bits (21), Expect = 2.4 Identities = 27/29 (93%) Strand = Plus / Minus Query: 224 atggtgagcttgatacccttgcccttggg 252 ||||||||||| | ||||||||||||||| Sbjct: 740 atggtgagcttaacacccttgcccttggg 712
>ref|XM_446360.1| Candida glabrata CBS138, CAGL0F09031g partial mRNA Length = 786 Score = 42.1 bits (21), Expect = 2.4 Identities = 39/45 (86%) Strand = Plus / Minus Query: 479 gtcgagcttgatggtgtcgttggccttgatgagtgggtctgggta 523 ||||| ||||| |||||| ||| |||||||| |||||||||||| Sbjct: 489 gtcgaccttgacggtgtcattgaccttgatgtttgggtctgggta 445
>emb|AM048930.1| Mycetophagus quadripustulatus mRNA for ribosomal protein S4e (rpS4e gene) Length = 786 Score = 42.1 bits (21), Expect = 2.4 Identities = 27/29 (93%) Strand = Plus / Minus Query: 513 gggtctgggtagcggatggtgcggccatc 541 ||||||||||| ||||||||||| ||||| Sbjct: 455 gggtctgggtaacggatggtgcgtccatc 427
>gb|AC146554.5| Medicago truncatula clone mth2-9l7, complete sequence Length = 135334 Score = 42.1 bits (21), Expect = 2.4 Identities = 100/125 (80%), Gaps = 1/125 (0%) Strand = Plus / Plus Query: 486 ttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcggccatcatta 545 ||||| ||||| |||||||| || || || || || |||||||| || || ||||||| | Sbjct: 10857 ttgattgtgtcattggccttaataaggggatcaggatagcggattgtacgcccatcat-a 10915 Query: 546 ggtgttcaggtatgggatgcccttctggccgaactggacagacctgaccttgcagagctt 605 ||||||||| || || || || ||||| || ||||| ||||| | |||||||| ||||| Sbjct: 10916 ggtgttcagatagggtatccctttctgaccaaactgaacagatcgtaccttgcaaagctt 10975 Query: 606 gaact 610 |||| Sbjct: 10976 aaact 10980
>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence Length = 4895836 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 486 ttgatggtgtcgttggccttgatga 510 ||||||||||||||| ||||||||| Sbjct: 3708992 ttgatggtgtcgttgcccttgatga 3709016
>emb|CR380952.1| Candida glabrata strain CBS138 chromosome F complete sequence Length = 927101 Score = 42.1 bits (21), Expect = 2.4 Identities = 39/45 (86%) Strand = Plus / Plus Query: 479 gtcgagcttgatggtgtcgttggccttgatgagtgggtctgggta 523 ||||| ||||| |||||| ||| |||||||| |||||||||||| Sbjct: 885815 gtcgaccttgacggtgtcattgaccttgatgtttgggtctgggta 885859
>emb|CR938551.1| Single read from an extremity of a full-length cDNA clone made from Aedes aegypti total adult females. 5-prime end of clone KW0AAA1YI07AAM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 747 Score = 42.1 bits (21), Expect = 2.4 Identities = 39/45 (86%) Strand = Plus / Minus Query: 268 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 312 ||||||| |||| |||||| |||| |||||| |||||||||||| Sbjct: 721 cttggtggccttaccaatgatgaaaacgttggtcagacgggtggc 677
>emb|CR938407.1| Single read from an extremity of a full-length cDNA clone made from Aedes aegypti total adult females. 5-prime end of clone KW0AAA2YA05AAM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 806 Score = 42.1 bits (21), Expect = 2.4 Identities = 39/45 (86%) Strand = Plus / Minus Query: 268 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 312 ||||||| |||| |||||| |||| |||||| |||||||||||| Sbjct: 720 cttggtggccttaccaatgatgaaaacgttggtcagacgggtggc 676
>emb|CR938406.1| Single read from an extremity of a full-length cDNA clone made from Aedes aegypti total adult females. 3-prime end of clone KW0AAA2YA05BBM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 605 Score = 42.1 bits (21), Expect = 2.4 Identities = 39/45 (86%) Strand = Plus / Plus Query: 268 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 312 ||||||| |||| |||||| |||| |||||| |||||||||||| Sbjct: 296 cttggtggccttaccaatgatgaaaacgttggtcagacgggtggc 340 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,772,451 Number of Sequences: 3902068 Number of extensions: 5772451 Number of successful extensions: 116604 Number of sequences better than 10.0: 311 Number of HSP's better than 10.0 without gapping: 306 Number of HSP's successfully gapped in prelim test: 5 Number of HSP's that attempted gapping in prelim test: 115511 Number of HSP's gapped (non-prelim): 967 length of query: 681 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 658 effective length of database: 17,143,297,704 effective search space: 11280289889232 effective search space used: 11280289889232 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)