Clone Name	rbags21d10
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	ref|XM_470037.1| Oryza sativa (japonica cultivar-group), mRNA	488	e-134
2	dbj|AK064984.1| Oryza sativa (japonica cultivar-group) cDNA clon...	488	e-134
3	gb|AY104047.1| Zea mays PCO131880 mRNA sequence	426	e-116
4	ref|XM_477083.1| Oryza sativa (japonica cultivar-group), mRNA	406	e-110
5	dbj|AK063732.1| Oryza sativa (japonica cultivar-group) cDNA clon...	406	e-110
6	gb|BT016220.1| Zea mays clone Contig53 mRNA sequence	387	e-104
7	gb|AY104097.1| Zea mays PCO131882 mRNA sequence	387	e-104
8	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	383	e-103
9	gb|AC135958.2| Oryza sativa chromosome 3 BAC OSJNBa0059E14 genom...	383	e-103
10	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	383	e-103
11	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	339	7e-90
12	dbj|AP003943.3| Oryza sativa (japonica cultivar-group) genomic D...	339	7e-90
13	dbj|AP004911.1| Lotus japonicus genomic DNA, chromosome 4, clone...	178	1e-41
14	gb|AY292483.1| Brosme brosme S2 ribosomal protein (S2) gene, par...	172	9e-40
15	gb|AY292475.1| Pollachius virens S2 ribosomal protein (S2) gene,...	165	2e-37
16	gb|AY231813.1| Drosophila yakuba clone yak-em_sop mRNA sequence	165	2e-37
17	ref|NG_002360.1| Homo sapiens ribosomal protein S2 pseudogene (L...	163	9e-37
18	gb|AC004448.4| Homo sapiens chromosome 17, clone CTB-187M2, comp...	163	9e-37
19	emb|X17206.1|HSLLREP3 Human mRNA for LLRep3	163	9e-37
20	emb|CR626574.1| full-length cDNA clone CS0DJ014YK12 of T cells (...	163	9e-37
21	emb|CR625501.1| full-length cDNA clone CS0DI080YC10 of Placenta ...	163	9e-37
22	emb|CR617024.1| full-length cDNA clone CS0DI020YA19 of Placenta ...	163	9e-37
23	emb|CR616773.1| full-length cDNA clone CS0DA001YA14 of Neuroblas...	163	9e-37
24	emb|CR616346.1| full-length cDNA clone CS0DA003YB13 of Neuroblas...	163	9e-37
25	emb|CR608345.1| full-length cDNA clone CS0DE007YL08 of Placenta ...	163	9e-37
26	emb|CR603246.1| full-length cDNA clone CS0DE002YA17 of Placenta ...	163	9e-37
27	emb|CR602473.1| full-length cDNA clone CS0DM013YC17 of Fetal liv...	163	9e-37
28	emb|CR600325.1| full-length cDNA clone CS0DJ011YG17 of T cells (...	163	9e-37
29	emb|CR600119.1| full-length cDNA clone CS0DH004YP15 of T cells (...	163	9e-37
30	emb|CR598755.1| full-length cDNA clone CS0DH007YG11 of T cells (...	163	9e-37
31	emb|CR595621.1| full-length cDNA clone CS0DJ003YI21 of T cells (...	163	9e-37
32	emb|CR593677.1| full-length cDNA clone CS0DI020YA20 of Placenta ...	163	9e-37
33	emb|CR593327.1| full-length cDNA clone CS0DJ011YJ17 of T cells (...	163	9e-37
34	gb|AY292476.1| Pollachius pollachius S2 ribosomal protein (S2) g...	161	3e-36
35	gb|AY292484.1| Molva molva S2 ribosomal protein (S2) gene, parti...	157	5e-35
36	gb|AY292474.1| Merlangius merlangus S2 ribosomal protein (S2) ge...	157	5e-35
37	gb|AY292473.1| Melanogrammus aeglefinus S2 ribosomal protein (S2...	157	5e-35
38	gb|AY292472.1| Boreogadus saida S2 ribosomal protein (S2) gene, ...	157	5e-35
39	gb|AY292470.1| Gadus ogac S2 ribosomal protein (S2) gene, partia...	157	5e-35
40	gb|AY292469.1| Gadus macrocephalus S2 ribosomal protein (S2) gen...	157	5e-35
41	gb|AY292468.1| Gadus morhua S2 ribosomal protein (S2) gene, part...	157	5e-35
42	gb|AY292467.1| Arctogadus glacialis S2 ribosomal protein (S2) ge...	157	5e-35
43	gb|BC105985.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	155	2e-34
44	gb|BC106060.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	155	2e-34
45	gb|BC103756.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	155	2e-34
46	ref|XM_514839.1| PREDICTED: Pan troglodytes similar to ribosomal...	155	2e-34
47	ref|XM_511195.1| PREDICTED: Pan troglodytes LOC454344 (LOC454344...	155	2e-34
48	gb|BC016178.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	155	2e-34
49	gb|BC075830.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	155	2e-34
50	gb|BC073966.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	155	2e-34
51	gb|BC012354.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	155	2e-34
52	gb|BC010165.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	155	2e-34
53	gb|BC025677.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	155	2e-34
54	gb|BC001795.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	155	2e-34
55	gb|BC016951.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	155	2e-34
56	gb|BC021545.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	155	2e-34
57	gb|BC023541.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	155	2e-34
58	gb|BC019021.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	155	2e-34
59	gb|BC005824.1| Homo sapiens cDNA clone IMAGE:2823381, **** WARNI...	155	2e-34
60	gb|BC005129.1| Homo sapiens PDZ domain containing 7, mRNA (cDNA ...	155	2e-34
61	gb|BC020336.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	155	2e-34
62	gb|BC021002.1| Homo sapiens cDNA clone IMAGE:3841858, **** WARNI...	155	2e-34
63	gb|BC063508.1| Homo sapiens cDNA clone IMAGE:3861495, **** WARNI...	155	2e-34
64	gb|BC044628.1| Homo sapiens mRNA similar to collagen, type XVII,...	155	2e-34
65	gb|BC011850.1| Homo sapiens mRNA similar to delta (Drosophila)-l...	155	2e-34
66	gb|BC011661.1| Homo sapiens cDNA clone IMAGE:4130973, **** WARNI...	155	2e-34
67	gb|BC012773.1| Homo sapiens cDNA clone IMAGE:3837950, **** WARNI...	155	2e-34
68	gb|BC004120.1| Homo sapiens mRNA similar to ribosomal protein S2...	155	2e-34
69	gb|BC013970.1| Homo sapiens mRNA similar to makorin, ring finger...	155	2e-34
70	gb|BC066321.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	155	2e-34
71	emb|AL832857.1|HSM804168 Homo sapiens genomic DNA; cDNA DKFZp667...	155	2e-34
72	gb|BC008862.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	155	2e-34
73	gb|BC006559.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	155	2e-34
74	gb|BC035504.1| Homo sapiens, clone IMAGE:4636047, mRNA	155	2e-34
75	emb|CR624847.1| full-length cDNA clone CS0DH002YK09 of T cells (...	155	2e-34
76	emb|CR622407.1| full-length cDNA clone CS0DI084YM13 of Placenta ...	155	2e-34
77	emb|CR620130.1| full-length cDNA clone CS0DA002YB15 of Neuroblas...	155	2e-34
78	emb|CR617837.1| full-length cDNA clone CS0DC019YM02 of Neuroblas...	155	2e-34
79	emb|CR613584.1| full-length cDNA clone CS0DH005YA07 of T cells (...	155	2e-34
80	emb|CR613101.1| full-length cDNA clone CS0DI021YI17 of Placenta ...	155	2e-34
81	emb|CR612811.1| full-length cDNA clone CS0DF034YC19 of Fetal bra...	155	2e-34
82	emb|CR610190.1| full-length cDNA clone CS0CAP004YA17 of Thymus o...	155	2e-34
83	emb|CR609604.1| full-length cDNA clone CS0CAP007YC22 of Thymus o...	155	2e-34
84	emb|CR608509.1| full-length cDNA clone CS0DG001YB20 of B cells (...	155	2e-34
85	emb|CR608202.1| full-length cDNA clone CS0DK001YN08 of HeLa cell...	155	2e-34
86	emb|CR607747.1| full-length cDNA clone CS0CAP007YB09 of Thymus o...	155	2e-34
87	emb|CR607612.1| full-length cDNA clone CS0DE002YJ03 of Placenta ...	155	2e-34
88	emb|CR607006.1| full-length cDNA clone CS0DL005YN02 of B cells (...	155	2e-34
89	emb|CR606602.1| full-length cDNA clone CS0DE002YD08 of Placenta ...	155	2e-34
90	emb|CR605226.1| full-length cDNA clone CS0DA001YI08 of Neuroblas...	155	2e-34
91	emb|CR596231.1| full-length cDNA clone CS0CAP001YL18 of Thymus o...	155	2e-34
92	emb|CR594414.1| full-length cDNA clone CS0DF019YI05 of Fetal bra...	155	2e-34
93	emb|CR593005.1| full-length cDNA clone CS0DC023YC03 of Neuroblas...	155	2e-34
94	emb|CR591765.1| full-length cDNA clone CS0DF026YI06 of Fetal bra...	155	2e-34
95	emb|CR590936.1| full-length cDNA clone CS0DJ001YF12 of T cells (...	155	2e-34
96	gb|BC068051.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	155	2e-34
97	gb|BC017252.1| Homo sapiens, clone IMAGE:2905229, mRNA	155	2e-34
98	gb|BC007700.1| Homo sapiens, clone IMAGE:3954272, mRNA	155	2e-34
99	gb|AY892474.1| Synthetic construct Homo sapiens clone FLH028028....	155	2e-34
100	gb|AY889989.1| Synthetic construct Homo sapiens clone FLH028029....	155	2e-34
101	gb|BC071923.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	155	2e-34
102	gb|BC071924.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	155	2e-34
103	gb|BC071922.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	155	2e-34
104	gb|BC071673.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	155	2e-34
105	gb|BC018993.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	155	2e-34
106	gb|BC032129.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	155	2e-34
107	ref|NM_002952.3| Homo sapiens ribosomal protein S2 (RPS2), mRNA	155	2e-34
108	dbj|AB082925.1| Homo sapiens rps2 mRNA for ribosomal protein S2,...	155	2e-34
109	gb|BC008329.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	155	2e-34
110	gb|BC029979.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	155	2e-34
111	gb|BC013833.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	155	2e-34
112	gb|BC035427.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	155	2e-34
113	dbj|AB065088.1| Homo sapiens OK/KNS-cl.6 mRNA for ribosomal prot...	155	2e-34
114	gb|AC005606.3| Homo sapiens chromosome 16, P1 clone 109-8C (LANL...	153	8e-34
115	gb|AC005363.1| Homo sapiens chromosome 16, P1 clone 47-2H (LANL)...	153	8e-34
116	gb|BC063011.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clo...	153	8e-34
117	dbj|AB065089.1| Homo sapiens OK/KNS-cl.7 mRNA for ribosomal prot...	153	8e-34
118	gb|DQ214052.1| Taeniopygia guttata clone 0058P0045G10 ribosomal ...	149	1e-32
119	gb|AY292479.1| Eleginus gracilis S2 ribosomal protein (S2) gene,...	149	1e-32
120	gb|AY292477.1| Microgadus tomcod S2 ribosomal protein (S2) gene,...	149	1e-32
121	gb|AY292471.1| Theragra chalcogramma S2 ribosomal protein (S2) g...	149	1e-32
122	emb|AJ132531.1|PAB132531 Picea abies mRNA for 40S ribosomal prot...	149	1e-32
123	ref|XM_510798.1| PREDICTED: Pan troglodytes similar to ribosomal...	147	5e-32
124	gb|AC026366.20| Homo sapiens 12 BAC RP11-139O18 (Roswell Park Ca...	147	5e-32
125	gb|AC073596.40| Homo sapiens 12 BAC RP11-385C6 (Roswell Park Can...	147	5e-32
126	ref|XM_946024.1| PREDICTED: Homo sapiens similar to ribosomal pr...	147	5e-32
127	ref|XM_946023.1| PREDICTED: Homo sapiens similar to ribosomal pr...	147	5e-32
128	ref|XM_946022.1| PREDICTED: Homo sapiens similar to ribosomal pr...	147	5e-32
129	ref|XM_946021.1| PREDICTED: Homo sapiens similar to ribosomal pr...	147	5e-32
130	ref|XM_946020.1| PREDICTED: Homo sapiens similar to ribosomal pr...	147	5e-32
131	ref|XM_942473.1| PREDICTED: Homo sapiens similar to ribosomal pr...	147	5e-32
132	gb|AC022210.8| Homo sapiens BAC clone RP11-617F9 from 2, complet...	147	5e-32
133	gb|AY190670.1| Pagrus major 40S ribosomal protein S2 mRNA, parti...	145	2e-31
134	gb|AC093196.2| Drosophila melanogaster clone BACR22H06, complete...	145	2e-31
135	gb|AC009744.8| Drosophila melanogaster clone BACR06G16, complete...	145	2e-31
136	gb|AY292480.1| Micromesistius poutassou S2 ribosomal protein (S2...	145	2e-31
137	emb|AL031671.12|HS688G8 Human DNA sequence from clone RP4-688G8 ...	145	2e-31
138	gb|AC091305.9| Homo sapiens chromosome 18, clone RP11-644A7, com...	145	2e-31
139	emb|X69120.1|DMRPS2 D.melanogaster mRNA for ribosomal protein S2	145	2e-31
140	gb|AY094799.1| Drosophila melanogaster LD24077 full insert cDNA	145	2e-31
141	ref|NM_057526.3| Drosophila melanogaster string of pearls CG5920...	145	2e-31
142	ref|NG_000946.1| Homo sapiens ribosomal protein S2-like 1 (RPS2L...	145	2e-31
143	gb|AE003626.4| Drosophila melanogaster chromosome 2L, section 35...	145	2e-31
144	gb|U01334.1|DMU01334 Drosophila melanogaster ribosomal protein S...	145	2e-31
145	gb|AC005135.1|AC005135 Drosophila melanogaster DNA sequence (P1 ...	145	2e-31
146	dbj|AP006685.1| Lotus japonicus genomic DNA, chromosome 1, clone...	145	2e-31
147	gb|U01335.1|DMU01335 Drosophila melanogaster ribosomal protein S...	145	2e-31
148	dbj|AB246885.1| Lethenteron japonicum RPS2 mRNA for ribosomal pr...	143	8e-31
149	ref|XM_946019.1| PREDICTED: Homo sapiens similar to ribosomal pr...	143	8e-31
150	ref|XM_514680.1| PREDICTED: Pan troglodytes LOC458285 (LOC458285...	139	1e-29
151	gb|DQ214051.1| Taeniopygia guttata clone 0058P0017F05 ribosomal ...	139	1e-29
152	gb|DQ214050.1| Taeniopygia guttata clone 0061P0020E02 ribosomal ...	139	1e-29
153	gb|AC092268.4| Homo sapiens chromosome X clone RP11-185O17 map p...	139	1e-29
154	gb|AY292478.1| Microgadus proximus S2 ribosomal protein (S2) gen...	139	1e-29
155	emb|AL663070.15| Human DNA sequence from clone RP3-342P20 on chr...	139	1e-29
156	gb|AC097658.2| Homo sapiens BAC clone RP11-364L4 from 4, complet...	139	1e-29
157	ref|XM_938104.1| PREDICTED: Homo sapiens similar to ribosomal pr...	139	1e-29
158	ref|XM_930178.1| PREDICTED: Homo sapiens similar to ribosomal pr...	139	1e-29
159	ref|NG_002522.1| Homo sapiens ribosomal protein S2 pseudogene 4 ...	139	1e-29
160	gb|DQ021880.1| Homo sapiens GRB2-associated binding protein 1 (G...	139	1e-29
161	emb|AL590326.3|CNS07EG7 Human chromosome 14 DNA sequence BAC R-4...	139	1e-29
162	emb|AL583810.5|CNS07EFZ Human chromosome 14 DNA sequence BAC C-3...	139	1e-29
163	ref|XM_523967.1| PREDICTED: Pan troglodytes similar to 40S ribos...	137	5e-29
164	ref|XM_515580.1| PREDICTED: Pan troglodytes LOC459356 (LOC459356...	137	5e-29
165	ref|XM_513399.1| PREDICTED: Pan troglodytes similar to ribosomal...	137	5e-29
166	emb|AL596275.10| Human DNA sequence from clone RP11-183G22 on ch...	137	5e-29
167	emb|AL355802.13| Human DNA sequence from clone RP3-337H4 on chro...	137	5e-29
168	emb|AL162430.15| Human DNA sequence from clone RP11-296A18 on ch...	137	5e-29
169	ref|XM_942424.1| PREDICTED: Homo sapiens similar to ribosomal pr...	137	5e-29
170	ref|XM_496363.2| PREDICTED: Homo sapiens similar to ribosomal pr...	137	5e-29
171	gb|AY130359.1| Branchiostoma lanceolatum ribosomal protein S2 mR...	137	5e-29
172	gb|AY292481.1| Trisopterus esmarkii S2 ribosomal protein (S2) ge...	135	2e-28
173	ref|XM_945956.1| PREDICTED: Homo sapiens similar to ribosomal pr...	135	2e-28
174	ref|XM_934646.1| PREDICTED: Homo sapiens similar to ribosomal pr...	135	2e-28
175	ref|XM_517458.1| PREDICTED: Pan troglodytes similar to GRB2-asso...	131	3e-27
176	ref|XM_521016.1| PREDICTED: Pan troglodytes similar to ribosomal...	129	1e-26
177	ref|XM_849364.1| PREDICTED: Canis familiaris similar to 40S ribo...	129	1e-26
178	ref|XM_855734.1| PREDICTED: Canis familiaris similar to 40S ribo...	129	1e-26
179	ref|XM_845058.1| PREDICTED: Canis familiaris similar to 40S ribo...	129	1e-26
180	ref|XM_859982.1| PREDICTED: Canis familiaris similar to 40S ribo...	129	1e-26
181	ref|XM_859963.1| PREDICTED: Canis familiaris similar to 40S ribo...	129	1e-26
182	ref|XM_859945.1| PREDICTED: Canis familiaris similar to 40S ribo...	129	1e-26
183	ref|XM_859927.1| PREDICTED: Canis familiaris similar to 40S ribo...	129	1e-26
184	ref|XM_537011.2| PREDICTED: Canis familiaris similar to 40S ribo...	129	1e-26
185	gb|AC012618.7| Homo sapiens chromosome 19 clone CTD-2666L21, com...	129	1e-26
186	ref|XM_513943.1| PREDICTED: Pan troglodytes similar to ribosomal...	127	5e-26
187	gb|AY292482.1| Trisopterus minutus S2 ribosomal protein (S2) gen...	127	5e-26
188	gb|AC034268.4| Homo sapiens chromosome 17, clone RP11-312B18, co...	127	5e-26
189	ref|XM_215498.3| PREDICTED: Rattus norvegicus similar to Hypothe...	125	2e-25
190	emb|AL137072.8| Human DNA sequence from clone RP11-29B11 on chro...	123	8e-25
191	ref|XM_945419.1| PREDICTED: Homo sapiens similar to ribosomal pr...	123	8e-25
192	ref|XM_945418.1| PREDICTED: Homo sapiens similar to ribosomal pr...	123	8e-25
193	ref|XM_945417.1| PREDICTED: Homo sapiens similar to ribosomal pr...	123	8e-25
194	ref|XM_945415.1| PREDICTED: Homo sapiens similar to ribosomal pr...	123	8e-25
195	ref|XM_941738.1| PREDICTED: Homo sapiens similar to ribosomal pr...	123	8e-25
196	ref|XM_934189.1| PREDICTED: Homo sapiens similar to ribosomal pr...	123	8e-25
197	ref|XM_934185.1| PREDICTED: Homo sapiens similar to ribosomal pr...	123	8e-25
198	ref|XM_934183.1| PREDICTED: Homo sapiens similar to ribosomal pr...	123	8e-25
199	ref|XM_934180.1| PREDICTED: Homo sapiens similar to ribosomal pr...	123	8e-25
200	ref|XM_934176.1| PREDICTED: Homo sapiens similar to ribosomal pr...	123	8e-25
201	ref|XM_039218.13| PREDICTED: Homo sapiens similar to ribosomal p...	123	8e-25
202	gb|AC107956.8| Homo sapiens chromosome 11, clone RP11-452G18, co...	123	8e-25
203	gb|BC098726.1| Rattus norvegicus ribosomal protein S2, mRNA (cDN...	121	3e-24
204	ref|XM_527688.1| PREDICTED: Pan troglodytes similar to MGC27348 ...	121	3e-24
205	ref|XM_527393.1| PREDICTED: Pan troglodytes similar to exportin ...	121	3e-24
206	ref|NM_031838.3| Rattus norvegicus ribosomal protein S2 (Rps2), ...	121	3e-24
207	gb|AC023105.7| Homo sapiens BAC clone GS1-13M19 from 7, complete...	121	3e-24
208	emb|AL592295.25| Human DNA sequence from clone RP11-122G18 on ch...	121	3e-24
209	emb|X57432.1|RRRPS2 R.rattus mRNA for ribosomal protein S2	121	3e-24
210	gb|BC026177.1| Homo sapiens ribosomal protein S2 pseudogene, mRN...	121	3e-24
211	ref|XM_937623.1| PREDICTED: Homo sapiens similar to ribosomal pr...	121	3e-24
212	ref|XM_499270.2| PREDICTED: Homo sapiens similar to ribosomal pr...	121	3e-24
213	ref|XM_171158.5| PREDICTED: Homo sapiens similar to ribosomal pr...	121	3e-24
214	gb|U92700.1|RNU92700 Rattus norvegicus ribosomal protein S2 mRNA...	121	3e-24
215	gb|U92696.1|RNU92696 Rattus norvegicus ribosomal protein S2 mRNA...	121	3e-24
216	gb|AY130361.1| Petromyzon marinus ribosomal protein S2 mRNA, par...	119	1e-23
217	gb|AC098590.3| Homo sapiens BAC clone RP11-324J13 from 4, comple...	119	1e-23
218	gb|U92698.1|RNU92698 Rattus norvegicus ribosomal protein S2 mRNA...	119	1e-23
219	ref|XR_003696.1| PREDICTED: Mus musculus hypothetical LOC620877 ...	117	5e-23
220	gb|AC129342.5| Rattus norvegicus BAC CH230-229B21 (Children's H...	117	5e-23
221	gb|U92699.1|RNU92699 Rattus norvegicus ribosomal protein S2 mRNA...	117	5e-23
222	emb|AL607129.16| Mouse DNA sequence from clone RP23-120H2 on chr...	117	5e-23
223	ref|XM_520152.1| PREDICTED: Pan troglodytes similar to ribosomal...	115	2e-22
224	ref|XM_532470.2| PREDICTED: Canis familiaris hypothetical LOC475...	115	2e-22
225	ref|XM_537709.2| PREDICTED: Canis familiaris similar to 40S ribo...	115	2e-22
226	emb|CR707364.2|CNS0G8R4 Tetraodon nigroviridis full-length cDNA	113	7e-22
227	emb|CR675272.2|CNS0FK0E Tetraodon nigroviridis full-length cDNA	113	7e-22
228	emb|CR674020.2|CNS0FJ1M Tetraodon nigroviridis full-length cDNA	113	7e-22
229	gb|U92697.1|RNU92697 Rattus norvegicus ribosomal protein S2 mRNA...	113	7e-22
230	gb|BC106136.1| Mus musculus ribosomal protein S2, mRNA (cDNA clo...	111	3e-21
231	gb|AC154566.2| Mus musculus BAC clone RP23-407A17 from chromosom...	111	3e-21
232	gb|AC140426.3| Mus musculus BAC clone RP24-98A17 from chromosome...	111	3e-21
233	gb|AC132345.4| Mus musculus BAC clone RP24-177P9 from chromosome...	111	3e-21
234	ref|NM_008503.2| Mus musculus ribosomal protein S2 (Rps2), mRNA	111	3e-21
235	ref|XM_989830.1| PREDICTED: Mus musculus similar to 40S ribosoma...	111	3e-21
236	ref|XM_994358.1| PREDICTED: Mus musculus similar to 40S ribosoma...	111	3e-21
237	ref|XM_985281.1| PREDICTED: Mus musculus similar to 40S ribosoma...	111	3e-21
238	ref|XM_001001275.1| PREDICTED: Mus musculus similar to 40S ribos...	111	3e-21
239	ref|XM_916654.2| PREDICTED: Mus musculus similar to 40S ribosoma...	111	3e-21
240	ref|XM_484395.4| PREDICTED: Mus musculus similar to 40S ribosoma...	111	3e-21
241	ref|XR_002630.1| PREDICTED: Mus musculus similar to ribosomal pr...	111	3e-21
242	ref|XR_002093.1| PREDICTED: Mus musculus hypothetical LOC634678 ...	111	3e-21
243	ref|XM_924178.2| PREDICTED: Mus musculus similar to 40S ribosoma...	111	3e-21
244	ref|XM_916251.2| PREDICTED: Mus musculus similar to 40S ribosoma...	111	3e-21
245	ref|XM_902930.2| PREDICTED: Mus musculus similar to 40S ribosoma...	111	3e-21
246	ref|XM_620794.3| PREDICTED: Mus musculus similar to 40S ribosoma...	111	3e-21
247	ref|XR_003219.1| PREDICTED: Mus musculus similar to ribosomal pr...	111	3e-21
248	gb|AC122252.4| Mus musculus BAC clone RP23-170E7 from chromosome...	111	3e-21
249	gb|AC122367.4| Mus musculus BAC clone RP23-449L24 from chromosom...	111	3e-21
250	gb|AC069564.34| Mus musculus strain C57BL/6J chromosome 17 clone...	111	3e-21
251	emb|BX649539.6| Mouse DNA sequence from clone RP24-371A24 on chr...	111	3e-21
252	gb|BC094058.1| Mus musculus ribosomal protein S2, mRNA (cDNA clo...	111	3e-21
253	dbj|AK151985.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	111	3e-21
254	dbj|AK159138.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu...	111	3e-21
255	dbj|AK159121.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu...	111	3e-21
256	dbj|AK166726.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f...	111	3e-21
257	dbj|AK166664.1| Mus musculus morula whole body morula cDNA, RIKE...	111	3e-21
258	dbj|AK167799.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length...	111	3e-21
259	gb|AC008494.8| Homo sapiens chromosome 5 clone CTC-428G20, compl...	111	3e-21
260	dbj|AK152299.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	111	3e-21
261	dbj|AK151119.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	111	3e-21
262	dbj|AK168630.1| Mus musculus 16 days embryo heart cDNA, RIKEN fu...	111	3e-21
263	dbj|AK166549.1| Mus musculus 5 days embryo whole body cDNA, RIKE...	111	3e-21
264	dbj|AK168528.1| Mus musculus 16 days embryo kidney cDNA, RIKEN f...	111	3e-21
265	dbj|AK167033.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f...	111	3e-21
266	dbj|AK163821.1| Mus musculus 16 days embryo head cDNA, RIKEN ful...	111	3e-21
267	dbj|AK169119.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f...	111	3e-21
268	gb|AC161265.2| Mus musculus BAC clone RP23-271F18 from chromosom...	111	3e-21
269	dbj|AK012360.1| Mus musculus 11 days embryo whole body cDNA, RIK...	111	3e-21
270	dbj|AK191286.1| Mus musculus cDNA, clone:Y1G0105G13, strand:plus...	111	3e-21
271	gb|AC008585.4|AC008585 Homo sapiens chromosome 5 clone CTC-568C6...	111	3e-21
272	gb|BC091730.1| Mus musculus ribosomal protein S2, mRNA (cDNA clo...	111	3e-21
273	gb|BC087956.1| Mus musculus ribosomal protein S2, mRNA (cDNA clo...	111	3e-21
274	gb|BC110678.1| Mus musculus ribosomal protein S2, mRNA (cDNA clo...	111	3e-21
275	gb|M20634.1|MUSRSC Mouse LLRep3 protein pseudogene from a repeti...	111	3e-21
276	gb|M20632.1|MUSRSA Mouse LLRep3 protein mRNA from a repetitive e...	111	3e-21
277	gb|AC091981.4| Homo sapiens chromosome 5 clone RP11-549L3, compl...	111	3e-21
278	emb|AL929371.6| Mouse DNA sequence from clone RP23-176O5 on chro...	109	1e-20
279	ref|NG_002575.1| Homo sapiens ribosomal protein S2 pseudogene 2 ...	109	1e-20
280	gb|AC005519.3|AC005519 Homo sapiens PAC clone RP5-919J22 from 14...	109	1e-20
281	ref|NM_129748.2| Arabidopsis thaliana structural constituent of ...	107	4e-20
282	ref|XM_508308.1| PREDICTED: Pan troglodytes similar to ribosomal...	107	4e-20
283	gb|AC159199.3| Mus musculus BAC clone RP23-401H23 from chromosom...	107	4e-20
284	gb|AY133561.1| Arabidopsis thaliana At2g41840/T11A7.6 mRNA, comp...	107	4e-20
285	gb|AY048250.1| Arabidopsis thaliana At2g41840/T11A7.6 mRNA, comp...	107	4e-20
286	gb|AY085726.1| Arabidopsis thaliana clone 17415 mRNA, complete s...	107	4e-20
287	dbj|AB038509.1| Trichosporon mucoides mRNA for ribosomal protein...	107	4e-20
288	ref|XM_549224.2| PREDICTED: Canis familiaris similar to 40S ribo...	105	2e-19
289	ref|XR_003800.1| PREDICTED: Mus musculus similar to 40S ribosoma...	105	2e-19
290	ref|XR_005015.1| PREDICTED: Mus musculus similar to 40S ribosoma...	105	2e-19
291	ref|XM_001000286.1| PREDICTED: Mus musculus similar to 40S ribos...	105	2e-19
292	ref|XM_001001372.1| PREDICTED: Mus musculus similar to 40S ribos...	105	2e-19
293	ref|XR_003910.1| PREDICTED: Mus musculus similar to 40S ribosoma...	105	2e-19
294	ref|XM_992869.1| PREDICTED: Mus musculus similar to 40S ribosoma...	105	2e-19
295	gb|AC127419.3| Mus musculus BAC clone RP24-242N1 from chromosome...	105	2e-19
296	emb|CR734203.2|CNS0GTAI Tetraodon nigroviridis full-length cDNA	105	2e-19
297	emb|CR664366.2|CNS0FBLG Tetraodon nigroviridis full-length cDNA	105	2e-19
298	emb|CR704660.2|CNS0G6O0 Tetraodon nigroviridis full-length cDNA	105	2e-19
299	emb|CR692231.2|CNS0FX2R Tetraodon nigroviridis full-length cDNA	105	2e-19
300	emb|CR732001.2|CNS0GRRA Tetraodon nigroviridis full-length cDNA	105	2e-19
301	emb|CR727725.2|CNS0GOGJ Tetraodon nigroviridis full-length cDNA	105	2e-19
302	emb|CR722979.2|CNS0GKSP Tetraodon nigroviridis full-length cDNA	105	2e-19
303	emb|CR722923.2|CNS0GKR5 Tetraodon nigroviridis full-length cDNA	105	2e-19
304	emb|CR722531.2|CNS0GKG9 Tetraodon nigroviridis full-length cDNA	105	2e-19
305	emb|CR722105.2|CNS0GK4F Tetraodon nigroviridis full-length cDNA	105	2e-19
306	emb|CR721993.2|CNS0GK1B Tetraodon nigroviridis full-length cDNA	105	2e-19
307	emb|CR721787.2|CNS0GJVL Tetraodon nigroviridis full-length cDNA	105	2e-19
308	emb|CR721776.2|CNS0GJVA Tetraodon nigroviridis full-length cDNA	105	2e-19
309	emb|CR720995.2|CNS0GJ9L Tetraodon nigroviridis full-length cDNA	105	2e-19
310	emb|CR720848.2|CNS0GJ5I Tetraodon nigroviridis full-length cDNA	105	2e-19
311	emb|CR720822.2|CNS0GJ4S Tetraodon nigroviridis full-length cDNA	105	2e-19
312	emb|CR720790.2|CNS0GJ3W Tetraodon nigroviridis full-length cDNA	105	2e-19
313	emb|CR720655.2|CNS0GJ05 Tetraodon nigroviridis full-length cDNA	105	2e-19
314	emb|CR719532.2|CNS0GI4Y Tetraodon nigroviridis full-length cDNA	105	2e-19
315	emb|CR719436.2|CNS0GI2A Tetraodon nigroviridis full-length cDNA	105	2e-19
316	emb|CR719289.2|CNS0GHY7 Tetraodon nigroviridis full-length cDNA	105	2e-19
317	emb|CR718977.2|CNS0GHPJ Tetraodon nigroviridis full-length cDNA	105	2e-19
318	emb|CR716876.2|CNS0GG39 Tetraodon nigroviridis full-length cDNA	105	2e-19
319	emb|CR715849.2|CNS0GFAT Tetraodon nigroviridis full-length cDNA	105	2e-19
320	emb|CR714666.2|CNS0GEDY Tetraodon nigroviridis full-length cDNA	105	2e-19
321	emb|CR711482.2|CNS0GBXI Tetraodon nigroviridis full-length cDNA	105	2e-19
322	emb|CR714363.2|CNS0GE5J Tetraodon nigroviridis full-length cDNA	105	2e-19
323	emb|CR714249.2|CNS0GE2D Tetraodon nigroviridis full-length cDNA	105	2e-19
324	emb|CR713933.2|CNS0GDTL Tetraodon nigroviridis full-length cDNA	105	2e-19
325	emb|CR713523.2|CNS0GDI7 Tetraodon nigroviridis full-length cDNA	105	2e-19
326	emb|CR713114.2|CNS0GD6U Tetraodon nigroviridis full-length cDNA	105	2e-19
327	emb|CR711046.2|CNS0GBLE Tetraodon nigroviridis full-length cDNA	105	2e-19
328	emb|CR710399.2|CNS0GB3F Tetraodon nigroviridis full-length cDNA	105	2e-19
329	emb|CR710221.2|CNS0GAYH Tetraodon nigroviridis full-length cDNA	105	2e-19
330	emb|CR709721.2|CNS0GAKL Tetraodon nigroviridis full-length cDNA	105	2e-19
331	emb|CR709470.2|CNS0GADM Tetraodon nigroviridis full-length cDNA	105	2e-19
332	emb|CR709452.2|CNS0GAD4 Tetraodon nigroviridis full-length cDNA	105	2e-19
333	emb|CR708860.2|CNS0G9WO Tetraodon nigroviridis full-length cDNA	105	2e-19
334	emb|CR708175.2|CNS0G9DN Tetraodon nigroviridis full-length cDNA	105	2e-19
335	emb|CR707530.2|CNS0G8VQ Tetraodon nigroviridis full-length cDNA	105	2e-19
336	emb|CR706797.2|CNS0G8BD Tetraodon nigroviridis full-length cDNA	105	2e-19
337	emb|CR706741.2|CNS0G89T Tetraodon nigroviridis full-length cDNA	105	2e-19
338	emb|CR706127.2|CNS0G7SR Tetraodon nigroviridis full-length cDNA	105	2e-19
339	emb|CR705311.2|CNS0G763 Tetraodon nigroviridis full-length cDNA	105	2e-19
340	emb|CR705131.2|CNS0G713 Tetraodon nigroviridis full-length cDNA	105	2e-19
341	emb|CR704751.2|CNS0G6QJ Tetraodon nigroviridis full-length cDNA	105	2e-19
342	emb|CR704575.2|CNS0G6LN Tetraodon nigroviridis full-length cDNA	105	2e-19
343	emb|CR704548.2|CNS0G6KW Tetraodon nigroviridis full-length cDNA	105	2e-19
344	emb|CR704377.2|CNS0G6G5 Tetraodon nigroviridis full-length cDNA	105	2e-19
345	emb|CR704255.2|CNS0G6CR Tetraodon nigroviridis full-length cDNA	105	2e-19
346	emb|CR703866.2|CNS0G61Y Tetraodon nigroviridis full-length cDNA	105	2e-19
347	emb|CR703822.2|CNS0G60Q Tetraodon nigroviridis full-length cDNA	105	2e-19
348	emb|CR703691.2|CNS0G5X3 Tetraodon nigroviridis full-length cDNA	105	2e-19
349	emb|CR703346.2|CNS0G5NI Tetraodon nigroviridis full-length cDNA	105	2e-19
350	emb|CR703068.2|CNS0G5FS Tetraodon nigroviridis full-length cDNA	105	2e-19
351	emb|CR702851.2|CNS0G59R Tetraodon nigroviridis full-length cDNA	105	2e-19
352	emb|CR702318.2|CNS0G4UY Tetraodon nigroviridis full-length cDNA	105	2e-19
353	emb|CR702234.2|CNS0G4SM Tetraodon nigroviridis full-length cDNA	105	2e-19
354	emb|CR701941.2|CNS0G4KH Tetraodon nigroviridis full-length cDNA	105	2e-19
355	emb|CR701183.2|CNS0G3ZF Tetraodon nigroviridis full-length cDNA	105	2e-19
356	emb|CR701078.2|CNS0G3WI Tetraodon nigroviridis full-length cDNA	105	2e-19
357	emb|CR700962.2|CNS0G3TA Tetraodon nigroviridis full-length cDNA	105	2e-19
358	emb|CR700828.2|CNS0G3PK Tetraodon nigroviridis full-length cDNA	105	2e-19
359	emb|CR700369.2|CNS0G3CT Tetraodon nigroviridis full-length cDNA	105	2e-19
360	emb|CR699376.2|CNS0G2L8 Tetraodon nigroviridis full-length cDNA	105	2e-19
361	emb|CR699196.2|CNS0G2G8 Tetraodon nigroviridis full-length cDNA	105	2e-19
362	emb|CR699094.2|CNS0G2DE Tetraodon nigroviridis full-length cDNA	105	2e-19
363	emb|CR698997.2|CNS0G2AP Tetraodon nigroviridis full-length cDNA	105	2e-19
364	emb|CR698958.2|CNS0G29M Tetraodon nigroviridis full-length cDNA	105	2e-19
365	emb|CR697582.2|CNS0G17E Tetraodon nigroviridis full-length cDNA	105	2e-19
366	emb|CR697380.2|CNS0G11S Tetraodon nigroviridis full-length cDNA	105	2e-19
367	emb|CR697645.2|CNS0G195 Tetraodon nigroviridis full-length cDNA	105	2e-19
368	emb|CR697303.2|CNS0G0ZN Tetraodon nigroviridis full-length cDNA	105	2e-19
369	emb|CR697282.2|CNS0G0Z2 Tetraodon nigroviridis full-length cDNA	105	2e-19
370	emb|CR697110.2|CNS0G0UA Tetraodon nigroviridis full-length cDNA	105	2e-19
371	emb|CR697076.2|CNS0G0TC Tetraodon nigroviridis full-length cDNA	105	2e-19
372	emb|CR696836.2|CNS0G0MO Tetraodon nigroviridis full-length cDNA	105	2e-19
373	emb|CR696806.2|CNS0G0LU Tetraodon nigroviridis full-length cDNA	105	2e-19
374	emb|CR696226.2|CNS0G05Q Tetraodon nigroviridis full-length cDNA	105	2e-19
375	emb|CR692067.2|CNS0FWY7 Tetraodon nigroviridis full-length cDNA	105	2e-19
376	emb|CR695165.2|CNS0FZC9 Tetraodon nigroviridis full-length cDNA	105	2e-19
377	emb|CR694992.2|CNS0FZ7G Tetraodon nigroviridis full-length cDNA	105	2e-19
378	emb|CR694968.2|CNS0FZ6S Tetraodon nigroviridis full-length cDNA	105	2e-19
379	emb|CR694731.2|CNS0FZ07 Tetraodon nigroviridis full-length cDNA	105	2e-19
380	emb|CR694476.2|CNS0FYT4 Tetraodon nigroviridis full-length cDNA	105	2e-19
381	emb|CR694277.2|CNS0FYNL Tetraodon nigroviridis full-length cDNA	105	2e-19
382	emb|CR694221.2|CNS0FYM1 Tetraodon nigroviridis full-length cDNA	105	2e-19
383	emb|CR694551.1|CNS0FYV7 Tetraodon nigroviridis full-length cDNA	105	2e-19
384	emb|CR693880.2|CNS0FYCK Tetraodon nigroviridis full-length cDNA	105	2e-19
385	emb|CR693593.2|CNS0FY4L Tetraodon nigroviridis full-length cDNA	105	2e-19
386	emb|CR693530.2|CNS0FY2U Tetraodon nigroviridis full-length cDNA	105	2e-19
387	emb|CR693523.2|CNS0FY2N Tetraodon nigroviridis full-length cDNA	105	2e-19
388	emb|CR693393.2|CNS0FXZ1 Tetraodon nigroviridis full-length cDNA	105	2e-19
389	emb|CR693274.2|CNS0FXVQ Tetraodon nigroviridis full-length cDNA	105	2e-19
390	emb|CR693258.2|CNS0FXVA Tetraodon nigroviridis full-length cDNA	105	2e-19
391	emb|CR692490.2|CNS0FX9Y Tetraodon nigroviridis full-length cDNA	105	2e-19
392	emb|CR692427.2|CNS0FX87 Tetraodon nigroviridis full-length cDNA	105	2e-19
393	emb|CR692279.2|CNS0FX43 Tetraodon nigroviridis full-length cDNA	105	2e-19
394	emb|CR691961.2|CNS0FWV9 Tetraodon nigroviridis full-length cDNA	105	2e-19
395	emb|CR691931.2|CNS0FWUF Tetraodon nigroviridis full-length cDNA	105	2e-19
396	emb|CR690870.2|CNS0FW0Y Tetraodon nigroviridis full-length cDNA	105	2e-19
397	emb|CR690602.2|CNS0FVTI Tetraodon nigroviridis full-length cDNA	105	2e-19
398	emb|CR688382.2|CNS0FU3U Tetraodon nigroviridis full-length cDNA	105	2e-19
399	emb|CR690358.2|CNS0FVMQ Tetraodon nigroviridis full-length cDNA	105	2e-19
400	emb|CR690261.2|CNS0FVK1 Tetraodon nigroviridis full-length cDNA	105	2e-19
401	emb|CR689809.2|CNS0FV7H Tetraodon nigroviridis full-length cDNA	105	2e-19
402	emb|CR689481.2|CNS0FUYD Tetraodon nigroviridis full-length cDNA	105	2e-19
403	emb|CR689440.2|CNS0FUX8 Tetraodon nigroviridis full-length cDNA	105	2e-19
404	emb|CR689418.2|CNS0FUWM Tetraodon nigroviridis full-length cDNA	105	2e-19
405	emb|CR689124.2|CNS0FUOG Tetraodon nigroviridis full-length cDNA	105	2e-19
406	emb|CR688962.2|CNS0FUJY Tetraodon nigroviridis full-length cDNA	105	2e-19
407	emb|CR687672.2|CNS0FTK4 Tetraodon nigroviridis full-length cDNA	105	2e-19
408	emb|CR687218.2|CNS0FT7I Tetraodon nigroviridis full-length cDNA	105	2e-19
409	emb|CR687365.2|CNS0FTBL Tetraodon nigroviridis full-length cDNA	105	2e-19
410	emb|CR687288.2|CNS0FT9G Tetraodon nigroviridis full-length cDNA	105	2e-19
411	emb|CR687016.2|CNS0FT1W Tetraodon nigroviridis full-length cDNA	105	2e-19
412	emb|CR686549.2|CNS0FSOX Tetraodon nigroviridis full-length cDNA	105	2e-19
413	emb|CR686529.2|CNS0FSOD Tetraodon nigroviridis full-length cDNA	105	2e-19
414	emb|CR686330.2|CNS0FSIU Tetraodon nigroviridis full-length cDNA	105	2e-19
415	emb|CR686278.2|CNS0FSHE Tetraodon nigroviridis full-length cDNA	105	2e-19
416	emb|CR685657.2|CNS0FS05 Tetraodon nigroviridis full-length cDNA	105	2e-19
417	emb|CR685477.2|CNS0FRV5 Tetraodon nigroviridis full-length cDNA	105	2e-19
418	emb|CR685266.2|CNS0FRPA Tetraodon nigroviridis full-length cDNA	105	2e-19
419	emb|CR684991.2|CNS0FRHN Tetraodon nigroviridis full-length cDNA	105	2e-19
420	emb|CR684512.2|CNS0FR4C Tetraodon nigroviridis full-length cDNA	105	2e-19
421	emb|CR682074.2|CNS0FP8M Tetraodon nigroviridis full-length cDNA	105	2e-19
422	emb|CR682039.2|CNS0FP7N Tetraodon nigroviridis full-length cDNA	105	2e-19
423	emb|CR684210.2|CNS0FQVY Tetraodon nigroviridis full-length cDNA	105	2e-19
424	emb|CR683481.2|CNS0FQBP Tetraodon nigroviridis full-length cDNA	105	2e-19
425	emb|CR683743.2|CNS0FQIZ Tetraodon nigroviridis full-length cDNA	105	2e-19
426	emb|CR683272.2|CNS0FQ5W Tetraodon nigroviridis full-length cDNA	105	2e-19
427	emb|CR683139.2|CNS0FQ27 Tetraodon nigroviridis full-length cDNA	105	2e-19
428	emb|CR683119.2|CNS0FQ1N Tetraodon nigroviridis full-length cDNA	105	2e-19
429	emb|CR682861.2|CNS0FPUH Tetraodon nigroviridis full-length cDNA	105	2e-19
430	emb|CR682824.2|CNS0FPTG Tetraodon nigroviridis full-length cDNA	105	2e-19
431	emb|CR682804.2|CNS0FPSW Tetraodon nigroviridis full-length cDNA	105	2e-19
432	emb|CR682705.2|CNS0FPQ5 Tetraodon nigroviridis full-length cDNA	105	2e-19
433	emb|CR682698.2|CNS0FPPY Tetraodon nigroviridis full-length cDNA	105	2e-19
434	emb|CR682548.2|CNS0FPLS Tetraodon nigroviridis full-length cDNA	105	2e-19
435	emb|CR682516.2|CNS0FPKW Tetraodon nigroviridis full-length cDNA	105	2e-19
436	emb|CR682454.2|CNS0FPJ6 Tetraodon nigroviridis full-length cDNA	105	2e-19
437	emb|CR682125.2|CNS0FPA1 Tetraodon nigroviridis full-length cDNA	105	2e-19
438	emb|CR682100.2|CNS0FP9C Tetraodon nigroviridis full-length cDNA	105	2e-19
439	emb|CR681712.2|CNS0FOYK Tetraodon nigroviridis full-length cDNA	105	2e-19
440	emb|CR681340.2|CNS0FOO8 Tetraodon nigroviridis full-length cDNA	105	2e-19
441	emb|CR681035.2|CNS0FOFR Tetraodon nigroviridis full-length cDNA	105	2e-19
442	emb|CR680889.2|CNS0FOBP Tetraodon nigroviridis full-length cDNA	105	2e-19
443	emb|CR680825.2|CNS0FO9X Tetraodon nigroviridis full-length cDNA	105	2e-19
444	emb|CR680821.2|CNS0FO9T Tetraodon nigroviridis full-length cDNA	105	2e-19
445	emb|CR680706.2|CNS0FO6M Tetraodon nigroviridis full-length cDNA	105	2e-19
446	emb|CR680686.2|CNS0FO62 Tetraodon nigroviridis full-length cDNA	105	2e-19
447	emb|CR680416.2|CNS0FNYK Tetraodon nigroviridis full-length cDNA	105	2e-19
448	emb|CR680180.2|CNS0FNS0 Tetraodon nigroviridis full-length cDNA	105	2e-19
449	emb|CR680014.2|CNS0FNNE Tetraodon nigroviridis full-length cDNA	105	2e-19
450	emb|CR679994.2|CNS0FNMU Tetraodon nigroviridis full-length cDNA	105	2e-19
451	emb|CR678823.2|CNS0FMQB Tetraodon nigroviridis full-length cDNA	105	2e-19
452	emb|CR677493.2|CNS0FLPT Tetraodon nigroviridis full-length cDNA	105	2e-19
453	emb|CR678225.2|CNS0FM9X Tetraodon nigroviridis full-length cDNA	105	2e-19
454	emb|CR678220.2|CNS0FM9S Tetraodon nigroviridis full-length cDNA	105	2e-19
455	emb|CR678547.2|CNS0FMIN Tetraodon nigroviridis full-length cDNA	105	2e-19
456	emb|CR678499.2|CNS0FMHB Tetraodon nigroviridis full-length cDNA	105	2e-19
457	emb|CR678446.2|CNS0FMFX Tetraodon nigroviridis full-length cDNA	105	2e-19
458	emb|CR678161.2|CNS0FM85 Tetraodon nigroviridis full-length cDNA	105	2e-19
459	emb|CR677434.2|CNS0FLO6 Tetraodon nigroviridis full-length cDNA	105	2e-19
460	emb|CR677417.2|CNS0FLNP Tetraodon nigroviridis full-length cDNA	105	2e-19
461	emb|CR677340.2|CNS0FLLK Tetraodon nigroviridis full-length cDNA	105	2e-19
462	emb|CR677265.2|CNS0FLJH Tetraodon nigroviridis full-length cDNA	105	2e-19
463	emb|CR676353.2|CNS0FKU5 Tetraodon nigroviridis full-length cDNA	105	2e-19
464	emb|CR676331.2|CNS0FKTJ Tetraodon nigroviridis full-length cDNA	105	2e-19
465	emb|CR676227.2|CNS0FKQN Tetraodon nigroviridis full-length cDNA	105	2e-19
466	emb|CR676067.2|CNS0FKMH Tetraodon nigroviridis full-length cDNA	105	2e-19
467	emb|CR675712.2|CNS0FKCM Tetraodon nigroviridis full-length cDNA	105	2e-19
468	emb|CR675607.2|CNS0FK9P Tetraodon nigroviridis full-length cDNA	105	2e-19
469	emb|CR675559.2|CNS0FK8D Tetraodon nigroviridis full-length cDNA	105	2e-19
470	emb|CR675553.2|CNS0FK87 Tetraodon nigroviridis full-length cDNA	105	2e-19
471	emb|CR674841.2|CNS0FJOF Tetraodon nigroviridis full-length cDNA	105	2e-19
472	emb|CR674123.2|CNS0FJ4H Tetraodon nigroviridis full-length cDNA	105	2e-19
473	emb|CR673955.2|CNS0FIZT Tetraodon nigroviridis full-length cDNA	105	2e-19
474	emb|CR673878.2|CNS0FIXO Tetraodon nigroviridis full-length cDNA	105	2e-19
475	emb|CR673867.2|CNS0FIXD Tetraodon nigroviridis full-length cDNA	105	2e-19
476	emb|CR673257.2|CNS0FIGF Tetraodon nigroviridis full-length cDNA	105	2e-19
477	emb|CR672717.2|CNS0FI1F Tetraodon nigroviridis full-length cDNA	105	2e-19
478	emb|CR671763.2|CNS0FHAX Tetraodon nigroviridis full-length cDNA	105	2e-19
479	emb|CR671697.2|CNS0FH93 Tetraodon nigroviridis full-length cDNA	105	2e-19
480	emb|CR671689.2|CNS0FH8V Tetraodon nigroviridis full-length cDNA	105	2e-19
481	emb|CR671686.2|CNS0FH8S Tetraodon nigroviridis full-length cDNA	105	2e-19
482	emb|CR671858.2|CNS0FHDK Tetraodon nigroviridis full-length cDNA	105	2e-19
483	emb|CR671852.2|CNS0FHDE Tetraodon nigroviridis full-length cDNA	105	2e-19
484	emb|CR670761.2|CNS0FGJ3 Tetraodon nigroviridis full-length cDNA	105	2e-19
485	emb|CR670735.2|CNS0FGID Tetraodon nigroviridis full-length cDNA	105	2e-19
486	emb|CR670644.2|CNS0FGFU Tetraodon nigroviridis full-length cDNA	105	2e-19
487	emb|CR670459.2|CNS0FGAP Tetraodon nigroviridis full-length cDNA	105	2e-19
488	emb|CR670387.2|CNS0FG8P Tetraodon nigroviridis full-length cDNA	105	2e-19
489	emb|CR670160.2|CNS0FG2E Tetraodon nigroviridis full-length cDNA	105	2e-19
490	emb|CR669975.2|CNS0FFX9 Tetraodon nigroviridis full-length cDNA	105	2e-19
491	emb|CR669687.2|CNS0FFP9 Tetraodon nigroviridis full-length cDNA	105	2e-19
492	emb|CR669495.2|CNS0FFJX Tetraodon nigroviridis full-length cDNA	105	2e-19
493	emb|CR669478.2|CNS0FFJG Tetraodon nigroviridis full-length cDNA	105	2e-19
494	emb|CR669365.2|CNS0FFGB Tetraodon nigroviridis full-length cDNA	105	2e-19
495	emb|CR669257.2|CNS0FFDB Tetraodon nigroviridis full-length cDNA	105	2e-19
496	emb|CR669219.2|CNS0FFC9 Tetraodon nigroviridis full-length cDNA	105	2e-19
497	emb|CR668974.2|CNS0FF5G Tetraodon nigroviridis full-length cDNA	105	2e-19
498	emb|CR668813.2|CNS0FF0Z Tetraodon nigroviridis full-length cDNA	105	2e-19
499	emb|CR668431.2|CNS0FEQD Tetraodon nigroviridis full-length cDNA	105	2e-19
500	emb|CR668421.2|CNS0FEQ3 Tetraodon nigroviridis full-length cDNA	105	2e-19

---

>ref|XM_470037.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1064

 Score =  488 bits (246), Expect = e-134
 Identities = 471/545 (86%), Gaps = 2/545 (0%)
 Strand = Plus / Minus

                                                                       
Query: 96  taactataataaaacaaagtgcattagacagctcccagctagtaaaaaccct--ttacac 153
           |||||||  ||||||||||||||| |||||  ||| |||||| ||| || ||  |||| |
Sbjct: 929 taactattgtaaaacaaagtgcatcagacaagtccgagctagcaaagactctctttactc 870

                                                                       
Query: 154 cgacatcctaagcttctatcttctcggctggtacatcatggatcagggccttggtcggtt 213
           || |||||||||| ||||  |||||| | ||| |||||   || || ||||| ||||| |
Sbjct: 869 cgccatcctaagcctctacgttctcgacaggtgcatcaatcataagagccttagtcggct 810

                                                                       
Query: 214 tcgccaagatgtcggtgaactcctggtacggagtcttggtgaaggtcgtctccctccaga 273
           | ||||||| ||||||| |||||||| | |||| ||||  |||  | || ||||||||||
Sbjct: 809 tggccaagaggtcggtgtactcctggaatggagacttgacgaacttggtgtccctccaga 750

                                                                       
Query: 274 agtcaggggtgaggaatccataggtcttcatcaggcagtcgaaggttgccttgacgaagt 333
           ||||||| || ||||||||||| ||||||||||||||||| ||||| |||||||||||||
Sbjct: 749 agtcaggagtaaggaatccataagtcttcatcaggcagtcaaaggtggccttgacgaagt 690

                                                                       
Query: 334 tgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaataccagcgaact 393
           ||||||||||||||||||||||||| || || ||||||||||| ||||| || |||||||
Sbjct: 689 tgccaagggtcttggtggatccacgggacgaggtgaagacatcctcaatgccggcgaact 630

                                                                       
Query: 394 ggagcaccttcttggggacccgggcggcgacgattccagaacccctcggggcgggcacca 453
           | |||||||||||||| || ||||||||||| || || ||||||||||||||||||||||
Sbjct: 629 gcagcaccttcttgggcacgcgggcggcgacaatacccgaacccctcggggcgggcacca 570

                                                                       
Query: 454 tacgcacggtgacagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgc 513
           | ||||||||||||||||| ||||| |||||||||||||| ||||||||||| |||   |
Sbjct: 569 tgcgcacggtgacagagccacactttccggtgaccttgcacggcacggtgtgcggctgcc 510

                                                                       
Query: 514 cgatcttgttcccccagtagcccctcctgacggggacgatggagagcttggcgaggatga 573
           |||||||||| |||||||| |||||||||||||| || | ||| |||||||| |||||||
Sbjct: 509 cgatcttgttaccccagtaacccctcctgacgggcaccacggacagcttggccaggatga 450

                                                                       
Query: 574 tggcgccgcggatggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggc 633
           |||||||||||||||| |||||||||||||| ||||||||||| || |||||||||||||
Sbjct: 449 tggcgccgcggatggcggtggccacctccttggcgcacttgacccccagcccgacgtggc 390

                
Query: 634 cgttg 638
           |||||
Sbjct: 389 cgttg 385

---

>dbj|AK064984.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001C14, full
           insert sequence
          Length = 1084

 Score =  488 bits (246), Expect = e-134
 Identities = 471/545 (86%), Gaps = 2/545 (0%)
 Strand = Plus / Minus

                                                                       
Query: 96  taactataataaaacaaagtgcattagacagctcccagctagtaaaaaccct--ttacac 153
           |||||||  ||||||||||||||| |||||  ||| |||||| ||| || ||  |||| |
Sbjct: 971 taactattgtaaaacaaagtgcatcagacaagtccgagctagcaaagactctctttactc 912

                                                                       
Query: 154 cgacatcctaagcttctatcttctcggctggtacatcatggatcagggccttggtcggtt 213
           || |||||||||| ||||  |||||| | ||| |||||   || || ||||| ||||| |
Sbjct: 911 cgccatcctaagcctctacgttctcgacaggtgcatcaatcataagagccttagtcggct 852

                                                                       
Query: 214 tcgccaagatgtcggtgaactcctggtacggagtcttggtgaaggtcgtctccctccaga 273
           | ||||||| ||||||| |||||||| | |||| ||||  |||  | || ||||||||||
Sbjct: 851 tggccaagaggtcggtgtactcctggaatggagacttgacgaacttggtgtccctccaga 792

                                                                       
Query: 274 agtcaggggtgaggaatccataggtcttcatcaggcagtcgaaggttgccttgacgaagt 333
           ||||||| || ||||||||||| ||||||||||||||||| ||||| |||||||||||||
Sbjct: 791 agtcaggagtaaggaatccataagtcttcatcaggcagtcaaaggtggccttgacgaagt 732

                                                                       
Query: 334 tgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaataccagcgaact 393
           ||||||||||||||||||||||||| || || ||||||||||| ||||| || |||||||
Sbjct: 731 tgccaagggtcttggtggatccacgggacgaggtgaagacatcctcaatgccggcgaact 672

                                                                       
Query: 394 ggagcaccttcttggggacccgggcggcgacgattccagaacccctcggggcgggcacca 453
           | |||||||||||||| || ||||||||||| || || ||||||||||||||||||||||
Sbjct: 671 gcagcaccttcttgggcacgcgggcggcgacaatacccgaacccctcggggcgggcacca 612

                                                                       
Query: 454 tacgcacggtgacagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgc 513
           | ||||||||||||||||| ||||| |||||||||||||| ||||||||||| |||   |
Sbjct: 611 tgcgcacggtgacagagccacactttccggtgaccttgcacggcacggtgtgcggctgcc 552

                                                                       
Query: 514 cgatcttgttcccccagtagcccctcctgacggggacgatggagagcttggcgaggatga 573
           |||||||||| |||||||| |||||||||||||| || | ||| |||||||| |||||||
Sbjct: 551 cgatcttgttaccccagtaacccctcctgacgggcaccacggacagcttggccaggatga 492

                                                                       
Query: 574 tggcgccgcggatggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggc 633
           |||||||||||||||| |||||||||||||| ||||||||||| || |||||||||||||
Sbjct: 491 tggcgccgcggatggcggtggccacctccttggcgcacttgacccccagcccgacgtggc 432

                
Query: 634 cgttg 638
           |||||
Sbjct: 431 cgttg 427

---

>gb|AY104047.1| Zea mays PCO131880 mRNA sequence
          Length = 873

 Score =  426 bits (215), Expect = e-116
 Identities = 380/435 (87%)
 Strand = Plus / Minus

                                                                       
Query: 202 ccttggtcggtttcgccaagatgtcggtgaactcctggtacggagtcttggtgaaggtcg 261
           ||||||| || |||||||  | ||| ||| ||| |||| |||||||| ||| |||  | |
Sbjct: 636 ccttggtgggcttcgccagcaggtccgtgtactgctggaacggagtcatggagaacttgg 577

                                                                       
Query: 262 tctccctccagaagtcaggggtgaggaatccataggtcttcatcaggcagtcgaaggttg 321
           |||  |||||||| ||||| || ||||| || ||||||||||| ||||||||||||||||
Sbjct: 576 tctgactccagaattcaggagtaaggaagccgtaggtcttcatgaggcagtcgaaggttg 517

                                                                       
Query: 322 ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 381
           ||||||||||||||||||||||||| ||||| ||||| || || ||||||||||| ||||
Sbjct: 516 ccttgacgaagttgccaagggtcttagtggagccacgggacgaggtgaagacatcctcaa 457

                                                                       
Query: 382 taccagcgaactggagcaccttcttggggacccgggcggcgacgattccagaacccctcg 441
           | ||||||||||| |||||||||||||| || || ||||||||||| ||||||||||| |
Sbjct: 456 tgccagcgaactgcagcaccttcttgggcacgcgcgcggcgacgatgccagaacccctgg 397

                                                                       
Query: 442 gggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttgcagggcacgg 501
           | || |||||||| ||||||||||| || |||||||||||||||||||||||||||||||
Sbjct: 396 gcgcaggcaccatgcgcacggtgacggacccgcacttgccggtgaccttgcagggcacgg 337

                                                                       
Query: 502 tgtggggcatgccgatcttgttcccccagtagcccctcctgacggggacgatggagagct 561
           |||| |||   ||||||||||| ||||||||||| ||||||||||| || | ||||||||
Sbjct: 336 tgtgcggctgcccgatcttgtttccccagtagcctctcctgacgggaacaacggagagct 277

                                                                       
Query: 562 tggcgaggatgatggcgccgcggatggccgtggccacctcctttgcgcacttgacgccga 621
           |||||||||||||||||||||||||||| || ||||||||||| ||||||||||| || |
Sbjct: 276 tggcgaggatgatggcgccgcggatggcggtagccacctccttggcgcacttgactccca 217

                          
Query: 622 gcccgacgtggccgt 636
           | |||||||||||||
Sbjct: 216 ggccgacgtggccgt 202

---

>ref|XM_477083.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 831

 Score =  406 bits (205), Expect = e-110
 Identities = 367/421 (87%)
 Strand = Plus / Minus

                                                                       
Query: 216 gccaagatgtcggtgaactcctggtacggagtcttggtgaaggtcgtctccctccagaag 275
           ||||||| ||| ||| |||||||| |||| |||||| | ||  | ||||| |||||||||
Sbjct: 779 gccaagaggtccgtgtactcctggaacggcgtcttgataaacctggtctctctccagaag 720

                                                                       
Query: 276 tcaggggtgaggaatccataggtcttcatcaggcagtcgaaggttgccttgacgaagttg 335
           ||||| || ||||| |||||||||||||| || || |||||||| |||||||||||||||
Sbjct: 719 tcaggagtcaggaacccataggtcttcatgagacaatcgaaggtggccttgacgaagttg 660

                                                                       
Query: 336 ccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaataccagcgaactgg 395
           || |||||||||||||| || ||||| || |||||||| || || || || |||||||||
Sbjct: 659 ccgagggtcttggtggagccgcgcgacgaggtgaagacgtcctcgatgccggcgaactgg 600

                                                                       
Query: 396 agcaccttcttggggacccgggcggcgacgattccagaacccctcggggcgggcaccata 455
           |||||||||||||| ||  | || || ||||| || || ||||| || || |||||||| 
Sbjct: 599 agcaccttcttgggcacgtgcgccgccacgatcccggaccccctgggcgccggcaccatg 540

                                                                       
Query: 456 cgcacggtgacagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccg 515
           ||||||||||| |||||||||||||||||||||||||| ||||||||||| ||| | |||
Sbjct: 539 cgcacggtgacggagccgcacttgccggtgaccttgcacggcacggtgtgcggcttcccg 480

                                                                       
Query: 516 atcttgttcccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatg 575
           ||||||||||||||||| |||||||| ||||| |||| ||||||||||||||||||||||
Sbjct: 479 atcttgttcccccagtaccccctcctcacgggcacgacggagagcttggcgaggatgatg 420

                                                                       
Query: 576 gcgccgcggatggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggccg 635
           ||||||||||| ||||| || |||||||| ||||||||||||||||||||||||||||||
Sbjct: 419 gcgccgcggatcgccgttgcgacctccttggcgcacttgacgccgagcccgacgtggccg 360

            
Query: 636 t 636
           |
Sbjct: 359 t 359

---

>dbj|AK063732.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-120-E09, full
           insert sequence
          Length = 869

 Score =  406 bits (205), Expect = e-110
 Identities = 367/421 (87%)
 Strand = Plus / Minus

                                                                       
Query: 216 gccaagatgtcggtgaactcctggtacggagtcttggtgaaggtcgtctccctccagaag 275
           ||||||| ||| ||| |||||||| |||| |||||| | ||  | ||||| |||||||||
Sbjct: 447 gccaagaggtccgtgtactcctggaacggcgtcttgataaacctggtctctctccagaag 388

                                                                       
Query: 276 tcaggggtgaggaatccataggtcttcatcaggcagtcgaaggttgccttgacgaagttg 335
           ||||| || ||||| |||||||||||||| || || |||||||| |||||||||||||||
Sbjct: 387 tcaggagtcaggaacccataggtcttcatgagacaatcgaaggtggccttgacgaagttg 328

                                                                       
Query: 336 ccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaataccagcgaactgg 395
           || |||||||||||||| || ||||| || |||||||| || || || || |||||||||
Sbjct: 327 ccgagggtcttggtggagccgcgcgacgaggtgaagacgtcctcgatgccggcgaactgg 268

                                                                       
Query: 396 agcaccttcttggggacccgggcggcgacgattccagaacccctcggggcgggcaccata 455
           |||||||||||||| ||  | || || ||||| || || ||||| || || |||||||| 
Sbjct: 267 agcaccttcttgggcacgtgcgccgccacgatcccggaccccctgggcgccggcaccatg 208

                                                                       
Query: 456 cgcacggtgacagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccg 515
           ||||||||||| |||||||||||||||||||||||||| ||||||||||| ||| | |||
Sbjct: 207 cgcacggtgacggagccgcacttgccggtgaccttgcacggcacggtgtgcggcttcccg 148

                                                                       
Query: 516 atcttgttcccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatg 575
           ||||||||||||||||| |||||||| ||||| |||| ||||||||||||||||||||||
Sbjct: 147 atcttgttcccccagtaccccctcctcacgggcacgacggagagcttggcgaggatgatg 88

                                                                       
Query: 576 gcgccgcggatggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggccg 635
           ||||||||||| ||||| || |||||||| ||||||||||||||||||||||||||||||
Sbjct: 87  gcgccgcggatcgccgttgcgacctccttggcgcacttgacgccgagcccgacgtggccg 28

            
Query: 636 t 636
           |
Sbjct: 27  t 27

---

>gb|BT016220.1| Zea mays clone Contig53 mRNA sequence
          Length = 1159

 Score =  387 bits (195), Expect = e-104
 Identities = 375/435 (86%)
 Strand = Plus / Minus

                                                                       
Query: 202 ccttggtcggtttcgccaagatgtcggtgaactcctggtacggagtcttggtgaaggtcg 261
           |||| ||||| || ||||||| |||||||||||||||| |||| |||||||   |  | |
Sbjct: 873 cctttgtcggcttagccaagaggtcggtgaactcctggaacggggtcttggcatacttgg 814

                                                                       
Query: 262 tctccctccagaagtcaggggtgaggaatccataggtcttcatcaggcagtcgaaggttg 321
           ||||   |||||| ||||| |||||||| || |||||||||||||| || || |||||||
Sbjct: 813 tctcggcccagaactcaggagtgaggaagccgtaggtcttcatcagacaatcaaaggttg 754

                                                                       
Query: 322 ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 381
           ||||||||||||| || || ||||||||||| ||||| || || || |||||||| ||||
Sbjct: 753 ccttgacgaagttaccgagtgtcttggtggagccacgggacgaggtaaagacatcttcaa 694

                                                                       
Query: 382 taccagcgaactggagcaccttcttggggacccgggcggcgacgattccagaacccctcg 441
           | || ||||||||||| ||||||||||| || ||||| ||||| || || || ||||| |
Sbjct: 693 tgccggcgaactggaggaccttcttgggcacgcgggcagcgacaatcccggaccccctgg 634

                                                                       
Query: 442 gggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttgcagggcacgg 501
           | || |||||||| ||||||||||| || ||||||||||||||||||||||||||||| |
Sbjct: 633 gcgccggcaccatgcgcacggtgacggacccgcacttgccggtgaccttgcagggcacag 574

                                                                       
Query: 502 tgtggggcatgccgatcttgttcccccagtagcccctcctgacggggacgatggagagct 561
           |||| |||  |||||||||||| ||||||||||||||||||||||| ||||  |||||||
Sbjct: 573 tgtgcggctggccgatcttgtttccccagtagcccctcctgacgggcacgaccgagagct 514

                                                                       
Query: 562 tggcgaggatgatggcgccgcggatggccgtggccacctcctttgcgcacttgacgccga 621
           |||| |||||||||||||| |||||||| ||||| |||||||| ||||||||||||||||
Sbjct: 513 tggccaggatgatggcgccacggatggcggtggcgacctccttggcgcacttgacgccga 454

                          
Query: 622 gcccgacgtggccgt 636
           |||||||||||||||
Sbjct: 453 gcccgacgtggccgt 439

---

>gb|AY104097.1| Zea mays PCO131882 mRNA sequence
          Length = 1083

 Score =  387 bits (195), Expect = e-104
 Identities = 375/435 (86%)
 Strand = Plus / Minus

                                                                       
Query: 202 ccttggtcggtttcgccaagatgtcggtgaactcctggtacggagtcttggtgaaggtcg 261
           |||| ||||| || ||||||| |||||||||||||||| |||| |||||||   |  | |
Sbjct: 777 cctttgtcggcttagccaagaggtcggtgaactcctggaacggggtcttggcatacttgg 718

                                                                       
Query: 262 tctccctccagaagtcaggggtgaggaatccataggtcttcatcaggcagtcgaaggttg 321
           ||||   |||||| ||||| |||||||| || |||||||||||||| || || |||||||
Sbjct: 717 tctcggcccagaactcaggagtgaggaagccgtaggtcttcatcagacaatcaaaggttg 658

                                                                       
Query: 322 ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 381
           ||||||||||||| || || ||||||||||| ||||| || || || |||||||| ||||
Sbjct: 657 ccttgacgaagttaccgagtgtcttggtggagccacgggacgaggtaaagacatcctcaa 598

                                                                       
Query: 382 taccagcgaactggagcaccttcttggggacccgggcggcgacgattccagaacccctcg 441
           | || ||||||||||| ||||||||||| || ||||| ||||| || || || ||||| |
Sbjct: 597 tgccggcgaactggaggaccttcttgggcacgcgggcagcgacaatcccggaccccctgg 538

                                                                       
Query: 442 gggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttgcagggcacgg 501
           | || |||||||| ||||||||||| || ||||||||||||||||||||||||||||| |
Sbjct: 537 gcgccggcaccatgcgcacggtgacggacccgcacttgccggtgaccttgcagggcacag 478

                                                                       
Query: 502 tgtggggcatgccgatcttgttcccccagtagcccctcctgacggggacgatggagagct 561
           |||| |||  |||||||||||| ||||||||||||||||||||||| ||||  |||||||
Sbjct: 477 tgtgcggctggccgatcttgtttccccagtagcccctcctgacgggcacgaccgagagct 418

                                                                       
Query: 562 tggcgaggatgatggcgccgcggatggccgtggccacctcctttgcgcacttgacgccga 621
           |||| |||||||||||||| |||||||| ||||| |||||||| ||||||||||||||||
Sbjct: 417 tggccaggatgatggcgccacggatggcggtggcgacctccttggcgcacttgacgccga 358

                          
Query: 622 gcccgacgtggccgt 636
           |||||||||||||||
Sbjct: 357 gcccgacgtggccgt 343

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  383 bits (193), Expect = e-103
 Identities = 286/317 (90%)
 Strand = Plus / Minus

                                                                            
Query: 322      ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 381
                ||||||||||||||||||||||||||||||||||||| || || ||||||||||| ||||
Sbjct: 33465835 ccttgacgaagttgccaagggtcttggtggatccacgggacgaggtgaagacatcctcaa 33465776

                                                                            
Query: 382      taccagcgaactggagcaccttcttggggacccgggcggcgacgattccagaacccctcg 441
                | || |||||||| |||||||||||||| || ||||||||||| || || ||||||||||
Sbjct: 33465775 tgccggcgaactgcagcaccttcttgggcacgcgggcggcgacaatacccgaacccctcg 33465716

                                                                            
Query: 442      gggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttgcagggcacgg 501
                ||||||||||||| ||||||||||||||||| ||||| |||||||||||||| |||||||
Sbjct: 33465715 gggcgggcaccatgcgcacggtgacagagccacactttccggtgaccttgcacggcacgg 33465656

                                                                            
Query: 502      tgtggggcatgccgatcttgttcccccagtagcccctcctgacggggacgatggagagct 561
                |||| |||   ||||||||||| |||||||| |||||||||||||| || | ||| ||||
Sbjct: 33465655 tgtgcggctgcccgatcttgttaccccagtaacccctcctgacgggcaccacggacagct 33465596

                                                                            
Query: 562      tggcgaggatgatggcgccgcggatggccgtggccacctcctttgcgcacttgacgccga 621
                |||| ||||||||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 33465595 tggccaggatgatggcgccgcggatggcggtggccacctccttggcgcacttgaccccca 33465536

                                 
Query: 622      gcccgacgtggccgttg 638
                |||||||||||||||||
Sbjct: 33465535 gcccgacgtggccgttg 33465519



 Score =  111 bits (56), Expect = 3e-21
 Identities = 188/231 (81%), Gaps = 2/231 (0%)
 Strand = Plus / Minus

                                                                            
Query: 96       taactataataaaacaaagtgcattagacagctcccagctagtaaaaaccct--ttacac 153
                |||||||  ||||||||||||||| |||||  ||| |||||| ||| || ||  |||| |
Sbjct: 33466856 taactattgtaaaacaaagtgcatcagacaagtccgagctagcaaagactctctttactc 33466797

                                                                            
Query: 154      cgacatcctaagcttctatcttctcggctggtacatcatggatcagggccttggtcggtt 213
                || |||||||||| ||||  |||||| | ||| |||||   || || ||||| ||||| |
Sbjct: 33466796 cgccatcctaagcctctacgttctcgacaggtgcatcaatcataagagccttagtcggct 33466737

                                                                            
Query: 214      tcgccaagatgtcggtgaactcctggtacggagtcttggtgaaggtcgtctccctccaga 273
                | ||||||| ||||||| |||||||| | |||| ||||  |||  | || ||||||||||
Sbjct: 33466736 tggccaagaggtcggtgtactcctggaatggagacttgacgaacttggtgtccctccaga 33466677

                                                                   
Query: 274      agtcaggggtgaggaatccataggtcttcatcaggcagtcgaaggttgcct 324
                ||||||| || ||||||||||| ||||||||||||||||| ||||| ||||
Sbjct: 33466676 agtcaggagtaaggaatccataagtcttcatcaggcagtcaaaggtggcct 33466626

---

>gb|AC135958.2| Oryza sativa chromosome 3 BAC OSJNBa0059E14 genomic sequence, complete
             sequence
          Length = 154555

 Score =  383 bits (193), Expect = e-103
 Identities = 286/317 (90%)
 Strand = Plus / Plus

                                                                         
Query: 322   ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 381
             ||||||||||||||||||||||||||||||||||||| || || ||||||||||| ||||
Sbjct: 32276 ccttgacgaagttgccaagggtcttggtggatccacgggacgaggtgaagacatcctcaa 32335

                                                                         
Query: 382   taccagcgaactggagcaccttcttggggacccgggcggcgacgattccagaacccctcg 441
             | || |||||||| |||||||||||||| || ||||||||||| || || ||||||||||
Sbjct: 32336 tgccggcgaactgcagcaccttcttgggcacgcgggcggcgacaatacccgaacccctcg 32395

                                                                         
Query: 442   gggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttgcagggcacgg 501
             ||||||||||||| ||||||||||||||||| ||||| |||||||||||||| |||||||
Sbjct: 32396 gggcgggcaccatgcgcacggtgacagagccacactttccggtgaccttgcacggcacgg 32455

                                                                         
Query: 502   tgtggggcatgccgatcttgttcccccagtagcccctcctgacggggacgatggagagct 561
             |||| |||   ||||||||||| |||||||| |||||||||||||| || | ||| ||||
Sbjct: 32456 tgtgcggctgcccgatcttgttaccccagtaacccctcctgacgggcaccacggacagct 32515

                                                                         
Query: 562   tggcgaggatgatggcgccgcggatggccgtggccacctcctttgcgcacttgacgccga 621
             |||| ||||||||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 32516 tggccaggatgatggcgccgcggatggcggtggccacctccttggcgcacttgaccccca 32575

                              
Query: 622   gcccgacgtggccgttg 638
             |||||||||||||||||
Sbjct: 32576 gcccgacgtggccgttg 32592



 Score =  111 bits (56), Expect = 3e-21
 Identities = 188/231 (81%), Gaps = 2/231 (0%)
 Strand = Plus / Plus

                                                                         
Query: 96    taactataataaaacaaagtgcattagacagctcccagctagtaaaaaccct--ttacac 153
             |||||||  ||||||||||||||| |||||  ||| |||||| ||| || ||  |||| |
Sbjct: 31255 taactattgtaaaacaaagtgcatcagacaagtccgagctagcaaagactctctttactc 31314

                                                                         
Query: 154   cgacatcctaagcttctatcttctcggctggtacatcatggatcagggccttggtcggtt 213
             || |||||||||| ||||  |||||| | ||| |||||   || || ||||| ||||| |
Sbjct: 31315 cgccatcctaagcctctacgttctcgacaggtgcatcaatcataagagccttagtcggct 31374

                                                                         
Query: 214   tcgccaagatgtcggtgaactcctggtacggagtcttggtgaaggtcgtctccctccaga 273
             | ||||||| ||||||| |||||||| | |||| ||||  |||  | || ||||||||||
Sbjct: 31375 tggccaagaggtcggtgtactcctggaatggagacttgacgaacttggtgtccctccaga 31434

                                                                
Query: 274   agtcaggggtgaggaatccataggtcttcatcaggcagtcgaaggttgcct 324
             ||||||| || ||||||||||| ||||||||||||||||| ||||| ||||
Sbjct: 31435 agtcaggagtaaggaatccataagtcttcatcaggcagtcaaaggtggcct 31485

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  383 bits (193), Expect = e-103
 Identities = 286/317 (90%)
 Strand = Plus / Minus

                                                                            
Query: 322      ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 381
                ||||||||||||||||||||||||||||||||||||| || || ||||||||||| ||||
Sbjct: 33556345 ccttgacgaagttgccaagggtcttggtggatccacgggacgaggtgaagacatcctcaa 33556286

                                                                            
Query: 382      taccagcgaactggagcaccttcttggggacccgggcggcgacgattccagaacccctcg 441
                | || |||||||| |||||||||||||| || ||||||||||| || || ||||||||||
Sbjct: 33556285 tgccggcgaactgcagcaccttcttgggcacgcgggcggcgacaatacccgaacccctcg 33556226

                                                                            
Query: 442      gggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttgcagggcacgg 501
                ||||||||||||| ||||||||||||||||| ||||| |||||||||||||| |||||||
Sbjct: 33556225 gggcgggcaccatgcgcacggtgacagagccacactttccggtgaccttgcacggcacgg 33556166

                                                                            
Query: 502      tgtggggcatgccgatcttgttcccccagtagcccctcctgacggggacgatggagagct 561
                |||| |||   ||||||||||| |||||||| |||||||||||||| || | ||| ||||
Sbjct: 33556165 tgtgcggctgcccgatcttgttaccccagtaacccctcctgacgggcaccacggacagct 33556106

                                                                            
Query: 562      tggcgaggatgatggcgccgcggatggccgtggccacctcctttgcgcacttgacgccga 621
                |||| ||||||||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 33556105 tggccaggatgatggcgccgcggatggcggtggccacctccttggcgcacttgaccccca 33556046

                                 
Query: 622      gcccgacgtggccgttg 638
                |||||||||||||||||
Sbjct: 33556045 gcccgacgtggccgttg 33556029



 Score =  111 bits (56), Expect = 3e-21
 Identities = 188/231 (81%), Gaps = 2/231 (0%)
 Strand = Plus / Minus

                                                                            
Query: 96       taactataataaaacaaagtgcattagacagctcccagctagtaaaaaccct--ttacac 153
                |||||||  ||||||||||||||| |||||  ||| |||||| ||| || ||  |||| |
Sbjct: 33557366 taactattgtaaaacaaagtgcatcagacaagtccgagctagcaaagactctctttactc 33557307

                                                                            
Query: 154      cgacatcctaagcttctatcttctcggctggtacatcatggatcagggccttggtcggtt 213
                || |||||||||| ||||  |||||| | ||| |||||   || || ||||| ||||| |
Sbjct: 33557306 cgccatcctaagcctctacgttctcgacaggtgcatcaatcataagagccttagtcggct 33557247

                                                                            
Query: 214      tcgccaagatgtcggtgaactcctggtacggagtcttggtgaaggtcgtctccctccaga 273
                | ||||||| ||||||| |||||||| | |||| ||||  |||  | || ||||||||||
Sbjct: 33557246 tggccaagaggtcggtgtactcctggaatggagacttgacgaacttggtgtccctccaga 33557187

                                                                   
Query: 274      agtcaggggtgaggaatccataggtcttcatcaggcagtcgaaggttgcct 324
                ||||||| || ||||||||||| ||||||||||||||||| ||||| ||||
Sbjct: 33557186 agtcaggagtaaggaatccataagtcttcatcaggcagtcaaaggtggcct 33557136

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
               sequence
          Length = 29644043

 Score =  339 bits (171), Expect = 7e-90
 Identities = 279/315 (88%)
 Strand = Plus / Minus

                                                                           
Query: 322     ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 381
               |||||||||||||||| |||||||||||||| || ||||| || |||||||| || || |
Sbjct: 5820039 ccttgacgaagttgccgagggtcttggtggagccgcgcgacgaggtgaagacgtcctcga 5819980

                                                                           
Query: 382     taccagcgaactggagcaccttcttggggacccgggcggcgacgattccagaacccctcg 441
               | || ||||||||||||||||||||||| ||  | || || ||||| || || ||||| |
Sbjct: 5819979 tgccggcgaactggagcaccttcttgggcacgtgcgccgccacgatcccggaccccctgg 5819920

                                                                           
Query: 442     gggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttgcagggcacgg 501
               | || |||||||| ||||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 5819919 gcgccggcaccatgcgcacggtgacggagccgcacttgccggtgaccttgcacggcacgg 5819860

                                                                           
Query: 502     tgtggggcatgccgatcttgttcccccagtagcccctcctgacggggacgatggagagct 561
               |||| ||| | |||||||||||||||||||| |||||||| ||||| |||| ||||||||
Sbjct: 5819859 tgtgcggcttcccgatcttgttcccccagtaccccctcctcacgggcacgacggagagct 5819800

                                                                           
Query: 562     tggcgaggatgatggcgccgcggatggccgtggccacctcctttgcgcacttgacgccga 621
               ||||||||||||||||||||||||| ||||| || |||||||| ||||||||||||||||
Sbjct: 5819799 tggcgaggatgatggcgccgcggatcgccgttgcgacctccttggcgcacttgacgccga 5819740

                              
Query: 622     gcccgacgtggccgt 636
               |||||||||||||||
Sbjct: 5819739 gcccgacgtggccgt 5819725



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 91/109 (83%)
 Strand = Plus / Minus

                                                                           
Query: 216     gccaagatgtcggtgaactcctggtacggagtcttggtgaaggtcgtctccctccagaag 275
               ||||||| ||| ||| |||||||| |||| |||||| | ||  | ||||| |||||||||
Sbjct: 5820953 gccaagaggtccgtgtactcctggaacggcgtcttgataaacctggtctctctccagaag 5820894

                                                                
Query: 276     tcaggggtgaggaatccataggtcttcatcaggcagtcgaaggttgcct 324
               ||||| || ||||| |||||||||||||| || || |||||||| ||||
Sbjct: 5820893 tcaggagtcaggaacccataggtcttcatgagacaatcgaaggtggcct 5820845



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 75/88 (85%)
 Strand = Plus / Minus

                                                                            
Query: 322      ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 381
                |||||||||||||||  |||||||||||||| ||||| || || |||||||| || || |
Sbjct: 13387865 ccttgacgaagttgctgagggtcttggtggagccacgtgacgaggtgaagacgtcctcga 13387806

                                            
Query: 382      taccagcgaactggagcaccttcttggg 409
                | || |||||||  ||||||||||||||
Sbjct: 13387805 tgccggcgaacttaagcaccttcttggg 13387778



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                             
Query: 465      acagagccgcacttgccggtgaccttgcagggcacggtgtggggc 509
                ||||||||| ||||| |||  |||||||| | |||||||||||||
Sbjct: 13387722 acagagccgtacttgtcggcaaccttgcacgacacggtgtggggc 13387678

---

>dbj|AP003943.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OJ1119_B04
          Length = 151721

 Score =  339 bits (171), Expect = 7e-90
 Identities = 279/315 (88%)
 Strand = Plus / Minus

                                                                          
Query: 322    ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 381
              |||||||||||||||| |||||||||||||| || ||||| || |||||||| || || |
Sbjct: 127067 ccttgacgaagttgccgagggtcttggtggagccgcgcgacgaggtgaagacgtcctcga 127008

                                                                          
Query: 382    taccagcgaactggagcaccttcttggggacccgggcggcgacgattccagaacccctcg 441
              | || ||||||||||||||||||||||| ||  | || || ||||| || || ||||| |
Sbjct: 127007 tgccggcgaactggagcaccttcttgggcacgtgcgccgccacgatcccggaccccctgg 126948

                                                                          
Query: 442    gggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttgcagggcacgg 501
              | || |||||||| ||||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 126947 gcgccggcaccatgcgcacggtgacggagccgcacttgccggtgaccttgcacggcacgg 126888

                                                                          
Query: 502    tgtggggcatgccgatcttgttcccccagtagcccctcctgacggggacgatggagagct 561
              |||| ||| | |||||||||||||||||||| |||||||| ||||| |||| ||||||||
Sbjct: 126887 tgtgcggcttcccgatcttgttcccccagtaccccctcctcacgggcacgacggagagct 126828

                                                                          
Query: 562    tggcgaggatgatggcgccgcggatggccgtggccacctcctttgcgcacttgacgccga 621
              ||||||||||||||||||||||||| ||||| || |||||||| ||||||||||||||||
Sbjct: 126827 tggcgaggatgatggcgccgcggatcgccgttgcgacctccttggcgcacttgacgccga 126768

                             
Query: 622    gcccgacgtggccgt 636
              |||||||||||||||
Sbjct: 126767 gcccgacgtggccgt 126753



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 91/109 (83%)
 Strand = Plus / Minus

                                                                          
Query: 216    gccaagatgtcggtgaactcctggtacggagtcttggtgaaggtcgtctccctccagaag 275
              ||||||| ||| ||| |||||||| |||| |||||| | ||  | ||||| |||||||||
Sbjct: 127981 gccaagaggtccgtgtactcctggaacggcgtcttgataaacctggtctctctccagaag 127922

                                                               
Query: 276    tcaggggtgaggaatccataggtcttcatcaggcagtcgaaggttgcct 324
              ||||| || ||||| |||||||||||||| || || |||||||| ||||
Sbjct: 127921 tcaggagtcaggaacccataggtcttcatgagacaatcgaaggtggcct 127873

---

>dbj|AP004911.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT13O11, TM0069,
             complete sequence
          Length = 103659

 Score =  178 bits (90), Expect = 1e-41
 Identities = 255/310 (82%)
 Strand = Plus / Plus

                                                                         
Query: 322   ccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatcaa 381
             |||||||||| || |||||||| |||||||| || |  ||||||||||| ||||||||||
Sbjct: 75702 ccttgacgaaatttccaagggttttggtggaacccctggaggaagtgaaaacatcatcaa 75761

                                                                         
Query: 382   taccagcgaactggagcaccttcttggggacccgggcggcgacgattccagaacccctcg 441
             | ||||||||||| |  ||||||||||| ||||  || || |||||||||||||| |  |
Sbjct: 75762 tcccagcgaactgcaagaccttcttgggaaccctagcagcaacgattccagaaccacgag 75821

                                                                         
Query: 442   gggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttgcagggcacgg 501
             | || || ||||| || || ||||| || || ||||| ||||| ||||||||||| ||||
Sbjct: 75822 gagcagggaccatgcggacagtgacggaaccacactttccggtaaccttgcagggaacgg 75881

                                                                         
Query: 502   tgtggggcatgccgatcttgttcccccagtagcccctcctgacggggacgatggagagct 561
             |||||||| | ||||||||||| |||||||| ||||||||||||||||  |  |||||||
Sbjct: 75882 tgtggggctttccgatcttgttaccccagtatcccctcctgacggggataacagagagct 75941

                                                                         
Query: 562   tggcgaggatgatggcgccgcggatggccgtggccacctcctttgcgcacttgacgccga 621
             | || ||||| ||  | ||||| ||||| || || || |||||   |||||| |||||||
Sbjct: 75942 tagcaaggataatcccaccgcgaatggcggtagcaacttccttgctgcacttcacgccga 76001

                       
Query: 622   gcccgacgtg 631
             ||||||||||
Sbjct: 76002 gcccgacgtg 76011

---

>gb|AY292483.1| Brosme brosme S2 ribosomal protein (S2) gene, partial cds
          Length = 910

 Score =  172 bits (87), Expect = 9e-40
 Identities = 141/159 (88%)
 Strand = Plus / Minus

                                                                       
Query: 480 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctc 539
           ||||| |||||||||||||||||||||||| ||||||||||||| |||||||| || |||
Sbjct: 252 ccggtcaccttgcagggcacggtgtggggcttgccgatcttgttaccccagtaacctctc 193

                                                                       
Query: 540 ctgacggggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacc 599
           |||||||| |||||||| |||||||| ||||||||||| || |||||||| |||||||||
Sbjct: 192 ctgacgggcacgatggacagcttggccaggatgatggcaccacggatggcggtggccacc 133

                                                  
Query: 600 tcctttgcgcacttgacgccgagcccgacgtggccgttg 638
           ||||| | |||||| ||||| || || || |||||||||
Sbjct: 132 tccttggagcacttcacgcccagacccacatggccgttg 94

---

>gb|AY292475.1| Pollachius virens S2 ribosomal protein (S2) gene, partial cds
          Length = 904

 Score =  165 bits (83), Expect = 2e-37
 Identities = 140/159 (88%)
 Strand = Plus / Minus

                                                                       
Query: 480 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctc 539
           ||||| |||||||||||||||||||||||| ||||||||||||| |||||||| || |||
Sbjct: 252 ccggtcaccttgcagggcacggtgtggggcttgccgatcttgttaccccagtaacctctc 193

                                                                       
Query: 540 ctgacggggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacc 599
           ||||| || |||||||| |||||||| ||||||||||| || |||||||| || ||||||
Sbjct: 192 ctgactggaacgatggacagcttggccaggatgatggcaccacggatggcggttgccacc 133

                                                  
Query: 600 tcctttgcgcacttgacgccgagcccgacgtggccgttg 638
           ||||| | ||||||||| || || || ||||||||||||
Sbjct: 132 tccttggagcacttgacacccagaccaacgtggccgttg 94

---

>gb|AY231813.1| Drosophila yakuba clone yak-em_sop mRNA sequence
          Length = 801

 Score =  165 bits (83), Expect = 2e-37
 Identities = 158/183 (86%)
 Strand = Plus / Minus

                                                                       
Query: 456 cgcacggtgacagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccg 515
           ||||||| ||| || ||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 530 cgcacggagacggatccgcacttgccggtgaccttgcagggcacggtgtggggcttgccg 471

                                                                       
Query: 516 atcttgttcccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatg 575
           |||||||| ||||||||||| |  |  ||||| || | |||||||||||| |||||||||
Sbjct: 470 atcttgtttccccagtagccacggcgcacgggcacaacggagagcttggccaggatgatg 411

                                                                       
Query: 576 gcgccgcggatggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggccg 635
           || || |||||||| |||||||| |||||   |||||| |||||||| || | |||||||
Sbjct: 410 gcaccacggatggcggtggccacttccttgctgcacttaacgccgagaccaatgtggccg 351

              
Query: 636 ttg 638
           |||
Sbjct: 350 ttg 348

---

>ref|NG_002360.1| Homo sapiens ribosomal protein S2 pseudogene (LOC125208) on
           chromosome 17
          Length = 1111

 Score =  163 bits (82), Expect = 9e-37
 Identities = 151/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 664 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 605

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 604 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 545

                                                                 
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggccgttg 638
           ||||| |||||||||||||| | |||||| || || || |||||||||||||||
Sbjct: 544 atggcggtggccacctccttggagcacttaacacccagaccgacgtggccgttg 491

---

>gb|AC004448.4| Homo sapiens chromosome 17, clone CTB-187M2, complete sequence
          Length = 149157

 Score =  163 bits (82), Expect = 9e-37
 Identities = 151/174 (86%)
 Strand = Plus / Minus

                                                                         
Query: 465   acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
             |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 70615 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 70556

                                                                         
Query: 525   ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
             ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 70555 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 70496

                                                                   
Query: 585   atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggccgttg 638
             ||||| |||||||||||||| | |||||| || || || |||||||||||||||
Sbjct: 70495 atggcggtggccacctccttggagcacttaacacccagaccgacgtggccgttg 70442

---

>emb|X17206.1|HSLLREP3 Human mRNA for LLRep3
          Length = 934

 Score =  163 bits (82), Expect = 9e-37
 Identities = 148/170 (87%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || ||||||||||| || ||||||||| ||||||||||||||
Sbjct: 596 acagagccgcagcggcctgtcaccttgcaggggacagtgtggggcttgccgatcttgttc 537

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 536 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 477

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 476 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 427

---

>emb|CR626574.1| full-length cDNA clone CS0DJ014YK12 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 899

 Score =  163 bits (82), Expect = 9e-37
 Identities = 151/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 584 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 525

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 524 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 465

                                                                 
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggccgttg 638
           ||||| |||||||||||||| | |||||| || || || |||||||||||||||
Sbjct: 464 atggcggtggccacctccttggagcacttaacacccagaccgacgtggccgttg 411

---

>emb|CR625501.1| full-length cDNA clone CS0DI080YC10 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 925

 Score =  163 bits (82), Expect = 9e-37
 Identities = 151/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 579 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 520

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 519 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 460

                                                                 
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggccgttg 638
           ||||| |||||||||||||| | |||||| || || || |||||||||||||||
Sbjct: 459 atggcggtggccacctccttggagcacttaacacccagaccgacgtggccgttg 406

---

>emb|CR617024.1| full-length cDNA clone CS0DI020YA19 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 933

 Score =  163 bits (82), Expect = 9e-37
 Identities = 151/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 586 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 527

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 526 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 467

                                                                 
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggccgttg 638
           ||||| |||||||||||||| | |||||| || || || |||||||||||||||
Sbjct: 466 atggcggtggccacctccttggagcacttaacacccagaccgacgtggccgttg 413

---

>emb|CR616773.1| full-length cDNA clone CS0DA001YA14 of Neuroblastoma of Homo
           sapiens (human)
          Length = 923

 Score =  163 bits (82), Expect = 9e-37
 Identities = 151/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 576 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 517

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 516 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 457

                                                                 
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggccgttg 638
           ||||| |||||||||||||| | |||||| || || || |||||||||||||||
Sbjct: 456 atggcggtggccacctccttggagcacttaacacccagaccgacgtggccgttg 403

---

>emb|CR616346.1| full-length cDNA clone CS0DA003YB13 of Neuroblastoma of Homo
           sapiens (human)
          Length = 982

 Score =  163 bits (82), Expect = 9e-37
 Identities = 151/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 635 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 576

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 575 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 516

                                                                 
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggccgttg 638
           ||||| |||||||||||||| | |||||| || || || |||||||||||||||
Sbjct: 515 atggcggtggccacctccttggagcacttaacacccagaccgacgtggccgttg 462

---

>emb|CR608345.1| full-length cDNA clone CS0DE007YL08 of Placenta of Homo sapiens
           (human)
          Length = 926

 Score =  163 bits (82), Expect = 9e-37
 Identities = 151/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 579 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 520

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 519 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 460

                                                                 
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggccgttg 638
           ||||| |||||||||||||| | |||||| || || || |||||||||||||||
Sbjct: 459 atggcggtggccacctccttggagcacttaacacccagaccgacgtggccgttg 406

---

>emb|CR603246.1| full-length cDNA clone CS0DE002YA17 of Placenta of Homo sapiens
           (human)
          Length = 921

 Score =  163 bits (82), Expect = 9e-37
 Identities = 151/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 579 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 520

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 519 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 460

                                                                 
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggccgttg 638
           ||||| |||||||||||||| | |||||| || || || |||||||||||||||
Sbjct: 459 atggcggtggccacctccttggagcacttaacacccagaccgacgtggccgttg 406

---

>emb|CR602473.1| full-length cDNA clone CS0DM013YC17 of Fetal liver of Homo sapiens
           (human)
          Length = 894

 Score =  163 bits (82), Expect = 9e-37
 Identities = 151/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 584 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 525

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 524 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 465

                                                                 
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggccgttg 638
           ||||| |||||||||||||| | |||||| || || || |||||||||||||||
Sbjct: 464 atggcggtggccacctccttggagcacttaacacccagaccgacgtggccgttg 411

---

>emb|CR600325.1| full-length cDNA clone CS0DJ011YG17 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 943

 Score =  163 bits (82), Expect = 9e-37
 Identities = 151/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 611 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 552

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 551 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 492

                                                                 
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggccgttg 638
           ||||| |||||||||||||| | |||||| || || || |||||||||||||||
Sbjct: 491 atggcggtggccacctccttggagcacttaacacccagaccgacgtggccgttg 438

---

>emb|CR600119.1| full-length cDNA clone CS0DH004YP15 of T cells (Jurkat cell line)
           of Homo sapiens (human)
          Length = 913

 Score =  163 bits (82), Expect = 9e-37
 Identities = 151/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 570 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 511

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 510 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 451

                                                                 
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggccgttg 638
           ||||| |||||||||||||| | |||||| || || || |||||||||||||||
Sbjct: 450 atggcggtggccacctccttggagcacttaacacccagaccgacgtggccgttg 397

---

>emb|CR598755.1| full-length cDNA clone CS0DH007YG11 of T cells (Jurkat cell line)
           of Homo sapiens (human)
          Length = 906

 Score =  163 bits (82), Expect = 9e-37
 Identities = 151/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 562 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 503

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 502 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 443

                                                                 
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggccgttg 638
           ||||| |||||||||||||| | |||||| || || || |||||||||||||||
Sbjct: 442 atggcggtggccacctccttggagcacttaacacccagaccgacgtggccgttg 389

---

>emb|CR595621.1| full-length cDNA clone CS0DJ003YI21 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 922

 Score =  163 bits (82), Expect = 9e-37
 Identities = 151/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 579 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 520

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 519 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 460

                                                                 
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggccgttg 638
           ||||| |||||||||||||| | |||||| || || || |||||||||||||||
Sbjct: 459 atggcggtggccacctccttggagcacttaacacccagaccgacgtggccgttg 406

---

>emb|CR593677.1| full-length cDNA clone CS0DI020YA20 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 902

 Score =  163 bits (82), Expect = 9e-37
 Identities = 151/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 586 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 527

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 526 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 467

                                                                 
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggccgttg 638
           ||||| |||||||||||||| | |||||| || || || |||||||||||||||
Sbjct: 466 atggcggtggccacctccttggagcacttaacacccagaccgacgtggccgttg 413

---

>emb|CR593327.1| full-length cDNA clone CS0DJ011YJ17 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 893

 Score =  163 bits (82), Expect = 9e-37
 Identities = 151/174 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 573 acagagccgcagcagcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 514

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 513 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 454

                                                                 
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggccgttg 638
           ||||| |||||||||||||| | |||||| || || || |||||||||||||||
Sbjct: 453 atggcggtggccacctccttggagcacttaacacccagaccgacgtggccgttg 400

---

>gb|AY292476.1| Pollachius pollachius S2 ribosomal protein (S2) gene, partial cds
          Length = 920

 Score =  161 bits (81), Expect = 3e-36
 Identities = 135/153 (88%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||||||||||||||||||| ||||||||||||| |||||||| || |||||||| 
Sbjct: 246 accttgcagggcacggtgtggggcttgccgatcttgttaccccagtaacctctcctgact 187

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           || |||||||| |||||||| ||||||||||| || |||||||| || ||||||||||| 
Sbjct: 186 ggaacgatggacagcttggccaggatgatggcaccacggatggcggttgccacctccttg 127

                                            
Query: 606 gcgcacttgacgccgagcccgacgtggccgttg 638
           | ||||||||| || || || ||||||||||||
Sbjct: 126 gagcacttgacacccagaccaacgtggccgttg 94

---

>gb|AY292484.1| Molva molva S2 ribosomal protein (S2) gene, partial cds
          Length = 913

 Score =  157 bits (79), Expect = 5e-35
 Identities = 139/159 (87%)
 Strand = Plus / Minus

                                                                       
Query: 480 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctc 539
           ||||| |||||||||||||||||||||||| | ||||||||||| |||||||| || |||
Sbjct: 252 ccggtcaccttgcagggcacggtgtggggcttaccgatcttgttaccccagtaacctctc 193

                                                                       
Query: 540 ctgacggggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacc 599
           |||||||| |||||||| |||||||| ||||||||||| || |||||||| |||||||||
Sbjct: 192 ctgacgggcacgatggacagcttggccaggatgatggcaccacggatggcggtggccacc 133

                                                  
Query: 600 tcctttgcgcacttgacgccgagcccgacgtggccgttg 638
           || || | |||||| ||||| || || || |||||||||
Sbjct: 132 tctttggagcacttcacgcccagacccacatggccgttg 94

---

>gb|AY292474.1| Merlangius merlangus S2 ribosomal protein (S2) gene, partial cds
          Length = 903

 Score =  157 bits (79), Expect = 5e-35
 Identities = 139/159 (87%)
 Strand = Plus / Minus

                                                                       
Query: 480 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctc 539
           ||||| |||||||||||||||||||||||| ||||||||||||| |||||||| || |||
Sbjct: 252 ccggtcaccttgcagggcacggtgtggggcttgccgatcttgttaccccagtaacctctc 193

                                                                       
Query: 540 ctgacggggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacc 599
           ||||| || || ||||| |||||||| ||||||||||| || |||||||| || ||||||
Sbjct: 192 ctgactggaacaatggacagcttggccaggatgatggcaccacggatggcggttgccacc 133

                                                  
Query: 600 tcctttgcgcacttgacgccgagcccgacgtggccgttg 638
           ||||| | ||||||||| || || || ||||||||||||
Sbjct: 132 tccttggagcacttgacacccagaccaacgtggccgttg 94

---

>gb|AY292473.1| Melanogrammus aeglefinus S2 ribosomal protein (S2) gene, partial
           cds
          Length = 902

 Score =  157 bits (79), Expect = 5e-35
 Identities = 139/159 (87%)
 Strand = Plus / Minus

                                                                       
Query: 480 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctc 539
           ||||| |||||||||||||||||||||||| ||||||||||||| |||||||| || |||
Sbjct: 252 ccggtcaccttgcagggcacggtgtggggcttgccgatcttgttaccccagtaacctctc 193

                                                                       
Query: 540 ctgacggggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacc 599
           ||||| || || ||||| |||||||| ||||||||||| || |||||||| || ||||||
Sbjct: 192 ctgactggaacaatggacagcttggccaggatgatggcaccacggatggcagttgccacc 133

                                                  
Query: 600 tcctttgcgcacttgacgccgagcccgacgtggccgttg 638
           ||||| | ||||||||| || || || ||||||||||||
Sbjct: 132 tccttggagcacttgacacccagaccaacgtggccgttg 94

---

>gb|AY292472.1| Boreogadus saida S2 ribosomal protein (S2) gene, partial cds
          Length = 897

 Score =  157 bits (79), Expect = 5e-35
 Identities = 139/159 (87%)
 Strand = Plus / Minus

                                                                       
Query: 480 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctc 539
           ||||| |||||||||||||||||||||||| ||||||||||||| |||||||| || |||
Sbjct: 252 ccggtcaccttgcagggcacggtgtggggcttgccgatcttgttaccccagtaacctctc 193

                                                                       
Query: 540 ctgacggggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacc 599
           ||||| || || ||||| |||||||| ||||||||||| || |||||||| || ||||||
Sbjct: 192 ctgactggaacaatggacagcttggccaggatgatggcaccacggatggcggttgccacc 133

                                                  
Query: 600 tcctttgcgcacttgacgccgagcccgacgtggccgttg 638
           ||||| | ||||||||| || || || ||||||||||||
Sbjct: 132 tccttggagcacttgacacccagaccaacgtggccgttg 94

---

>gb|AY292470.1| Gadus ogac S2 ribosomal protein (S2) gene, partial cds
          Length = 899

 Score =  157 bits (79), Expect = 5e-35
 Identities = 139/159 (87%)
 Strand = Plus / Minus

                                                                       
Query: 480 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctc 539
           |||||||||||||||||||||||||||||| ||||||||||||| |||||||| || |||
Sbjct: 252 ccggtgaccttgcagggcacggtgtggggcttgccgatcttgttaccccagtaacctctc 193

                                                                       
Query: 540 ctgacggggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacc 599
           ||||| || || ||||| |||||||| |||||||| || || |||||||| || ||||||
Sbjct: 192 ctgactggaacaatggacagcttggccaggatgattgcaccacggatggcggttgccacc 133

                                                  
Query: 600 tcctttgcgcacttgacgccgagcccgacgtggccgttg 638
           ||||| | ||||||||| || || || ||||||||||||
Sbjct: 132 tccttggagcacttgacacccagaccaacgtggccgttg 94

---

>gb|AY292469.1| Gadus macrocephalus S2 ribosomal protein (S2) gene, partial cds
          Length = 902

 Score =  157 bits (79), Expect = 5e-35
 Identities = 139/159 (87%)
 Strand = Plus / Minus

                                                                       
Query: 480 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctc 539
           |||||||||||||||||||||||||||||| ||||||||||||| |||||||| || |||
Sbjct: 252 ccggtgaccttgcagggcacggtgtggggcttgccgatcttgttaccccagtaacctctc 193

                                                                       
Query: 540 ctgacggggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacc 599
           ||||| || || ||||| |||||||| |||||||| || || |||||||| || ||||||
Sbjct: 192 ctgactggaacaatggacagcttggccaggatgattgcaccacggatggcggttgccacc 133

                                                  
Query: 600 tcctttgcgcacttgacgccgagcccgacgtggccgttg 638
           ||||| | ||||||||| || || || ||||||||||||
Sbjct: 132 tccttggagcacttgacacccagaccaacgtggccgttg 94

---

>gb|AY292468.1| Gadus morhua S2 ribosomal protein (S2) gene, partial cds
          Length = 902

 Score =  157 bits (79), Expect = 5e-35
 Identities = 139/159 (87%)
 Strand = Plus / Minus

                                                                       
Query: 480 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctc 539
           ||||| |||||||||||||||||||||||| ||||||||||||| |||||||| || |||
Sbjct: 252 ccggtcaccttgcagggcacggtgtggggcttgccgatcttgttaccccagtaacctctc 193

                                                                       
Query: 540 ctgacggggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacc 599
           ||||| || || ||||| |||||||| ||||||||||| || |||||||| || ||||||
Sbjct: 192 ctgactggaacaatggacagcttggccaggatgatggcaccacggatggcggttgccacc 133

                                                  
Query: 600 tcctttgcgcacttgacgccgagcccgacgtggccgttg 638
           ||||| | ||||||||| || || || ||||||||||||
Sbjct: 132 tccttggagcacttgacacccagaccaacgtggccgttg 94

---

>gb|AY292467.1| Arctogadus glacialis S2 ribosomal protein (S2) gene, partial cds
          Length = 893

 Score =  157 bits (79), Expect = 5e-35
 Identities = 139/159 (87%)
 Strand = Plus / Minus

                                                                       
Query: 480 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctc 539
           ||||| |||||||||||||||||||||||| ||||||||||||| |||||||| || |||
Sbjct: 252 ccggtcaccttgcagggcacggtgtggggcttgccgatcttgttaccccagtaacctctc 193

                                                                       
Query: 540 ctgacggggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacc 599
           ||||| || || ||||| |||||||| ||||||||||| || |||||||| || ||||||
Sbjct: 192 ctgactggaacaatggacagcttggccaggatgatggcaccacggatggcggttgccacc 133

                                                  
Query: 600 tcctttgcgcacttgacgccgagcccgacgtggccgttg 638
           ||||| | ||||||||| || || || ||||||||||||
Sbjct: 132 tccttggagcacttgacacccagaccaacgtggccgttg 94

---

>gb|BC105985.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:102851
           IMAGE:5114688), complete cds
          Length = 956

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 584 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 525

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 524 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 465

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 464 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 415

---

>gb|BC106060.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:117345
           IMAGE:6471612), complete cds
          Length = 998

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 583 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 524

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 523 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 464

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 463 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 414

---

>gb|BC103756.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:117344
           IMAGE:6008803), complete cds
          Length = 990

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 608 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 549

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 548 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 489

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 488 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 439

---

>ref|XM_514839.1| PREDICTED: Pan troglodytes similar to ribosomal protein S2
           (LOC458481), mRNA
          Length = 956

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 589 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 530

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 529 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 470

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 469 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 420

---

>ref|XM_511195.1| PREDICTED: Pan troglodytes LOC454344 (LOC454344), mRNA
          Length = 945

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 581 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 522

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 521 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 462

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 461 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 412

---

>gb|BC016178.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:17896
           IMAGE:3909865), complete cds
          Length = 950

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 575 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 516

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 515 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 456

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 455 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 406

---

>gb|BC075830.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:88606
           IMAGE:5441508), complete cds
          Length = 948

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 583 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 524

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 523 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 464

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 463 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 414

---

>gb|BC073966.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:87875
           IMAGE:6047887), complete cds
          Length = 962

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 582 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 523

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 522 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 463

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 462 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 413

---

>gb|BC012354.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:20390
           IMAGE:4564801), complete cds
          Length = 945

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 578 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 519

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 518 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 459

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 458 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 409

---

>gb|BC010165.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:19832
           IMAGE:4040679), complete cds
          Length = 976

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 578 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 519

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 518 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 459

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 458 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 409

---

>gb|BC025677.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:35569
           IMAGE:5203563), complete cds
          Length = 966

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 576 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 517

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 516 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 457

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 456 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 407

---

>gb|BC001795.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:3141
           IMAGE:3353508), complete cds
          Length = 978

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 583 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 524

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 523 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 464

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 463 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 414

---

>gb|BC016951.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:21506
           IMAGE:3883854), complete cds
          Length = 945

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 583 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 524

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 523 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 464

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 463 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 414

---

>gb|BC021545.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:15956
           IMAGE:3538227), complete cds
          Length = 952

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 583 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 524

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 523 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 464

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 463 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 414

---

>gb|BC023541.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:15421
           IMAGE:4120795), complete cds
          Length = 980

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 578 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 519

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 518 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 459

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 458 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 409

---

>gb|BC019021.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clone IMAGE:4547162)
          Length = 933

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 568 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 509

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 508 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 449

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 448 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 399

---

>gb|BC005824.1| Homo sapiens cDNA clone IMAGE:2823381, **** WARNING: chimeric clone
           ****
          Length = 3287

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 593 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 534

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 533 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 474

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 473 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 424

---

>gb|BC005129.1| Homo sapiens PDZ domain containing 7, mRNA (cDNA clone
            IMAGE:3842021), **** WARNING: chimeric clone ****
          Length = 2929

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                        
Query: 465  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
            |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 2564 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 2505

                                                                        
Query: 525  ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
            ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 2504 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 2445

                                                              
Query: 585  atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
            ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 2444 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 2395

---

>gb|BC020336.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone IMAGE:3857902)
          Length = 956

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Plus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 370 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 429

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 430 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 489

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 490 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 539

---

>gb|BC021002.1| Homo sapiens cDNA clone IMAGE:3841858, **** WARNING: chimeric clone
            ****
          Length = 3491

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                        
Query: 465  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
            |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 3126 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 3067

                                                                        
Query: 525  ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
            ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 3066 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 3007

                                                              
Query: 585  atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
            ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 3006 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 2957

---

>gb|BC063508.1| Homo sapiens cDNA clone IMAGE:3861495, **** WARNING: chimeric clone
            ****
          Length = 1451

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                        
Query: 465  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
            |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 1089 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 1030

                                                                        
Query: 525  ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
            ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 1029 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 970

                                                              
Query: 585  atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
            ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 969  atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 920

---

>gb|BC044628.1| Homo sapiens mRNA similar to collagen, type XVII, alpha 1 (cDNA clone
            IMAGE:5431129)
          Length = 4175

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                        
Query: 465  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
            |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 3810 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 3751

                                                                        
Query: 525  ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
            ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 3750 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 3691

                                                              
Query: 585  atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
            ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 3690 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 3641

---

>gb|BC011850.1| Homo sapiens mRNA similar to delta (Drosophila)-like 3 (cDNA clone
            IMAGE:4136318)
          Length = 2960

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                        
Query: 465  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
            |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 2594 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 2535

                                                                        
Query: 525  ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
            ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 2534 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 2475

                                                              
Query: 585  atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
            ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 2474 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 2425

---

>gb|BC011661.1| Homo sapiens cDNA clone IMAGE:4130973, **** WARNING: chimeric clone
            ****
          Length = 1766

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                        
Query: 465  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
            |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 1401 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 1342

                                                                        
Query: 525  ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
            ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 1341 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 1282

                                                              
Query: 585  atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
            ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 1281 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 1232

---

>gb|BC012773.1| Homo sapiens cDNA clone IMAGE:3837950, **** WARNING: chimeric clone
            ****
          Length = 2181

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                        
Query: 465  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
            |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 1815 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 1756

                                                                        
Query: 525  ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
            ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 1755 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 1696

                                                              
Query: 585  atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
            ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 1695 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 1646

---

>gb|BC004120.1| Homo sapiens mRNA similar to ribosomal protein S2 (cDNA clone
            IMAGE:3925714)
          Length = 1693

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                        
Query: 465  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
            |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 1312 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 1253

                                                                        
Query: 525  ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
            ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 1252 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 1193

                                                              
Query: 585  atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
            ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 1192 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 1143

---

>gb|BC013970.1| Homo sapiens mRNA similar to makorin, ring finger protein, 3 (cDNA
            clone IMAGE:3958123)
          Length = 3291

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                        
Query: 465  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
            |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 2920 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 2861

                                                                        
Query: 525  ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
            ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 2860 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 2801

                                                              
Query: 585  atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
            ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 2800 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 2751

---

>gb|BC066321.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:87212
           IMAGE:5296344), complete cds
          Length = 957

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 595 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 536

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 535 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 476

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 475 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 426

---

>emb|AL832857.1|HSM804168 Homo sapiens genomic DNA; cDNA DKFZp667P2125 (from clone
           DKFZp667P2125)
          Length = 963

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 581 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 522

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 521 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 462

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 461 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 412

---

>gb|BC008862.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:16692
           IMAGE:4126765), complete cds
          Length = 949

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 583 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 524

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 523 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 464

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 463 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 414

---

>gb|BC006559.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:2778
           IMAGE:2959602), complete cds
          Length = 951

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 583 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 524

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 523 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 464

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 463 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 414

---

>gb|BC035504.1| Homo sapiens, clone IMAGE:4636047, mRNA
          Length = 3228

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Plus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 297 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 356

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 357 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 416

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 417 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 466

---

>emb|CR624847.1| full-length cDNA clone CS0DH002YK09 of T cells (Jurkat cell line) of
            Homo sapiens (human)
          Length = 1548

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                        
Query: 465  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
            |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 1201 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 1142

                                                                        
Query: 525  ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
            ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 1141 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 1082

                                                              
Query: 585  atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
            ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 1081 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 1032

---

>emb|CR622407.1| full-length cDNA clone CS0DI084YM13 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 907

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 561 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 502

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 501 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 442

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 441 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 392

---

>emb|CR620130.1| full-length cDNA clone CS0DA002YB15 of Neuroblastoma of Homo
           sapiens (human)
          Length = 929

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 582 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 523

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 522 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 463

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 462 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 413

---

>emb|CR617837.1| full-length cDNA clone CS0DC019YM02 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 919

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 572 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 513

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 512 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 453

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 452 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 403

---

>emb|CR613584.1| full-length cDNA clone CS0DH005YA07 of T cells (Jurkat cell line)
           of Homo sapiens (human)
          Length = 921

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 574 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 515

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 514 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 455

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 454 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 405

---

>emb|CR613101.1| full-length cDNA clone CS0DI021YI17 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 915

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 568 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 509

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 508 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 449

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 448 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 399

---

>emb|CR612811.1| full-length cDNA clone CS0DF034YC19 of Fetal brain of Homo sapiens
           (human)
          Length = 924

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 578 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 519

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 518 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 459

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 458 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 409

---

>emb|CR610190.1| full-length cDNA clone CS0CAP004YA17 of Thymus of Homo sapiens
           (human)
          Length = 923

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 576 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 517

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 516 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 457

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 456 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 407

---

>emb|CR609604.1| full-length cDNA clone CS0CAP007YC22 of Thymus of Homo sapiens
           (human)
          Length = 891

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 575 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 516

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 515 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 456

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 455 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 406

---

>emb|CR608509.1| full-length cDNA clone CS0DG001YB20 of B cells (Ramos cell line) of
           Homo sapiens (human)
          Length = 531

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 184 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 125

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 124 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 65

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 64  atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 15

---

>emb|CR608202.1| full-length cDNA clone CS0DK001YN08 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 651

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 304 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 245

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 244 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 185

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 184 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 135

---

>emb|CR607747.1| full-length cDNA clone CS0CAP007YB09 of Thymus of Homo sapiens
           (human)
          Length = 894

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 578 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 519

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 518 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 459

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 458 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 409

---

>emb|CR607612.1| full-length cDNA clone CS0DE002YJ03 of Placenta of Homo sapiens
           (human)
          Length = 895

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 575 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 516

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 515 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 456

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 455 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 406

---

>emb|CR607006.1| full-length cDNA clone CS0DL005YN02 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 919

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 572 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 513

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 512 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 453

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 452 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 403

---

>emb|CR606602.1| full-length cDNA clone CS0DE002YD08 of Placenta of Homo sapiens
           (human)
          Length = 925

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 578 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 519

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 518 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 459

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 458 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 409

---

>emb|CR605226.1| full-length cDNA clone CS0DA001YI08 of Neuroblastoma of Homo
           sapiens (human)
          Length = 925

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 578 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 519

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 518 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 459

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 458 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 409

---

>emb|CR596231.1| full-length cDNA clone CS0CAP001YL18 of Thymus of Homo sapiens
           (human)
          Length = 884

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 542 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 483

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 482 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 423

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 422 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 373

---

>emb|CR594414.1| full-length cDNA clone CS0DF019YI05 of Fetal brain of Homo sapiens
           (human)
          Length = 895

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 569 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 510

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 509 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 450

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 449 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 400

---

>emb|CR593005.1| full-length cDNA clone CS0DC023YC03 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 925

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 578 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 519

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 518 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 459

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 458 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 409

---

>emb|CR591765.1| full-length cDNA clone CS0DF026YI06 of Fetal brain of Homo sapiens
           (human)
          Length = 901

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 575 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 516

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 515 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 456

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 455 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 406

---

>emb|CR590936.1| full-length cDNA clone CS0DJ001YF12 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 920

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 570 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 511

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 510 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 451

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 450 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 401

---

>gb|BC068051.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:78476
           IMAGE:4853351), complete cds
          Length = 951

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 584 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 525

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 524 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 465

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 464 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 415

---

>gb|BC017252.1| Homo sapiens, clone IMAGE:2905229, mRNA
          Length = 2739

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                        
Query: 465  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
            |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 2374 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 2315

                                                                        
Query: 525  ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
            ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 2314 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 2255

                                                              
Query: 585  atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
            ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 2254 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 2205

---

>gb|BC007700.1| Homo sapiens, clone IMAGE:3954272, mRNA
          Length = 1568

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 579 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 520

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 519 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 460

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 459 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 410

---

>gb|AY892474.1| Synthetic construct Homo sapiens clone FLH028028.01L ribosomal
           protein S2 (RPS2) mRNA, partial cds
          Length = 882

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 572 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 513

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 512 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 453

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 452 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 403

---

>gb|AY889989.1| Synthetic construct Homo sapiens clone FLH028029.01X ribosomal
           protein S2 (RPS2) mRNA, complete cds
          Length = 882

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 572 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 513

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 512 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 453

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 452 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 403

---

>gb|BC071923.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:88608
           IMAGE:5477295), complete cds
          Length = 950

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 582 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 523

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 522 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 463

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 462 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 413

---

>gb|BC071924.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:88609
           IMAGE:6729920), complete cds
          Length = 947

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 578 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 519

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 518 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 459

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 458 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 409

---

>gb|BC071922.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:88607
           IMAGE:5455280), complete cds
          Length = 982

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 577 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 518

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 517 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 458

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 457 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 408

---

>gb|BC071673.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:87874
           IMAGE:4540360), complete cds
          Length = 992

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 583 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 524

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 523 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 464

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 463 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 414

---

>gb|BC018993.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:20302
           IMAGE:4127411), complete cds
          Length = 944

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 578 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 519

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 518 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 459

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 458 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 409

---

>gb|BC032129.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clone MGC:29707
           IMAGE:5019977), complete cds
          Length = 961

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 583 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 524

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 523 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 464

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 463 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 414

---

>ref|NM_002952.3| Homo sapiens ribosomal protein S2 (RPS2), mRNA
          Length = 962

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 595 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 536

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 535 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 476

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 475 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 426

---

>dbj|AB082925.1| Homo sapiens rps2 mRNA for ribosomal protein S2, complete cds
          Length = 821

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 448 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 389

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 388 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 329

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 328 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 279

---

>gb|BC008329.2| Homo sapiens ribosomal protein S2, mRNA (cDNA clone IMAGE:3504130)
          Length = 943

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 576 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 517

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 516 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 457

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 456 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 407

---

>gb|BC029979.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone IMAGE:4389294)
          Length = 968

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 583 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 524

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 523 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 464

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 463 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 414

---

>gb|BC013833.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone IMAGE:4149435)
          Length = 947

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 577 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 518

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 517 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 458

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 457 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 408

---

>gb|BC035427.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone IMAGE:3446871)
          Length = 947

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 578 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 519

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 518 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 459

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 458 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 409

---

>dbj|AB065088.1| Homo sapiens OK/KNS-cl.6 mRNA for ribosomal protein S2, complete
           cds
          Length = 677

 Score =  155 bits (78), Expect = 2e-34
 Identities = 147/170 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 239 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 180

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  ||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 179 ccccagtagcctctgcgcacggggacgatggagagcttggccaggatgatggccccacgg 120

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 119 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 70

---

>gb|AC005606.3| Homo sapiens chromosome 16, P1 clone 109-8C (LANL), complete sequence
          Length = 80662

 Score =  153 bits (77), Expect = 8e-34
 Identities = 131/149 (87%)
 Strand = Plus / Plus

                                                                         
Query: 486   accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
             |||||||| || || ||||||||| ||||||||||||||||||||||||| || |  |||
Sbjct: 21825 accttgcaagggacagtgtggggcttgccgatcttgttcccccagtagcctctgcgcacg 21884

                                                                         
Query: 546   gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
             |||||||||||||||||||| ||||||||||| || |||||||| |||||||||||||| 
Sbjct: 21885 gggacgatggagagcttggccaggatgatggccccacggatggcggtggccacctccttg 21944

                                          
Query: 606   gcgcacttgacgccgagcccgacgtggcc 634
             | |||||| || || || |||||||||||
Sbjct: 21945 gagcacttaacacccagaccgacgtggcc 21973

---

>gb|AC005363.1| Homo sapiens chromosome 16, P1 clone 47-2H (LANL), complete sequence
          Length = 75108

 Score =  153 bits (77), Expect = 8e-34
 Identities = 131/149 (87%)
 Strand = Plus / Plus

                                                                         
Query: 486   accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
             |||||||| || || ||||||||| ||||||||||||||||||||||||| || |  |||
Sbjct: 64418 accttgcaagggacagtgtggggcttgccgatcttgttcccccagtagcctctgcgcacg 64477

                                                                         
Query: 546   gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
             |||||||||||||||||||| ||||||||||| || |||||||| |||||||||||||| 
Sbjct: 64478 gggacgatggagagcttggccaggatgatggccccacggatggcggtggccacctccttg 64537

                                          
Query: 606   gcgcacttgacgccgagcccgacgtggcc 634
             | |||||| || || || |||||||||||
Sbjct: 64538 gagcacttaacacccagaccgacgtggcc 64566

---

>gb|BC063011.1| Homo sapiens ribosomal protein S2, mRNA (cDNA clone IMAGE:5217154),
           partial cds
          Length = 1308

 Score =  153 bits (77), Expect = 8e-34
 Identities = 131/149 (87%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || || ||||||||| ||||||||||||||||||||||||| || |  |||
Sbjct: 796 accttgcaagggacagtgtggggcttgccgatcttgttcccccagtagcctctgcgcacg 737

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           |||||||||||||||||||| ||||||||||| || |||||||| |||||||||||||| 
Sbjct: 736 gggacgatggagagcttggccaggatgatggccccacggatggcggtggccacctccttg 677

                                        
Query: 606 gcgcacttgacgccgagcccgacgtggcc 634
           | |||||| || || || |||||||||||
Sbjct: 676 gagcacttaacacccagaccgacgtggcc 648

---

>dbj|AB065089.1| Homo sapiens OK/KNS-cl.7 mRNA for ribosomal protein S2, complete
           cds
          Length = 1212

 Score =  153 bits (77), Expect = 8e-34
 Identities = 131/149 (87%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || || ||||||||| ||||||||||||||||||||||||| || |  |||
Sbjct: 739 accttgcaagggacagtgtggggcttgccgatcttgttcccccagtagcctctgcgcacg 680

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           |||||||||||||||||||| ||||||||||| || |||||||| |||||||||||||| 
Sbjct: 679 gggacgatggagagcttggccaggatgatggccccacggatggcggtggccacctccttg 620

                                        
Query: 606 gcgcacttgacgccgagcccgacgtggcc 634
           | |||||| || || || |||||||||||
Sbjct: 619 gagcacttaacacccagaccgacgtggcc 591

---

>gb|DQ214052.1| Taeniopygia guttata clone 0058P0045G10 ribosomal protein S2-like
           mRNA, complete sequence
          Length = 890

 Score =  149 bits (75), Expect = 1e-32
 Identities = 138/159 (86%)
 Strand = Plus / Minus

                                                                       
Query: 480 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctc 539
           |||||||||||||||||||| ||||| ||| | ||||||||||| ||||||||||| |  
Sbjct: 512 ccggtgaccttgcagggcaccgtgtgtggcttcccgatcttgttgccccagtagccgcgt 453

                                                                       
Query: 540 ctgacggggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacc 599
           |  ||||| |||||||| |||||||| ||||||||||| |||||||||||||||||||||
Sbjct: 452 cgcacgggcacgatggacagcttggccaggatgatggccccgcggatggccgtggccacc 393

                                                  
Query: 600 tcctttgcgcacttgacgccgagcccgacgtggccgttg 638
           ||||| | |||||| || || ||||| || |||||||||
Sbjct: 392 tccttggagcacttcacccccagccccacatggccgttg 354



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 228 gtgaactcctggtacggagtcttggtgaag 257
           |||||||||||||| |||| ||||||||||
Sbjct: 764 gtgaactcctggtaaggagacttggtgaag 735

---

>gb|AY292479.1| Eleginus gracilis S2 ribosomal protein (S2) gene, partial cds
          Length = 901

 Score =  149 bits (75), Expect = 1e-32
 Identities = 138/159 (86%)
 Strand = Plus / Minus

                                                                       
Query: 480 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctc 539
           ||||| |||||||||||||||||||||||| ||||||||||||| |||||||| || |||
Sbjct: 252 ccggtcaccttgcagggcacggtgtggggcttgccgatcttgttaccccagtaacctctc 193

                                                                       
Query: 540 ctgacggggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacc 599
           ||||| || |||||||| |||||||| |||||||| || || |||||||| || ||||||
Sbjct: 192 ctgactggaacgatggacagcttggccaggatgatagcaccacggatggcggttgccacc 133

                                                  
Query: 600 tcctttgcgcacttgacgccgagcccgacgtggccgttg 638
           ||||| | |||||| || || || || ||||||||||||
Sbjct: 132 tccttggagcacttaacacccagaccaacgtggccgttg 94

---

>gb|AY292477.1| Microgadus tomcod S2 ribosomal protein (S2) gene, partial cds
          Length = 900

 Score =  149 bits (75), Expect = 1e-32
 Identities = 138/159 (86%)
 Strand = Plus / Minus

                                                                       
Query: 480 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctc 539
           ||||| |||||||||||||||||||||||| ||||||||||||| |||||||| || |||
Sbjct: 252 ccggtcaccttgcagggcacggtgtggggcttgccgatcttgttaccccagtaacctctc 193

                                                                       
Query: 540 ctgacggggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacc 599
           ||||| || |||||||| |||||||| |||||||| || || |||||||| || ||||||
Sbjct: 192 ctgactggaacgatggacagcttggccaggatgatagcaccacggatggctgttgccacc 133

                                                  
Query: 600 tcctttgcgcacttgacgccgagcccgacgtggccgttg 638
           ||||| | |||||| || || || || ||||||||||||
Sbjct: 132 tccttggagcacttaacacccagaccaacgtggccgttg 94

---

>gb|AY292471.1| Theragra chalcogramma S2 ribosomal protein (S2) gene, partial cds
          Length = 896

 Score =  149 bits (75), Expect = 1e-32
 Identities = 138/159 (86%)
 Strand = Plus / Minus

                                                                       
Query: 480 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctc 539
           ||||| |||||||||||||||||||||||| ||||||||||||| |||||||| || |||
Sbjct: 252 ccggtcaccttgcagggcacggtgtggggcttgccgatcttgttaccccagtaacctctc 193

                                                                       
Query: 540 ctgacggggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacc 599
           ||||| || || ||||| | |||||| ||||||||||| || |||||||| || ||||||
Sbjct: 192 ctgactggaacaatggacaacttggccaggatgatggcaccacggatggcggttgccacc 133

                                                  
Query: 600 tcctttgcgcacttgacgccgagcccgacgtggccgttg 638
           ||||| | ||||||||| || || || ||||||||||||
Sbjct: 132 tccttggagcacttgacacccagaccaacgtggccgttg 94

---

>emb|AJ132531.1|PAB132531 Picea abies mRNA for 40S ribosomal protein S2
          Length = 1090

 Score =  149 bits (75), Expect = 1e-32
 Identities = 297/371 (80%)
 Strand = Plus / Minus

                                                                       
Query: 261 gtctccctccagaagtcaggggtgaggaatccataggtcttcatcaggcagtcgaaggtt 320
           ||||||||||| || ||||| || |  |||||||| ||||| |  || || || || |||
Sbjct: 779 gtctccctccacaaatcaggtgttaaaaatccataagtctttaatagacactcaaaagtt 720

                                                                       
Query: 321 gccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatca 380
           |||||||| || || ||||| |||||||| || || |||||||| ||||||||||| || 
Sbjct: 719 gccttgacaaaatttccaagagtcttggtcgaccctcgcgaggaggtgaagacatcttcg 660

                                                                       
Query: 381 ataccagcgaactggagcaccttcttggggacccgggcggcgacgattccagaacccctc 440
           || ||||| ||||| || ||||||||||| || || || || ||||| |||| ||| || 
Sbjct: 659 atcccagcaaactgcagaaccttcttgggcactcgagcagccacgatcccagcacctctg 600

                                                                       
Query: 441 ggggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttgcagggcacg 500
           |||||||||||||| |  || || |||||||| || || || |||||||||   || |||
Sbjct: 599 ggggcgggcaccattctgaccgttacagagccacatttcccagtgaccttgacaggaacg 540

                                                                       
Query: 501 gtgtggggcatgccgatcttgttcccccagtagcccctcctgacggggacgatggagagc 560
           || |||||  | ||||||||||| |||||||| |||||||| ||||| |  |  || |||
Sbjct: 539 gtatggggtttaccgatcttgttaccccagtaacccctccttacgggaataaccgaaagc 480

                                                                       
Query: 561 ttggcgaggatgatggcgccgcggatggccgtggccacctcctttgcgcacttgacgccg 620
           ||||| |  || ||||| || ||||| |||||||||||||||||   ||||||||| |||
Sbjct: 479 ttggccaaaataatggctccacggatagccgtggccacctccttgctgcacttgaccccg 420

                      
Query: 621 agcccgacgtg 631
           |||||||||||
Sbjct: 419 agcccgacgtg 409

---

>ref|XM_510798.1| PREDICTED: Pan troglodytes similar to ribosomal protein S2; 40S
           ribosomal protein S2 (LOC453897), mRNA
          Length = 877

 Score =  147 bits (74), Expect = 5e-32
 Identities = 146/170 (85%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 570 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 511

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  || |||||||||||||||||||| ||||||||||| || |||
Sbjct: 510 ccccagtagcctctgcgcacagggacgatggagagcttggccaggatgatggccccacgg 451

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 450 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 401

---

>gb|AC026366.20| Homo sapiens 12 BAC RP11-139O18 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 164429

 Score =  147 bits (74), Expect = 5e-32
 Identities = 146/170 (85%)
 Strand = Plus / Minus

                                                                          
Query: 465    acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
              |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 146135 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 146076

                                                                          
Query: 525    ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
              ||||||||||| || |  |||||||| |||||||||||||| ||||||||||| || |||
Sbjct: 146075 ccccagtagcctctgcgcacggggacaatggagagcttggccaggatgatggccccacgg 146016

                                                                
Query: 585    atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
              ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 146015 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 145966

---

>gb|AC073596.40| Homo sapiens 12 BAC RP11-385C6 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 203395

 Score =  147 bits (74), Expect = 5e-32
 Identities = 146/170 (85%)
 Strand = Plus / Plus

                                                                         
Query: 465   acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
             |||||||||||   ||| || |||||||| || || ||||||||| ||||||||||||||
Sbjct: 64512 acagagccgcagcggcctgtcaccttgcaagggacagtgtggggcttgccgatcttgttc 64571

                                                                         
Query: 525   ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
             ||||||||||| || |  |||||||| |||||||||||||| ||||||||||| || |||
Sbjct: 64572 ccccagtagcctctgcgcacggggacaatggagagcttggccaggatgatggccccacgg 64631

                                                               
Query: 585   atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
             ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 64632 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 64681

---

>ref|XM_946024.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
           variant 8 (LOC650901), mRNA
          Length = 871

 Score =  147 bits (74), Expect = 5e-32
 Identities = 146/170 (85%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 509 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 450

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  |||||||| |||||||||||||| ||||||||||| || |||
Sbjct: 449 ccccagtagcctctgcgcacggggacaatggagagcttggccaggatgatggccccacgg 390

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || ||||| |||||
Sbjct: 389 atggctgtggccacctccttggagcacttaacacccagaccgacatggcc 340

---

>ref|XM_946023.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
           variant 7 (LOC650901), mRNA
          Length = 778

 Score =  147 bits (74), Expect = 5e-32
 Identities = 146/170 (85%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 416 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 357

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  |||||||| |||||||||||||| ||||||||||| || |||
Sbjct: 356 ccccagtagcctctgcgcacggggacaatggagagcttggccaggatgatggccccacgg 297

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || ||||| |||||
Sbjct: 296 atggctgtggccacctccttggagcacttaacacccagaccgacatggcc 247

---

>ref|XM_946022.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
           variant 6 (LOC650901), mRNA
          Length = 721

 Score =  147 bits (74), Expect = 5e-32
 Identities = 146/170 (85%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 356 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 297

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  |||||||| |||||||||||||| ||||||||||| || |||
Sbjct: 296 ccccagtagcctctgcgcacggggacaatggagagcttggccaggatgatggccccacgg 237

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || ||||| |||||
Sbjct: 236 atggctgtggccacctccttggagcacttaacacccagaccgacatggcc 187

---

>ref|XM_946021.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
           variant 5 (LOC650901), mRNA
          Length = 843

 Score =  147 bits (74), Expect = 5e-32
 Identities = 146/170 (85%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 485 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 426

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  |||||||| |||||||||||||| ||||||||||| || |||
Sbjct: 425 ccccagtagcctctgcgcacggggacaatggagagcttggccaggatgatggccccacgg 366

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || ||||| |||||
Sbjct: 365 atggctgtggccacctccttggagcacttaacacccagaccgacatggcc 316

---

>ref|XM_946020.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
           variant 4 (LOC650901), mRNA
          Length = 658

 Score =  147 bits (74), Expect = 5e-32
 Identities = 146/170 (85%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 300 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 241

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  |||||||| |||||||||||||| ||||||||||| || |||
Sbjct: 240 ccccagtagcctctgcgcacggggacaatggagagcttggccaggatgatggccccacgg 181

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || ||||| |||||
Sbjct: 180 atggctgtggccacctccttggagcacttaacacccagaccgacatggcc 131

---

>ref|XM_942473.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
           variant 1 (LOC650901), mRNA
          Length = 970

 Score =  147 bits (74), Expect = 5e-32
 Identities = 146/170 (85%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 601 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 542

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  |||||||| |||||||||||||| ||||||||||| || |||
Sbjct: 541 ccccagtagcctctgcgcacggggacaatggagagcttggccaggatgatggccccacgg 482

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || ||||| |||||
Sbjct: 481 atggctgtggccacctccttggagcacttaacacccagaccgacatggcc 432

---

>gb|AC022210.8| Homo sapiens BAC clone RP11-617F9 from 2, complete sequence
          Length = 164846

 Score =  147 bits (74), Expect = 5e-32
 Identities = 146/170 (85%)
 Strand = Plus / Minus

                                                                         
Query: 465   acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
             |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 31572 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 31513

                                                                         
Query: 525   ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
             ||||||||||| || |  |||||||| |||||||||||||| ||||||||||| || |||
Sbjct: 31512 ccccagtagcctctgcgcacggggacaatggagagcttggccaggatgatggccccacgg 31453

                                                               
Query: 585   atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
             ||||| |||||||||||||| | |||||| || || || ||||| |||||
Sbjct: 31452 atggctgtggccacctccttggagcacttaacacccagaccgacatggcc 31403

---

>gb|AY190670.1| Pagrus major 40S ribosomal protein S2 mRNA, partial cds
          Length = 646

 Score =  145 bits (73), Expect = 2e-31
 Identities = 133/153 (86%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||||||||||||||||||| | ||||||||||| ||||| || || |||||||||
Sbjct: 530 accttgcagggcacggtgtggggctttccgatcttgttaccccaataacctctcctgacg 471

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||| ||||| |||||||| ||||||||||| || |||||||| ||||||||||| || 
Sbjct: 470 gggacaatggacagcttggccaggatgatggcaccacggatggcggtggccacctctttg 411

                                            
Query: 606 gcgcacttgacgccgagcccgacgtggccgttg 638
           | |||||| || || || || ||||||||||||
Sbjct: 410 gagcacttcacacccagacccacgtggccgttg 378

---

>gb|AC093196.2| Drosophila melanogaster clone BACR22H06, complete sequence
          Length = 173008

 Score =  145 bits (73), Expect = 2e-31
 Identities = 130/149 (87%)
 Strand = Plus / Plus

                                                                          
Query: 456    cgcacggtgacagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccg 515
              ||||||| ||| || ||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 112651 cgcacggagacggaaccgcacttgccggtgaccttgcagggcacggtgtggggcttgccg 112710

                                                                          
Query: 516    atcttgttcccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatg 575
              |||||||| ||||||||||| |  |  ||||| || | |||||||||||| || ||||||
Sbjct: 112711 atcttgttgccccagtagccacggcgcacgggcaccacggagagcttggccagaatgatg 112770

                                           
Query: 576    gcgccgcggatggccgtggccacctcctt 604
              || || |||||||| |||||||| |||||
Sbjct: 112771 gcaccacggatggcggtggccacttcctt 112799

---

>gb|AC009744.8| Drosophila melanogaster clone BACR06G16, complete sequence
          Length = 179038

 Score =  145 bits (73), Expect = 2e-31
 Identities = 130/149 (87%)
 Strand = Plus / Plus

                                                                        
Query: 456  cgcacggtgacagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccg 515
            ||||||| ||| || ||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 5510 cgcacggagacggaaccgcacttgccggtgaccttgcagggcacggtgtggggcttgccg 5569

                                                                        
Query: 516  atcttgttcccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatg 575
            |||||||| ||||||||||| |  |  ||||| || | |||||||||||| || ||||||
Sbjct: 5570 atcttgttgccccagtagccacggcgcacgggcaccacggagagcttggccagaatgatg 5629

                                         
Query: 576  gcgccgcggatggccgtggccacctcctt 604
            || || |||||||| |||||||| |||||
Sbjct: 5630 gcaccacggatggcggtggccacttcctt 5658

---

>gb|AY292480.1| Micromesistius poutassou S2 ribosomal protein (S2) gene, partial
           cds
          Length = 915

 Score =  145 bits (73), Expect = 2e-31
 Identities = 133/153 (86%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||||||||||||||||||| ||||||||||||| |||||||| || |||||||| 
Sbjct: 246 accttgcagggcacggtgtggggcttgccgatcttgttaccccagtaacctctcctgact 187

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           || || ||||| |||||||| ||||||||||| || |||||||| |||||||||||||| 
Sbjct: 186 ggcactatggacagcttggccaggatgatggcaccacggatggcggtggccacctccttg 127

                                            
Query: 606 gcgcacttgacgccgagcccgacgtggccgttg 638
           | |||||| || || || || || |||||||||
Sbjct: 126 gagcacttcacacccagacccacatggccgttg 94

---

>emb|AL031671.12|HS688G8 Human DNA sequence from clone RP4-688G8 on chromosome 20q11.2-12
             Contains the RPS2L1 gene for ribosomal protein S2-like 1
             (pseudogene), the gene for protease inhibitor WAP9 (WAP9),
             the C20orf46 gene for WAP10 precursor, the gene for
             protease inhibitor WAP11 (WAP11), the 3' end of the gene
             for protease inhibitor WAP12 (WAP12) and a CpG island,
             complete sequence
          Length = 116380

 Score =  145 bits (73), Expect = 2e-31
 Identities = 130/149 (87%)
 Strand = Plus / Plus

                                                                         
Query: 486   accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
             |||||||| || |||||||||||| ||||||||||||| ||||||||||| || |  |||
Sbjct: 60146 accttgcaagggacggtgtggggcttgccgatcttgttgccccagtagcctctgcacacg 60205

                                                                         
Query: 546   gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
             ||||| |||||||||||||| ||||||||||| || |||||||| |||||||||||||| 
Sbjct: 60206 gggacaatggagagcttggccaggatgatggccccacggatggcggtggccacctccttg 60265

                                          
Query: 606   gcgcacttgacgccgagcccgacgtggcc 634
             | |||||| || || || |||||||||||
Sbjct: 60266 gagcacttaacacccagaccgacgtggcc 60294

---

>gb|AC091305.9| Homo sapiens chromosome 18, clone RP11-644A7, complete sequence
          Length = 118401

 Score =  145 bits (73), Expect = 2e-31
 Identities = 121/137 (88%)
 Strand = Plus / Plus

                                                                         
Query: 465   acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
             ||||||||||| | ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 79450 acagagccgcagtggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 79509

                                                                         
Query: 525   ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
             ||||||||||| || |  |||||||| |||||||||||||| ||||| ||||| ||||||
Sbjct: 79510 ccccagtagcctctgcgcacggggacaatggagagcttggccaggataatggccccgcgg 79569

                              
Query: 585   atggccgtggccacctc 601
             ||||| |||||||||||
Sbjct: 79570 atggcagtggccacctc 79586

---

>emb|X69120.1|DMRPS2 D.melanogaster mRNA for ribosomal protein S2
          Length = 916

 Score =  145 bits (73), Expect = 2e-31
 Identities = 130/149 (87%)
 Strand = Plus / Minus

                                                                       
Query: 456 cgcacggtgacagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccg 515
           ||||||| ||| || ||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 548 cgcacggagacggaaccgcacttgccggtgaccttgcagggcacggtgtggggcttgccg 489

                                                                       
Query: 516 atcttgttcccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatg 575
           |||||||| ||||||||||| |  |  ||||| || | |||||||||||| || ||||||
Sbjct: 488 atcttgttgccccagtagccacggcgcacgggcaccacggagagcttggccagaatgatg 429

                                        
Query: 576 gcgccgcggatggccgtggccacctcctt 604
           || || |||||||| |||||||| |||||
Sbjct: 428 gcaccacggatggcggtggccacttcctt 400

---

>gb|AY094799.1| Drosophila melanogaster LD24077 full insert cDNA
          Length = 915

 Score =  145 bits (73), Expect = 2e-31
 Identities = 130/149 (87%)
 Strand = Plus / Minus

                                                                       
Query: 456 cgcacggtgacagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccg 515
           ||||||| ||| || ||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 560 cgcacggagacggaaccgcacttgccggtgaccttgcagggcacggtgtggggcttgccg 501

                                                                       
Query: 516 atcttgttcccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatg 575
           |||||||| ||||||||||| |  |  ||||| || | |||||||||||| || ||||||
Sbjct: 500 atcttgttgccccagtagccacggcgcacgggcaccacggagagcttggccagaatgatg 441

                                        
Query: 576 gcgccgcggatggccgtggccacctcctt 604
           || || |||||||| |||||||| |||||
Sbjct: 440 gcaccacggatggcggtggccacttcctt 412

---

>ref|NM_057526.3| Drosophila melanogaster string of pearls CG5920-RA (sop), mRNA
          Length = 939

 Score =  145 bits (73), Expect = 2e-31
 Identities = 130/149 (87%)
 Strand = Plus / Minus

                                                                       
Query: 456 cgcacggtgacagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccg 515
           ||||||| ||| || ||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 601 cgcacggagacggaaccgcacttgccggtgaccttgcagggcacggtgtggggcttgccg 542

                                                                       
Query: 516 atcttgttcccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatg 575
           |||||||| ||||||||||| |  |  ||||| || | |||||||||||| || ||||||
Sbjct: 541 atcttgttgccccagtagccacggcgcacgggcaccacggagagcttggccagaatgatg 482

                                        
Query: 576 gcgccgcggatggccgtggccacctcctt 604
           || || |||||||| |||||||| |||||
Sbjct: 481 gcaccacggatggcggtggccacttcctt 453

---

>ref|NG_000946.1| Homo sapiens ribosomal protein S2-like 1 (RPS2L1) pseudogene on
           chromosome 20
          Length = 1166

 Score =  145 bits (73), Expect = 2e-31
 Identities = 130/149 (87%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || |||||||||||| ||||||||||||| ||||||||||| || |  |||
Sbjct: 674 accttgcaagggacggtgtggggcttgccgatcttgttgccccagtagcctctgcacacg 615

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||| |||||||||||||| ||||||||||| || |||||||| |||||||||||||| 
Sbjct: 614 gggacaatggagagcttggccaggatgatggccccacggatggcggtggccacctccttg 555

                                        
Query: 606 gcgcacttgacgccgagcccgacgtggcc 634
           | |||||| || || || |||||||||||
Sbjct: 554 gagcacttaacacccagaccgacgtggcc 526

---

>gb|AE003626.4| Drosophila melanogaster chromosome 2L, section 35 of 83 of the complete
              sequence
          Length = 264919

 Score =  145 bits (73), Expect = 2e-31
 Identities = 130/149 (87%)
 Strand = Plus / Plus

                                                                          
Query: 456    cgcacggtgacagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccg 515
              ||||||| ||| || ||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 187740 cgcacggagacggaaccgcacttgccggtgaccttgcagggcacggtgtggggcttgccg 187799

                                                                          
Query: 516    atcttgttcccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatg 575
              |||||||| ||||||||||| |  |  ||||| || | |||||||||||| || ||||||
Sbjct: 187800 atcttgttgccccagtagccacggcgcacgggcaccacggagagcttggccagaatgatg 187859

                                           
Query: 576    gcgccgcggatggccgtggccacctcctt 604
              || || |||||||| |||||||| |||||
Sbjct: 187860 gcaccacggatggcggtggccacttcctt 187888

---

>gb|U01334.1|DMU01334 Drosophila melanogaster ribosomal protein S2 (sop) mRNA, complete
           cds
          Length = 905

 Score =  145 bits (73), Expect = 2e-31
 Identities = 130/149 (87%)
 Strand = Plus / Minus

                                                                       
Query: 456 cgcacggtgacagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccg 515
           ||||||| ||| || ||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 566 cgcacggagacggaaccgcacttgccggtgaccttgcagggcacggtgtggggcttgccg 507

                                                                       
Query: 516 atcttgttcccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatg 575
           |||||||| ||||||||||| |  |  ||||| || | |||||||||||| || ||||||
Sbjct: 506 atcttgttgccccagtagccacggcgcacgggcaccacggagagcttggccagaatgatg 447

                                        
Query: 576 gcgccgcggatggccgtggccacctcctt 604
           || || |||||||| |||||||| |||||
Sbjct: 446 gcaccacggatggcggtggccacttcctt 418

---

>gb|AC005135.1|AC005135 Drosophila melanogaster DNA sequence (P1 DS07070 (D331)), complete
             sequence
          Length = 67297

 Score =  145 bits (73), Expect = 2e-31
 Identities = 130/149 (87%)
 Strand = Plus / Plus

                                                                         
Query: 456   cgcacggtgacagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccg 515
             ||||||| ||| || ||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 39286 cgcacggagacggaaccgcacttgccggtgaccttgcagggcacggtgtggggcttgccg 39345

                                                                         
Query: 516   atcttgttcccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatg 575
             |||||||| ||||||||||| |  |  ||||| || | |||||||||||| || ||||||
Sbjct: 39346 atcttgttgccccagtagccacggcgcacgggcaccacggagagcttggccagaatgatg 39405

                                          
Query: 576   gcgccgcggatggccgtggccacctcctt 604
             || || |||||||| |||||||| |||||
Sbjct: 39406 gcaccacggatggcggtggccacttcctt 39434

---

>dbj|AP006685.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT45M12, TM0378b,
             complete sequence
          Length = 86433

 Score =  145 bits (73), Expect = 2e-31
 Identities = 235/289 (81%)
 Strand = Plus / Minus

                                                                         
Query: 261   gtctccctccagaagtcaggggtgaggaatccataggtcttcatcaggcagtcgaaggtt 320
             |||||| ||||||| ||||| || ||||| |  ||||| |||| ||  ||||| || |||
Sbjct: 17933 gtctccttccagaattcaggtgtcaggaaactgtaggttttcagcaaacagtcaaaagtt 17874

                                                                         
Query: 321   gccttgacgaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatcatca 380
             ||||||||||| ||||| || |||||||||||||| |  || ||||||||||||||||||
Sbjct: 17873 gccttgacgaaattgccgagtgtcttggtggatcctctggaagaagtgaagacatcatca 17814

                                                                         
Query: 381   ataccagcgaactggagcaccttcttggggacccgggcggcgacgattccagaacccctc 440
             || ||||||||||| | ||||||||| || ||||  || || |||||||| ||||| |  
Sbjct: 17813 atcccagcgaactgcaacaccttctttggaaccctagcagccacgattcccgaaccacga 17754

                                                                         
Query: 441   ggggcgggcaccatacgcacggtgacagagccgcacttgccggtgaccttgcagggcacg 500
             || || || ||||| |  || || || || || ||||| || || |||||||| || || 
Sbjct: 17753 ggcgctggaaccattctgacagttacggaaccacacttccctgtcaccttgcacggaaca 17694

                                                              
Query: 501   gtgtggggcatgccgatcttgttcccccagtagcccctcctgacgggga 549
             ||||||||| | || ||||||||||||||||| ||||||||||||||||
Sbjct: 17693 gtgtggggcttcccaatcttgttcccccagtaccccctcctgacgggga 17645

---

>gb|U01335.1|DMU01335 Drosophila melanogaster ribosomal protein S2 (sop) gene, complete cds
          Length = 1358

 Score =  145 bits (73), Expect = 2e-31
 Identities = 130/149 (87%)
 Strand = Plus / Minus

                                                                        
Query: 456  cgcacggtgacagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccg 515
            ||||||| ||| || ||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 1019 cgcacggagacggaaccgcacttgccggtgaccttgcagggcacggtgtggggcttgccg 960

                                                                        
Query: 516  atcttgttcccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatg 575
            |||||||| ||||||||||| |  |  ||||| || | |||||||||||| || ||||||
Sbjct: 959  atcttgttgccccagtagccacggcgcacgggcaccacggagagcttggccagaatgatg 900

                                         
Query: 576  gcgccgcggatggccgtggccacctcctt 604
            || || |||||||| |||||||| |||||
Sbjct: 899  gcaccacggatggcggtggccacttcctt 871

---

>dbj|AB246885.1| Lethenteron japonicum RPS2 mRNA for ribosomal protein S2, partial
           cds
          Length = 784

 Score =  143 bits (72), Expect = 8e-31
 Identities = 135/156 (86%)
 Strand = Plus / Minus

                                                                       
Query: 483 gtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctg 542
           ||||||||||||||||||||||| ||  ||| ||||||||| ||||||||||| |  |  
Sbjct: 516 gtgaccttgcagggcacggtgtgcggtttgctgatcttgttaccccagtagccacggcgc 457

                                                                       
Query: 543 acggggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctcc 602
           || || ||||||||||| ||||||||||||||||||||||||||||| || |||||||||
Sbjct: 456 accggcacgatggagagtttggcgaggatgatggcgccgcggatggcggtcgccacctcc 397

                                               
Query: 603 tttgcgcacttgacgccgagcccgacgtggccgttg 638
           || | |||||| |||||||| |||| ||| ||||||
Sbjct: 396 ttggagcacttcacgccgagaccgatgtgtccgttg 361

---

>ref|XM_946019.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
           variant 3 (LOC650901), mRNA
          Length = 904

 Score =  143 bits (72), Expect = 8e-31
 Identities = 129/148 (87%)
 Strand = Plus / Minus

                                                                       
Query: 487 ccttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacgg 546
           ||||||| || |||||||||||| ||||||||||||||||||||||||| || |  ||||
Sbjct: 574 ccttgcaagggacggtgtggggcttgccgatcttgttcccccagtagcctctgcgcacgg 515

                                                                       
Query: 547 ggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctcctttg 606
           |||| |||||||||||||| ||||||||||| || |||||||| |||||||||||||| |
Sbjct: 514 ggacaatggagagcttggccaggatgatggccccacggatggctgtggccacctccttgg 455

                                       
Query: 607 cgcacttgacgccgagcccgacgtggcc 634
            |||||| || || || ||||| |||||
Sbjct: 454 agcacttaacacccagaccgacatggcc 427

---

>ref|XM_514680.1| PREDICTED: Pan troglodytes LOC458285 (LOC458285), mRNA
          Length = 916

 Score =  139 bits (70), Expect = 1e-29
 Identities = 145/170 (85%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || ||| |||||||| ||||||||||||| 
Sbjct: 575 acagagccgcagcggcctgtcaccttgcaagggacgatgtggggcttgccgatcttgttg 516

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  |||||||| |||||||||||||| ||||||||||| || |||
Sbjct: 515 ccccagtagcctctgcacacggggacaatggagagcttggccaggatgatggccccacgg 456

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 455 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 406

---

>gb|DQ214051.1| Taeniopygia guttata clone 0058P0017F05 ribosomal protein S2-like
           mRNA, complete sequence
          Length = 931

 Score =  139 bits (70), Expect = 1e-29
 Identities = 118/134 (88%)
 Strand = Plus / Minus

                                                                       
Query: 480 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctc 539
           |||||||||||||||||||| ||||| ||| | ||||||||||| ||||||||||| |  
Sbjct: 562 ccggtgaccttgcagggcaccgtgtgtggcttcccgatcttgttgccccagtagccgcgt 503

                                                                       
Query: 540 ctgacggggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacc 599
           |  ||||| |||||||| |||||||| ||||||||||| |||||||||||||||||||||
Sbjct: 502 cgcacgggcacgatggacagcttggccaggatgatggccccgcggatggccgtggccacc 443

                         
Query: 600 tcctttgcgcactt 613
           ||||| | ||||||
Sbjct: 442 tccttggagcactt 429



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 228 gtgaactcctggtacggagtcttggtgaag 257
           |||||||||||||| |||| ||||||||||
Sbjct: 814 gtgaactcctggtaaggagacttggtgaag 785

---

>gb|DQ214050.1| Taeniopygia guttata clone 0061P0020E02 ribosomal protein S2-like
           mRNA, complete sequence
          Length = 939

 Score =  139 bits (70), Expect = 1e-29
 Identities = 118/134 (88%)
 Strand = Plus / Minus

                                                                       
Query: 480 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctc 539
           |||||||||||||||||||| ||||| ||| | ||||||||||| ||||||||||| |  
Sbjct: 562 ccggtgaccttgcagggcaccgtgtgtggcttcccgatcttgttgccccagtagccgcgt 503

                                                                       
Query: 540 ctgacggggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacc 599
           |  ||||| |||||||| |||||||| ||||||||||| |||||||||||||||||||||
Sbjct: 502 cgcacgggcacgatggacagcttggccaggatgatggccccgcggatggccgtggccacc 443

                         
Query: 600 tcctttgcgcactt 613
           ||||| | ||||||
Sbjct: 442 tccttggagcactt 429



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 228 gtgaactcctggtacggagtcttggtgaag 257
           |||||||||||||| |||| ||||||||||
Sbjct: 815 gtgaactcctggtaaggagacttggtgaag 786

---

>gb|AC092268.4| Homo sapiens chromosome X clone RP11-185O17 map p11.4, complete
             sequence
          Length = 183539

 Score =  139 bits (70), Expect = 1e-29
 Identities = 145/170 (85%)
 Strand = Plus / Plus

                                                                         
Query: 465   acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
             |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 78747 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 78806

                                                                         
Query: 525   ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
             | ||||||||| || |  |||||||| |||||||||||||| ||||||||||| || |||
Sbjct: 78807 ctccagtagcctctgcgcacggggacaatggagagcttggccaggatgatggccccacgg 78866

                                                               
Query: 585   atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
             ||||| |||||||||||||| |  ||||| || || || |||||||||||
Sbjct: 78867 atggcggtggccacctccttggaacacttaacacccagaccgacgtggcc 78916

---

>gb|AY292478.1| Microgadus proximus S2 ribosomal protein (S2) gene, partial cds
          Length = 901

 Score =  139 bits (70), Expect = 1e-29
 Identities = 118/134 (88%)
 Strand = Plus / Minus

                                                                       
Query: 480 ccggtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctc 539
           ||||| |||||||||||||||||||||||| ||||||||||||| |||||||| || |||
Sbjct: 252 ccggtcaccttgcagggcacggtgtggggcttgccgatcttgttaccccagtaacctctc 193

                                                                       
Query: 540 ctgacggggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacc 599
           ||||| || |||||||| |||||||| |||||||| || || |||||||| || ||||||
Sbjct: 192 ctgactggaacgatggacagcttggccaggatgatagcaccacggatggcggttgccacc 133

                         
Query: 600 tcctttgcgcactt 613
           ||||| | ||||||
Sbjct: 132 tccttggagcactt 119

---

>emb|AL663070.15| Human DNA sequence from clone RP3-342P20 on chromosome 1 Contains the
             gene for a novel protein (FLJ90702, FLJ14997 and
             FLJ35904), a ribosomal protein S2 (RPS2) pseudogene and
             two CpG islands, complete sequence
          Length = 115043

 Score =  139 bits (70), Expect = 1e-29
 Identities = 145/170 (85%)
 Strand = Plus / Minus

                                                                         
Query: 465   acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
             |||||||||||   ||| || |||||||| || |||||||||||| ||| ||||||||||
Sbjct: 39151 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgctgatcttgttc 39092

                                                                         
Query: 525   ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
             ||||||||||| || |  |||||||| |||||||||||||| ||||||||||| || |||
Sbjct: 39091 ccccagtagcctctgcgcacggggacaatggagagcttggccaggatgatggccccacgg 39032

                                                               
Query: 585   atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
             ||||| |||||||||||||| | |||||| || || || ||||| |||||
Sbjct: 39031 atggcggtggccacctccttggagcacttaacacccagaccgacatggcc 38982

---

>gb|AC097658.2| Homo sapiens BAC clone RP11-364L4 from 4, complete sequence
          Length = 165247

 Score =  139 bits (70), Expect = 1e-29
 Identities = 145/170 (85%)
 Strand = Plus / Plus

                                                                          
Query: 465    acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
              |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 122195 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 122254

                                                                          
Query: 525    ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
              ||||||||||| ||    |||||||| |||||||||||||| ||||||||||| || | |
Sbjct: 122255 ccccagtagcctctgtgcacggggacaatggagagcttggccaggatgatggccccacag 122314

                                                                
Query: 585    atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
              ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 122315 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 122364

---

>ref|XM_938104.1| PREDICTED: Homo sapiens similar to ribosomal protein S2
           (LOC648114), mRNA
          Length = 1037

 Score =  139 bits (70), Expect = 1e-29
 Identities = 145/170 (85%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 555 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 496

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| ||    |||||||| |||||||||||||| ||||||||||| || | |
Sbjct: 495 ccccagtagcctctgtgcacggggacaatggagagcttggccaggatgatggccccacag 436

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 435 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 386

---

>ref|XM_930178.1| PREDICTED: Homo sapiens similar to ribosomal protein S2
           (LOC645018), mRNA
          Length = 1037

 Score =  139 bits (70), Expect = 1e-29
 Identities = 145/170 (85%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 555 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 496

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| ||    |||||||| |||||||||||||| ||||||||||| || | |
Sbjct: 495 ccccagtagcctctgtgcacggggacaatggagagcttggccaggatgatggccccacag 436

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 435 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 386

---

>ref|NG_002522.1| Homo sapiens ribosomal protein S2 pseudogene 4 (RPS2P4) on
           chromosome 14
          Length = 1142

 Score =  139 bits (70), Expect = 1e-29
 Identities = 145/170 (85%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 704 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 645

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| ||    || ||||| |||||||||||||| ||||||||||| || |||
Sbjct: 644 ccccagtagcctctgtgcacagggacaatggagagcttggccaggatgatggccccacgg 585

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 584 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 535

---

>gb|DQ021880.1| Homo sapiens GRB2-associated binding protein 1 (GAB1) gene, complete
             cds
          Length = 135764

 Score =  139 bits (70), Expect = 1e-29
 Identities = 145/170 (85%)
 Strand = Plus / Plus

                                                                         
Query: 465   acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
             |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 13249 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 13308

                                                                         
Query: 525   ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
             ||||||||||| ||    |||||||| |||||||||||||| ||||||||||| || | |
Sbjct: 13309 ccccagtagcctctgtgcacggggacaatggagagcttggccaggatgatggccccacag 13368

                                                               
Query: 585   atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
             ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 13369 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 13418

---

>emb|AL590326.3|CNS07EG7 Human chromosome 14 DNA sequence BAC R-477I4 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 31184

 Score =  139 bits (70), Expect = 1e-29
 Identities = 145/170 (85%)
 Strand = Plus / Plus

                                                                         
Query: 465   acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
             |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 23403 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 23462

                                                                         
Query: 525   ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
             ||||||||||| ||    || ||||| |||||||||||||| ||||||||||| || |||
Sbjct: 23463 ccccagtagcctctgtgcacagggacaatggagagcttggccaggatgatggccccacgg 23522

                                                               
Query: 585   atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
             ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 23523 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 23572

---

>emb|AL583810.5|CNS07EFZ Human chromosome 14 DNA sequence BAC C-3051D23 of library CalTech-D
           from chromosome 14 of Homo sapiens (Human), complete
           sequence
          Length = 94227

 Score =  139 bits (70), Expect = 1e-29
 Identities = 145/170 (85%)
 Strand = Plus / Plus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 236 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 295

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| ||    || ||||| |||||||||||||| ||||||||||| || |||
Sbjct: 296 ccccagtagcctctgtgcacagggacaatggagagcttggccaggatgatggccccacgg 355

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| |||||||||||||| | |||||| || || || |||||||||||
Sbjct: 356 atggcggtggccacctccttggagcacttaacacccagaccgacgtggcc 405

---

>ref|XM_523967.1| PREDICTED: Pan troglodytes similar to 40S ribosomal protein S2
           (LOC468578), mRNA
          Length = 765

 Score =  137 bits (69), Expect = 5e-29
 Identities = 120/137 (87%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 581 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 522

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  |||||||| |||||||||||||| ||||| ||||| ||||||
Sbjct: 521 ccccagtagcctctgcgcacggggacaatggagagcttggccaggataatggccccgcgg 462

                            
Query: 585 atggccgtggccacctc 601
           ||||| |||||||||||
Sbjct: 461 atggcagtggccacctc 445

---

>ref|XM_515580.1| PREDICTED: Pan troglodytes LOC459356 (LOC459356), mRNA
          Length = 844

 Score =  137 bits (69), Expect = 5e-29
 Identities = 129/149 (86%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 582 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 523

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  |||||||| |||||||||||||| ||| ||||||| || |||
Sbjct: 522 ccccagtagcctctgcgcacggggacaatggagagcttggccagggtgatggccccacgg 463

                                        
Query: 585 atggccgtggccacctcctttgcgcactt 613
           ||||| |||||||||||||| | ||||||
Sbjct: 462 atggcggtggccacctccttggagcactt 434

---

>ref|XM_513399.1| PREDICTED: Pan troglodytes similar to ribosomal protein S2; 40S
           ribosomal protein S2 (LOC456848), mRNA
          Length = 954

 Score =  137 bits (69), Expect = 5e-29
 Identities = 129/149 (86%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || |||||||||||| ||| ||||||||||||||||||||| || |  |||
Sbjct: 560 accttgcaagggacggtgtggggcttgctgatcttgttcccccagtagcctctgcgcacg 501

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||| |||||||||||||| ||||||||||| ||  ||||||| |||||||||||||| 
Sbjct: 500 gggacaatggagagcttggccaggatgatggccccatggatggcggtggccacctccttg 441

                                        
Query: 606 gcgcacttgacgccgagcccgacgtggcc 634
           | |||||| || || || |||||||||||
Sbjct: 440 gagcacttaacacccagaccgacgtggcc 412

---

>emb|AL596275.10| Human DNA sequence from clone RP11-183G22 on chromosome 1 Contains a
             ribosomal protein S2 (RPS2) pseudogene, a high-mobility
             group box 1 (HMGB1) pseudogene and a chromosome 14 open
             reading frame 111 (C14orf111) pseudogene, complete
             sequence
          Length = 139273

 Score =  137 bits (69), Expect = 5e-29
 Identities = 129/149 (86%)
 Strand = Plus / Minus

                                                                         
Query: 486   accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
             |||||||| || |||||||||||| ||||||||||||||||||||||||| || |  |||
Sbjct: 53558 accttgcaagggacggtgtggggcttgccgatcttgttcccccagtagcctctgcgcacg 53499

                                                                         
Query: 546   gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
              |||| |||||||||||||  ||||||||||| || |||||||| |||||||||||||| 
Sbjct: 53498 aggacaatggagagcttggtcaggatgatggctccacggatggcagtggccacctccttg 53439

                                          
Query: 606   gcgcacttgacgccgagcccgacgtggcc 634
             | |||||| || || || |||||||||||
Sbjct: 53438 gagcacttaacacccagaccgacgtggcc 53410

---

>emb|AL355802.13| Human DNA sequence from clone RP3-337H4 on chromosome 6 Contains the 3'
             part of a novel gene, three novel genes, the gene for RNA
             polymerase I 40 kDa subunit (RPA40) (RPA39), the gene for
             exportin 5 (KIAA1291) (XPO5), a 40S ribosomal protein S2
             (RPS2) pseudogene, the 5' part of the POLH gene for DNA
             directed polymerase eta and four CpG islands, complete
             sequence
          Length = 105935

 Score =  137 bits (69), Expect = 5e-29
 Identities = 129/149 (86%)
 Strand = Plus / Plus

                                                                         
Query: 486   accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
             ||||||||||| |||||||||||| ||||||||||||||||| ||||||| ||    |||
Sbjct: 51909 accttgcaggggacggtgtggggcttgccgatcttgttcccctagtagcctctgtgcacg 51968

                                                                         
Query: 546   gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
             ||||| |||||||||||||| ||||||||||| || ||| |||| |||||||||||||| 
Sbjct: 51969 gggacaatggagagcttggccaggatgatggccccacgggtggcggtggccacctccttg 52028

                                          
Query: 606   gcgcacttgacgccgagcccgacgtggcc 634
             | |||||| || || || |||||||||||
Sbjct: 52029 gagcacttaacacccagaccgacgtggcc 52057

---

>emb|AL162430.15| Human DNA sequence from clone RP11-296A18 on chromosome 1 Contains for
              novel genes, a cofilin 1 (non-muscle) (CFL1) pseudogene,
              the RNF11 gene for ring finger protein 11, a ribosomal
              protein S2 (RPS2) pseudogene and the 3' end of the C1orf34
              gene for chromosome 1 open reading frame 34, complete
              sequence
          Length = 211791

 Score =  137 bits (69), Expect = 5e-29
 Identities = 129/149 (86%)
 Strand = Plus / Plus

                                                                          
Query: 486    accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
              |||||||| || |||||||||||| |||| |||||||||||||||||||| || |  |||
Sbjct: 154805 accttgcaagggacggtgtggggcttgccaatcttgttcccccagtagcctctgcgcacg 154864

                                                                          
Query: 546    gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
              ||||| |||||||||||||| ||||||||||| ||  ||||||| |||||||||||||| 
Sbjct: 154865 gggacaatggagagcttggccaggatgatggccccatggatggcggtggccacctccttg 154924

                                           
Query: 606    gcgcacttgacgccgagcccgacgtggcc 634
              | |||||| || || || |||||||||||
Sbjct: 154925 gagcacttaacacccagaccgacgtggcc 154953

---

>ref|XM_942424.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
           variant 3 (LOC440589), mRNA
          Length = 935

 Score =  137 bits (69), Expect = 5e-29
 Identities = 129/149 (86%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || |||||||||||| |||| |||||||||||||||||||| || |  |||
Sbjct: 560 accttgcaagggacggtgtggggcttgccaatcttgttcccccagtagcctctgcgcacg 501

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||| |||||||||||||| ||||||||||| ||  ||||||| |||||||||||||| 
Sbjct: 500 gggacaatggagagcttggccaggatgatggccccatggatggcggtggccacctccttg 441

                                        
Query: 606 gcgcacttgacgccgagcccgacgtggcc 634
           | |||||| || || || |||||||||||
Sbjct: 440 gagcacttaacacccagaccgacgtggcc 412

---

>ref|XM_496363.2| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
           variant 1 (LOC440589), mRNA
          Length = 935

 Score =  137 bits (69), Expect = 5e-29
 Identities = 129/149 (86%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || |||||||||||| |||| |||||||||||||||||||| || |  |||
Sbjct: 560 accttgcaagggacggtgtggggcttgccaatcttgttcccccagtagcctctgcgcacg 501

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||| |||||||||||||| ||||||||||| ||  ||||||| |||||||||||||| 
Sbjct: 500 gggacaatggagagcttggccaggatgatggccccatggatggcggtggccacctccttg 441

                                        
Query: 606 gcgcacttgacgccgagcccgacgtggcc 634
           | |||||| || || || |||||||||||
Sbjct: 440 gagcacttaacacccagaccgacgtggcc 412

---

>gb|AY130359.1| Branchiostoma lanceolatum ribosomal protein S2 mRNA, partial cds
          Length = 604

 Score =  137 bits (69), Expect = 5e-29
 Identities = 132/153 (86%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| ||||| || |||||| ||||||||||||| ||||||||||| | |||||| 
Sbjct: 357 accttgcaaggcacagtatggggcttgccgatcttgtttccccagtagcctcgcctgaca 298

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||| ||||| |||||||| |||||||||||||| |||||||| || ||||| ||||| 
Sbjct: 297 gggacaatggacagcttggccaggatgatggcgccacggatggctgtcgccacttccttg 238

                                            
Query: 606 gcgcacttgacgccgagcccgacgtggccgttg 638
           | |||||| || || ||||||| ||||||||||
Sbjct: 237 gagcacttcacacccagcccgatgtggccgttg 205

---

>gb|AY292481.1| Trisopterus esmarkii S2 ribosomal protein (S2) gene, partial cds
          Length = 907

 Score =  135 bits (68), Expect = 2e-28
 Identities = 113/128 (88%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||||||||||||||||||| ||||||||||||| ||||| || || |||||||| 
Sbjct: 246 accttgcagggcacggtgtggggcttgccgatcttgttaccccaatatcctctcctgact 187

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           || || ||||| |||||||| ||||||||||| || |||||||| |||||||||||||| 
Sbjct: 186 ggcactatggacagcttggccaggatgatggcaccacggatggcggtggccacctccttg 127

                   
Query: 606 gcgcactt 613
           | ||||||
Sbjct: 126 gagcactt 119

---

>ref|XM_945956.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
           variant 4 (LOC440589), mRNA
          Length = 883

 Score =  135 bits (68), Expect = 2e-28
 Identities = 128/148 (86%)
 Strand = Plus / Minus

                                                                       
Query: 487 ccttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacgg 546
           ||||||| || |||||||||||| |||| |||||||||||||||||||| || |  ||||
Sbjct: 559 ccttgcaagggacggtgtggggcttgccaatcttgttcccccagtagcctctgcgcacgg 500

                                                                       
Query: 547 ggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctcctttg 606
           |||| |||||||||||||| ||||||||||| ||  ||||||| |||||||||||||| |
Sbjct: 499 ggacaatggagagcttggccaggatgatggccccatggatggcggtggccacctccttgg 440

                                       
Query: 607 cgcacttgacgccgagcccgacgtggcc 634
            |||||| || || || |||||||||||
Sbjct: 439 agcacttaacacccagaccgacgtggcc 412

---

>ref|XM_934646.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
           variant 2 (LOC440589), mRNA
          Length = 883

 Score =  135 bits (68), Expect = 2e-28
 Identities = 128/148 (86%)
 Strand = Plus / Minus

                                                                       
Query: 487 ccttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacgg 546
           ||||||| || |||||||||||| |||| |||||||||||||||||||| || |  ||||
Sbjct: 559 ccttgcaagggacggtgtggggcttgccaatcttgttcccccagtagcctctgcgcacgg 500

                                                                       
Query: 547 ggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctcctttg 606
           |||| |||||||||||||| ||||||||||| ||  ||||||| |||||||||||||| |
Sbjct: 499 ggacaatggagagcttggccaggatgatggccccatggatggcggtggccacctccttgg 440

                                       
Query: 607 cgcacttgacgccgagcccgacgtggcc 634
            |||||| || || || |||||||||||
Sbjct: 439 agcacttaacacccagaccgacgtggcc 412

---

>ref|XM_517458.1| PREDICTED: Pan troglodytes similar to GRB2-associated binding protein
            1 isoform a (LOC461516), mRNA
          Length = 3270

 Score =  131 bits (66), Expect = 3e-27
 Identities = 144/170 (84%)
 Strand = Plus / Plus

                                                                        
Query: 465  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
            |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 866  acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 925

                                                                        
Query: 525  ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
            ||||||||||| ||    |||||||| |||||||||||||| ||||||||||| || | |
Sbjct: 926  ccccagtagcctctgtgcacggggacaatggagagcttggccaggatgatggccccacag 985

                                                              
Query: 585  atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
            ||||| |||||| ||||||| | |||||| || || || |||||||||||
Sbjct: 986  atggcggtggccgcctccttggagcacttaacacccagaccgacgtggcc 1035

---

>ref|XM_521016.1| PREDICTED: Pan troglodytes similar to ribosomal protein S2; 40S
           ribosomal protein S2 (LOC465581), mRNA
          Length = 764

 Score =  129 bits (65), Expect = 1e-26
 Identities = 119/137 (86%)
 Strand = Plus / Minus

                                                                       
Query: 498 acggtgtggggcatgccgatcttgttcccccagtagcccctcctgacggggacgatggag 557
           |||||| ||||| ||||||||||||||| ||||||||| || |  |||||||| ||||||
Sbjct: 558 acggtggggggcttgccgatcttgttcctccagtagcctctgcgcacggggacaatggag 499

                                                                       
Query: 558 agcttggcgaggatgatggcgccgcggatggccgtggccacctcctttgcgcacttgacg 617
           |||||||| ||||||||||| || |||||||| |||||||||||||| | |||||| || 
Sbjct: 498 agcttggccaggatgatggccccacggatggcggtggccacctccttggagcacttaaca 439

                            
Query: 618 ccgagcccgacgtggcc 634
           || || |||||||||||
Sbjct: 438 cccagaccgacgtggcc 422

---

>ref|XM_849364.1| PREDICTED: Canis familiaris similar to 40S ribosomal protein S2
           (LOC611666), mRNA
          Length = 595

 Score =  129 bits (65), Expect = 1e-26
 Identities = 131/153 (85%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || || ||||||||| ||||||||||||||||||||||||| |     |||
Sbjct: 227 accttgcatgggacagtgtggggcttgccgatcttgttcccccagtagcctcgtggcacg 168

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||||||||| |||||||| ||||||||||| || |||||||| ||||| |||||||| 
Sbjct: 167 gggacgatggaaagcttggccaggatgatggccccacggatggcagtggctacctccttg 108

                                            
Query: 606 gcgcacttgacgccgagcccgacgtggccgttg 638
           | |||||||||||| || || ||||| ||||||
Sbjct: 107 gagcacttgacgcccagacccacgtgtccgttg 75

---

>ref|XM_855734.1| PREDICTED: Canis familiaris similar to 40S ribosomal protein S2,
           transcript variant 3 (LOC608162), mRNA
          Length = 843

 Score =  129 bits (65), Expect = 1e-26
 Identities = 131/153 (85%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || || ||||||||| ||||||||||||||||||||||||| |  |  |||
Sbjct: 451 accttgcatgggacagtgtggggcttgccgatcttgttcccccagtagcctcgtcgcacg 392

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||| ||||| |||||||| ||||||||||| || |||||||| ||||| |||||||| 
Sbjct: 391 gggacaatggaaagcttggccaggatgatggccccacggatggcagtggctacctccttg 332

                                            
Query: 606 gcgcacttgacgccgagcccgacgtggccgttg 638
           | |||||||||||| || || ||||| ||||||
Sbjct: 331 gagcacttgacgcccagacccacgtgtccgttg 299

---

>ref|XM_845058.1| PREDICTED: Canis familiaris similar to 40S ribosomal protein S2,
           transcript variant 2 (LOC608162), mRNA
          Length = 968

 Score =  129 bits (65), Expect = 1e-26
 Identities = 131/153 (85%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || || ||||||||| ||||||||||||||||||||||||| |  |  |||
Sbjct: 576 accttgcatgggacagtgtggggcttgccgatcttgttcccccagtagcctcgtcgcacg 517

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||| ||||| |||||||| ||||||||||| || |||||||| ||||| |||||||| 
Sbjct: 516 gggacaatggaaagcttggccaggatgatggccccacggatggcagtggctacctccttg 457

                                            
Query: 606 gcgcacttgacgccgagcccgacgtggccgttg 638
           | |||||||||||| || || ||||| ||||||
Sbjct: 456 gagcacttgacgcccagacccacgtgtccgttg 424

---

>ref|XM_859982.1| PREDICTED: Canis familiaris similar to 40S ribosomal protein S2,
           transcript variant 6 (LOC479886), mRNA
          Length = 802

 Score =  129 bits (65), Expect = 1e-26
 Identities = 131/153 (85%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || || ||||||||| ||||||||||||||||||||||||| |  |  |||
Sbjct: 431 accttgcatgggacagtgtggggcttgccgatcttgttcccccagtagcctcgtcgcacg 372

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||| ||||| |||||||| ||||||||||| || |||||||| ||||| |||||||| 
Sbjct: 371 gggacaatggaaagcttggccaggatgatggccccacggatggcagtggctacctccttg 312

                                            
Query: 606 gcgcacttgacgccgagcccgacgtggccgttg 638
           | |||||||||||| || || ||||| ||||||
Sbjct: 311 gagcacttgacgcccagacccacgtgtccgttg 279

---

>ref|XM_859963.1| PREDICTED: Canis familiaris similar to 40S ribosomal protein S2,
           transcript variant 5 (LOC479886), mRNA
          Length = 847

 Score =  129 bits (65), Expect = 1e-26
 Identities = 131/153 (85%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || || ||||||||| ||||||||||||||||||||||||| |  |  |||
Sbjct: 476 accttgcatgggacagtgtggggcttgccgatcttgttcccccagtagcctcgtcgcacg 417

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||| ||||| |||||||| ||||||||||| || |||||||| ||||| |||||||| 
Sbjct: 416 gggacaatggaaagcttggccaggatgatggccccacggatggcagtggctacctccttg 357

                                            
Query: 606 gcgcacttgacgccgagcccgacgtggccgttg 638
           | |||||||||||| || || ||||| ||||||
Sbjct: 356 gagcacttgacgcccagacccacgtgtccgttg 324

---

>ref|XM_859945.1| PREDICTED: Canis familiaris similar to 40S ribosomal protein S2,
           transcript variant 4 (LOC479886), mRNA
          Length = 716

 Score =  129 bits (65), Expect = 1e-26
 Identities = 131/153 (85%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || || ||||||||| ||||||||||||||||||||||||| |  |  |||
Sbjct: 345 accttgcatgggacagtgtggggcttgccgatcttgttcccccagtagcctcgtcgcacg 286

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||| ||||| |||||||| ||||||||||| || |||||||| ||||| |||||||| 
Sbjct: 285 gggacaatggaaagcttggccaggatgatggccccacggatggcagtggctacctccttg 226

                                            
Query: 606 gcgcacttgacgccgagcccgacgtggccgttg 638
           | |||||||||||| || || ||||| ||||||
Sbjct: 225 gagcacttgacgcccagacccacgtgtccgttg 193

---

>ref|XM_859927.1| PREDICTED: Canis familiaris similar to 40S ribosomal protein S2,
           transcript variant 3 (LOC479886), mRNA
          Length = 832

 Score =  129 bits (65), Expect = 1e-26
 Identities = 131/153 (85%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || || ||||||||| ||||||||||||||||||||||||| |  |  |||
Sbjct: 461 accttgcatgggacagtgtggggcttgccgatcttgttcccccagtagcctcgtcgcacg 402

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||| ||||| |||||||| ||||||||||| || |||||||| ||||| |||||||| 
Sbjct: 401 gggacaatggaaagcttggccaggatgatggccccacggatggcagtggctacctccttg 342

                                            
Query: 606 gcgcacttgacgccgagcccgacgtggccgttg 638
           | |||||||||||| || || ||||| ||||||
Sbjct: 341 gagcacttgacgcccagacccacgtgtccgttg 309

---

>ref|XM_537011.2| PREDICTED: Canis familiaris similar to 40S ribosomal protein S2,
           transcript variant 1 (LOC479886), mRNA
          Length = 929

 Score =  129 bits (65), Expect = 1e-26
 Identities = 131/153 (85%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || || ||||||||| ||||||||||||||||||||||||| |  |  |||
Sbjct: 558 accttgcatgggacagtgtggggcttgccgatcttgttcccccagtagcctcgtcgcacg 499

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||| ||||| |||||||| ||||||||||| || |||||||| ||||| |||||||| 
Sbjct: 498 gggacaatggaaagcttggccaggatgatggccccacggatggcagtggctacctccttg 439

                                            
Query: 606 gcgcacttgacgccgagcccgacgtggccgttg 638
           | |||||||||||| || || ||||| ||||||
Sbjct: 438 gagcacttgacgcccagacccacgtgtccgttg 406

---

>gb|AC012618.7| Homo sapiens chromosome 19 clone CTD-2666L21, complete sequence
          Length = 159451

 Score =  129 bits (65), Expect = 1e-26
 Identities = 128/149 (85%)
 Strand = Plus / Minus

                                                                          
Query: 465    acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
              ||||||||||| | ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 100934 acagagccgcagtggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 100875

                                                                          
Query: 525    ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
              ||||||||||| || |  ||| ||||  ||||||||||||| ||||||||||| ||||||
Sbjct: 100874 ccccagtagcctctgcgcacgaggacagtggagagcttggccaggatgatggccccgcgg 100815

                                           
Query: 585    atggccgtggccacctcctttgcgcactt 613
              ||||| |||||  ||||||| | ||||||
Sbjct: 100814 atggcagtggctgcctccttggagcactt 100786

---

>ref|XM_513943.1| PREDICTED: Pan troglodytes similar to ribosomal protein S2; 40S
           ribosomal protein S2 (LOC457456), mRNA
          Length = 1336

 Score =  127 bits (64), Expect = 5e-26
 Identities = 142/168 (84%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || |||||||||||| ||| ||||||||||
Sbjct: 965 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgctgatcttgttc 906

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           | ||||||||| || |  |||||||| |||||||||||||| ||||||||||| || |||
Sbjct: 905 caccagtagcctctgcgcacggggacaatggagagcttggccaggatgatggccccacgg 846

                                                           
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtgg 632
            |||| |||||||||||||| | |||||| || || || |||||||||
Sbjct: 845 gtggcggtggccacctccttggagcacttaacacccagaccgacgtgg 798

---

>gb|AY292482.1| Trisopterus minutus S2 ribosomal protein (S2) gene, partial cds
          Length = 908

 Score =  127 bits (64), Expect = 5e-26
 Identities = 112/128 (87%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||||||||||||||||||| |||| |||||||| ||||| || || |||||||| 
Sbjct: 246 accttgcagggcacggtgtggggcttgccaatcttgttaccccaatatcctctcctgact 187

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           || || ||||| |||||||| ||||||||||| || |||||||| |||||||||||||| 
Sbjct: 186 ggcactatggacagcttggccaggatgatggcaccacggatggcggtggccacctccttg 127

                   
Query: 606 gcgcactt 613
           | ||||||
Sbjct: 126 gagcactt 119

---

>gb|AC034268.4| Homo sapiens chromosome 17, clone RP11-312B18, complete sequence
          Length = 198935

 Score =  127 bits (64), Expect = 5e-26
 Identities = 127/148 (85%)
 Strand = Plus / Plus

                                                                          
Query: 487    ccttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacgg 546
              ||||||| || |||||||||||| ||||||||||| |||  |||||||| || |  ||||
Sbjct: 175888 ccttgcaagggacggtgtggggcttgccgatcttgctccttcagtagcctctgcgcacgg 175947

                                                                          
Query: 547    ggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctcctttg 606
              |||| |||||||||||||| ||||||||||| || |||||||| |||||||||||||| |
Sbjct: 175948 ggacaatggagagcttggccaggatgatggccccacggatggcggtggccacctccttgg 176007

                                          
Query: 607    cgcacttgacgccgagcccgacgtggcc 634
               |||||| || || || |||||||||||
Sbjct: 176008 agcacttaacacccaggccgacgtggcc 176035

---

>ref|XM_215498.3| PREDICTED: Rattus norvegicus similar to Hypothetical protein FLJ25422
            (predicted) (LOC294789), mRNA
          Length = 3773

 Score =  125 bits (63), Expect = 2e-25
 Identities = 114/131 (87%)
 Strand = Plus / Plus

                                                                        
Query: 483  gtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctg 542
            ||||||||||| ||||| ||||||||| |||| |||||||||||||||||||| ||||  
Sbjct: 1616 gtgaccttgcatggcacagtgtggggcttgccaatcttgttcccccagtagcctctccgc 1675

                                                                        
Query: 543  acggggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctcc 602
            || |||||||| || |||||||| ||||||||||| || |||||||| ||||| ||||||
Sbjct: 1676 actgggacgatcgaaagcttggccaggatgatggcccctcggatggcagtggctacctcc 1735

                       
Query: 603  tttgcgcactt 613
            || | ||||||
Sbjct: 1736 ttggagcactt 1746

---

>emb|AL137072.8| Human DNA sequence from clone RP11-29B11 on chromosome 9 Contains the 5'
              end of the TXNDC4 gene for thioredoxin domain containing 4
              (endoplasmic reticulum) (ERP44, ERp44,KIAA0573), the 5' end
              of the INVS gene for inversin, a ribosomal protein S2
              (RPS2) pseudogene, a novel pseudogene and two CpG islands,
              complete sequence
          Length = 172830

 Score =  123 bits (62), Expect = 8e-25
 Identities = 146/174 (83%)
 Strand = Plus / Plus

                                                                          
Query: 465    acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
              |||||||||||   ||| || |||||||| || |||||||||||| ||||||||||||||
Sbjct: 109204 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgccgatcttgttc 109263

                                                                          
Query: 525    ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
              ||||||||||| ||    |||||||| |||||||||||||| |||||||||||    |||
Sbjct: 109264 ccccagtagcctctgtgcacggggacaatggagagcttggccaggatgatggccttacgg 109323

                                                                    
Query: 585    atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggccgttg 638
              ||||  |||||||| ||||| | |||||| || || || |||||||||||||||
Sbjct: 109324 atggtggtggccacttccttggagcacttaacacccagaccgacgtggccgttg 109377

---

>ref|XM_945419.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
           variant 6 (LOC650149), mRNA
          Length = 823

 Score =  123 bits (62), Expect = 8e-25
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || |||||||||||| ||| ||||||||||
Sbjct: 466 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgctgatcttgttc 407

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  |||||||| || ||||||||||| ||||||||||| || |||
Sbjct: 406 ccccagtagcctctgcgcacggggacaatagagagcttggccaggatgatggccccacgg 347

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| ||||||||| | || | |||||| || || || |||||||||||
Sbjct: 346 atggcggtggccaccactttggagcacttaacacccagaccgacgtggcc 297

---

>ref|XM_945418.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
            variant 5 (LOC650149), mRNA
          Length = 1547

 Score =  123 bits (62), Expect = 8e-25
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                        
Query: 465  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
            |||||||||||   ||| || |||||||| || |||||||||||| ||| ||||||||||
Sbjct: 1187 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgctgatcttgttc 1128

                                                                        
Query: 525  ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
            ||||||||||| || |  |||||||| || ||||||||||| ||||||||||| || |||
Sbjct: 1127 ccccagtagcctctgcgcacggggacaatagagagcttggccaggatgatggccccacgg 1068

                                                              
Query: 585  atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
            ||||| ||||||||| | || | |||||| || || || |||||||||||
Sbjct: 1067 atggcggtggccaccactttggagcacttaacacccagaccgacgtggcc 1018

---

>ref|XM_945417.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
            variant 4 (LOC650149), mRNA
          Length = 1536

 Score =  123 bits (62), Expect = 8e-25
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                        
Query: 465  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
            |||||||||||   ||| || |||||||| || |||||||||||| ||| ||||||||||
Sbjct: 1187 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgctgatcttgttc 1128

                                                                        
Query: 525  ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
            ||||||||||| || |  |||||||| || ||||||||||| ||||||||||| || |||
Sbjct: 1127 ccccagtagcctctgcgcacggggacaatagagagcttggccaggatgatggccccacgg 1068

                                                              
Query: 585  atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
            ||||| ||||||||| | || | |||||| || || || |||||||||||
Sbjct: 1067 atggcggtggccaccactttggagcacttaacacccagaccgacgtggcc 1018

---

>ref|XM_945415.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
            variant 3 (LOC650149), mRNA
          Length = 1548

 Score =  123 bits (62), Expect = 8e-25
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                        
Query: 465  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
            |||||||||||   ||| || |||||||| || |||||||||||| ||| ||||||||||
Sbjct: 1187 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgctgatcttgttc 1128

                                                                        
Query: 525  ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
            ||||||||||| || |  |||||||| || ||||||||||| ||||||||||| || |||
Sbjct: 1127 ccccagtagcctctgcgcacggggacaatagagagcttggccaggatgatggccccacgg 1068

                                                              
Query: 585  atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
            ||||| ||||||||| | || | |||||| || || || |||||||||||
Sbjct: 1067 atggcggtggccaccactttggagcacttaacacccagaccgacgtggcc 1018

---

>ref|XM_941738.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
            variant 1 (LOC650149), mRNA
          Length = 1548

 Score =  123 bits (62), Expect = 8e-25
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                        
Query: 465  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
            |||||||||||   ||| || |||||||| || |||||||||||| ||| ||||||||||
Sbjct: 1187 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgctgatcttgttc 1128

                                                                        
Query: 525  ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
            ||||||||||| || |  |||||||| || ||||||||||| ||||||||||| || |||
Sbjct: 1127 ccccagtagcctctgcgcacggggacaatagagagcttggccaggatgatggccccacgg 1068

                                                              
Query: 585  atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
            ||||| ||||||||| | || | |||||| || || || |||||||||||
Sbjct: 1067 atggcggtggccaccactttggagcacttaacacccagaccgacgtggcc 1018

---

>ref|XM_934189.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
            variant 7 (LOC91561), mRNA
          Length = 1549

 Score =  123 bits (62), Expect = 8e-25
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                        
Query: 465  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
            |||||||||||   ||| || |||||||| || |||||||||||| ||| ||||||||||
Sbjct: 1188 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgctgatcttgttc 1129

                                                                        
Query: 525  ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
            ||||||||||| || |  |||||||| || ||||||||||| ||||||||||| || |||
Sbjct: 1128 ccccagtagcctctgcgcacggggacaatagagagcttggccaggatgatggccccacgg 1069

                                                              
Query: 585  atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
            ||||| ||||||||| | || | |||||| || || || |||||||||||
Sbjct: 1068 atggcggtggccaccactttggagcacttaacacccagaccgacgtggcc 1019

---

>ref|XM_934185.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
            variant 6 (LOC91561), mRNA
          Length = 1537

 Score =  123 bits (62), Expect = 8e-25
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                        
Query: 465  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
            |||||||||||   ||| || |||||||| || |||||||||||| ||| ||||||||||
Sbjct: 1188 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgctgatcttgttc 1129

                                                                        
Query: 525  ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
            ||||||||||| || |  |||||||| || ||||||||||| ||||||||||| || |||
Sbjct: 1128 ccccagtagcctctgcgcacggggacaatagagagcttggccaggatgatggccccacgg 1069

                                                              
Query: 585  atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
            ||||| ||||||||| | || | |||||| || || || |||||||||||
Sbjct: 1068 atggcggtggccaccactttggagcacttaacacccagaccgacgtggcc 1019

---

>ref|XM_934183.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
            variant 5 (LOC91561), mRNA
          Length = 1548

 Score =  123 bits (62), Expect = 8e-25
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                        
Query: 465  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
            |||||||||||   ||| || |||||||| || |||||||||||| ||| ||||||||||
Sbjct: 1188 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgctgatcttgttc 1129

                                                                        
Query: 525  ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
            ||||||||||| || |  |||||||| || ||||||||||| ||||||||||| || |||
Sbjct: 1128 ccccagtagcctctgcgcacggggacaatagagagcttggccaggatgatggccccacgg 1069

                                                              
Query: 585  atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
            ||||| ||||||||| | || | |||||| || || || |||||||||||
Sbjct: 1068 atggcggtggccaccactttggagcacttaacacccagaccgacgtggcc 1019

---

>ref|XM_934180.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
            variant 4 (LOC91561), mRNA
          Length = 1558

 Score =  123 bits (62), Expect = 8e-25
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                        
Query: 465  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
            |||||||||||   ||| || |||||||| || |||||||||||| ||| ||||||||||
Sbjct: 1188 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgctgatcttgttc 1129

                                                                        
Query: 525  ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
            ||||||||||| || |  |||||||| || ||||||||||| ||||||||||| || |||
Sbjct: 1128 ccccagtagcctctgcgcacggggacaatagagagcttggccaggatgatggccccacgg 1069

                                                              
Query: 585  atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
            ||||| ||||||||| | || | |||||| || || || |||||||||||
Sbjct: 1068 atggcggtggccaccactttggagcacttaacacccagaccgacgtggcc 1019

---

>ref|XM_934176.1| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
           variant 3 (LOC91561), mRNA
          Length = 839

 Score =  123 bits (62), Expect = 8e-25
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || |||||||||||| ||| ||||||||||
Sbjct: 482 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgctgatcttgttc 423

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  |||||||| || ||||||||||| ||||||||||| || |||
Sbjct: 422 ccccagtagcctctgcgcacggggacaatagagagcttggccaggatgatggccccacgg 363

                                                             
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
           ||||| ||||||||| | || | |||||| || || || |||||||||||
Sbjct: 362 atggcggtggccaccactttggagcacttaacacccagaccgacgtggcc 313

---

>ref|XM_039218.13| PREDICTED: Homo sapiens similar to ribosomal protein S2, transcript
            variant 1 (LOC91561), mRNA
          Length = 1549

 Score =  123 bits (62), Expect = 8e-25
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                        
Query: 465  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
            |||||||||||   ||| || |||||||| || |||||||||||| ||| ||||||||||
Sbjct: 1188 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgctgatcttgttc 1129

                                                                        
Query: 525  ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
            ||||||||||| || |  |||||||| || ||||||||||| ||||||||||| || |||
Sbjct: 1128 ccccagtagcctctgcgcacggggacaatagagagcttggccaggatgatggccccacgg 1069

                                                              
Query: 585  atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
            ||||| ||||||||| | || | |||||| || || || |||||||||||
Sbjct: 1068 atggcggtggccaccactttggagcacttaacacccagaccgacgtggcc 1019

---

>gb|AC107956.8| Homo sapiens chromosome 11, clone RP11-452G18, complete sequence
          Length = 188571

 Score =  123 bits (62), Expect = 8e-25
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                         
Query: 465   acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
             |||||||||||   ||| || |||||||| || |||||||||||| ||| ||||||||||
Sbjct: 58718 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggcttgctgatcttgttc 58659

                                                                         
Query: 525   ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
             ||||||||||| || |  |||||||| || ||||||||||| ||||||||||| || |||
Sbjct: 58658 ccccagtagcctctgcgcacggggacaatagagagcttggccaggatgatggccccacgg 58599

                                                               
Query: 585   atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggcc 634
             ||||| ||||||||| | || | |||||| || || || |||||||||||
Sbjct: 58598 atggcggtggccaccactttggagcacttaacacccagaccgacgtggcc 58549

---

>gb|BC098726.1| Rattus norvegicus ribosomal protein S2, mRNA (cDNA clone MGC:112718
           IMAGE:7378399), complete cds
          Length = 949

 Score =  121 bits (61), Expect = 3e-24
 Identities = 127/149 (85%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| ||||| ||||||||| |||| |||||||||||||||||||| ||||  || 
Sbjct: 554 accttgcatggcacagtgtggggcttgccaatcttgttcccccagtagcctctccgcact 495

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           |||||||| || |||||||| ||||||||||| || |||||||| ||||| |||||||| 
Sbjct: 494 gggacgatcgaaagcttggccaggatgatggcccctcggatggcagtggctacctccttg 435

                                        
Query: 606 gcgcacttgacgccgagcccgacgtggcc 634
           | |||||| || || || || ||||||||
Sbjct: 434 gagcacttaacaccaagaccaacgtggcc 406

---

>ref|XM_527688.1| PREDICTED: Pan troglodytes similar to MGC27348 protein (LOC472313),
           mRNA
          Length = 555

 Score =  121 bits (61), Expect = 3e-24
 Identities = 127/149 (85%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || ||||||||| || ||||||||||||||
Sbjct: 390 acagagccgcagcggcctgtcaccttgcaagggacggtgtggagcttgccgatcttgttc 331

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  |||| ||| |||||||||||||  ||||||||||| ||||||
Sbjct: 330 ccccagtagcctctgcgcacggtgacaatggagagcttggtcaggatgatggccccgcgg 271

                                        
Query: 585 atggccgtggccacctcctttgcgcactt 613
           ||||| | |||||||||||| | ||||||
Sbjct: 270 atggcggcggccacctccttggagcactt 242

---

>ref|XM_527393.1| PREDICTED: Pan troglodytes similar to exportin 5 (LOC472014), mRNA
          Length = 4215

 Score =  121 bits (61), Expect = 3e-24
 Identities = 127/149 (85%)
 Strand = Plus / Minus

                                                                        
Query: 486  accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
            |||||||| || | |||||||||| | |||||||||||||||||| |||| ||    |||
Sbjct: 2849 accttgcaagggatggtgtggggcttcccgatcttgttcccccagcagcctctgtgcacg 2790

                                                                        
Query: 546  gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
            ||||| |||||||||||||| ||||||||||| || |||||||| |||||||||||||| 
Sbjct: 2789 gggacaatggagagcttggccaggatgatggccccacggatggcggtggccacctccttg 2730

                                         
Query: 606  gcgcacttgacgccgagcccgacgtggcc 634
            | |||||| || || || |||||||||||
Sbjct: 2729 gagcacttaacacccagaccgacgtggcc 2701

---

>ref|NM_031838.3| Rattus norvegicus ribosomal protein S2 (Rps2), mRNA
          Length = 952

 Score =  121 bits (61), Expect = 3e-24
 Identities = 127/149 (85%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| ||||| ||||||||| |||| |||||||||||||||||||| ||||  || 
Sbjct: 565 accttgcatggcacagtgtggggcttgccaatcttgttcccccagtagcctctccgcact 506

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           |||||||| || |||||||| ||||||||||| || |||||||| ||||| |||||||| 
Sbjct: 505 gggacgatcgaaagcttggccaggatgatggcccctcggatggcagtggctacctccttg 446

                                        
Query: 606 gcgcacttgacgccgagcccgacgtggcc 634
           | |||||| || || || || ||||||||
Sbjct: 445 gagcacttaacaccaagaccaacgtggcc 417

---

>gb|AC023105.7| Homo sapiens BAC clone GS1-13M19 from 7, complete sequence
          Length = 70876

 Score =  121 bits (61), Expect = 3e-24
 Identities = 127/149 (85%)
 Strand = Plus / Minus

                                                                        
Query: 465  acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
            |||||||||||   ||| || |||||||| || ||||||||| || ||||||||||||||
Sbjct: 2986 acagagccgcagcggcctgtcaccttgcaagggacggtgtggagcttgccgatcttgttc 2927

                                                                        
Query: 525  ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
            ||||||||||| || |  |||| ||| |||||||||||||  ||||||||||| ||||||
Sbjct: 2926 ccccagtagcctctgcgcacggtgacaatggagagcttggtcaggatgatggccccgcgg 2867

                                         
Query: 585  atggccgtggccacctcctttgcgcactt 613
            ||||| | |||||||||||| | ||||||
Sbjct: 2866 atggcggcggccacctccttggagcactt 2838

---

>emb|AL592295.25| Human DNA sequence from clone RP11-122G18 on chromosome 1 Contains the 3'
              end of a novel gene, the MPZ gene for myelin protein zero
              (Charcot-Marie-Tooth neuropathy 1B), the SDHC gene for
              succinate dehydrogenase complex subunit C  integral
              membrane protein 15kDa, the gene for a novel protein, a
              novel gene, a pseudogene similar to part of ribonucleotide
              reductase M2 polypeptide (RRM2), a ribosomal protein S2
              (RPS2) pseudogene and two CpG islands, complete sequence
          Length = 162189

 Score =  121 bits (61), Expect = 3e-24
 Identities = 127/149 (85%)
 Strand = Plus / Minus

                                                                          
Query: 486    accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
              |||||||| || |||||||||||| ||| ||||||||| ||||||||||| || |  |||
Sbjct: 130424 accttgcaagggacggtgtggggcttgctgatcttgttaccccagtagcctctgcgcacg 130365

                                                                          
Query: 546    gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
              ||||| |||||||||||||| ||||||||||| || ||| |||| |||||||||||||| 
Sbjct: 130364 gggacaatggagagcttggccaggatgatggccccacgggtggcggtggccacctccttg 130305

                                           
Query: 606    gcgcacttgacgccgagcccgacgtggcc 634
              | |||||| || || || || ||||||||
Sbjct: 130304 gagcacttaacacccagaccaacgtggcc 130276

---

>emb|X57432.1|RRRPS2 R.rattus mRNA for ribosomal protein S2
          Length = 922

 Score =  121 bits (61), Expect = 3e-24
 Identities = 127/149 (85%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| ||||| ||||||||| |||| |||||||||||||||||||| ||||  || 
Sbjct: 575 accttgcatggcacagtgtggggcttgccaatcttgttcccccagtagcctctccgcact 516

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           |||||||| || |||||||| ||||||||||| || |||||||| ||||| |||||||| 
Sbjct: 515 gggacgatcgaaagcttggccaggatgatggcccctcggatggcagtggctacctccttg 456

                                        
Query: 606 gcgcacttgacgccgagcccgacgtggcc 634
           | |||||| || || || || ||||||||
Sbjct: 455 gagcacttaacaccaagaccaacgtggcc 427

---

>gb|BC026177.1| Homo sapiens ribosomal protein S2 pseudogene, mRNA (cDNA clone
           MGC:27348 IMAGE:4671259), complete cds
          Length = 862

 Score =  121 bits (61), Expect = 3e-24
 Identities = 127/149 (85%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || ||||||||| || ||||||||||||||
Sbjct: 471 acagagccgcagcggcctgtcaccttgcaagggacggtgtggagcttgccgatcttgttc 412

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  |||| ||| |||||||||||||  ||||||||||| ||||||
Sbjct: 411 ccccagtagcctctgcgcacggtgacaatggagagcttggtcaggatgatggccccgcgg 352

                                        
Query: 585 atggccgtggccacctcctttgcgcactt 613
           ||||| | |||||||||||| | ||||||
Sbjct: 351 atggcggcggccacctccttggagcactt 323

---

>ref|XM_937623.1| PREDICTED: Homo sapiens similar to ribosomal protein S2; 40S
           ribosomal protein S2 (MGC27348), mRNA
          Length = 947

 Score =  121 bits (61), Expect = 3e-24
 Identities = 127/149 (85%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || ||||||||| || ||||||||||||||
Sbjct: 573 acagagccgcagcggcctgtcaccttgcaagggacggtgtggagcttgccgatcttgttc 514

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  |||| ||| |||||||||||||  ||||||||||| ||||||
Sbjct: 513 ccccagtagcctctgcgcacggtgacaatggagagcttggtcaggatgatggccccgcgg 454

                                        
Query: 585 atggccgtggccacctcctttgcgcactt 613
           ||||| | |||||||||||| | ||||||
Sbjct: 453 atggcggcggccacctccttggagcactt 425

---

>ref|XM_499270.2| PREDICTED: Homo sapiens similar to ribosomal protein S2; 40S
           ribosomal protein S2 (MGC27348), mRNA
          Length = 946

 Score =  121 bits (61), Expect = 3e-24
 Identities = 127/149 (85%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || ||||||||| || ||||||||||||||
Sbjct: 573 acagagccgcagcggcctgtcaccttgcaagggacggtgtggagcttgccgatcttgttc 514

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  |||| ||| |||||||||||||  ||||||||||| ||||||
Sbjct: 513 ccccagtagcctctgcgcacggtgacaatggagagcttggtcaggatgatggccccgcgg 454

                                        
Query: 585 atggccgtggccacctcctttgcgcactt 613
           ||||| | |||||||||||| | ||||||
Sbjct: 453 atggcggcggccacctccttggagcactt 425

---

>ref|XM_171158.5| PREDICTED: Homo sapiens similar to ribosomal protein S2; 40S
           ribosomal protein S2 (MGC27348), mRNA
          Length = 946

 Score =  121 bits (61), Expect = 3e-24
 Identities = 127/149 (85%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || ||||||||| || ||||||||||||||
Sbjct: 573 acagagccgcagcggcctgtcaccttgcaagggacggtgtggagcttgccgatcttgttc 514

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| || |  |||| ||| |||||||||||||  ||||||||||| ||||||
Sbjct: 513 ccccagtagcctctgcgcacggtgacaatggagagcttggtcaggatgatggccccgcgg 454

                                        
Query: 585 atggccgtggccacctcctttgcgcactt 613
           ||||| | |||||||||||| | ||||||
Sbjct: 453 atggcggcggccacctccttggagcactt 425

---

>gb|U92700.1|RNU92700 Rattus norvegicus ribosomal protein S2 mRNA, complete cds
          Length = 766

 Score =  121 bits (61), Expect = 3e-24
 Identities = 127/149 (85%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| ||||| ||||||||| |||| |||||||||||||||||||| ||||  || 
Sbjct: 430 accttgcatggcacagtgtggggcttgccaatcttgttcccccagtagcctctccgcact 371

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           |||||||| || |||||||| ||||||||||| || |||||||| ||||| |||||||| 
Sbjct: 370 gggacgatcgaaagcttggccaggatgatggcccctcggatggcagtggctacctccttg 311

                                        
Query: 606 gcgcacttgacgccgagcccgacgtggcc 634
           | |||||| || || || || ||||||||
Sbjct: 310 gagcacttaacaccaagaccaacgtggcc 282

---

>gb|U92696.1|RNU92696 Rattus norvegicus ribosomal protein S2 mRNA, complete cds
          Length = 794

 Score =  121 bits (61), Expect = 3e-24
 Identities = 127/149 (85%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| ||||| ||||||||| |||| |||||||||||||||||||| ||||  || 
Sbjct: 458 accttgcatggcacagtgtggggcttgccaatcttgttcccccagtagcctctccgcact 399

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           |||||||| || |||||||| ||||||||||| || |||||||| ||||| |||||||| 
Sbjct: 398 gggacgatcgaaagcttggccaggatgatggcccctcggatggcagtggctacctccttg 339

                                        
Query: 606 gcgcacttgacgccgagcccgacgtggcc 634
           | |||||| || || || || ||||||||
Sbjct: 338 gagcacttaacaccaagaccaacgtggcc 310

---

>gb|AY130361.1| Petromyzon marinus ribosomal protein S2 mRNA, partial cds
          Length = 604

 Score =  119 bits (60), Expect = 1e-23
 Identities = 132/156 (84%)
 Strand = Plus / Minus

                                                                       
Query: 483 gtgaccttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctg 542
           |||||||||||||| |||||||| ||  |||  |||||||| ||||||||||| |  |  
Sbjct: 360 gtgaccttgcagggtacggtgtgcggtttgctaatcttgttaccccagtagccacggcgc 301

                                                                       
Query: 543 acggggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctcc 602
           || || ||||||||||| ||||||||||| ||||||||||||||||| || |||||||||
Sbjct: 300 accggcacgatggagagtttggcgaggataatggcgccgcggatggcggtcgccacctcc 241

                                               
Query: 603 tttgcgcacttgacgccgagcccgacgtggccgttg 638
           || | |||||| |||||||| |||| ||| ||||||
Sbjct: 240 ttggagcacttcacgccgagaccgatgtgtccgttg 205

---

>gb|AC098590.3| Homo sapiens BAC clone RP11-324J13 from 4, complete sequence
          Length = 157544

 Score =  119 bits (60), Expect = 1e-23
 Identities = 111/128 (86%)
 Strand = Plus / Plus

                                                                         
Query: 486   accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
             |||||||| || |||||||||||| ||| ||||||||||||||||||| | || |  |||
Sbjct: 22578 accttgcaagggacggtgtggggcttgctgatcttgttcccccagtaggctctgcgcacg 22637

                                                                         
Query: 546   gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
             ||||| |||||||||||||| |||||| |||| || |||||||| |||||||||||||| 
Sbjct: 22638 gggacaatggagagcttggccaggatggtggccccacggatggcggtggccacctccttg 22697

                     
Query: 606   gcgcactt 613
             | ||||||
Sbjct: 22698 gagcactt 22705

---

>gb|U92698.1|RNU92698 Rattus norvegicus ribosomal protein S2 mRNA, complete cds
          Length = 819

 Score =  119 bits (60), Expect = 1e-23
 Identities = 111/128 (86%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| ||||| ||||||||| |||| |||||||||||||||||||| ||||  || 
Sbjct: 483 accttgcatggcacagtgtggggcttgccaatcttgttcccccagtagcctctccgcact 424

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           |||||||| || |||||||| ||||||||||| || |||||||| ||||| |||||||| 
Sbjct: 423 gggacgatcgaaagcttggccaggatgatggcccctcggatggcagtggctacctccttg 364

                   
Query: 606 gcgcactt 613
           | ||||||
Sbjct: 363 gagcactt 356

---

>ref|XR_003696.1| PREDICTED: Mus musculus hypothetical LOC620877 (LOC620877), mRNA
          Length = 962

 Score =  117 bits (59), Expect = 5e-23
 Identities = 104/119 (87%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || || ||||||||| |||| |||||||||||||||||||| ||||  |||
Sbjct: 570 accttgcatggaacagtgtggggcttgccaatcttgttcccccagtagcctctccacacg 511

                                                                      
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctcctt 604
           ||||||||||| |||||||| | ||||||||| || |||||||| ||||| ||||||||
Sbjct: 510 gggacgatggaaagcttggctaagatgatggcccctcggatggcagtggcaacctcctt 452

---

>gb|AC129342.5| Rattus norvegicus  BAC CH230-229B21 (Children's Hospital Oakland
             Research Institute Rat (BN/SsNHsd/MCW) BAC library)
             complete sequence
          Length = 224257

 Score =  117 bits (59), Expect = 5e-23
 Identities = 104/119 (87%)
 Strand = Plus / Minus

                                                                         
Query: 486   accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
             |||||||| ||||| ||||||||| |||| |||||||||||||||||||| ||||  || 
Sbjct: 17215 accttgcatggcacagtgtggggcttgccaatcttgttcccccagtagcctctccgcact 17156

                                                                        
Query: 546   gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctcctt 604
             |||||||| || |||||||| ||||||||||| || |||||||| ||||| ||||||||
Sbjct: 17155 gggacgatcgaaagcttggccaggatgatggcccctcggatggcagtggctacctcctt 17097

---

>gb|U92699.1|RNU92699 Rattus norvegicus ribosomal protein S2 mRNA, complete cds
          Length = 793

 Score =  117 bits (59), Expect = 5e-23
 Identities = 104/119 (87%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| ||||| ||||||||| |||| |||||||||||||||||||| ||||  || 
Sbjct: 457 accttgcatggcacagtgtggggcttgccaatcttgttcccccagtagcctctccgcact 398

                                                                      
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctcctt 604
           |||||||| || |||||||| ||||||||||| || |||||||| ||||| ||||||||
Sbjct: 397 gggacgatcgaaagcttggccaggatgatggcccctcggatggcagtggctacctcctt 339

---

>emb|AL607129.16| Mouse DNA sequence from clone RP23-120H2 on chromosome 4, complete
            sequence
          Length = 76465

 Score =  117 bits (59), Expect = 5e-23
 Identities = 104/119 (87%)
 Strand = Plus / Minus

                                                                        
Query: 486  accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
            |||||||| || || ||||||||| |||| |||||||||||||||||||| ||||  |||
Sbjct: 3856 accttgcatggaacagtgtggggcttgccaatcttgttcccccagtagcctctccacacg 3797

                                                                       
Query: 546  gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctcctt 604
            ||||||||||| |||||||| | ||||||||| || |||||||| ||||| ||||||||
Sbjct: 3796 gggacgatggaaagcttggctaagatgatggcccctcggatggcagtggcaacctcctt 3738

---

>ref|XM_520152.1| PREDICTED: Pan troglodytes similar to ribosomal protein S2; 40S
           ribosomal protein S2 (LOC464617), mRNA
          Length = 774

 Score =  115 bits (58), Expect = 2e-22
 Identities = 145/174 (83%)
 Strand = Plus / Minus

                                                                       
Query: 465 acagagccgcacttgccggtgaccttgcagggcacggtgtggggcatgccgatcttgttc 524
           |||||||||||   ||| || |||||||| || |||||||||||  ||||||||||||||
Sbjct: 452 acagagccgcagcggcctgtcaccttgcaagggacggtgtggggtttgccgatcttgttc 393

                                                                       
Query: 525 ccccagtagcccctcctgacggggacgatggagagcttggcgaggatgatggcgccgcgg 584
           ||||||||||| ||    |||||||| |||||||||||||| |||||||||||    |||
Sbjct: 392 ccccagtagcctctgtgcacggggacaatggagagcttggccaggatgatggccttacgg 333

                                                                 
Query: 585 atggccgtggccacctcctttgcgcacttgacgccgagcccgacgtggccgttg 638
           ||||  |||||||| ||||| | |||||| || || || |||||||||||||||
Sbjct: 332 atggtggtggccacttccttggagcacttaacacccagaccgacgtggccgttg 279

---

>ref|XM_532470.2| PREDICTED: Canis familiaris hypothetical LOC475237 (LOC475237),
           mRNA
          Length = 848

 Score =  115 bits (58), Expect = 2e-22
 Identities = 112/130 (86%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || || ||||||||| ||||||||||||||||||||||||| |  |  || 
Sbjct: 465 accttgcatgggacagtgtggggcttgccgatcttgttcccccagtagcctcgtcgcaca 406

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||||||||| |||||||| ||||||||||| || |||||||| ||||| |||||||| 
Sbjct: 405 gggacgatggaaagcttggccaggatgatggccccacggatggcagtggctacctccttg 346

                     
Query: 606 gcgcacttga 615
           | ||||||||
Sbjct: 345 gagcacttga 336

---

>ref|XM_537709.2| PREDICTED: Canis familiaris similar to 40S ribosomal protein S2
           (LOC480589), mRNA
          Length = 871

 Score =  115 bits (58), Expect = 2e-22
 Identities = 112/130 (86%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || || ||||||||  ||||||||||||||||||||||||| | ||  || 
Sbjct: 491 accttgcatgggacagtgtggggtttgccgatcttgttcccccagtagcctcgccgaacc 432

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||||||||| |||||||| ||||||||||| || |||||||| ||||| |||||||| 
Sbjct: 431 gggacgatggaaagcttggccaggatgatggccccacggatggcagtggctacctccttg 372

                     
Query: 606 gcgcacttga 615
           | ||||||||
Sbjct: 371 gagcacttga 362

---

>emb|CR707364.2|CNS0G8R4 Tetraodon nigroviridis full-length cDNA
          Length = 901

 Score =  113 bits (57), Expect = 7e-22
 Identities = 129/153 (84%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           ||||||||||| |||||||||||  ||||||||||||| ||||| || ||||||| ||| 
Sbjct: 535 accttgcagggtacggtgtggggtttgccgatcttgttaccccaataacccctccggaca 476

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||| ||||| |||||||| |||||||| || || |||||||| ||||||||||| || 
Sbjct: 475 gggacaatggacagcttggcaaggatgatcgccccacggatggctgtggccacctctttg 416

                                            
Query: 606 gcgcacttgacgccgagcccgacgtggccgttg 638
           | |||||| || || || || ||||| ||||||
Sbjct: 415 gagcacttcactcccaggcccacgtgaccgttg 383



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 228 gtgaactcctggtacggagtcttggtgaaggtcgtctccctccagaagtcaggggt 283
           |||||||||||||| |||| ||| ||||||   |||||| |||| | |||||||||
Sbjct: 793 gtgaactcctggtagggagactttgtgaagactgtctccttccacaggtcaggggt 738

---

>emb|CR675272.2|CNS0FK0E Tetraodon nigroviridis full-length cDNA
          Length = 883

 Score =  113 bits (57), Expect = 7e-22
 Identities = 129/153 (84%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           ||||||||||| |||||||| ||  ||||||||||||| ||||| || ||||||| ||| 
Sbjct: 512 accttgcagggtacggtgtgaggtttgccgatcttgttaccccaataacccctccggaca 453

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||| ||||| ||||||||||||||||| || || |||||||| ||||||||||| || 
Sbjct: 452 gggacaatggacagcttggcgaggatgatcgccccacggatggctgtggccacctctttg 393

                                            
Query: 606 gcgcacttgacgccgagcccgacgtggccgttg 638
           | |||||| || || || || ||||| ||||||
Sbjct: 392 gagcacttcactcccagacccacgtgaccgttg 360



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 228 gtgaactcctggtacggagtcttggtgaaggtcgtctccctccagaagtcaggggt 283
           |||||||||||||| |||| ||| ||||||   |||||| |||| | |||||||||
Sbjct: 770 gtgaactcctggtagggagactttgtgaagactgtctccttccacaggtcaggggt 715

---

>emb|CR674020.2|CNS0FJ1M Tetraodon nigroviridis full-length cDNA
          Length = 874

 Score =  113 bits (57), Expect = 7e-22
 Identities = 129/153 (84%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           ||||||||||| |||||||| ||  ||||||||||||| ||||| || ||||||| ||| 
Sbjct: 511 accttgcagggtacggtgtgaggtttgccgatcttgttaccccaataacccctccggaca 452

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||||||||| |||||||| |||||||| || || |||||||| ||||||||||| || 
Sbjct: 451 gggacgatggacagcttggcaaggatgatcgccccacggatggctgtggccacctctttg 392

                                            
Query: 606 gcgcacttgacgccgagcccgacgtggccgttg 638
           | |||||| || || || || ||||| ||||||
Sbjct: 391 gagcacttcactcccagacccacgtgaccgttg 359



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 228 gtgaactcctggtacggagtcttggtgaaggtcgtctccctccagaagtcaggggt 283
           |||||||||||||| |||| ||| ||||||   |||||| |||| | |||||||||
Sbjct: 769 gtgaactcctggtagggagactttgtgaagactgtctccttccacaggtcaggggt 714

---

>gb|U92697.1|RNU92697 Rattus norvegicus ribosomal protein S2 mRNA, complete cds
          Length = 817

 Score =  113 bits (57), Expect = 7e-22
 Identities = 126/149 (84%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| ||||| ||||||||| |||| |||||||||||||||||||| ||||  || 
Sbjct: 481 accttgcatggcacagtgtggggcttgccaatcttgttcccccagtagcctctccacact 422

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           |||||| | || |||||||| ||||||||||| || |||||||| ||||| |||||||| 
Sbjct: 421 gggacggtcgaaagcttggccaggatgatggcccctcggatggcagtggctacctccttg 362

                                        
Query: 606 gcgcacttgacgccgagcccgacgtggcc 634
           | |||||| || || || || ||||||||
Sbjct: 361 gagcacttaacaccaagaccaacgtggcc 333

---

>gb|BC106136.1| Mus musculus ribosomal protein S2, mRNA (cDNA clone MGC:118037
           IMAGE:3676057), complete cds
          Length = 1006

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || || ||||||||| |||| |||||||||||||||||||| ||||  || 
Sbjct: 554 accttgcatggaacagtgtggggcttgccaatcttgttcccccagtagcctctccgcaca 495

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||||||||| |||||||| | ||||||||| || |||||||| ||||| |||||||| 
Sbjct: 494 gggacgatggaaagcttggccaagatgatggcccctcggatggcagtggcaacctccttg 435

                   
Query: 606 gcgcactt 613
           | ||||||
Sbjct: 434 gagcactt 427

---

>gb|AC154566.2| Mus musculus BAC clone RP23-407A17 from chromosome 17, complete
             sequence
          Length = 204306

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Plus

                                                                         
Query: 486   accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
             |||||||| || || ||||||||| |||| |||||||||||||||||||| ||||  || 
Sbjct: 41977 accttgcatggaacagtgtggggcttgccaatcttgttcccccagtagcctctccgcaca 42036

                                                                         
Query: 546   gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
             ||||||||||| |||||||| | ||||||||| || |||||||| ||||| |||||||| 
Sbjct: 42037 gggacgatggaaagcttggccaagatgatggcccctcggatggcagtggcaacctccttg 42096

                     
Query: 606   gcgcactt 613
             | ||||||
Sbjct: 42097 gagcactt 42104

---

>gb|AC140426.3| Mus musculus BAC clone RP24-98A17 from chromosome 14, complete sequence
          Length = 189282

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                          
Query: 486    accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
              |||||||| || || ||||||||| |||| |||||||||||||||||||| ||||  || 
Sbjct: 106982 accttgcatggaacagtgtggggcttgccaatcttgttcccccagtagcctctccgcaca 106923

                                                                          
Query: 546    gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
              ||||||||||| |||||||| | ||||||||| || |||||||| ||||| |||||||| 
Sbjct: 106922 gggacgatggaaagcttggccaagatgatggcccctcggatggcagtggcaacctccttg 106863

                      
Query: 606    gcgcactt 613
              | ||||||
Sbjct: 106862 gagcactt 106855

---

>gb|AC132345.4| Mus musculus BAC clone RP24-177P9 from chromosome 9, complete sequence
          Length = 183638

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Plus

                                                                         
Query: 486   accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
             |||||||| || || ||||||||| |||| |||||||||||||||||||| ||||  || 
Sbjct: 21669 accttgcatggaacagtgtggggcttgccaatcttgttcccccagtagcctctccgcaca 21728

                                                                         
Query: 546   gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
             ||||||||||| |||||||| | ||||||||| || |||||||| ||||| |||||||| 
Sbjct: 21729 gggacgatggaaagcttggccaagatgatggcccctcggatggcagtggcaacctccttg 21788

                     
Query: 606   gcgcactt 613
             | ||||||
Sbjct: 21789 gagcactt 21796

---

>ref|NM_008503.2| Mus musculus ribosomal protein S2 (Rps2), mRNA
          Length = 951

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || || ||||||||| |||| |||||||||||||||||||| ||||  || 
Sbjct: 580 accttgcatggaacagtgtggggcttgccaatcttgttcccccagtagcctctccgcaca 521

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||||||||| |||||||| | ||||||||| || |||||||| ||||| |||||||| 
Sbjct: 520 gggacgatggaaagcttggccaagatgatggcccctcggatggcagtggcaacctccttg 461

                   
Query: 606 gcgcactt 613
           | ||||||
Sbjct: 460 gagcactt 453

---

>ref|XM_989830.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S2
           (LOC671914), mRNA
          Length = 918

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || || ||||||||| |||| |||||||||||||||||||| ||||  || 
Sbjct: 551 accttgcatggaacagtgtggggcttgccaatcttgttcccccagtagcctctccgcaca 492

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||||||||| |||||||| | ||||||||| || |||||||| ||||| |||||||| 
Sbjct: 491 gggacgatggaaagcttggccaagatgatggcccctcggatggcagtggcaacctccttg 432

                   
Query: 606 gcgcactt 613
           | ||||||
Sbjct: 431 gagcactt 424

---

>ref|XM_994358.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S2
           (LOC676958), mRNA
          Length = 918

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || || ||||||||| |||| |||||||||||||||||||| ||||  || 
Sbjct: 551 accttgcatggaacagtgtggggcttgccaatcttgttcccccagtagcctctccgcaca 492

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||||||||| |||||||| | ||||||||| || |||||||| ||||| |||||||| 
Sbjct: 491 gggacgatggaaagcttggccaagatgatggcccctcggatggcagtggcaacctccttg 432

                   
Query: 606 gcgcactt 613
           | ||||||
Sbjct: 431 gagcactt 424

---

>ref|XM_985281.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S2
           (LOC666668), mRNA
          Length = 918

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || || ||||||||| |||| |||||||||||||||||||| ||||  || 
Sbjct: 551 accttgcatggaacagtgtggggcttgccaatcttgttcccccagtagcctctccgcaca 492

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||||||||| |||||||| | ||||||||| || |||||||| ||||| |||||||| 
Sbjct: 491 gggacgatggaaagcttggccaagatgatggcccctcggatggcagtggcaacctccttg 432

                   
Query: 606 gcgcactt 613
           | ||||||
Sbjct: 431 gagcactt 424

---

>ref|XM_001001275.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S2
           (LOC628962), mRNA
          Length = 969

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || || ||||||||| |||| |||||||||||||||||||| ||||  || 
Sbjct: 557 accttgcatggaacagtgtggggcttgccaatcttgttcccccagtagcctctccgcaca 498

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||||||||| |||||||| | ||||||||| || |||||||| ||||| |||||||| 
Sbjct: 497 gggacgatggaaagcttggccaagatgatggcccctcggatggcagtggcaacctccttg 438

                   
Query: 606 gcgcactt 613
           | ||||||
Sbjct: 437 gagcactt 430

---

>ref|XM_916654.2| PREDICTED: Mus musculus similar to 40S ribosomal protein S2,
           transcript variant 1 (LOC637606), mRNA
          Length = 970

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || || ||||||||| |||| |||||||||||||||||||| ||||  || 
Sbjct: 557 accttgcatggaacagtgtggggcttgccaatcttgttcccccagtagcctctccgcaca 498

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||||||||| |||||||| | ||||||||| || |||||||| ||||| |||||||| 
Sbjct: 497 gggacgatggaaagcttggccaagatgatggcccctcggatggcagtggcaacctccttg 438

                   
Query: 606 gcgcactt 613
           | ||||||
Sbjct: 437 gagcactt 430

---

>ref|XM_484395.4| PREDICTED: Mus musculus similar to 40S ribosomal protein S2,
           transcript variant 1 (LOC628962), mRNA
          Length = 969

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || || ||||||||| |||| |||||||||||||||||||| ||||  || 
Sbjct: 557 accttgcatggaacagtgtggggcttgccaatcttgttcccccagtagcctctccgcaca 498

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||||||||| |||||||| | ||||||||| || |||||||| ||||| |||||||| 
Sbjct: 497 gggacgatggaaagcttggccaagatgatggcccctcggatggcagtggcaacctccttg 438

                   
Query: 606 gcgcactt 613
           | ||||||
Sbjct: 437 gagcactt 430

---

>ref|XR_002630.1| PREDICTED: Mus musculus similar to ribosomal protein S2
           (LOC669682), mRNA
          Length = 1036

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || || ||||||||| |||| |||||||||||||||||||| ||||  || 
Sbjct: 625 accttgcatggaacagtgtggggcttgccaatcttgttcccccagtagcctctccgcaca 566

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||||||||| |||||||| | ||||||||| || |||||||| ||||| |||||||| 
Sbjct: 565 gggacgatggaaagcttggccaagatgatggcccctcggatggcagtggcaacctccttg 506

                   
Query: 606 gcgcactt 613
           | ||||||
Sbjct: 505 gagcactt 498

---

>ref|XR_002093.1| PREDICTED: Mus musculus hypothetical LOC634678 (LOC634678), mRNA
          Length = 972

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || || ||||||||| |||| |||||||||||||||||||| ||||  || 
Sbjct: 561 accttgcatggaacagtgtggggcttgccaatcttgttcccccagtagcctctccgcaca 502

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||||||||| |||||||| | ||||||||| || |||||||| ||||| |||||||| 
Sbjct: 501 gggacgatggaaagcttggccaagatgatggcccctcggatggcagtggcaacctccttg 442

                   
Query: 606 gcgcactt 613
           | ||||||
Sbjct: 441 gagcactt 434

---

>ref|XM_924178.2| PREDICTED: Mus musculus similar to 40S ribosomal protein S2,
           transcript variant 6 (LOC546164), mRNA
          Length = 764

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || || ||||||||| |||| |||||||||||||||||||| ||||  || 
Sbjct: 376 accttgcatggaacagtgtggggcttgccaatcttgttcccccagtagcctctccgcaca 317

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||||||||| |||||||| | ||||||||| || |||||||| ||||| |||||||| 
Sbjct: 316 gggacgatggaaagcttggccaagatgatggcccctcggatggcagtggcaacctccttg 257

                   
Query: 606 gcgcactt 613
           | ||||||
Sbjct: 256 gagcactt 249

---

>ref|XM_916251.2| PREDICTED: Mus musculus similar to 40S ribosomal protein S2,
           transcript variant 5 (LOC546164), mRNA
          Length = 966

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || || ||||||||| |||| |||||||||||||||||||| ||||  || 
Sbjct: 578 accttgcatggaacagtgtggggcttgccaatcttgttcccccagtagcctctccgcaca 519

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||||||||| |||||||| | ||||||||| || |||||||| ||||| |||||||| 
Sbjct: 518 gggacgatggaaagcttggccaagatgatggcccctcggatggcagtggcaacctccttg 459

                   
Query: 606 gcgcactt 613
           | ||||||
Sbjct: 458 gagcactt 451

---

>ref|XM_902930.2| PREDICTED: Mus musculus similar to 40S ribosomal protein S2,
           transcript variant 2 (LOC546164), mRNA
          Length = 764

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || || ||||||||| |||| |||||||||||||||||||| ||||  || 
Sbjct: 376 accttgcatggaacagtgtggggcttgccaatcttgttcccccagtagcctctccgcaca 317

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||||||||| |||||||| | ||||||||| || |||||||| ||||| |||||||| 
Sbjct: 316 gggacgatggaaagcttggccaagatgatggcccctcggatggcagtggcaacctccttg 257

                   
Query: 606 gcgcactt 613
           | ||||||
Sbjct: 256 gagcactt 249

---

>ref|XM_620794.3| PREDICTED: Mus musculus similar to 40S ribosomal protein S2,
           transcript variant 1 (LOC546164), mRNA
          Length = 966

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| || || ||||||||| |||| |||||||||||||||||||| ||||  || 
Sbjct: 578 accttgcatggaacagtgtggggcttgccaatcttgttcccccagtagcctctccgcaca 519

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           ||||||||||| |||||||| | ||||||||| || |||||||| ||||| |||||||| 
Sbjct: 518 gggacgatggaaagcttggccaagatgatggcccctcggatggcagtggcaacctccttg 459

                   
Query: 606 gcgcactt 613
           | ||||||
Sbjct: 458 gagcactt 451

---

>ref|XR_003219.1| PREDICTED: Mus musculus similar to ribosomal protein S2
           (LOC670968), mRNA
          Length = 953

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 486 accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
           |||||||| ||||| ||||||||| |||| |||||||||||||||||||| ||||  || 
Sbjct: 558 accttgcatggcacagtgtggggcttgccaatcttgttcccccagtagcctctccgcaca 499

                                                                       
Query: 546 gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
           | ||||||||| |||||||| | ||||||||| || |||||||| ||||| |||||||| 
Sbjct: 498 gagacgatggaaagcttggccaagatgatggcccctcggatggcagtggcaacctccttg 439

                   
Query: 606 gcgcactt 613
           | ||||||
Sbjct: 438 gagcactt 431

---

>gb|AC122252.4| Mus musculus BAC clone RP23-170E7 from chromosome 17, complete sequence
          Length = 219695

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Plus

                                                                         
Query: 486   accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
             |||||||| || || ||||||||| |||| |||||||||||||||||||| ||||  || 
Sbjct: 99516 accttgcatggaacagtgtggggcttgccaatcttgttcccccagtagcctctccgcaca 99575

                                                                         
Query: 546   gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
             ||||||||||| |||||||| | ||||||||| || |||||||| ||||| |||||||| 
Sbjct: 99576 gggacgatggaaagcttggccaagatgatggcccctcggatggcagtggcaacctccttg 99635

                     
Query: 606   gcgcactt 613
             | ||||||
Sbjct: 99636 gagcactt 99643

---

>gb|AC122367.4| Mus musculus BAC clone RP23-449L24 from chromosome 12, complete
             sequence
          Length = 200004

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Plus

                                                                         
Query: 486   accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
             |||||||| || || ||||||||| |||| |||||||||||||||||||| ||||  || 
Sbjct: 48476 accttgcatggaacagtgtggggcttgccaatcttgttcccccagtagcctctccgcaca 48535

                                                                         
Query: 546   gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
             ||||||||||| |||||||| | ||||||||| || |||||||| ||||| |||||||| 
Sbjct: 48536 gggacgatggaaagcttggccaagatgatggcccctcggatggcagtggcaacctccttg 48595

                     
Query: 606   gcgcactt 613
             | ||||||
Sbjct: 48596 gagcactt 48603

---

>gb|AC069564.34| Mus musculus strain C57BL/6J chromosome 17 clone rp23-435n13, complete
             sequence
          Length = 185784

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                         
Query: 486   accttgcagggcacggtgtggggcatgccgatcttgttcccccagtagcccctcctgacg 545
             |||||||| || || ||||||||| |||| |||||||||||||||||||| ||||  || 
Sbjct: 20353 accttgcatggaacagtgtggggcttgccaatcttgttcccccagtagcctctccgcaca 20294

                                                                         
Query: 546   gggacgatggagagcttggcgaggatgatggcgccgcggatggccgtggccacctccttt 605
             ||||||||||| |||||||| | ||||||||| || |||||||| ||||| |||||||| 
Sbjct: 20293 gggacgatggaaagcttggccaagatgatggcccctcggatggcagtggcaacctccttg 20234

                     
Query: 606   gcgcactt 613
             | ||||||
Sbjct: 20233 gagcactt 20226


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,992,720
Number of Sequences: 3902068
Number of extensions: 4992720
Number of successful extensions: 95385
Number of sequences better than 10.0: 2084
Number of HSP's better than 10.0 without gapping: 2081
Number of HSP's successfully gapped in prelim test: 4
Number of HSP's that attempted gapping in prelim test: 89727
Number of HSP's gapped (non-prelim): 4771
length of query: 640
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 617
effective length of database: 17,143,297,704
effective search space: 10577414683368
effective search space used: 10577414683368
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---