| Clone Name | rbags21c11 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY103621.1| Zea mays PCO154872 mRNA sequence Length = 805 Score = 470 bits (237), Expect = e-129 Identities = 340/376 (90%) Strand = Plus / Minus Query: 174 ggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgc 233 ||||||| |||||||||||||||| ||||||||||||||||| |||||||||||||||| Sbjct: 533 ggtacacaagcgggaacttgatctcggagttgtggaactgcttggtgttgtccctcttgc 474 Query: 234 acagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggt 293 |||||||||||| |||||||| |||||||||||||| ||||| ||||| | |||||||| Sbjct: 473 acagcttgaagtggaccgtcgctgtcttgatgatctgtatgcagggggacctcacgcggt 414 Query: 294 gccgcgacgccatctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggt 353 | || || |||||||| |||||||||||||||| ||||||||| || |||||||||| Sbjct: 413 ggcgggaggccatctcgttgtacatctgctccactgcgccgttcagggtggtgtcgcggt 354 Query: 354 actccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtant 413 ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || | Sbjct: 353 actccttgtacatgttgtggtaaccagtcctgctctggtagcgcagccagatgccatagt 294 Query: 414 tcttgatggnggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttgg 473 ||||||||| ||||||||| ||||||||||||||||||||| ||||||||||| ||| Sbjct: 293 tcttgatggtggtcgggttgcgctcaaagatctcgttgatggcaagcatctggccattgc 234 Query: 474 ccttnttcaccttcttgagcttcctnaggaagtaccagaacttggacttggcgcggacct 533 ||| ||||||||||||||||| || ||||||||||||||||||||||||||||| |||| Sbjct: 233 tcttcttcaccttcttgagctttctcaggaagtaccagaacttggacttggcgcgaacct 174 Query: 534 cgttggtggcccagag 549 |||||||||||||||| Sbjct: 173 cgttggtggcccagag 158
>gb|BT017327.1| Zea mays clone EL01N0320F05.c mRNA sequence Length = 791 Score = 406 bits (205), Expect = e-110 Identities = 326/368 (88%) Strand = Plus / Minus Query: 182 agcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttg 241 |||||||||||||||| ||||||||||||||| ||||||||||||||||| |||||| Sbjct: 503 agcgggaacttgatctcactgttgtggaactgcttagtgttgtccctcttgcagagcttg 444 Query: 242 aagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgac 301 |||| |||||||||||||||||||||||||||||| ||||| | ||||||||| || || Sbjct: 443 aagtgcaccgtcgcagtcttgatgatctggatgcagggggacctcacgcggtggcgagag 384 Query: 302 gccatctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggtactccttg 361 |||||||| ||||||||||||||||| |||| |||| || |||||||||||||||||| Sbjct: 383 gccatctcgttgtacatctgctccacagcgccattcagggttgtgtcgcggtactccttg 324 Query: 362 tacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtanttcttgatg 421 |||||||||||||| ||||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 323 tacatgttgtggtagccggttctgctctggtagcgcagccagatgccgtagttcttgatt 264 Query: 422 gnggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttnttc 481 | |||||||| ||||||||||||||||||||| || | |||||||||| ||| || Sbjct: 263 gtcgtcgggttacgctcaaagatctcgttgatggccaggacctggccgttgctcttctta 204 Query: 482 accttcttgagcttcctnaggaagtaccagaacttggacttggcgcggacctcgttggtg 541 |||||||| | |||||| | |||||||||||||||| |||||||||||||||||||||| Sbjct: 203 accttcttcaacttcctcaagaagtaccagaacttgctcttggcgcggacctcgttggtg 144 Query: 542 gcccagag 549 |||||||| Sbjct: 143 gcccagag 136
>dbj|AK102673.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033102C12, full insert sequence Length = 966 Score = 406 bits (205), Expect = e-110 Identities = 332/376 (88%) Strand = Plus / Minus Query: 174 ggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgc 233 ||||||| |||||||||||||| |||||||||||||||||||| |||||||||||||||| Sbjct: 531 ggtacacgagcgggaacttgatattcgagttgtggaactgcttagtgttgtccctcttgc 472 Query: 234 acagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggt 293 | |||||||||| || || || |||||||||||||| ||||| ||| | | ||| |||| Sbjct: 471 agagcttgaagtgaactgttgcggtcttgatgatctgaatgcaggggaacctcacacggt 412 Query: 294 gccgcgacgccatctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggt 353 | || || |||||||| |||||||||||||||||| | || |||| ||| ||||| |||| Sbjct: 411 gacgagaggccatctcggtgtacatctgctccacagcaccattcagagtagtgtcacggt 352 Query: 354 actccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtant 413 | ||||||||||||||||||||||| || ||||||||||| ||||||||||||||||| | Sbjct: 351 attccttgtacatgttgtggtaacctgttctgctctggtaacgcagccagatgccgtagt 292 Query: 414 tcttgatggnggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttgg 473 ||||||| | || ||||| |||||||||||||||||||||||||||||| || ||| Sbjct: 291 tcttgatcgttgtagggttacgctcaaagatctcgttgatggcgagcatctgtccattgc 232 Query: 474 ccttnttcaccttcttgagcttcctnaggaagtaccagaacttggacttggcgcggacct 533 ||| ||||||||||| |||||||| |||||||||||||||||||||||||||||||||| Sbjct: 231 tcttcttcaccttcttcagcttcctcaggaagtaccagaacttggacttggcgcggacct 172 Query: 534 cgttggtggcccagag 549 |||||||||||||||| Sbjct: 171 cgttggtggcccagag 156
>gb|AY103768.1| Zea mays PCO155588 mRNA sequence Length = 818 Score = 391 bits (197), Expect = e-105 Identities = 330/376 (87%) Strand = Plus / Minus Query: 174 ggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgc 233 ||||||| || ||||||||||||| ||||||||||||||| |||||||||||||||| Sbjct: 529 ggtacacgagtgggaacttgatctcactgttgtggaactgcttagtgttgtccctcttgc 470 Query: 234 acagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggt 293 | |||||||||| |||||||||||||||||||||||||||||| ||||| | |||||||| Sbjct: 469 agagcttgaagtgcaccgtcgcagtcttgatgatctggatgcagggggacctcacgcggt 410 Query: 294 gccgcgacgccatctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggt 353 | || || |||||||| ||||||||||||||||| |||| |||| || |||||||||| Sbjct: 409 ggcgagaagccatctcgttgtacatctgctccacagcgccattcagggttgtgtcgcggt 350 Query: 354 actccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtant 413 |||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| | Sbjct: 349 actccttgtacatgttgtggtagccggttctgctctggtagcgcagccagatgccgtagt 290 Query: 414 tcttgatggnggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttgg 473 ||||||| | |||||||| ||| ||||||||||||||||| || | ||| |||||| Sbjct: 289 tcttgatcgtcgtcgggttacgctcgaagatctcgttgatggccaggacctgaccgttgc 230 Query: 474 ccttnttcaccttcttgagcttcctnaggaagtaccagaacttggacttggcgcggacct 533 ||| || |||||||| | |||||| |||||||||||||||||| |||||||||||| | Sbjct: 229 tcttcttaaccttcttcaacttcctcaggaagtaccagaacttgctcttggcgcggactt 170 Query: 534 cgttggtggcccagag 549 |||||||||||||||| Sbjct: 169 cgttggtggcccagag 154
>gb|BT016199.1| Zea mays clone Contig32 mRNA sequence Length = 732 Score = 367 bits (185), Expect = 3e-98 Identities = 327/376 (86%) Strand = Plus / Minus Query: 174 ggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgc 233 ||||||| || ||||||||||||| |||||| |||||||| |||||||||||||||| Sbjct: 536 ggtacacgagtgggaacttgatctcactgttgtgaaactgcttggtgttgtccctcttgc 477 Query: 234 acagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggt 293 |||||||||||| ||| || || |||||||||||||||||||| ||||| | |||||||| Sbjct: 476 acagcttgaagtgcactgtggcggtcttgatgatctggatgcatggggacctcacgcggt 417 Query: 294 gccgcgacgccatctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggt 353 | || || |||||||| ||||||||||||| ||| ||||||||| || |||||||||| Sbjct: 416 ggcgagaagccatctcattgtacatctgctctacagcgccgttcagggttgtgtcgcggt 357 Query: 354 actccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtant 413 |||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| | Sbjct: 356 actccttgtacatgttgtggtagccggttctgctctggtagcgcagccagatgccgtagt 297 Query: 414 tcttgatggnggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttgg 473 ||||||| | |||||||| ||| ||||||||||||||||| || | ||| |||||| Sbjct: 296 tcttgatcgtcgtcgggttacgctcgaagatctcgttgatggccaggacctgaccgttgc 237 Query: 474 ccttnttcaccttcttgagcttcctnaggaagtaccagaacttggacttggcgcggacct 533 ||| || |||||||| | |||||| |||||||||||||||||| |||||||||||| | Sbjct: 236 tcttcttaaccttcttcaacttcctcaggaagtaccagaacttgctcttggcgcggactt 177 Query: 534 cgttggtggcccagag 549 |||||||||||||||| Sbjct: 176 cgttggtggcccagag 161
>gb|BT017504.1| Zea mays clone EL01N0414H05.c mRNA sequence Length = 834 Score = 329 bits (166), Expect = 6e-87 Identities = 284/325 (87%) Strand = Plus / Minus Query: 225 ccctcttgcacagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaac 284 ||||||||||||||||||||| ||| || || |||||||||||||||||||| ||||| | Sbjct: 465 ccctcttgcacagcttgaagtgcactgtggcggtcttgatgatctggatgcatggggacc 406 Query: 285 gcacgcggtgccgcgacgccatctccgtgtacatctgctccacaccgccgttcanagtcg 344 ||||||||| || || |||||||| ||||||||||||| ||| ||||||||| || | Sbjct: 405 tcacgcggtggcgagaagccatctcattgtacatctgctctacagcgccgttcagggttg 346 Query: 345 tgtcgcggtactccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccaga 404 ||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| Sbjct: 345 tgtcgcggtactccttgtacatgttgtggtagccggttctgctctggtagcgcagccaga 286 Query: 405 tgccgtanttcttgatggnggtcgggttcttctcaaagatctcgttgatggcgagcatct 464 ||||||| |||||||| | |||||||| ||| ||||||||||||||||| || | || Sbjct: 285 tgccgtagttcttgatcgtcgtcgggttacgctcgaagatctcgttgatggccaggacct 226 Query: 465 ggccgttggccttnttcaccttcttgagcttcctnaggaagtaccagaacttggacttgg 524 | |||||| ||| || |||||||| | |||||| |||||||||||||||||| ||||| Sbjct: 225 gaccgttgctcttcttaaccttcttcaacttcctcaggaagtaccagaacttgctcttgg 166 Query: 525 cgcggacctcgttggtggcccagag 549 ||||||| ||||||||||||||||| Sbjct: 165 cgcggacttcgttggtggcccagag 141
>ref|NM_191921.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 588 Score = 303 bits (153), Expect = 3e-79 Identities = 289/336 (86%) Strand = Plus / Minus Query: 174 ggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgc 233 ||||||| || ||||||||||| || ||||||||||||||| |||||||||||||||| Sbjct: 517 ggtacacaagggggaacttgatgctcccgttgtggaactgcttggtgttgtccctcttgc 458 Query: 234 acagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggt 293 | |||||||||| || || || |||||||||||||||||||| ||| | | ||| |||| Sbjct: 457 agagcttgaagtggacagtggcggtcttgatgatctggatgcaagggaatctcacacggt 398 Query: 294 gccgcgacgccatctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggt 353 | || || |||||||| ||||||||||| ||||| | || |||| || ||||| |||| Sbjct: 397 ggcgagaagccatctcggtgtacatctgttccacggcaccattcaatgtagtgtcacggt 338 Query: 354 actccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtant 413 |||||||||||||||||||||||||||| ||||||||||| |||||||||||||| || | Sbjct: 337 actccttgtacatgttgtggtaaccggttctgctctggtaacgcagccagatgccatagt 278 Query: 414 tcttgatggnggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttgg 473 ||||||| | ||| ||||| ||| ||||||||||||||||||||||||||||||||| Sbjct: 277 tcttgatcgtggttgggttgcgctcgaagatctcgttgatggcgagcatctggccgttgc 218 Query: 474 ccttnttcaccttcttgagcttcctnaggaagtacc 509 ||| ||||||||||| |||||||| |||||||||| Sbjct: 217 tcttcttcaccttcttcagcttcctcaggaagtacc 182 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 509 cagaacttggacttggcgcggacctcgttggtggcccagag 549 ||||||||| ||||||||||||||| |||||||||||||| Sbjct: 131 cagaacttgctcttggcgcggacctcattggtggcccagag 91
>ref|NM_191253.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 537 Score = 285 bits (144), Expect = 7e-74 Identities = 316/375 (84%) Strand = Plus / Minus Query: 175 gtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 234 ||||||||| ||||||||||| | || |||||||||||||| |||||||| | |||||| Sbjct: 465 gtacaccagtgggaacttgatatctgacttgtggaactgcttagtgttgtcacgcttgca 406 Query: 235 cagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtg 294 || || |||| || || ||||||||||||||||| ||||| ||| | | || ||||| Sbjct: 405 gagtttaaagtggacagtagcagtcttgatgatctgaatgcaagggaatctgacacggtg 346 Query: 295 ccgcgacgccatctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggta 354 || || |||||||| |||||||||||||| || | || || | || || || ||||| Sbjct: 345 gcgggaagccatctcagtgtacatctgctcaacggcaccattgagggtggtatcacggta 286 Query: 355 ctccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtantt 414 ||||||||||||||||||||| || ||||| |||||||| |||||||||||||| || || Sbjct: 285 ctccttgtacatgttgtggtagccagtcctactctggtaacgcagccagatgccatagtt 226 Query: 415 cttgatggnggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggc 474 |||||| | || |||||||||||||| |||||||||||||| || ||||| |||||| Sbjct: 225 cttgatagttgttgggttcttctcaaaaatctcgttgatggcaaggatctgcccgttgct 166 Query: 475 cttnttcaccttcttgagcttcctnaggaagtaccagaacttggacttggcgcggacctc 534 ||| ||||||||||| ||||| | ||||||||||||||||||||||||||||||||||| Sbjct: 165 cttcttcaccttcttcagcttgcggaggaagtaccagaacttggacttggcgcggacctc 106 Query: 535 gttggtggcccagag 549 |||||| |||||||| Sbjct: 105 gttggtagcccagag 91
>dbj|AK121755.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033088C04, full insert sequence Length = 910 Score = 285 bits (144), Expect = 7e-74 Identities = 316/375 (84%) Strand = Plus / Minus Query: 175 gtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 234 ||||||||| ||||||||||| | || |||||||||||||| |||||||| | |||||| Sbjct: 582 gtacaccagtgggaacttgatatctgacttgtggaactgcttagtgttgtcacgcttgca 523 Query: 235 cagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtg 294 || || |||| || || ||||||||||||||||| ||||| ||| | | || ||||| Sbjct: 522 gagtttaaagtggacagtagcagtcttgatgatctgaatgcaagggaatctgacacggtg 463 Query: 295 ccgcgacgccatctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggta 354 || || |||||||| |||||||||||||| || | || || | || || || ||||| Sbjct: 462 gcgggaagccatctcagtgtacatctgctcaacggcaccattgagggtggtatcacggta 403 Query: 355 ctccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtantt 414 ||||||||||||||||||||| || ||||| |||||||| |||||||||||||| || || Sbjct: 402 ctccttgtacatgttgtggtagccagtcctactctggtaacgcagccagatgccatagtt 343 Query: 415 cttgatggnggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggc 474 |||||| | || |||||||||||||| |||||||||||||| || ||||| |||||| Sbjct: 342 cttgatagttgttgggttcttctcaaaaatctcgttgatggcaaggatctgcccgttgct 283 Query: 475 cttnttcaccttcttgagcttcctnaggaagtaccagaacttggacttggcgcggacctc 534 ||| ||||||||||| ||||| | ||||||||||||||||||||||||||||||||||| Sbjct: 282 cttcttcaccttcttcagcttgcggaggaagtaccagaacttggacttggcgcggacctc 223 Query: 535 gttggtggcccagag 549 |||||| |||||||| Sbjct: 222 gttggtagcccagag 208
>gb|AC124143.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0053D02, complete sequence Length = 157106 Score = 256 bits (129), Expect = 7e-65 Identities = 217/247 (87%) Strand = Plus / Minus Query: 174 ggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgc 233 ||||||| |||||||||||||| |||||||||||||||||||| |||||||||||||||| Sbjct: 130137 ggtacacgagcgggaacttgatattcgagttgtggaactgcttagtgttgtccctcttgc 130078 Query: 234 acagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggt 293 | |||||||||| || || || |||||||||||||| ||||| ||| | | ||| |||| Sbjct: 130077 agagcttgaagtgaactgttgcggtcttgatgatctgaatgcaggggaacctcacacggt 130018 Query: 294 gccgcgacgccatctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggt 353 | || || |||||||| |||||||||||||||||| | || |||| ||| ||||| |||| Sbjct: 130017 gacgagaggccatctcggtgtacatctgctccacagcaccattcagagtagtgtcacggt 129958 Query: 354 actccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtant 413 | ||||||||||||||||||||||| || ||||||||||| ||||||||||||||||| | Sbjct: 129957 attccttgtacatgttgtggtaacctgttctgctctggtaacgcagccagatgccgtagt 129898 Query: 414 tcttgat 420 ||||||| Sbjct: 129897 tcttgat 129891 Score = 85.7 bits (43), Expect = 1e-13 Identities = 43/43 (100%) Strand = Plus / Minus Query: 507 accagaacttggacttggcgcggacctcgttggtggcccagag 549 ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 128693 accagaacttggacttggcgcggacctcgttggtggcccagag 128651 Score = 77.8 bits (39), Expect = 3e-11 Identities = 58/65 (89%) Strand = Plus / Minus Query: 445 ctcgttgatggcgagcatctggccgttggccttnttcaccttcttgagcttcctnaggaa 504 ||||||||||||||||||||| || ||| ||| ||||||||||| |||||||| ||||| Sbjct: 128841 ctcgttgatggcgagcatctgtccattgctcttcttcaccttcttcagcttcctcaggaa 128782 Query: 505 gtacc 509 ||||| Sbjct: 128781 gtacc 128777
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 256 bits (129), Expect = 7e-65 Identities = 217/247 (87%) Strand = Plus / Minus Query: 174 ggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgc 233 ||||||| |||||||||||||| |||||||||||||||||||| |||||||||||||||| Sbjct: 27899720 ggtacacgagcgggaacttgatattcgagttgtggaactgcttagtgttgtccctcttgc 27899661 Query: 234 acagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggt 293 | |||||||||| || || || |||||||||||||| ||||| ||| | | ||| |||| Sbjct: 27899660 agagcttgaagtgaactgttgcggtcttgatgatctgaatgcaggggaacctcacacggt 27899601 Query: 294 gccgcgacgccatctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggt 353 | || || |||||||| |||||||||||||||||| | || |||| ||| ||||| |||| Sbjct: 27899600 gacgagaggccatctcggtgtacatctgctccacagcaccattcagagtagtgtcacggt 27899541 Query: 354 actccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtant 413 | ||||||||||||||||||||||| || ||||||||||| ||||||||||||||||| | Sbjct: 27899540 attccttgtacatgttgtggtaacctgttctgctctggtaacgcagccagatgccgtagt 27899481 Query: 414 tcttgat 420 ||||||| Sbjct: 27899480 tcttgat 27899474 Score = 85.7 bits (43), Expect = 1e-13 Identities = 43/43 (100%) Strand = Plus / Minus Query: 507 accagaacttggacttggcgcggacctcgttggtggcccagag 549 ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 27898276 accagaacttggacttggcgcggacctcgttggtggcccagag 27898234 Score = 77.8 bits (39), Expect = 3e-11 Identities = 58/65 (89%) Strand = Plus / Minus Query: 445 ctcgttgatggcgagcatctggccgttggccttnttcaccttcttgagcttcctnaggaa 504 ||||||||||||||||||||| || ||| ||| ||||||||||| |||||||| ||||| Sbjct: 27898424 ctcgttgatggcgagcatctgtccattgctcttcttcaccttcttcagcttcctcaggaa 27898365 Query: 505 gtacc 509 ||||| Sbjct: 27898364 gtacc 27898360
>dbj|D21301.1|RICSS128 Oryza sativa SS128 mRNA for ribosomal protein L18a, partial sequence Length = 380 Score = 250 bits (126), Expect = 4e-63 Identities = 216/247 (87%) Strand = Plus / Minus Query: 174 ggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgc 233 ||||||| |||||||||||||| |||||||||||||||||||| |||||||||||||||| Sbjct: 262 ggtacacgagcgggaacttgatattcgagttgtggaactgcttagtgttgtccctcttgc 203 Query: 234 acagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggt 293 | |||||||||| || || || |||||||||||||| ||||| ||| | | ||| |||| Sbjct: 202 agagcttgaagtgaactgttgcggtcttgatgatctgaatgcaggggaacctcacacggt 143 Query: 294 gccgcgacgccatctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggt 353 | || || |||||||| |||||||||||||||||| | || |||| ||| ||||| |||| Sbjct: 142 gacgagaggccatctcggtgtacatctgctccacagcaccattcagagtagtgtcacggt 83 Query: 354 actccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtant 413 | ||||||||||||||||||||||| || ||||||||||| |||| |||||||||||| | Sbjct: 82 attccttgtacatgttgtggtaacctgttctgctctggtaacgcanccagatgccgtagt 23 Query: 414 tcttgat 420 ||||||| Sbjct: 22 tcttgat 16
>ref|NM_129000.2| Arabidopsis thaliana structural constituent of ribosome AT2G34480 mRNA, complete cds Length = 785 Score = 226 bits (114), Expect = 6e-56 Identities = 301/365 (82%) Strand = Plus / Minus Query: 185 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaag 244 |||||||||||||| |||||||||||| || ||| | || ||||||||||||||| Sbjct: 495 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttggct 436 Query: 245 tccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgcc 304 || || || |||||||||||||| ||||| ||| | | || ||||| || || ||| Sbjct: 435 gggacagtggctgtcttgatgatctgaatgcaagggaatctgacacggtgacgggatgcc 376 Query: 305 atctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggtactccttgtac 364 ||||| |||||||||||||| ||| | ||||| | ||| ||||| ||||||||||||||| Sbjct: 375 atctcagtgtacatctgctcaacagctccgttaagagtggtgtcacggtactccttgtac 316 Query: 365 atgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtanttcttgatggng 424 ||||||||||| || || || |||||||| | || ||| || ||| | |||||||| | Sbjct: 315 atgttgtggtacccagttctactctggtacctcaaccaaataccgaagttcttgatcgtt 256 Query: 425 gtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttnttcacc 484 || |||||||||||| ||||||||||||||||||||||||| || || ||| |||||| Sbjct: 255 gttgggttcttctcatagatctcgttgatggcgagcatctgtccattactcttcttcacc 196 Query: 485 ttcttgagcttcctnaggaagtaccagaacttggacttggcgcggacctcgttggtggcc 544 |||||||||||||| | ||| |||||||||||||||||||| || |||||||| || ||| Sbjct: 195 ttcttgagcttcctcaagaaataccagaacttggacttggcacgaacctcgttcgtagcc 136 Query: 545 cagag 549 ||||| Sbjct: 135 cagag 131
>gb|BT000076.1| Arabidopsis thaliana 60S ribosomal protein L18A (At2g34480) mRNA, complete cds Length = 672 Score = 226 bits (114), Expect = 6e-56 Identities = 301/365 (82%) Strand = Plus / Minus Query: 185 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaag 244 |||||||||||||| |||||||||||| || ||| | || ||||||||||||||| Sbjct: 455 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttggct 396 Query: 245 tccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgcc 304 || || || |||||||||||||| ||||| ||| | | || ||||| || || ||| Sbjct: 395 gggacagtggctgtcttgatgatctgaatgcaagggaatctgacacggtgacgggatgcc 336 Query: 305 atctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggtactccttgtac 364 ||||| |||||||||||||| ||| | ||||| | ||| ||||| ||||||||||||||| Sbjct: 335 atctcagtgtacatctgctcaacagctccgttaagagtggtgtcacggtactccttgtac 276 Query: 365 atgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtanttcttgatggng 424 ||||||||||| || || || |||||||| | || ||| || ||| | |||||||| | Sbjct: 275 atgttgtggtacccagttctactctggtacctcaaccaaataccgaagttcttgatcgtt 216 Query: 425 gtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttnttcacc 484 || |||||||||||| ||||||||||||||||||||||||| || || ||| |||||| Sbjct: 215 gttgggttcttctcatagatctcgttgatggcgagcatctgtccattactcttcttcacc 156 Query: 485 ttcttgagcttcctnaggaagtaccagaacttggacttggcgcggacctcgttggtggcc 544 |||||||||||||| | ||| |||||||||||||||||||| || |||||||| || ||| Sbjct: 155 ttcttgagcttcctcaagaaataccagaacttggacttggcacgaacctcgttcgtagcc 96 Query: 545 cagag 549 ||||| Sbjct: 95 cagag 91
>gb|AY120778.1| Arabidopsis thaliana 60S ribosomal protein L18A (At2g34480) mRNA, complete cds Length = 734 Score = 226 bits (114), Expect = 6e-56 Identities = 301/365 (82%) Strand = Plus / Minus Query: 185 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaag 244 |||||||||||||| |||||||||||| || ||| | || ||||||||||||||| Sbjct: 490 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttggct 431 Query: 245 tccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgcc 304 || || || |||||||||||||| ||||| ||| | | || ||||| || || ||| Sbjct: 430 gggacagtggctgtcttgatgatctgaatgcaagggaatctgacacggtgacgggatgcc 371 Query: 305 atctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggtactccttgtac 364 ||||| |||||||||||||| ||| | ||||| | ||| ||||| ||||||||||||||| Sbjct: 370 atctcagtgtacatctgctcaacagctccgttaagagtggtgtcacggtactccttgtac 311 Query: 365 atgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtanttcttgatggng 424 ||||||||||| || || || |||||||| | || ||| || ||| | |||||||| | Sbjct: 310 atgttgtggtacccagttctactctggtacctcaaccaaataccgaagttcttgatcgtt 251 Query: 425 gtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttnttcacc 484 || |||||||||||| ||||||||||||||||||||||||| || || ||| |||||| Sbjct: 250 gttgggttcttctcatagatctcgttgatggcgagcatctgtccattactcttcttcacc 191 Query: 485 ttcttgagcttcctnaggaagtaccagaacttggacttggcgcggacctcgttggtggcc 544 |||||||||||||| | ||| |||||||||||||||||||| || |||||||| || ||| Sbjct: 190 ttcttgagcttcctcaagaaataccagaacttggacttggcacgaacctcgttcgtagcc 131 Query: 545 cagag 549 ||||| Sbjct: 130 cagag 126
>gb|BT006559.1| Arabidopsis thaliana At2g34480 gene, complete cds Length = 537 Score = 226 bits (114), Expect = 6e-56 Identities = 301/365 (82%) Strand = Plus / Minus Query: 185 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaag 244 |||||||||||||| |||||||||||| || ||| | || ||||||||||||||| Sbjct: 455 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttggct 396 Query: 245 tccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgcc 304 || || || |||||||||||||| ||||| ||| | | || ||||| || || ||| Sbjct: 395 gggacagtggctgtcttgatgatctgaatgcaagggaatctgacacggtgacgggatgcc 336 Query: 305 atctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggtactccttgtac 364 ||||| |||||||||||||| ||| | ||||| | ||| ||||| ||||||||||||||| Sbjct: 335 atctcagtgtacatctgctcaacagctccgttaagagtggtgtcacggtactccttgtac 276 Query: 365 atgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtanttcttgatggng 424 ||||||||||| || || || |||||||| | || ||| || ||| | |||||||| | Sbjct: 275 atgttgtggtacccagttctactctggtacctcaaccaaataccgaagttcttgatcgtt 216 Query: 425 gtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttnttcacc 484 || |||||||||||| ||||||||||||||||||||||||| || || ||| |||||| Sbjct: 215 gttgggttcttctcatagatctcgttgatggcgagcatctgtccattactcttcttcacc 156 Query: 485 ttcttgagcttcctnaggaagtaccagaacttggacttggcgcggacctcgttggtggcc 544 |||||||||||||| | ||| |||||||||||||||||||| || |||||||| || ||| Sbjct: 155 ttcttgagcttcctcaagaaataccagaacttggacttggcacgaacctcgttcgtagcc 96 Query: 545 cagag 549 ||||| Sbjct: 95 cagag 91
>gb|AY042803.1| Arabidopsis thaliana Unknown protein mRNA, complete cds Length = 755 Score = 226 bits (114), Expect = 6e-56 Identities = 301/365 (82%) Strand = Plus / Minus Query: 185 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaag 244 |||||||||||||| |||||||||||| || ||| | || ||||||||||||||| Sbjct: 490 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttggct 431 Query: 245 tccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgcc 304 || || || |||||||||||||| ||||| ||| | | || ||||| || || ||| Sbjct: 430 gggacagtggctgtcttgatgatctgaatgcaagggaatctgacacggtgacgggatgcc 371 Query: 305 atctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggtactccttgtac 364 ||||| |||||||||||||| ||| | ||||| | ||| ||||| ||||||||||||||| Sbjct: 370 atctcagtgtacatctgctcaacagctccgttaagagtggtgtcacggtactccttgtac 311 Query: 365 atgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtanttcttgatggng 424 ||||||||||| || || || |||||||| | || ||| || ||| | |||||||| | Sbjct: 310 atgttgtggtacccagttctactctggtacctcaaccaaataccgaagttcttgatcgtt 251 Query: 425 gtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttnttcacc 484 || |||||||||||| ||||||||||||||||||||||||| || || ||| |||||| Sbjct: 250 gttgggttcttctcatagatctcgttgatggcgagcatctgtccattactcttcttcacc 191 Query: 485 ttcttgagcttcctnaggaagtaccagaacttggacttggcgcggacctcgttggtggcc 544 |||||||||||||| | ||| |||||||||||||||||||| || |||||||| || ||| Sbjct: 190 ttcttgagcttcctcaagaaataccagaacttggacttggcacgaacctcgttcgtagcc 131 Query: 545 cagag 549 ||||| Sbjct: 130 cagag 126
>emb|BX818972.1|CNS0A9U8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB32ZE10 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 752 Score = 226 bits (114), Expect = 6e-56 Identities = 301/365 (82%) Strand = Plus / Minus Query: 185 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaag 244 |||||||||||||| |||||||||||| || ||| | || ||||||||||||||| Sbjct: 489 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttggct 430 Query: 245 tccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgcc 304 || || || |||||||||||||| ||||| ||| | | || ||||| || || ||| Sbjct: 429 gggacagtggctgtcttgatgatctgaatgcaagggaatctgacacggtgacgggatgcc 370 Query: 305 atctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggtactccttgtac 364 ||||| |||||||||||||| ||| | ||||| | ||| ||||| ||||||||||||||| Sbjct: 369 atctcagtgtacatctgctcaacagctccgttaagagtggtgtcacggtactccttgtac 310 Query: 365 atgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtanttcttgatggng 424 ||||||||||| || || || |||||||| | || ||| || ||| | |||||||| | Sbjct: 309 atgttgtggtacccagttctactctggtacctcaaccaaataccgaagttcttgatcgtt 250 Query: 425 gtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttnttcacc 484 || |||||||||||| ||||||||||||||||||||||||| || || ||| |||||| Sbjct: 249 gttgggttcttctcatagatctcgttgatggcgagcatctgtccattactcttcttcacc 190 Query: 485 ttcttgagcttcctnaggaagtaccagaacttggacttggcgcggacctcgttggtggcc 544 |||||||||||||| | ||| |||||||||||||||||||| || |||||||| || ||| Sbjct: 189 ttcttgagcttcctcaagaaataccagaacttggacttggcacgaacctcgttcgtagcc 130 Query: 545 cagag 549 ||||| Sbjct: 129 cagag 125
>emb|BX818907.1|CNS0A9RI Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB25ZH03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 704 Score = 226 bits (114), Expect = 6e-56 Identities = 301/365 (82%) Strand = Plus / Minus Query: 185 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaag 244 |||||||||||||| |||||||||||| || ||| | || ||||||||||||||| Sbjct: 441 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttggct 382 Query: 245 tccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgcc 304 || || || |||||||||||||| ||||| ||| | | || ||||| || || ||| Sbjct: 381 gggacagtggctgtcttgatgatctgaatgcaagggaatctgacacggtgacgggatgcc 322 Query: 305 atctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggtactccttgtac 364 ||||| |||||||||||||| ||| | ||||| | ||| ||||| ||||||||||||||| Sbjct: 321 atctcagtgtacatctgctcaacagctccgttaagagtggtgtcacggtactccttgtac 262 Query: 365 atgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtanttcttgatggng 424 ||||||||||| || || || |||||||| | || ||| || ||| | |||||||| | Sbjct: 261 atgttgtggtacccagttctactctggtacctcaaccaaataccgaagttcttgatcgtt 202 Query: 425 gtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttnttcacc 484 || |||||||||||| ||||||||||||||||||||||||| || || ||| |||||| Sbjct: 201 gttgggttcttctcatagatctcgttgatggcgagcatctgtccattactcttcttcacc 142 Query: 485 ttcttgagcttcctnaggaagtaccagaacttggacttggcgcggacctcgttggtggcc 544 |||||||||||||| | ||| |||||||||||||||||||| || |||||||| || ||| Sbjct: 141 ttcttgagcttcctcaagaaataccagaacttggacttggcacgaacctcgttcgtagcc 82 Query: 545 cagag 549 ||||| Sbjct: 81 cagag 77
>ref|NM_112321.2| Arabidopsis thaliana structural constituent of ribosome AT3G14600 mRNA, complete cds Length = 853 Score = 224 bits (113), Expect = 2e-55 Identities = 287/344 (83%), Gaps = 2/344 (0%) Strand = Plus / Minus Query: 185 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagctt-gaa 243 |||||||||||||||||||| ||||||||||| ||| | || |||||||| ||||| | | Sbjct: 531 gggaacttgatcttcgagttatggaactgcttggtgatctctctcttgcaaagctttgca 472 Query: 244 gtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgc 303 | || |||||||||||||||||||| ||||| ||| | | ||| | || || || || Sbjct: 471 ggg-acagtcgcagtcttgatgatctgaatgcaagggaacctcactctatgacgagaagc 413 Query: 304 catctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggtactccttgta 363 |||||| ||||||||||||||||| || || || | || ||||| |||||||||||||| Sbjct: 412 catctcagtgtacatctgctccactccaccattgagtgttgtgtcacggtactccttgta 353 Query: 364 catgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtanttcttgatggn 423 |||||||||||| || || | |||||| || |||| |||||| ||||| |||||||||| Sbjct: 352 catgttgtggtacccagttcggctctgataacgcaaccagatcccgtagttcttgatggt 293 Query: 424 ggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttnttcac 483 || ||||||||||| || ||||| |||||||| |||||||| |||||| || ||||| Sbjct: 292 cgttgggttcttctcgaaaatctcattgatggcaagcatctgtccgttgcttttcttcac 233 Query: 484 cttcttgagcttcctnaggaagtaccagaacttggacttggcgc 527 |||||| || ||||| | |||||||||||||||||||||||||| Sbjct: 232 cttcttcagtttcctcatgaagtaccagaacttggacttggcgc 189
>gb|AY097377.1| Arabidopsis thaliana AT3g14600/MIE1_10 mRNA, complete cds Length = 537 Score = 224 bits (113), Expect = 2e-55 Identities = 287/344 (83%), Gaps = 2/344 (0%) Strand = Plus / Minus Query: 185 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagctt-gaa 243 |||||||||||||||||||| ||||||||||| ||| | || |||||||| ||||| | | Sbjct: 455 gggaacttgatcttcgagttatggaactgcttggtgatctctctcttgcaaagctttgca 396 Query: 244 gtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgc 303 | || |||||||||||||||||||| ||||| ||| | | ||| | || || || || Sbjct: 395 ggg-acagtcgcagtcttgatgatctgaatgcaagggaacctcactctatgacgagaagc 337 Query: 304 catctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggtactccttgta 363 |||||| ||||||||||||||||| || || || | || ||||| |||||||||||||| Sbjct: 336 catctcagtgtacatctgctccactccaccattgagtgttgtgtcacggtactccttgta 277 Query: 364 catgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtanttcttgatggn 423 |||||||||||| || || | |||||| || |||| |||||| ||||| |||||||||| Sbjct: 276 catgttgtggtacccagttcggctctgataacgcaaccagatcccgtagttcttgatggt 217 Query: 424 ggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttnttcac 483 || ||||||||||| || ||||| |||||||| |||||||| |||||| || ||||| Sbjct: 216 cgttgggttcttctcgaaaatctcattgatggcaagcatctgtccgttgcttttcttcac 157 Query: 484 cttcttgagcttcctnaggaagtaccagaacttggacttggcgc 527 |||||| || ||||| | |||||||||||||||||||||||||| Sbjct: 156 cttcttcagtttcctcatgaagtaccagaacttggacttggcgc 113
>gb|AY072540.1| Arabidopsis thaliana AT3g14600/MIE1_10 mRNA, complete cds Length = 829 Score = 224 bits (113), Expect = 2e-55 Identities = 287/344 (83%), Gaps = 2/344 (0%) Strand = Plus / Minus Query: 185 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagctt-gaa 243 |||||||||||||||||||| ||||||||||| ||| | || |||||||| ||||| | | Sbjct: 506 gggaacttgatcttcgagttatggaactgcttggtgatctctctcttgcaaagctttgca 447 Query: 244 gtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgc 303 | || |||||||||||||||||||| ||||| ||| | | ||| | || || || || Sbjct: 446 ggg-acagtcgcagtcttgatgatctgaatgcaagggaacctcactctatgacgagaagc 388 Query: 304 catctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggtactccttgta 363 |||||| ||||||||||||||||| || || || | || ||||| |||||||||||||| Sbjct: 387 catctcagtgtacatctgctccactccaccattgagtgttgtgtcacggtactccttgta 328 Query: 364 catgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtanttcttgatggn 423 |||||||||||| || || | |||||| || |||| |||||| ||||| |||||||||| Sbjct: 327 catgttgtggtacccagttcggctctgataacgcaaccagatcccgtagttcttgatggt 268 Query: 424 ggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttnttcac 483 || ||||||||||| || ||||| |||||||| |||||||| |||||| || ||||| Sbjct: 267 cgttgggttcttctcgaaaatctcattgatggcaagcatctgtccgttgcttttcttcac 208 Query: 484 cttcttgagcttcctnaggaagtaccagaacttggacttggcgc 527 |||||| || ||||| | |||||||||||||||||||||||||| Sbjct: 207 cttcttcagtttcctcatgaagtaccagaacttggacttggcgc 164
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 218 bits (110), Expect = 1e-53 Identities = 221/259 (85%) Strand = Plus / Plus Query: 174 ggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgc 233 ||||||| || ||||||||||| || ||||||||||||||| |||||||||||||||| Sbjct: 27260170 ggtacacaagggggaacttgatgctcccgttgtggaactgcttggtgttgtccctcttgc 27260229 Query: 234 acagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggt 293 | |||||||||| || || || |||||||||||||||||||| ||| | | ||| |||| Sbjct: 27260230 agagcttgaagtggacagtggcggtcttgatgatctggatgcaagggaatctcacacggt 27260289 Query: 294 gccgcgacgccatctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggt 353 | || || |||||||| ||||||||||| ||||| | || |||| || ||||| |||| Sbjct: 27260290 ggcgagaagccatctcggtgtacatctgttccacggcaccattcaatgtagtgtcacggt 27260349 Query: 354 actccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtant 413 |||||||||||||||||||||||||||| ||||||||||| |||||||||||||| || | Sbjct: 27260350 actccttgtacatgttgtggtaaccggttctgctctggtaacgcagccagatgccatagt 27260409 Query: 414 tcttgatggnggtcgggtt 432 ||||||| | ||| ||||| Sbjct: 27260410 tcttgatcgtggttgggtt 27260428 Score = 165 bits (83), Expect = 2e-37 Identities = 224/272 (82%) Strand = Plus / Plus Query: 175 gtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 234 ||||||||| ||||||||||| | || |||||||||||||| |||||||| | |||||| Sbjct: 31552819 gtacaccagtgggaacttgatatctgacttgtggaactgcttagtgttgtcacgcttgca 31552878 Query: 235 cagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtg 294 || || |||| || || ||||||||||||||||| ||||| ||| | | || ||||| Sbjct: 31552879 gagtttaaagtggacagtagcagtcttgatgatctgaatgcaagggaatctgacacggtg 31552938 Query: 295 ccgcgacgccatctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggta 354 || || |||||||| |||||||||||||| || | || || | || || || ||||| Sbjct: 31552939 gcgggaagccatctcagtgtacatctgctcaacggcaccattgagggtggtatcacggta 31552998 Query: 355 ctccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtantt 414 ||||||||||||||||||||| || ||||| |||||||| |||||||||||||| || || Sbjct: 31552999 ctccttgtacatgttgtggtagccagtcctactctggtaacgcagccagatgccatagtt 31553058 Query: 415 cttgatggnggtcgggttcttctcaaagatct 446 |||||| | || |||||||||||||| |||| Sbjct: 31553059 cttgatagttgttgggttcttctcaaaaatct 31553090 Score = 93.7 bits (47), Expect = 6e-16 Identities = 60/65 (92%) Strand = Plus / Plus Query: 445 ctcgttgatggcgagcatctggccgttggccttnttcaccttcttgagcttcctnaggaa 504 |||||||||||||||||||||||||||| ||| ||||||||||| |||||||| ||||| Sbjct: 27261236 ctcgttgatggcgagcatctggccgttgctcttcttcaccttcttcagcttcctcaggaa 27261295 Query: 505 gtacc 509 ||||| Sbjct: 27261296 gtacc 27261300 Score = 77.8 bits (39), Expect = 3e-11 Identities = 42/43 (97%) Strand = Plus / Plus Query: 507 accagaacttggacttggcgcggacctcgttggtggcccagag 549 |||||||||||||||||||||||||||||||||| |||||||| Sbjct: 31553741 accagaacttggacttggcgcggacctcgttggtagcccagag 31553783 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Plus Query: 507 accagaacttggacttggcgcggacctcgttggtggcccagag 549 ||||||||||| ||||||||||||||| |||||||||||||| Sbjct: 27261401 accagaacttgctcttggcgcggacctcattggtggcccagag 27261443 Score = 54.0 bits (27), Expect = 5e-04 Identities = 55/65 (84%) Strand = Plus / Plus Query: 445 ctcgttgatggcgagcatctggccgttggccttnttcaccttcttgagcttcctnaggaa 504 |||||||||||| || ||||| |||||| ||| ||||||||||| ||||| | ||||| Sbjct: 31553583 ctcgttgatggcaaggatctgcccgttgctcttcttcaccttcttcagcttgcggaggaa 31553642 Query: 505 gtacc 509 ||||| Sbjct: 31553643 gtacc 31553647
>dbj|AP003760.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJNBb0063G05 Length = 182681 Score = 218 bits (110), Expect = 1e-53 Identities = 221/259 (85%) Strand = Plus / Plus Query: 174 ggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgc 233 ||||||| || ||||||||||| || ||||||||||||||| |||||||||||||||| Sbjct: 40687 ggtacacaagggggaacttgatgctcccgttgtggaactgcttggtgttgtccctcttgc 40746 Query: 234 acagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggt 293 | |||||||||| || || || |||||||||||||||||||| ||| | | ||| |||| Sbjct: 40747 agagcttgaagtggacagtggcggtcttgatgatctggatgcaagggaatctcacacggt 40806 Query: 294 gccgcgacgccatctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggt 353 | || || |||||||| ||||||||||| ||||| | || |||| || ||||| |||| Sbjct: 40807 ggcgagaagccatctcggtgtacatctgttccacggcaccattcaatgtagtgtcacggt 40866 Query: 354 actccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtant 413 |||||||||||||||||||||||||||| ||||||||||| |||||||||||||| || | Sbjct: 40867 actccttgtacatgttgtggtaaccggttctgctctggtaacgcagccagatgccatagt 40926 Query: 414 tcttgatggnggtcgggtt 432 ||||||| | ||| ||||| Sbjct: 40927 tcttgatcgtggttgggtt 40945 Score = 93.7 bits (47), Expect = 6e-16 Identities = 60/65 (92%) Strand = Plus / Plus Query: 445 ctcgttgatggcgagcatctggccgttggccttnttcaccttcttgagcttcctnaggaa 504 |||||||||||||||||||||||||||| ||| ||||||||||| |||||||| ||||| Sbjct: 41753 ctcgttgatggcgagcatctggccgttgctcttcttcaccttcttcagcttcctcaggaa 41812 Query: 505 gtacc 509 ||||| Sbjct: 41813 gtacc 41817 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Plus Query: 507 accagaacttggacttggcgcggacctcgttggtggcccagag 549 ||||||||||| ||||||||||||||| |||||||||||||| Sbjct: 41918 accagaacttgctcttggcgcggacctcattggtggcccagag 41960
>gb|AY088351.1| Arabidopsis thaliana clone 5961 mRNA, complete sequence Length = 767 Score = 200 bits (101), Expect = 3e-48 Identities = 284/344 (82%), Gaps = 2/344 (0%) Strand = Plus / Minus Query: 185 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagctt-gaa 243 |||||||||||||||||||| ||||||||||| ||| | || |||||||| ||||| | | Sbjct: 531 gggaacttgatcttcgagttatggaactgcttggtgatctctctcttgcaaagctttgca 472 Query: 244 gtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgc 303 | || |||||||||||||||||||| ||||| ||| | | ||| | || || || || Sbjct: 471 ggg-acagtcgcagtcttgatgatctgaatgcaagggaacctcactctatgacgagaagc 413 Query: 304 catctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggtactccttgta 363 ||||| ||||||||||||||||| || || || | || ||||| |||||||||||||| Sbjct: 412 aatctcagtgtacatctgctccactccaccattgagtgttgtgtcacggtactccttgta 353 Query: 364 catgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtanttcttgatggn 423 |||||||||||| || || | |||||| || |||| |||||| ||||| |||||||| | Sbjct: 352 catgttgtggtacccagttcggctctgataacgcaaccagatcccgtaattcttgattgt 293 Query: 424 ggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttnttcac 483 || ||||||||||| || ||||| |||||||| |||||||| |||||| || ||||| Sbjct: 292 cgttgggttcttctcgaaaatctcattgatggcaagcatctgcccgttgcttttcttcac 233 Query: 484 cttcttgagcttcctnaggaagtaccagaacttggacttggcgc 527 |||||| || || || | |||||||||||||||||||||||||| Sbjct: 232 cttcttcagttttctcatgaagtaccagaacttggacttggcgc 189
>emb|BX819594.1|CNS0A9TR Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB92ZG02 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 711 Score = 192 bits (97), Expect = 8e-46 Identities = 296/364 (81%) Strand = Plus / Minus Query: 186 ggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaagt 245 ||||||||||||| |||||||||||| || ||| | || ||||||||||||||| Sbjct: 490 ggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttggctg 431 Query: 246 ccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgcca 305 || || || |||||||||||||| ||||| ||| | | || |||| || || |||| Sbjct: 430 ggacagttgctgtcttgatgatctgaatgcaagggaatcttacaaggtgacgggatgcca 371 Query: 306 tctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggtactccttgtaca 365 |||| || ||||||||||| ||| | ||||| | ||| |||| |||||||||||||||| Sbjct: 370 tctcagtatacatctgctcaacagcaccgttaagagtggtgtaacggtactccttgtaca 311 Query: 366 tgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtanttcttgatggngg 425 |||||||||| || || || |||||||| | || ||| || ||| | |||||||| | | Sbjct: 310 tgttgtggtacccagttctactctggtacctcaaccaaataccgaagttcttgatcgttg 251 Query: 426 tcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttnttcacct 485 | |||||||||||| |||||||||||||||||||||||| || || ||| ||||||| Sbjct: 250 ttgggttcttctcatagatctcgttgatggcgagcatctttccattactcttcttcacct 191 Query: 486 tcttgagcttcctnaggaagtaccagaacttggacttggcgcggacctcgttggtggccc 545 ||||||||||||| | ||| |||||||||||||||||||| || |||||||| || |||| Sbjct: 190 tcttgagcttcctcaagaaataccagaacttggacttggcacgaacctcgttcgtagccc 131 Query: 546 agag 549 |||| Sbjct: 130 agag 127
>gb|DQ175860.1| Hordeum vulgare clone DsC33 Ds insertion site flanking region genomic sequence Length = 556 Score = 188 bits (95), Expect = 1e-44 Identities = 95/95 (100%) Strand = Plus / Plus Query: 1 cagtgccaactgaaaacattctcaaagtgcataaccaaaacttccacatgcaaaacattc 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 55 cagtgccaactgaaaacattctcaaagtgcataaccaaaacttccacatgcaaaacattc 114 Query: 61 aaactcttacacacgctaaaacagtaggcagtggg 95 ||||||||||||||||||||||||||||||||||| Sbjct: 115 aaactcttacacacgctaaaacagtaggcagtggg 149 Score = 133 bits (67), Expect = 7e-28 Identities = 82/87 (94%), Gaps = 3/87 (3%) Strand = Plus / Plus Query: 428 gggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttnttcaccttc 487 ||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| Sbjct: 472 gggttcttctcaaagatctcgttgatggcgagcatctgg---ttggccttcttcaccttc 528 Query: 488 ttgagcttcctnaggaagtaccagaac 514 ||||||||||| ||||||||||||||| Sbjct: 529 ttgagcttcctcaggaagtaccagaac 555
>dbj|AP003249.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0435B05 Length = 150997 Score = 165 bits (83), Expect = 2e-37 Identities = 224/272 (82%) Strand = Plus / Plus Query: 175 gtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 234 ||||||||| ||||||||||| | || |||||||||||||| |||||||| | |||||| Sbjct: 65842 gtacaccagtgggaacttgatatctgacttgtggaactgcttagtgttgtcacgcttgca 65901 Query: 235 cagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtg 294 || || |||| || || ||||||||||||||||| ||||| ||| | | || ||||| Sbjct: 65902 gagtttaaagtggacagtagcagtcttgatgatctgaatgcaagggaatctgacacggtg 65961 Query: 295 ccgcgacgccatctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggta 354 || || |||||||| |||||||||||||| || | || || | || || || ||||| Sbjct: 65962 gcgggaagccatctcagtgtacatctgctcaacggcaccattgagggtggtatcacggta 66021 Query: 355 ctccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtantt 414 ||||||||||||||||||||| || ||||| |||||||| |||||||||||||| || || Sbjct: 66022 ctccttgtacatgttgtggtagccagtcctactctggtaacgcagccagatgccatagtt 66081 Query: 415 cttgatggnggtcgggttcttctcaaagatct 446 |||||| | || |||||||||||||| |||| Sbjct: 66082 cttgatagttgttgggttcttctcaaaaatct 66113 Score = 77.8 bits (39), Expect = 3e-11 Identities = 42/43 (97%) Strand = Plus / Plus Query: 507 accagaacttggacttggcgcggacctcgttggtggcccagag 549 |||||||||||||||||||||||||||||||||| |||||||| Sbjct: 66764 accagaacttggacttggcgcggacctcgttggtagcccagag 66806 Score = 54.0 bits (27), Expect = 5e-04 Identities = 55/65 (84%) Strand = Plus / Plus Query: 445 ctcgttgatggcgagcatctggccgttggccttnttcaccttcttgagcttcctnaggaa 504 |||||||||||| || ||||| |||||| ||| ||||||||||| ||||| | ||||| Sbjct: 66606 ctcgttgatggcaaggatctgcccgttgctcttcttcaccttcttcagcttgcggaggaa 66665 Query: 505 gtacc 509 ||||| Sbjct: 66666 gtacc 66670
>dbj|AP003237.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0046E05 Length = 162776 Score = 165 bits (83), Expect = 2e-37 Identities = 224/272 (82%) Strand = Plus / Plus Query: 175 gtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 234 ||||||||| ||||||||||| | || |||||||||||||| |||||||| | |||||| Sbjct: 146883 gtacaccagtgggaacttgatatctgacttgtggaactgcttagtgttgtcacgcttgca 146942 Query: 235 cagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtg 294 || || |||| || || ||||||||||||||||| ||||| ||| | | || ||||| Sbjct: 146943 gagtttaaagtggacagtagcagtcttgatgatctgaatgcaagggaatctgacacggtg 147002 Query: 295 ccgcgacgccatctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggta 354 || || |||||||| |||||||||||||| || | || || | || || || ||||| Sbjct: 147003 gcgggaagccatctcagtgtacatctgctcaacggcaccattgagggtggtatcacggta 147062 Query: 355 ctccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtantt 414 ||||||||||||||||||||| || ||||| |||||||| |||||||||||||| || || Sbjct: 147063 ctccttgtacatgttgtggtagccagtcctactctggtaacgcagccagatgccatagtt 147122 Query: 415 cttgatggnggtcgggttcttctcaaagatct 446 |||||| | || |||||||||||||| |||| Sbjct: 147123 cttgatagttgttgggttcttctcaaaaatct 147154 Score = 77.8 bits (39), Expect = 3e-11 Identities = 42/43 (97%) Strand = Plus / Plus Query: 507 accagaacttggacttggcgcggacctcgttggtggcccagag 549 |||||||||||||||||||||||||||||||||| |||||||| Sbjct: 147805 accagaacttggacttggcgcggacctcgttggtagcccagag 147847 Score = 54.0 bits (27), Expect = 5e-04 Identities = 55/65 (84%) Strand = Plus / Plus Query: 445 ctcgttgatggcgagcatctggccgttggccttnttcaccttcttgagcttcctnaggaa 504 |||||||||||| || ||||| |||||| ||| ||||||||||| ||||| | ||||| Sbjct: 147647 ctcgttgatggcaaggatctgcccgttgctcttcttcaccttcttcagcttgcggaggaa 147706 Query: 505 gtacc 509 ||||| Sbjct: 147707 gtacc 147711
>gb|DQ200390.1| Solanum tuberosum clone 067G06 unknown mRNA Length = 779 Score = 163 bits (82), Expect = 7e-37 Identities = 185/221 (83%) Strand = Plus / Minus Query: 302 gccatctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggtactccttg 361 |||||||| |||||||||||||||||||| || |||| || ||||| |||||||||||| Sbjct: 356 gccatctcagtgtacatctgctccacaccaccattcaatgtggtgtcacggtactccttg 297 Query: 362 tacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtanttcttgatg 421 |||||||||||||| || || || || ||||| || ||||| || || || |||||||| Sbjct: 296 tacatgttgtggtatccagttctactttggtaacggagccaaataccataattcttgatt 237 Query: 422 gnggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttnttc 481 | || ||||||||||| |||||||| || || || |||||||| |||||| ||| ||| Sbjct: 236 gttgttgggttcttctcgaagatctcattaatagccagcatctgaccgttgctcttcttc 177 Query: 482 accttcttgagcttcctnaggaagtaccagaacttggactt 522 |||||||| |||||||| | ||| |||||||| |||||||| Sbjct: 176 accttcttaagcttcctcaagaaataccagaatttggactt 136 Score = 71.9 bits (36), Expect = 2e-09 Identities = 57/64 (89%) Strand = Plus / Minus Query: 177 acaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcaca 236 |||||| ||||||||||||||| |||| ||||||||||| ||| | ||||||||||||| Sbjct: 481 acaccaacgggaacttgatcttggagtcatggaactgcttagtgctctccctcttgcaca 422 Query: 237 gctt 240 |||| Sbjct: 421 gctt 418
>ref|NM_179398.1| Arabidopsis thaliana structural constituent of ribosome AT1G29965 mRNA, complete cds Length = 774 Score = 153 bits (77), Expect = 7e-34 Identities = 204/248 (82%) Strand = Plus / Minus Query: 299 gacgccatctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggtactcc 358 ||||||||||| |||||||| |||||||| | || |||| ||| ||||| |||||||| Sbjct: 430 gacgccatctcagtgtacatttgctccactgctccattcaaagtagtgtcacggtactct 371 Query: 359 ttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtanttcttg 418 ||||||||||| |||||||| || | ||||||||| | || |||||| || | |||||| Sbjct: 370 ttgtacatgttatggtaacctgtacggctctggtatctcaaccagattccaaaattcttg 311 Query: 419 atggnggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttn 478 || | || ||||||||||||||||||||||||||||| |||||||| || || ||| Sbjct: 310 atcgttgttgggttcttctcaaagatctcgttgatggctagcatctgtccattactcttc 251 Query: 479 ttcaccttcttgagcttcctnaggaagtaccagaacttggacttggcgcggacctcgttg 538 ||||||||||| || |||| | | |||||||||||||||| ||||| | |||||||| Sbjct: 250 ttcaccttcttttgcctccttaagtagtaccagaacttggatttggcaagaacctcgttc 191 Query: 539 gtggccca 546 || ||||| Sbjct: 190 gttgccca 183 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Minus Query: 179 accagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 234 |||| ||||||||||||||| |||||| |||||||||||| | ||||||||||| Sbjct: 550 accaacgggaacttgatcttgctgttgtgaaactgcttcgtgctttccctcttgca 495
>gb|DQ235171.1| Solanum tuberosum clone 155B02 unknown mRNA Length = 722 Score = 153 bits (77), Expect = 7e-34 Identities = 204/248 (82%) Strand = Plus / Minus Query: 302 gccatctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggtactccttg 361 ||||| || ||||||||||| || ||||| || |||| || ||||| |||||||||||| Sbjct: 356 gccatttcagtgtacatctgttctacaccaccattcaatgtggtgtcacggtactccttg 297 Query: 362 tacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtanttcttgatg 421 |||||||| || || || ||||| || ||||| |||||||| || || || |||||||| Sbjct: 296 tacatgttatgatacccagtcctactttggtaacgcagccaaataccatagttcttgatt 237 Query: 422 gnggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttnttc 481 || |||| |||||||| ||||| ||||| || |||||||| || ||| ||| ||| Sbjct: 236 tttgttgggtatttctcaaaaatctcattgatagctagcatctgaccattgctcttcttc 177 Query: 482 accttcttgagcttcctnaggaagtaccagaacttggacttggcgcggacctcgttggtg 541 |||||||| |||||||| | |||||||||||||||||||||||| |||||||| || || Sbjct: 176 accttctttagcttcctcaagaagtaccagaacttggacttggcacggacctcatttgta 117 Query: 542 gcccagag 549 |||||||| Sbjct: 116 gcccagag 109 Score = 48.1 bits (24), Expect = 0.031 Identities = 54/64 (84%) Strand = Plus / Minus Query: 177 acaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcaca 236 |||||| |||||||||||| || |||| ||||||||||| ||| | |||| |||||| | Sbjct: 481 acaccaacgggaacttgattttggagtcatggaactgctttgtgctctcccgcttgcaga 422 Query: 237 gctt 240 |||| Sbjct: 421 gctt 418
>gb|BT000059.1| Arabidopsis thaliana 60S ribosomal protein L18A, putative (At1g29970) mRNA, complete cds Length = 633 Score = 153 bits (77), Expect = 7e-34 Identities = 204/248 (82%) Strand = Plus / Minus Query: 299 gacgccatctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggtactcc 358 ||||||||||| |||||||| |||||||| | || |||| ||| ||||| |||||||| Sbjct: 341 gacgccatctcagtgtacatttgctccactgctccattcaaagtagtgtcacggtactct 282 Query: 359 ttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtanttcttg 418 ||||||||||| |||||||| || | ||||||||| | || |||||| || | |||||| Sbjct: 281 ttgtacatgttatggtaacctgtacggctctggtatctcaaccagattccaaaattcttg 222 Query: 419 atggnggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttn 478 || | || ||||||||||||||||||||||||||||| |||||||| || || ||| Sbjct: 221 atcgttgttgggttcttctcaaagatctcgttgatggctagcatctgtccattactcttc 162 Query: 479 ttcaccttcttgagcttcctnaggaagtaccagaacttggacttggcgcggacctcgttg 538 ||||||||||| || |||| | | |||||||||||||||| ||||| | |||||||| Sbjct: 161 ttcaccttcttttgcctccttaagtagtaccagaacttggatttggcaagaacctcgttc 102 Query: 539 gtggccca 546 || ||||| Sbjct: 101 gttgccca 94 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Minus Query: 179 accagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 234 |||| ||||||||||||||| |||||| |||||||||||| | ||||||||||| Sbjct: 461 accaacgggaacttgatcttgctgttgtgaaactgcttcgtgctttccctcttgca 406
>gb|AY128411.1| Arabidopsis thaliana 60S ribosomal protein L18A, putative (At1g29970) mRNA, complete cds Length = 758 Score = 153 bits (77), Expect = 7e-34 Identities = 204/248 (82%) Strand = Plus / Minus Query: 299 gacgccatctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggtactcc 358 ||||||||||| |||||||| |||||||| | || |||| ||| ||||| |||||||| Sbjct: 418 gacgccatctcagtgtacatttgctccactgctccattcaaagtagtgtcacggtactct 359 Query: 359 ttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtanttcttg 418 ||||||||||| |||||||| || | ||||||||| | || |||||| || | |||||| Sbjct: 358 ttgtacatgttatggtaacctgtacggctctggtatctcaaccagattccaaaattcttg 299 Query: 419 atggnggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttn 478 || | || ||||||||||||||||||||||||||||| |||||||| || || ||| Sbjct: 298 atcgttgttgggttcttctcaaagatctcgttgatggctagcatctgtccattactcttc 239 Query: 479 ttcaccttcttgagcttcctnaggaagtaccagaacttggacttggcgcggacctcgttg 538 ||||||||||| || |||| | | |||||||||||||||| ||||| | |||||||| Sbjct: 238 ttcaccttcttttgcctccttaagtagtaccagaacttggatttggcaagaacctcgttc 179 Query: 539 gtggccca 546 || ||||| Sbjct: 178 gttgccca 171 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Minus Query: 179 accagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 234 |||| ||||||||||||||| |||||| |||||||||||| | ||||||||||| Sbjct: 538 accaacgggaacttgatcttgctgttgtgaaactgcttcgtgctttccctcttgca 483
>emb|BX816320.1|CNS0AD9L Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH40ZG05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1162 Score = 153 bits (77), Expect = 7e-34 Identities = 204/248 (82%) Strand = Plus / Minus Query: 299 gacgccatctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggtactcc 358 ||||||||||| |||||||| |||||||| | || |||| ||| ||||| |||||||| Sbjct: 859 gacgccatctcagtgtacatttgctccactgctccattcaaagtagtgtcacggtactct 800 Query: 359 ttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtanttcttg 418 ||||||||||| |||||||| || | ||||||||| | || |||||| || | |||||| Sbjct: 799 ttgtacatgttatggtaacctgtacggctctggtatctcaaccagattccaaaattcttg 740 Query: 419 atggnggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttn 478 || | || ||||||||||||||||||||||||||||| |||||||| || || ||| Sbjct: 739 atcgttgttgggttcttctcaaagatctcgttgatggctagcatctgtccattactcttc 680 Query: 479 ttcaccttcttgagcttcctnaggaagtaccagaacttggacttggcgcggacctcgttg 538 ||||||||||| || |||| | | |||||||||||||||| ||||| | |||||||| Sbjct: 679 ttcaccttcttttgcctccttaagtagtaccagaacttggatttggcaagaacctcgttc 620 Query: 539 gtggccca 546 || ||||| Sbjct: 619 gttgccca 612 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Minus Query: 179 accagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 234 |||| ||||||||||||||| |||||| |||||||||||| | ||||||||||| Sbjct: 979 accaacgggaacttgatcttgctgttgtgaaactgcttcgtgctttccctcttgca 924
>dbj|AB023038.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1 Length = 84462 Score = 147 bits (74), Expect = 4e-32 Identities = 211/255 (82%), Gaps = 2/255 (0%) Strand = Plus / Minus Query: 185 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagctt-gaa 243 |||||||||||||||||||| ||||||||||| ||| | || |||||||| ||||| | | Sbjct: 39811 gggaacttgatcttcgagttatggaactgcttggtgatctctctcttgcaaagctttgca 39752 Query: 244 gtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgc 303 | || |||||||||||||||||||| ||||| ||| | | ||| | || || || || Sbjct: 39751 ggg-acagtcgcagtcttgatgatctgaatgcaagggaacctcactctatgacgagaagc 39693 Query: 304 catctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggtactccttgta 363 |||||| ||||||||||||||||| || || || | || ||||| |||||||||||||| Sbjct: 39692 catctcagtgtacatctgctccactccaccattgagtgttgtgtcacggtactccttgta 39633 Query: 364 catgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtanttcttgatggn 423 |||||||||||| || || | |||||| || |||| |||||| ||||| |||||||||| Sbjct: 39632 catgttgtggtacccagttcggctctgataacgcaaccagatcccgtagttcttgatggt 39573 Query: 424 ggtcgggttcttctc 438 || ||||||||||| Sbjct: 39572 cgttgggttcttctc 39558 Score = 46.1 bits (23), Expect = 0.12 Identities = 51/61 (83%) Strand = Plus / Minus Query: 449 ttgatggcgagcatctggccgttggccttnttcaccttcttgagcttcctnaggaagtac 508 |||||||| |||||||| |||||| || ||||||||||| || ||||| | ||||||| Sbjct: 39462 ttgatggcaagcatctgtccgttgcttttcttcaccttcttcagtttcctcatgaagtac 39403 Query: 509 c 509 | Sbjct: 39402 c 39402 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 507 accagaacttggacttggcgc 527 ||||||||||||||||||||| Sbjct: 39310 accagaacttggacttggcgc 39290
>gb|AY389632.1| Hyacinthus orientalis ribosomal protein L18A (RPL18) mRNA, complete cds Length = 710 Score = 143 bits (72), Expect = 7e-31 Identities = 332/420 (79%), Gaps = 2/420 (0%) Strand = Plus / Minus Query: 128 gccttgtaggtggtcttgagcttgcgggtnnnnnnncgcaccttctggtacaccagcggg 187 |||||| |||||||||||||||| | ||| || ||||||| | |||| || ||| Sbjct: 518 gccttgaaggtggtcttgagcttcctggtgggcggccggaccttcttgaacacgaggggg 459 Query: 188 aacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaagtcc 247 || ||||||||||||| ||||||||||| ||| | || | |||||| |||||| | Sbjct: 458 aatttgatcttcgagtcatggaactgcttggtgctctcgcgcttgcagagcttggcgggg 399 Query: 248 accgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgccatc 307 | || || |||||||||||||||||||| ||| | | || | ||| || || ||||| Sbjct: 398 atggtggccgtcttgatgatctggatgcatgggaacctaaccctgtggcgtgatgccatt 339 Query: 308 tccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggtactccttgtacatg 367 || ||||||||||||||||| || || |||| || ||||| | |||||||||||||||| Sbjct: 338 tcagtgtacatctgctccactcctccattcagggtggtgtccctgtactccttgtacatg 279 Query: 368 ttgtggtaaccggtcctgctctggtagcgcagccagatgccgtanttct-tgatggnggt 426 | || || ||||| ||||||||||| | |||||| |||||||| |||| | || ||| Sbjct: 278 ta-tgatagccggttctgctctggtacctcagccatatgccgtagttctattattttggt 220 Query: 427 cgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttnttcacctt 486 |||||||||||||| ||||||||||| || || | ||||| || ||| ||||| || Sbjct: 219 ggggttcttctcaaatatctcgttgatagcaagaacttggccattactcttcttcacttt 160 Query: 487 cttgagcttcctnaggaagtaccagaacttggacttggcgcggacctcgttggtggccca 546 ||| |||||||| ||||| ||||| |||||||||||||| || || |||||||| ||||| Sbjct: 159 cttcagcttcctcaggaaataccaaaacttggacttggcccgaacttcgttggttgccca 100
>gb|DQ235168.1| Solanum tuberosum clone 154B10 unknown mRNA Length = 904 Score = 139 bits (70), Expect = 1e-29 Identities = 200/245 (81%) Strand = Plus / Minus Query: 302 gccatctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggtactccttg 361 |||||||| ||||||||||| || ||| | || |||| || || || |||||||||||| Sbjct: 383 gccatctctgtgtacatctgttctacagctccattcaatgtggtatcacggtactccttg 324 Query: 362 tacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtanttcttgatg 421 |||||||||||||| || || | ||||| || |||| ||| |||||||| |||||||| Sbjct: 323 tacatgttgtggtacccagtgcgactctgataacgcaaccaaatgccgtagttcttgatt 264 Query: 422 gnggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttnttc 481 || |||| ||||||||||||||| || || || |||||||| |||||| ||| || Sbjct: 263 ttagtagggtacttctcaaagatctcattaatagcaagcatctgcccgttgctcttctta 204 Query: 482 accttcttgagcttcctnaggaagtaccagaacttggacttggcgcggacctcgttggtg 541 |||||||| |||||||| | ||||||||||||||||| || || |||||||| ||||| Sbjct: 203 accttcttcagcttcctcaaaaagtaccagaacttggatttcgcacggacctcattggta 144 Query: 542 gccca 546 ||||| Sbjct: 143 gccca 139 Score = 50.1 bits (25), Expect = 0.008 Identities = 46/53 (86%) Strand = Plus / Minus Query: 185 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacag 237 ||||||||||| || |||| ||||||||||| ||| | |||||||||||||| Sbjct: 500 gggaacttgattttggagtcatggaactgcttggtgctctccctcttgcacag 448
>gb|BT014521.1| Lycopersicon esculentum clone 133914F, mRNA sequence Length = 810 Score = 123 bits (62), Expect = 6e-25 Identities = 234/293 (79%) Strand = Plus / Minus Query: 257 gtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgccatctccgtgtac 316 |||||||||||||||||||| | ||| || | ||| || || ||||| || |||||| Sbjct: 419 gtcttgatgatctggatgcagtgatgacggaccctgtggcgagaagccatttcagtgtac 360 Query: 317 atctgctccacaccgccgttcanagtcgtgtcgcggtactccttgtacatgttgtggtaa 376 ||||| || ||||| || |||| || || || |||||||||||||||||||| || || Sbjct: 359 atctgttctacaccaccattcaatgttgtatcacggtactccttgtacatgttatgatac 300 Query: 377 ccggtcctgctctggtagcgcagccagatgccgtanttcttgatggnggtcgggttcttc 436 || ||||| || ||||| |||||||| || || || |||||||| || |||| ||| Sbjct: 299 ccagtcctactttggtaacgcagccaaataccatagttcttgatttttgttgggtatttc 240 Query: 437 tcaaagatctcgttgatggcgagcatctggccgttggccttnttcaccttcttgagcttc 496 ||||| ||||| || || || |||||||| || ||| ||| ||||||||||| |||||| Sbjct: 239 tcaaaaatctcattaatagctagcatctgaccattgctcttcttcaccttctttagcttc 180 Query: 497 ctnaggaagtaccagaacttggacttggcgcggacctcgttggtggcccagag 549 || | ||||||||| ||||||||||| || |||||||| || || |||||||| Sbjct: 179 ctcaagaagtaccaaaacttggacttagcacggacctcattcgtagcccagag 127 Score = 56.0 bits (28), Expect = 1e-04 Identities = 55/64 (85%) Strand = Plus / Minus Query: 177 acaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcaca 236 |||||| |||||||||||| || |||| |||||||||||| ||| | |||| |||||| | Sbjct: 499 acaccaacgggaacttgattttggagtcgtggaactgctttgtgctctcccgcttgcaga 440 Query: 237 gctt 240 |||| Sbjct: 439 gctt 436
>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete sequence Length = 112763 Score = 121 bits (61), Expect = 3e-24 Identities = 211/262 (80%) Strand = Plus / Plus Query: 185 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaag 244 |||||||||||||| |||||||||||| || ||| | || ||||||||||||||| Sbjct: 103485 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttggct 103544 Query: 245 tccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgcc 304 || || || |||||||||||||| ||||| ||| | | || ||||| || || ||| Sbjct: 103545 gggacagtggctgtcttgatgatctgaatgcaagggaatctgacacggtgacgggatgcc 103604 Query: 305 atctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggtactccttgtac 364 ||||| |||||||||||||| ||| | ||||| | ||| ||||| ||||||||||||||| Sbjct: 103605 atctcagtgtacatctgctcaacagctccgttaagagtggtgtcacggtactccttgtac 103664 Query: 365 atgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtanttcttgatggng 424 ||||||||||| || || || |||||||| | || ||| || ||| | |||||||| | Sbjct: 103665 atgttgtggtacccagttctactctggtacctcaaccaaataccgaagttcttgatcgtt 103724 Query: 425 gtcgggttcttctcaaagatct 446 || |||||||||||| |||||| Sbjct: 103725 gttgggttcttctcatagatct 103746 Score = 61.9 bits (31), Expect = 2e-06 Identities = 48/54 (88%) Strand = Plus / Plus Query: 445 ctcgttgatggcgagcatctggccgttggccttnttcaccttcttgagcttcct 498 ||||||||||||||||||||| || || ||| |||||||||||||||||||| Sbjct: 104248 ctcgttgatggcgagcatctgtccattactcttcttcaccttcttgagcttcct 104301 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 507 accagaacttggacttggcgcggacctcgttggtggcccagag 549 ||||||||||||||||||| || |||||||| || |||||||| Sbjct: 104408 accagaacttggacttggcacgaacctcgttcgtagcccagag 104450
>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete sequence Length = 93060 Score = 121 bits (61), Expect = 3e-24 Identities = 211/262 (80%) Strand = Plus / Minus Query: 185 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaag 244 |||||||||||||| |||||||||||| || ||| | || ||||||||||||||| Sbjct: 70717 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttggct 70658 Query: 245 tccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgcc 304 || || || |||||||||||||| ||||| ||| | | || ||||| || || ||| Sbjct: 70657 gggacagtggctgtcttgatgatctgaatgcaagggaatctgacacggtgacgggatgcc 70598 Query: 305 atctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggtactccttgtac 364 ||||| |||||||||||||| ||| | ||||| | ||| ||||| ||||||||||||||| Sbjct: 70597 atctcagtgtacatctgctcaacagctccgttaagagtggtgtcacggtactccttgtac 70538 Query: 365 atgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtanttcttgatggng 424 ||||||||||| || || || |||||||| | || ||| || ||| | |||||||| | Sbjct: 70537 atgttgtggtacccagttctactctggtacctcaaccaaataccgaagttcttgatcgtt 70478 Query: 425 gtcgggttcttctcaaagatct 446 || |||||||||||| |||||| Sbjct: 70477 gttgggttcttctcatagatct 70456 Score = 61.9 bits (31), Expect = 2e-06 Identities = 48/54 (88%) Strand = Plus / Minus Query: 445 ctcgttgatggcgagcatctggccgttggccttnttcaccttcttgagcttcct 498 ||||||||||||||||||||| || || ||| |||||||||||||||||||| Sbjct: 69954 ctcgttgatggcgagcatctgtccattactcttcttcaccttcttgagcttcct 69901 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 507 accagaacttggacttggcgcggacctcgttggtggcccagag 549 ||||||||||||||||||| || |||||||| || |||||||| Sbjct: 69794 accagaacttggacttggcacgaacctcgttcgtagcccagag 69752
>gb|DQ226673.1| Boechera divaricarpa isolate SLW-348-443-C10 mRNA sequence Length = 312 Score = 105 bits (53), Expect = 2e-19 Identities = 136/165 (82%) Strand = Plus / Plus Query: 363 acatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtanttcttgatgg 422 ||||||| ||||| || || | |||||| || ||||||||||| || || |||||||| | Sbjct: 1 acatgttatggtatccagttcggctctgataacgcagccagataccataattcttgattg 60 Query: 423 nggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttnttca 482 |||||||||||||| || ||||| |||||||| |||||||| || ||| || |||| Sbjct: 61 tcgtcgggttcttctcgaaaatctcattgatggcaagcatctgcccattgcttttcttca 120 Query: 483 ccttcttgagcttcctnaggaagtaccagaacttggacttggcgc 527 ||||||| || ||||| | ||| ||||| |||||||||||||||| Sbjct: 121 ccttcttcagtttcctcatgaaataccaaaacttggacttggcgc 165
>dbj|AK110262.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-163-B05, full insert sequence Length = 885 Score = 105 bits (53), Expect = 2e-19 Identities = 127/152 (83%) Strand = Plus / Minus Query: 257 gtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgccatctccgtgtac 316 |||||||||||||||||||| ||| | ||||||||||| || || |||||||| ||||| Sbjct: 431 gtcttgatgatctggatgcaagggaagcgcacgcggtggcgtgatgccatctcgctgtac 372 Query: 317 atctgctccacaccgccgttcanagtcgtgtcgcggtactccttgtacatgttgtggtaa 376 ||||| ||||| | ||||| | || ||||| |||||||||||||||||||||||||| Sbjct: 371 atctggtccactgcaccgttgagggtggtgtcacggtactccttgtacatgttgtggtag 312 Query: 377 ccggtcctgctctggtagcgcagccagatgcc 408 || || | ||||||||||| ||||||||| Sbjct: 311 cctgtgcgtgactggtagcgcacccagatgcc 280
>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence, complete sequence Length = 82053 Score = 101 bits (51), Expect = 2e-18 Identities = 123/148 (83%) Strand = Plus / Plus Query: 299 gacgccatctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggtactcc 358 ||||||||||| |||||||| |||||||| | || |||| ||| ||||| |||||||| Sbjct: 20530 gacgccatctcagtgtacatttgctccactgctccattcaaagtagtgtcacggtactct 20589 Query: 359 ttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtanttcttg 418 ||||||||||| |||||||| || | ||||||||| | || |||||| || | |||||| Sbjct: 20590 ttgtacatgttatggtaacctgtacggctctggtatctcaaccagattccaaaattcttg 20649 Query: 419 atggnggtcgggttcttctcaaagatct 446 || | || ||||||||||||||||||| Sbjct: 20650 atcgttgttgggttcttctcaaagatct 20677 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Plus Query: 179 accagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 234 |||| ||||||||||||||| |||||| |||||||||||| | ||||||||||| Sbjct: 20410 accaacgggaacttgatcttgctgttgtgaaactgcttcgtgctttccctcttgca 20465
>gb|AF334839.1| Castanea sativa ribosomal protein L18a mRNA, complete cds Length = 775 Score = 83.8 bits (42), Expect = 6e-13 Identities = 184/233 (78%) Strand = Plus / Minus Query: 302 gccatctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggtactccttg 361 |||||||| ||||||| || |||||| | || || | ||| ||||| || |||||||| Sbjct: 421 gccatctcaatgtacatttgttccacagcaccatttagagtggtgtctcgatactcctta 362 Query: 362 tacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtanttcttgatg 421 ||||||||||| || || || | ||| || || ||||||||||| || || ||||| || Sbjct: 361 tacatgttgtgatacccagttcggctttgataccgcagccagataccataattcttaatc 302 Query: 422 gnggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttnttc 481 || || ||||||||||| ||||| ||||| || | |||||| || ||| ||| || Sbjct: 301 tttgtaggattcttctcaaaaatctcattgatagctaacatctgcccattgctcttctta 242 Query: 482 accttcttgagcttcctnaggaagtaccagaacttggacttggcgcggacctc 534 || ||||| |||||||| | |||||||||||||| |||||||| |||||||| Sbjct: 241 actttcttcagcttcctcaaaaagtaccagaacttcgacttggcacggacctc 189 Score = 48.1 bits (24), Expect = 0.031 Identities = 48/56 (85%) Strand = Plus / Minus Query: 179 accagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 234 ||||| ||||||||||| || || |||||||||||||| | | | ||||||||||| Sbjct: 544 accagagggaacttgattttggaattgtggaactgcttagagctctccctcttgca 489
>gb|BT016634.1| Zea mays clone Contig467 mRNA sequence Length = 859 Score = 73.8 bits (37), Expect = 5e-10 Identities = 101/123 (82%) Strand = Plus / Plus Query: 350 cggtactccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccg 409 ||||||||||||| || || ||||||||| ||||||| |||||| | |||||||||||| Sbjct: 537 cggtactccttgtgcaggtcgtggtaacctgtcctgcactggtaacacagccagatgcca 596 Query: 410 tanttcttgatggnggtcgggttcttctcaaagatctcgttgatggcgagcatctggccg 469 | |||||||| | || ||||| |||||| ||||||| |||||||| ||||| ||| Sbjct: 597 cagttcttgattgttgtagggttacactcaaatatctcgtctatggcgagaatctgaccg 656 Query: 470 ttg 472 ||| Sbjct: 657 ttg 659 Score = 69.9 bits (35), Expect = 8e-09 Identities = 71/83 (85%) Strand = Plus / Plus Query: 188 aacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaagtcc 247 ||||||| ||| || |||||||||||||| ||||||||||||||||| ||||| |||| Sbjct: 377 aacttgaactttgaattgtggaactgcttggtgttgtccctcttgcaaagcttaaagttg 436 Query: 248 accgtcgcagtcttgatgatctg 270 | || || |||||||||||||| Sbjct: 437 attgttgccgtcttgatgatctg 459 Score = 46.1 bits (23), Expect = 0.12 Identities = 46/54 (85%) Strand = Plus / Plus Query: 487 cttgagcttcctnaggaagtaccagaacttggacttggcgcggacctcgttggt 540 |||||||||||| || ||||||||| ||||| |||| || |||||||||||| Sbjct: 679 cttgagcttcctcagatagtaccagagattggatttggagcagacctcgttggt 732
>emb|BX820914.1|CNS0A9IE Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH81ZB06 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 705 Score = 73.8 bits (37), Expect = 5e-10 Identities = 84/99 (84%), Gaps = 1/99 (1%) Strand = Plus / Minus Query: 428 gggttcttctcaaagatctcgttgatggcgagcatctggccgttggcct-tnttcacctt 486 |||||||||||| |||||| |||||||||||||||||| || || || | |||||||| Sbjct: 199 gggttcttctcatagatcttgttgatggcgagcatctgtccattactctgtcttcacctt 140 Query: 487 cttgagcttcctnaggaagtaccagaacttggacttggc 525 |||||| ||||| | ||| |||||||| ||||| ||||| Sbjct: 139 cttgagtttcctcaagaaataccagaaattggatttggc 101 Score = 69.9 bits (35), Expect = 8e-09 Identities = 64/74 (86%) Strand = Plus / Minus Query: 302 gccatctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggtactccttg 361 |||||||| ||||||||||| || ||| | | ||| | ||| ||||| |||||||||||| Sbjct: 325 gccatctcagtgtacatctgttcaacagctctgttaagagtggtgtcacggtactccttg 266 Query: 362 tacatgttgtggta 375 |||||||||||||| Sbjct: 265 tacatgttgtggta 252
>emb|AJ718289.1| Nicotiana tabacum cDNA-AFLP-fragment BSTT4-43-380, cultivar Bright Yellow 2 Length = 320 Score = 67.9 bits (34), Expect = 3e-08 Identities = 60/69 (86%) Strand = Plus / Minus Query: 302 gccatctccgtgtacatctgctccacaccgccgttcanagtcgtgtcgcggtactccttg 361 |||||||| ||||||||||| |||||| | || |||| ||| || || |||||||||||| Sbjct: 109 gccatctcagtgtacatctgttccacagctccattcaaagtggtatctcggtactccttg 50 Query: 362 tacatgttg 370 ||||||||| Sbjct: 49 tacatgttg 41 Score = 40.1 bits (20), Expect = 7.4 Identities = 47/56 (83%) Strand = Plus / Minus Query: 185 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagctt 240 ||||||||||| || |||| ||||||||||| ||| | |||||||| || ||||| Sbjct: 226 gggaacttgattttggagtcatggaactgcttggtgctctccctcttacatagctt 171
>gb|AF548319.1| Branchiostoma belcheri ribosomal protein L18a mRNA, complete cds Length = 616 Score = 65.9 bits (33), Expect = 1e-07 Identities = 65/76 (85%) Strand = Plus / Minus Query: 346 gtcgcggtactccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagat 405 ||||||||||||| |||||||||||||| ||| | ||| | ||||||||||||||| Sbjct: 311 gtcgcggtactccctgtacatgttgtgggttccgcttctggagtcgtagcgcagccagat 252 Query: 406 gccgtanttcttgatg 421 |||||| ||||||||| Sbjct: 251 gccgtagttcttgatg 236
>gb|AC146330.33| Medicago truncatula clone mth2-7g7, complete sequence Length = 117139 Score = 58.0 bits (29), Expect = 3e-05 Identities = 59/69 (85%) Strand = Plus / Plus Query: 169 cttctggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccct 228 ||||| |||||||| ||||||||||| || || |||||||||||||| ||| | ||||| Sbjct: 19536 cttcttgtacaccaaggggaacttgattttggaattgtggaactgcttagtgctctccct 19595 Query: 229 cttgcacag 237 |||||||| Sbjct: 19596 tttgcacag 19604 Score = 50.1 bits (25), Expect = 0.008 Identities = 37/41 (90%) Strand = Plus / Plus Query: 506 taccagaacttggacttggcgcggacctcgttggtggccca 546 |||||||||||||| ||||| || ||||||||||| ||||| Sbjct: 20577 taccagaacttggatttggcacgaacctcgttggttgccca 20617 Score = 48.1 bits (24), Expect = 0.031 Identities = 99/125 (79%) Strand = Plus / Plus Query: 322 ctccacaccgccgttcanagtcgtgtcgcggtactccttgtacatgttgtggtaaccggt 381 ||||||| | ||||| | ||| || || ||||| ||||||||||| ||||| ||||| || Sbjct: 19689 ctccacagcaccgtttagagtagtatcacggtattccttgtacatattgtgataaccagt 19748 Query: 382 cctgctctggtagcgcagccagatgccgtanttcttgatggnggtcgggttcttctcaaa 441 | ||||| || |||||||| || ||||| ||||| || ||| || || |||||||| Sbjct: 19749 acgactctgataacgcagccaaattccgtagttcttaatcttggtaggatttttctcaaa 19808 Query: 442 gatct 446 ||||| Sbjct: 19809 gatct 19813
>ref|XM_524153.1| PREDICTED: Pan troglodytes similar to ribosomal protein L18a; 60S ribosomal protein L18a (LOC468766), mRNA Length = 390 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 321 cagcgggaacttgatcttggagtcgtggaactgctt 286
>ref|NM_000980.2| Homo sapiens ribosomal protein L18a (RPL18A), mRNA Length = 618 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 497 cagcgggaacttgatcttggagtcgtggaactgctt 462
>gb|U52111.3| Homo sapiens chromosome X clone Qc-7G6, QLL-F1720, QLL-C1335, Qc-8B7, Qc-11H12, Qc-7F6, QLL-E153, Qc-10E8, Qc-10B7 map q28, complete sequence Length = 247592 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 45832 cagcgggaacttgatcttggagtcgtggaactgctt 45797
>gb|AC089983.23| Homo sapiens 12 BAC RP11-818F20 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 204505 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 168555 cagcgggaacttgatcttggagtcgtggaactgctt 168520
>gb|BC098413.1| Homo sapiens cDNA clone IMAGE:6208834, **** WARNING: chimeric clone **** Length = 1360 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 1166 cagcgggaacttgatcttggagtcgtggaactgctt 1131
>gb|BC062307.1| Homo sapiens cDNA clone IMAGE:3504574, **** WARNING: chimeric clone **** Length = 1785 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 1608 cagcgggaacttgatcttggagtcgtggaactgctt 1573
>gb|BC071836.1| Homo sapiens cDNA clone IMAGE:6210072, **** WARNING: chimeric clone **** Length = 1360 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 1166 cagcgggaacttgatcttggagtcgtggaactgctt 1131
>gb|BC066319.1| Homo sapiens ribosomal protein L18a, mRNA (cDNA clone MGC:87208 IMAGE:5286436), complete cds Length = 632 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 501 cagcgggaacttgatcttggagtcgtggaactgctt 466
>gb|BC007512.2| Homo sapiens ribosomal protein L18a, mRNA (cDNA clone MGC:4476 IMAGE:2961519), complete cds Length = 616 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 481 cagcgggaacttgatcttggagtcgtggaactgctt 446
>emb|CR615832.1| full-length cDNA clone CS0DL001YB06 of B cells (Ramos cell line) Cot 25-normalized of Homo sapiens (human) Length = 602 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 481 cagcgggaacttgatcttggagtcgtggaactgctt 446
>emb|CR624588.1| full-length cDNA clone CS0DI021YD01 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 612 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 491 cagcgggaacttgatcttggagtcgtggaactgctt 456
>emb|CR619918.1| full-length cDNA clone CS0DM013YP23 of Fetal liver of Homo sapiens (human) Length = 1921 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 1802 cagcgggaacttgatcttggagtcgtggaactgctt 1767
>emb|CR619120.1| full-length cDNA clone CS0DI077YH09 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1912 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 1802 cagcgggaacttgatcttggagtcgtggaactgctt 1767
>emb|CR617184.1| full-length cDNA clone CS0DJ005YO06 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human) Length = 606 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 484 cagcgggaacttgatcttggagtcgtggaactgctt 449
>emb|CR606905.1| full-length cDNA clone CS0DC025YL04 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 604 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 483 cagcgggaacttgatcttggagtcgtggaactgctt 448
>emb|CR603612.1| full-length cDNA clone CS0DB009YJ04 of Neuroblastoma Cot 10-normalized of Homo sapiens (human) Length = 612 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 491 cagcgggaacttgatcttggagtcgtggaactgctt 456
>emb|CR600519.1| full-length cDNA clone CS0DC003YF24 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 605 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 484 cagcgggaacttgatcttggagtcgtggaactgctt 449
>emb|CR600845.1| full-length cDNA clone CS0DA007YA19 of Neuroblastoma of Homo sapiens (human) Length = 605 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 484 cagcgggaacttgatcttggagtcgtggaactgctt 449
>emb|CR594005.1| full-length cDNA clone CL0BB004ZF10 of Neuroblastoma of Homo sapiens (human) Length = 603 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 483 cagcgggaacttgatcttggagtcgtggaactgctt 448
>emb|CR592115.1| full-length cDNA clone CS0DI063YB22 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 601 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 482 cagcgggaacttgatcttggagtcgtggaactgctt 447
>ref|NR_001593.1| Homo sapiens similar to ribosomal protein L18a; 60S ribosomal protein L18a (LOC390354) on chromosome 12 Length = 616 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 501 cagcgggaacttgatcttggagtcgtggaactgctt 466
>ref|XM_938382.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a (LOC347544), mRNA Length = 574 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 462 cagcgggaacttgatcttggagtcgtggaactgctt 427
>ref|XM_293412.3| PREDICTED: Homo sapiens similar to ribosomal protein L18a (LOC347544), mRNA Length = 574 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 462 cagcgggaacttgatcttggagtcgtggaactgctt 427
>ref|XM_945469.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a, transcript variant 6 (LOC285053), mRNA Length = 588 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 465 cagcgggaacttgatcttggagtcgtggaactgctt 430
>ref|XM_945465.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a, transcript variant 5 (LOC285053), mRNA Length = 557 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 434 cagcgggaacttgatcttggagtcgtggaactgctt 399
>ref|XM_941835.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a, transcript variant 4 (LOC285053), mRNA Length = 659 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 511 cagcgggaacttgatcttggagtcgtggaactgctt 476
>ref|XM_934020.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a, transcript variant 3 (LOC285053), mRNA Length = 588 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 465 cagcgggaacttgatcttggagtcgtggaactgctt 430
>ref|XM_934018.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a, transcript variant 2 (LOC285053), mRNA Length = 557 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 434 cagcgggaacttgatcttggagtcgtggaactgctt 399
>ref|XM_208281.6| PREDICTED: Homo sapiens similar to ribosomal protein L18a, transcript variant 1 (LOC285053), mRNA Length = 659 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 511 cagcgggaacttgatcttggagtcgtggaactgctt 476
>dbj|AK222647.1| Homo sapiens mRNA for ribosomal protein L18a variant, clone: CBL08590 Length = 594 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 497 cagcgggaacttgatcttggagtcgtggaactgctt 462
>gb|AC079250.7| Homo sapiens BAC clone RP11-62I18 from 2, complete sequence Length = 82938 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 78637 cagcgggaacttgatcttggagtcgtggaactgctt 78672
>gb|L05093.1|HUMRIBPROD Homo sapiens ribosomal protein L18a mRNA, complete cds Length = 602 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 481 cagcgggaacttgatcttggagtcgtggaactgctt 446
>gb|BC071920.1| Homo sapiens ribosomal protein L18a, mRNA (cDNA clone MGC:88602 IMAGE:6293838), complete cds Length = 622 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 481 cagcgggaacttgatcttggagtcgtggaactgctt 446
>gb|AF045188.1|AF045188 Salmo salar ribosomal protein L18a mRNA, complete cds Length = 607 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Minus Query: 185 gggaacttgatcttcgagttgtggaactgctt 216 ||||||||||||||||||| |||||||||||| Sbjct: 474 gggaacttgatcttcgagtcgtggaactgctt 443
>emb|X80822.1|HSPLORF H.sapiens mRNA for ORF Length = 657 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 181 cagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||||||||| |||| |||||||||||| Sbjct: 487 cagcgggaacttgatcttggagtcgtggaactgctt 452
>gb|AY232187.1| Drosophila yakuba clone yak-ad_RpL18A mRNA sequence Length = 240 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 179 accagcgggaacttgatcttcgagttgtggaactgcttc 217 ||||| ||||||||||||||||| | ||||||||||||| Sbjct: 173 accagagggaacttgatcttcgaatcgtggaactgcttc 135
>gb|AY231805.1| Drosophila yakuba clone yak-em_RpL18A mRNA sequence Length = 528 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 179 accagcgggaacttgatcttcgagttgtggaactgcttc 217 ||||| |||||||||||||| |||| ||||||||||||| Sbjct: 461 accagagggaacttgatcttggagtcgtggaactgcttc 423
>emb|BX053393.1|CNS09DD1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC31AB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 165 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 111 caccagcgggaatcggatcttcgagttgtggaactgctt 149
>emb|BX072011.1|CNS09RQ7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9DB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 702 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 434 caccagcgggaatcggatcttcgagttgtggaactgctt 472
>emb|BX072010.1|CNS09RQ6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9DB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 773 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 506 caccagcgggaatcggatcttcgagttgtggaactgctt 468
>emb|BX071935.1|CNS09RO3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9CF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 940 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 414 caccagcgggaatcggatcttcgagttgtggaactgctt 452
>emb|BX071934.1|CNS09RO2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9CF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 492 caccagcgggaatcggatcttcgagttgtggaactgctt 454
>emb|BX071198.1|CNS09R3M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8CE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 951 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 407 caccagcgggaatcggatcttcgagttgtggaactgctt 445
>emb|BX071197.1|CNS09R3L Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8CE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 482 caccagcgggaatcggatcttcgagttgtggaactgctt 444
>emb|BX071326.1|CNS09R76 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8DC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 482 caccagcgggaatcggatcttcgagttgtggaactgctt 444
>emb|BX071022.1|CNS09QYQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8BE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 909 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 422 caccagcgggaatcggatcttcgagttgtggaactgctt 460
>emb|BX071021.1|CNS09QYP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8BE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 885 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 497 caccagcgggaatcggatcttcgagttgtggaactgctt 459
>emb|BX070958.1|CNS09QWY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8BC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 931 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 420 caccagcgggaatcggatcttcgagttgtggaactgctt 458
>emb|BX070094.1|CNS09Q8Y Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7AA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 684 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 479 caccagcgggaatcggatcttcgagttgtggaactgctt 441
>emb|BX069977.1|CNS09Q5P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6DD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 489 caccagcgggaatcggatcttcgagttgtggaactgctt 451
>emb|BX069941.1|CNS09Q4P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6DC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 694 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 413 caccagcgggaatcggatcttcgagttgtggaactgctt 451
>emb|BX069940.1|CNS09Q4O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6DC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 932 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 467 caccagcgggaatcggatcttcgagttgtggaactgctt 429
>emb|BX069703.1|CNS09PY3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6BH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 950 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 392 caccagcgggaatcggatcttcgagttgtggaactgctt 430
>emb|BX069702.1|CNS09PY2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6BH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 940 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 476 caccagcgggaatcggatcttcgagttgtggaactgctt 438
>emb|BX060940.1|CNS09J6O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41CB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 392 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 348 caccagcgggaatcggatcttcgagttgtggaactgctt 386
>emb|BX060939.1|CNS09J6N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41CB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 944 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 476 caccagcgggaatcggatcttcgagttgtggaactgctt 438
>emb|BX069369.1|CNS09POT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6AA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 577 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 437 caccagcgggaatcggatcttcgagttgtggaactgctt 475
>emb|BX069368.1|CNS09POS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6AA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 503 caccagcgggaatcggatcttcgagttgtggaactgctt 465
>emb|BX069214.1|CNS09PKI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53DB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 981 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 441 caccagcgggaatcggatcttcgagttgtggaactgctt 479
>emb|BX069213.1|CNS09PKH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53DB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 972 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 493 caccagcgggaatcggatcttcgagttgtggaactgctt 455
>emb|BX068918.1|CNS09PCA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53BE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 975 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 443 caccagcgggaatcggatcttcgagttgtggaactgctt 481
>emb|BX068917.1|CNS09PC9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53BE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 990 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 516 caccagcgggaatcggatcttcgagttgtggaactgctt 478
>emb|BX068781.1|CNS09P8H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53AG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 514 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 447 caccagcgggaatcggatcttcgagttgtggaactgctt 485
>emb|BX068780.1|CNS09P8G Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 974 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 501 caccagcgggaatcggatcttcgagttgtggaactgctt 463
>emb|BX068699.1|CNS09P67 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53AC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 896 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 435 caccagcgggaatcggatcttcgagttgtggaactgctt 473
>emb|BX068698.1|CNS09P66 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 966 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 486 caccagcgggaatcggatcttcgagttgtggaactgctt 448
>emb|BX068685.1|CNS09P5T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53AC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 796 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 271 caccagcgggaatcggatcttcgagttgtggaactgctt 309
>emb|BX068632.1|CNS09P4C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52DH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 469 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 401 caccagcgggaatcggatcttcgagttgtggaactgctt 439
>emb|BX068631.1|CNS09P4B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52DH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 962 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 494 caccagcgggaatcggatcttcgagttgtggaactgctt 456
>emb|BX068389.1|CNS09OXL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52CD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 968 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 494 caccagcgggaatcggatcttcgagttgtggaactgctt 456
>emb|BX068343.1|CNS09OWB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52BH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 894 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 387 caccagcgggaatcggatcttcgagttgtggaactgctt 425
>emb|BX068342.1|CNS09OWA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 858 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 471 caccagcgggaatcggatcttcgagttgtggaactgctt 433
>emb|BX068334.1|CNS09OW2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 954 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 488 caccagcgggaatcggatcttcgagttgtggaactgctt 450
>emb|BX068304.1|CNS09OV8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 978 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 500 caccagcgggaatcggatcttcgagttgtggaactgctt 462
>emb|BX068271.1|CNS09OUB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52BE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 538 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 347 caccagcgggaatcggatcttcgagttgtggaactgctt 385
>emb|BX068270.1|CNS09OUA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 910 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 483 caccagcgggaatcggatcttcgagttgtggaactgctt 445
>emb|BX068265.1|CNS09OU5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52BE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 790 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 411 caccagcgggaatcggatcttcgagttgtggaactgctt 449
>emb|BX068264.1|CNS09OU4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 741 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 490 caccagcgggaatcggatcttcgagttgtggaactgctt 452
>emb|BX068004.1|CNS09OMW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52AA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 832 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 400 caccagcgggaatcggatcttcgagttgtggaactgctt 438
>emb|BX068003.1|CNS09OMV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52AA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 822 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 470 caccagcgggaatcggatcttcgagttgtggaactgctt 432
>emb|BX067731.1|CNS09OFB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51CB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 887 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 422 caccagcgggaatcggatcttcgagttgtggaactgctt 460
>emb|BX067730.1|CNS09OFA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51CB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 977 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 492 caccagcgggaatcggatcttcgagttgtggaactgctt 454
>emb|BX067102.1|CNS09NXU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50CE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 564 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 438 caccagcgggaatcggatcttcgagttgtggaactgctt 476
>emb|BX067101.1|CNS09NXT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50CE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 801 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 500 caccagcgggaatcggatcttcgagttgtggaactgctt 462
>emb|BX066999.1|CNS09NUZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50CA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 755 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 430 caccagcgggaatcggatcttcgagttgtggaactgctt 468
>emb|BX066998.1|CNS09NUY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50CA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 869 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 494 caccagcgggaatcggatcttcgagttgtggaactgctt 456
>emb|BX066931.1|CNS09NT3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50BF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 968 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 491 caccagcgggaatcggatcttcgagttgtggaactgctt 453
>emb|BX066843.1|CNS09NQN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50BB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 804 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 429 caccagcgggaatcggatcttcgagttgtggaactgctt 467
>emb|BX066842.1|CNS09NQM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50BB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 499 caccagcgggaatcggatcttcgagttgtggaactgctt 461
>emb|BX066697.1|CNS09NML Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50AD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 613 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 495 caccagcgggaatcggatcttcgagttgtggaactgctt 457
>emb|BX066444.1|CNS09NFK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5DA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 815 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 486 caccagcgggaatcggatcttcgagttgtggaactgctt 448
>emb|BX065769.1|CNS09MWT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49DB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 648 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 419 caccagcgggaatcggatcttcgagttgtggaactgctt 457
>emb|BX065768.1|CNS09MWS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49DB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 873 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 497 caccagcgggaatcggatcttcgagttgtggaactgctt 459
>emb|BX065563.1|CNS09MR3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49CA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 853 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 401 caccagcgggaatcggatcttcgagttgtggaactgctt 439
>emb|BX065562.1|CNS09MR2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49CA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 913 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 522 caccagcgggaatcggatcttcgagttgtggaactgctt 484
>emb|BX065379.1|CNS09MLZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49BA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 955 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 425 caccagcgggaatcggatcttcgagttgtggaactgctt 463
>emb|BX065287.1|CNS09MJF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49AD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 779 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 410 caccagcgggaatcggatcttcgagttgtggaactgctt 448
>emb|BX065286.1|CNS09MJE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49AD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 854 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 480 caccagcgggaatcggatcttcgagttgtggaactgctt 442
>emb|BX065104.1|CNS09MEC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48DD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 814 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 407 caccagcgggaatcggatcttcgagttgtggaactgctt 445
>emb|BX065103.1|CNS09MEB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48DD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 943 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 479 caccagcgggaatcggatcttcgagttgtggaactgctt 441
>emb|BX065085.1|CNS09MDT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48DC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 681 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 311 caccagcgggaatcggatcttcgagttgtggaactgctt 273
>emb|BX065080.1|CNS09MDO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48DC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 895 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 402 caccagcgggaatcggatcttcgagttgtggaactgctt 440
>emb|BX065079.1|CNS09MDN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48DC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 928 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 481 caccagcgggaatcggatcttcgagttgtggaactgctt 443
>emb|BX065033.1|CNS09MCD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48DA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 824 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 402 caccagcgggaatcggatcttcgagttgtggaactgctt 440
>emb|BX065032.1|CNS09MCC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48DA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 919 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 471 caccagcgggaatcggatcttcgagttgtggaactgctt 433
>emb|BX064042.1|CNS09LKU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46AF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 463 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 27 caccagcgggaatcggatcttcgagttgtggaactgctt 65
>emb|BX064041.1|CNS09LKT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46AF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 497 caccagcgggaatcggatcttcgagttgtggaactgctt 459
>emb|BX063680.1|CNS09LAS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45CF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 824 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 361 caccagcgggaatcggatcttcgagttgtggaactgctt 323
>emb|BX063679.1|CNS09LAR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45CF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 951 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 412 caccagcgggaatcggatcttcgagttgtggaactgctt 450
>emb|BX063678.1|CNS09LAQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45CF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 922 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 476 caccagcgggaatcggatcttcgagttgtggaactgctt 438
>emb|BX063630.1|CNS09L9E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45CC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 555 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 424 caccagcgggaatcggatcttcgagttgtggaactgctt 462
>emb|BX063629.1|CNS09L9D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45CC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 552 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 489 caccagcgggaatcggatcttcgagttgtggaactgctt 451
>emb|BX063028.1|CNS09KSO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44CE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 851 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 413 caccagcgggaatcggatcttcgagttgtggaactgctt 451
>emb|BX063027.1|CNS09KSN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44CE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 904 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 610 caccagcgggaatcggatcttcgagttgtggaactgctt 572
>emb|BX062931.1|CNS09KPZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44BG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 485 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 422 caccagcgggaatcggatcttcgagttgtggaactgctt 460
>emb|BX062913.1|CNS09KPH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44BG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 858 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 411 caccagcgggaatcggatcttcgagttgtggaactgctt 449
>emb|BX062912.1|CNS09KPG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44BG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 860 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 484 caccagcgggaatcggatcttcgagttgtggaactgctt 446
>emb|BX062805.1|CNS09KMH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44BB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 953 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 489 caccagcgggaatcggatcttcgagttgtggaactgctt 451
>emb|BX062755.1|CNS09KL3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44AG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 695 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 350 caccagcgggaatcggatcttcgagttgtggaactgctt 312
>emb|BX062625.1|CNS09KHH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44AA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 884 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 405 caccagcgggaatcggatcttcgagttgtggaactgctt 443
>emb|BX062624.1|CNS09KHG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44AA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 890 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 480 caccagcgggaatcggatcttcgagttgtggaactgctt 442
>emb|BX062166.1|CNS09K4Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43BC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 865 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 417 caccagcgggaatcggatcttcgagttgtggaactgctt 455
>emb|BX062165.1|CNS09K4P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43BC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 816 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 490 caccagcgggaatcggatcttcgagttgtggaactgctt 452
>emb|BX062118.1|CNS09K3E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43BA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 914 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 486 caccagcgggaatcggatcttcgagttgtggaactgctt 448
>emb|BX062090.1|CNS09K2M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43AH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 921 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 455 caccagcgggaatcggatcttcgagttgtggaactgctt 417
>emb|BX061845.1|CNS09JVT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42DD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 800 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 435 caccagcgggaatcggatcttcgagttgtggaactgctt 473
>emb|BX061844.1|CNS09JVS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42DD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 681 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 475 caccagcgggaatcggatcttcgagttgtggaactgctt 437
>emb|BX061453.1|CNS09JKX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42BB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 862 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 305 caccagcgggaatcggatcttcgagttgtggaactgctt 343
>emb|BX061452.1|CNS09JKW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42BB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 846 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 392 caccagcgggaatcggatcttcgagttgtggaactgctt 354
>emb|BX061383.1|CNS09JIZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42AF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 931 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 473 caccagcgggaatcggatcttcgagttgtggaactgctt 435
>emb|BX061292.1|CNS09JGG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42AA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 916 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 416 caccagcgggaatcggatcttcgagttgtggaactgctt 454
>emb|BX061291.1|CNS09JGF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42AA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 916 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 480 caccagcgggaatcggatcttcgagttgtggaactgctt 442
>emb|BX061184.1|CNS09JDG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41DD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 947 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 480 caccagcgggaatcggatcttcgagttgtggaactgctt 442
>emb|BX060474.1|CNS09ITQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 892 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 501 caccagcgggaatcggatcttcgagttgtggaactgctt 463
>emb|BX060315.1|CNS09IPB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40CE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 801 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 353 caccagcgggaatcggatcttcgagttgtggaactgctt 391
>emb|BX060314.1|CNS09IPA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40CE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 596 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 489 caccagcgggaatcggatcttcgagttgtggaactgctt 451
>emb|BX060072.1|CNS09IIK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40BC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1043 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 736 caccagcgggaatcggatcttcgagttgtggaactgctt 698
>emb|BX059980.1|CNS09IG0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40AF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 947 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 426 caccagcgggaatcggatcttcgagttgtggaactgctt 464
>emb|BX059979.1|CNS09IFZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40AF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 755 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 494 caccagcgggaatcggatcttcgagttgtggaactgctt 456
>emb|BX059598.1|CNS09I5E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4CB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 901 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 412 caccagcgggaatcggatcttcgagttgtggaactgctt 450
>emb|BX059597.1|CNS09I5D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4CB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 945 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 492 caccagcgggaatcggatcttcgagttgtggaactgctt 454
>emb|BX059276.1|CNS09HWG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4AB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 949 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 474 caccagcgggaatcggatcttcgagttgtggaactgctt 436
>emb|BX059262.1|CNS09HW2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4AA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 949 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 499 caccagcgggaatcggatcttcgagttgtggaactgctt 461
>emb|BX059231.1|CNS09HV7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39DH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 437 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 19 caccagcgggaatcggatcttcgagttgtggaactgctt 57
>emb|BX059230.1|CNS09HV6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39DH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 954 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 480 caccagcgggaatcggatcttcgagttgtggaactgctt 442
>emb|BX058872.1|CNS09HL8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39BH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 938 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 384 caccagcgggaatcggatcttcgagttgtggaactgctt 422
>emb|BX058871.1|CNS09HL7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39BH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 928 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 463 caccagcgggaatcggatcttcgagttgtggaactgctt 425
>emb|BX058808.1|CNS09HJG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39BE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 905 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 396 caccagcgggaatcggatcttcgagttgtggaactgctt 434
>emb|BX058807.1|CNS09HJF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39BE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 932 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 462 caccagcgggaatcggatcttcgagttgtggaactgctt 424
>emb|BX058560.1|CNS09HCK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39AB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 955 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 401 caccagcgggaatcggatcttcgagttgtggaactgctt 439
>emb|BX058559.1|CNS09HCJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39AB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 690 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 478 caccagcgggaatcggatcttcgagttgtggaactgctt 440
>emb|BX058281.1|CNS09H4T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC38CD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 420 caccagcgggaatcggatcttcgagttgtggaactgctt 458
>emb|BX058280.1|CNS09H4S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38CD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 958 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 497 caccagcgggaatcggatcttcgagttgtggaactgctt 459
>emb|BX058269.1|CNS09H4H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38CC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 738 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 426 caccagcgggaatcggatcttcgagttgtggaactgctt 388
>emb|BX056753.1|CNS09FYD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC36BC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 559 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 417 caccagcgggaatcggatcttcgagttgtggaactgctt 455
>emb|BX056602.1|CNS09FU6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC36AB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 575 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 27 caccagcgggaatcggatcttcgagttgtggaactgctt 65
>emb|BX056601.1|CNS09FU5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36AB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 457 caccagcgggaatcggatcttcgagttgtggaactgctt 419
>emb|BX057958.1|CNS09GVU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38AE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 942 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 470 caccagcgggaatcggatcttcgagttgtggaactgctt 432
>emb|BX056891.1|CNS09G27 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36CC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 779 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 491 caccagcgggaatcggatcttcgagttgtggaactgctt 453
>emb|BX056571.1|CNS09FTB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35DH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 896 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 424 caccagcgggaatcggatcttcgagttgtggaactgctt 386
>emb|BX056553.1|CNS09FST Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC35DG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 847 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 410 caccagcgggaatcggatcttcgagttgtggaactgctt 448
>emb|BX056552.1|CNS09FSS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35DG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 739 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 460 caccagcgggaatcggatcttcgagttgtggaactgctt 422
>emb|BX056479.1|CNS09FQR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC35DB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 833 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 406 caccagcgggaatcggatcttcgagttgtggaactgctt 444
>emb|BX056478.1|CNS09FQQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35DB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 861 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 470 caccagcgggaatcggatcttcgagttgtggaactgctt 432
>emb|BX056309.1|CNS09FM1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35CB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 927 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 469 caccagcgggaatcggatcttcgagttgtggaactgctt 431
>emb|BX056040.1|CNS09FEK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34DG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 651 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 415 caccagcgggaatcggatcttcgagttgtggaactgctt 453
>emb|BX056039.1|CNS09FEJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34DG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 844 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 488 caccagcgggaatcggatcttcgagttgtggaactgctt 450
>emb|BX055724.1|CNS09F5S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34BH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 983 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 435 caccagcgggaatcggatcttcgagttgtggaactgctt 473
>emb|BX055723.1|CNS09F5R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34BH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 468 caccagcgggaatcggatcttcgagttgtggaactgctt 430
>emb|BX055717.1|CNS09F5L Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34BG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 544 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 433 caccagcgggaatcggatcttcgagttgtggaactgctt 471
>emb|BX055643.1|CNS09F3J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34BD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 911 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 436 caccagcgggaatcggatcttcgagttgtggaactgctt 474
>emb|BX055642.1|CNS09F3I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34BD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 942 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 486 caccagcgggaatcggatcttcgagttgtggaactgctt 448
>emb|BX055566.1|CNS09F1E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34AH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 474 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 407 caccagcgggaatcggatcttcgagttgtggaactgctt 445
>emb|BX055565.1|CNS09F1D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34AH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 957 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 508 caccagcgggaatcggatcttcgagttgtggaactgctt 470
>emb|BX055542.1|CNS09F0Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34AG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 892 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 415 caccagcgggaatcggatcttcgagttgtggaactgctt 453
>emb|BX055541.1|CNS09F0P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34AG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 944 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 494 caccagcgggaatcggatcttcgagttgtggaactgctt 456
>emb|BX055478.1|CNS09EYY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34AE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 942 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 396 caccagcgggaatcggatcttcgagttgtggaactgctt 434
>emb|BX055405.1|CNS09EWX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34AA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 432 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 303 caccagcgggaatcggatcttcgagttgtggaactgctt 341
>emb|BX055404.1|CNS09EWW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34AA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 858 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 498 caccagcgggaatcggatcttcgagttgtggaactgctt 460
>emb|BX055221.1|CNS09ERT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC33DA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 947 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 484 caccagcgggaatcggatcttcgagttgtggaactgctt 446
>emb|BX053165.1|CNS09D6P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30CG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 891 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 450 caccagcgggaatcggatcttcgagttgtggaactgctt 412
>emb|BX055118.1|CNS09EOY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC33CD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 692 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 437 caccagcgggaatcggatcttcgagttgtggaactgctt 399
>emb|BX054551.1|CNS09E97 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC32DA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 565 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 399 caccagcgggaatcggatcttcgagttgtggaactgctt 437
>emb|BX054550.1|CNS09E96 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32DA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 752 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 476 caccagcgggaatcggatcttcgagttgtggaactgctt 438
>emb|BX054490.1|CNS09E7I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC32CF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 726 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 405 caccagcgggaatcggatcttcgagttgtggaactgctt 443
>emb|BX054489.1|CNS09E7H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32CF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 775 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 491 caccagcgggaatcggatcttcgagttgtggaactgctt 453
>emb|BX054096.1|CNS09DWK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC32AE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 512 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 435 caccagcgggaatcggatcttcgagttgtggaactgctt 473
>emb|BX054095.1|CNS09DWJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32AE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 737 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 490 caccagcgggaatcggatcttcgagttgtggaactgctt 452
>emb|BX053786.1|CNS09DNY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31CF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 716 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 338 caccagcgggaatcggatcttcgagttgtggaactgctt 300
>emb|BX052786.1|CNS09CW6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC30AD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 891 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 424 caccagcgggaatcggatcttcgagttgtggaactgctt 462
>emb|BX052785.1|CNS09CW5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30AD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 909 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 493 caccagcgggaatcggatcttcgagttgtggaactgctt 455
>emb|BX052679.1|CNS09CT7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC3DF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 948 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 410 caccagcgggaatcggatcttcgagttgtggaactgctt 448
>emb|BX052678.1|CNS09CT6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC3DF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 734 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 328 caccagcgggaatcggatcttcgagttgtggaactgctt 290
>emb|BX052629.1|CNS09CRT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC3DC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 824 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 406 caccagcgggaatcggatcttcgagttgtggaactgctt 444
>emb|BX052628.1|CNS09CRS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC3DC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 698 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 330 caccagcgggaatcggatcttcgagttgtggaactgctt 292
>emb|BX052573.1|CNS09CQ9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC3CH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 950 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 412 caccagcgggaatcggatcttcgagttgtggaactgctt 450
>emb|BX052572.1|CNS09CQ8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC3CH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 949 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 481 caccagcgggaatcggatcttcgagttgtggaactgctt 443
>emb|BX052510.1|CNS09COI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC3CE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 979 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 423 caccagcgggaatcggatcttcgagttgtggaactgctt 461
>emb|BX052509.1|CNS09COH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC3CE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 957 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 478 caccagcgggaatcggatcttcgagttgtggaactgctt 440
>emb|BX052467.1|CNS09CNB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC3CC05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 950 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 178 caccagcgggaacttgatcttcgagttgtggaactgctt 216 |||||||||||| |||||||||||||||||||||||| Sbjct: 416 caccagcgggaatcggatcttcgagttgtggaactgctt 454 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,468,859 Number of Sequences: 3902068 Number of extensions: 3468859 Number of successful extensions: 64800 Number of sequences better than 10.0: 621 Number of HSP's better than 10.0 without gapping: 621 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 63106 Number of HSP's gapped (non-prelim): 1673 length of query: 549 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 526 effective length of database: 17,143,297,704 effective search space: 9017374592304 effective search space used: 9017374592304 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)