ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags20n02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene 1100 0.0
2gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt... 1100 0.0
3emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA 757 0.0
4emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene 640 e-180
5emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid tra... 517 e-143
6gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer prote... 458 e-125
7emb|X68656.1|HVCW19 H.vulgare Cw-19 mRNA 406 e-110
8gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid... 347 3e-92
9gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipi... 347 3e-92
10emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non sp... 347 3e-92
11emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific l... 331 2e-87
12emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non sp... 331 2e-87
13emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for ... 325 1e-85
14gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipi... 323 4e-85
15gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) g... 214 3e-52
16gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein ... 214 3e-52
17gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) m... 210 4e-51
18gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein ... 206 6e-50
19emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non sp... 206 6e-50
20gb|AY754742.1| Triticum aestivum lipid transfer protein (LTP2) m... 196 6e-47
21gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid... 194 2e-46
22gb|AY789644.1| Triticum aestivum lipid transfer protein 4 (LTP4)... 186 6e-44
23emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid tr... 159 1e-35
24emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA 143 8e-31
25emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA 131 3e-27
26gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome... 96 2e-16
27dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 96 2e-16
28dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clon... 96 2e-16
29dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 96 2e-16
30gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 96 2e-16
31dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 92 3e-15
32emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15 92 3e-15
33dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clon... 92 3e-15
34gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 92 3e-15
35emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136... 92 3e-15
36emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein 86 2e-13
37gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) m... 86 2e-13
38gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid tran... 84 6e-13
39dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 6e-13
40dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 6e-13
41emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa... 84 6e-13
42gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT I... 78 4e-11
43gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA,... 78 4e-11
44emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA 76 1e-10
45emb|X71667.1|SVLTP1 S.vulgare ltp1 gene 76 1e-10
46gb|AF017360.1|AF017360 Oryza sativa lipid transfer protein LPT I... 76 1e-10
47emb|X71668.1|SVLTP2 S.vulgare ltp2 gene 72 2e-09
48gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid tran... 68 4e-08
49emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, comp... 68 4e-08
50emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1 68 4e-08
51dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 4e-08
52dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 4e-08
53dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 4e-08
54gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT I... 68 4e-08
55gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA... 68 4e-08
56gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transf... 68 4e-08
57gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfe... 68 4e-08
58gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transf... 68 4e-08
59gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholi... 68 4e-08
60gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholip... 68 4e-08
61gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transf... 68 4e-08
62gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfe... 68 4e-08
63gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transf... 68 4e-08
64gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfe... 68 4e-08
65gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfe... 68 4e-08
66gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfe... 68 4e-08
67gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transf... 68 4e-08
68gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transf... 68 4e-08
69gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfe... 68 4e-08
70gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transf... 68 4e-08
71gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transf... 68 4e-08
72gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholi... 68 4e-08
73gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholi... 68 4e-08
74gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholi... 68 4e-08
75gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phosphol... 68 4e-08
76gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholi... 68 4e-08
77gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholip... 68 4e-08
78gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholip... 68 4e-08
79gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholi... 68 4e-08
80gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholi... 68 4e-08
81gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholip... 68 4e-08
82gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholip... 68 4e-08
83gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholip... 68 4e-08
84dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 64 6e-07
85dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic D... 64 6e-07
86gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence 60 9e-06
87gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfe... 60 9e-06
88gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholi... 60 9e-06
89gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholi... 60 9e-06
90gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholi... 60 9e-06
91gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phosphol... 60 9e-06
92gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholip... 60 9e-06
93gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholip... 60 9e-06
94gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholip... 60 9e-06
95gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholip... 60 9e-06
96gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholip... 60 9e-06
97gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phosphol... 60 9e-06
98gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholip... 60 9e-06
99gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3... 60 9e-06
100gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, co... 60 9e-06
101dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
102dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
103dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
104dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
105gb|AC131676.2| Mus musculus BAC clone RP23-330L3 from chromosome... 52 0.002
106emb|CT025614.7| Mouse DNA sequence from clone RP23-418B18 on chr... 52 0.002
107gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precurs... 52 0.002
108gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholip... 52 0.002
109gb|AC131678.4| Mus musculus BAC clone RP23-333L1 from chromosome... 50 0.009
110gb|AC147066.2| Pan troglodytes BAC clone RP43-164F2 from 7, comp... 50 0.009
111gb|AC146512.2| Pan troglodytes BAC clone RP43-16E21 from 7, comp... 50 0.009
112gb|AC006332.3| Homo sapiens BAC clone RP11-376O14 from 7, comple... 50 0.009
113gb|AC102367.35| Mus musculus chromosome 3, clone RP23-211J6, com... 50 0.009
114gb|AC099975.11| Mus musculus chromosome 5, clone RP23-23A2, comp... 48 0.034
115gb|AC122011.3| Mus musculus chromosome 10 clone RP24-352E6, comp... 48 0.034
116gb|AC166342.3| Mus musculus BAC clone RP24-340A12 from chromosom... 48 0.034
117gb|AC129336.4| Mus musculus BAC clone RP23-113I7 from chromosome... 48 0.034
118gb|AC116383.11| Mus musculus chromosome 5, clone RP23-15P21, com... 48 0.034
119gb|AC100506.17| Mus musculus chromosome 9, clone RP23-144D3, com... 48 0.034
120gb|AC161590.2| Mus musculus BAC clone RP24-300B21 from chromosom... 48 0.034
121emb|AL683843.9| Mouse DNA sequence from clone RP23-217E1 on chro... 48 0.034
122gb|AC009205.6|AC009205 Drosophila melanogaster, chromosome 2L, r... 48 0.034
123gb|AC011756.5|AC011756 Drosophila melanogaster, chromosome 2L, r... 48 0.034
124gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid... 48 0.034
125gb|AC005126.4|AC005126 Drosophila melanogaster, chromosome 2L, r... 48 0.034
126gb|AE003661.3| Drosophila melanogaster chromosome 2L, section 70... 48 0.034
127emb|AL451076.14| Mouse DNA sequence from clone RP23-43O20 on chr... 48 0.034
128gb|AC164875.14| Mus musculus chromosome 1, clone RP23-59P14, com... 48 0.034
129emb|AL732451.8| Mouse DNA sequence from clone RP23-85G19 on chro... 48 0.034
130gb|AC129931.19| Mus musculus chromosome 15, clone RP23-136I22, c... 46 0.13
131gb|AC131596.10| Mus musculus chromosome 10, clone RP23-476G10, c... 46 0.13
132gb|AC146296.3| Mus musculus BAC clone RP23-277D1 from chromosome... 46 0.13
133gb|AC122928.4| Mus musculus BAC clone RP23-10G8 from 9, complete... 46 0.13
134gb|AC121605.3| Mus musculus BAC clone RP23-312E16 from 1, comple... 46 0.13
135emb|AL391870.16| Human DNA sequence from clone RP11-491C24 on ch... 46 0.13
136emb|AL390785.15| Human DNA sequence from clone RP11-325N9 on chr... 46 0.13
137gb|AC159096.2| Mus musculus chromosome 1, clone RP24-95N15, comp... 46 0.13
138gb|AC098971.2| Homo sapiens chromosome 3 clone RP11-118N13, comp... 46 0.13
139gb|AC113370.2| Homo sapiens chromosome 5 clone RP11-124O5, compl... 46 0.13
140gb|AC109469.2| Homo sapiens chromosome 5 clone RP11-349F8, compl... 46 0.13
141gb|AC010474.5| Homo sapiens chromosome 5 clone CTD-2306F13, comp... 46 0.13
142emb|BX855592.19| Zebrafish DNA sequence from clone CH211-232K3, ... 46 0.13
143gb|AC107028.5| Homo sapiens 3 BAC RP11-547K2 (Roswell Park Cance... 46 0.13
144gb|AC104823.4| Homo sapiens BAC clone RP11-762E8 from 2, complet... 46 0.13
145gb|AC012450.9| Homo sapiens BAC clone RP11-351J7 from 2, complet... 46 0.13
146gb|AC093927.3| Homo sapiens chromosome 3 clone RP11-81I24, compl... 46 0.13
147gb|AC139299.3| Mus musculus BAC clone RP23-335D20 from 1, comple... 46 0.13
148gb|AC160762.4| Mus musculus BAC clone RP24-330E8 from chromosome... 46 0.13
149emb|AL772393.11| Mouse DNA sequence from clone RP23-398D18 on ch... 46 0.13
150gb|AC153526.13| Mus musculus 10 BAC RP23-383C2 (Roswell Park Can... 44 0.53
151gb|DP000014.1| Callithrix jacchus target 1 genomic scaffold 44 0.53
152gb|AC145272.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.53
153gb|AC158148.5| Mus musculus chromosome 1, clone RP24-353B6, comp... 44 0.53
154gb|AE014849.1| Plasmodium falciparum 3D7 chromosome 12, section ... 44 0.53
155gb|AY020626.1| Oryza sativa microsatellite MRG2951 containing (T... 44 0.53
156gb|AC128597.3| Rattus norvegicus BAC CH230-62C6 (Children's Hos... 44 0.53
157gb|AC115061.20| Mus musculus chromosome 1, clone RP24-399G3, com... 44 0.53
158gb|AC137612.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.53
159gb|AC166816.2| Mus musculus chromosome 5, clone RP24-321O22, com... 44 0.53
160gb|BT015295.1| Drosophila melanogaster GH02989 full insert cDNA 44 0.53
161gb|AC130649.2| Drosophila melanogaster clone BACR06L03, complete... 44 0.53
162gb|AC132440.3| Mus musculus BAC clone RP23-239I24 from chromosom... 44 0.53
163gb|AC142111.3| Mus musculus BAC clone RP24-63G9 from chromosome ... 44 0.53
164gb|AC158789.4| Mus musculus chromosome 5, clone RP23-192C21, com... 44 0.53
165gb|AY519500.1| Gallus gallus CNR/Pcdh-alpha gene cluster, comple... 44 0.53
166gb|AY190953.1| Drosophila virilis clone DVIF01_19_E15 (D1419) ge... 44 0.53
167gb|AC144808.2| Mus musculus BAC clone RP24-434O1 from chromosome... 44 0.53
168gb|AC134434.4| Mus musculus BAC clone RP24-420E8 from chromosome... 44 0.53
169gb|AC122386.3| Mus musculus BAC clone RP24-72H18 from chromosome... 44 0.53
170gb|AC133210.3| Mus musculus chromosome UNK clone RP23-27L12, com... 44 0.53
171gb|AC125234.4| Mus musculus BAC clone RP23-14K16 from 13, comple... 44 0.53
172gb|AC122187.3| Mus musculus BAC clone RP23-21P2 from 1, complete... 44 0.53
173gb|AC122037.2| Mus musculus BAC clone RP24-426D9 from 3, complet... 44 0.53
174gb|AC112261.4| Mus musculus BAC clone RP23-204O17 from 3, comple... 44 0.53
175emb|CR695648.1|CNS0FZPO Tetraodon nigroviridis full-length cDNA 44 0.53
176emb|CR692447.2|CNS0FX8R Tetraodon nigroviridis full-length cDNA 44 0.53
177emb|CR691712.2|CNS0FWOC Tetraodon nigroviridis full-length cDNA 44 0.53
178emb|CR683623.2|CNS0FQFN Tetraodon nigroviridis full-length cDNA 44 0.53
179gb|AC092108.4| Homo sapiens BAC clone RP11-1263I10 from 7, compl... 44 0.53
180emb|CR681376.2|CNS0FOP8 Tetraodon nigroviridis full-length cDNA 44 0.53
181emb|CR678828.2|CNS0FMQG Tetraodon nigroviridis full-length cDNA 44 0.53
182emb|CR675215.2|CNS0FJYT Tetraodon nigroviridis full-length cDNA 44 0.53
183emb|CR675000.2|CNS0FJSU Tetraodon nigroviridis full-length cDNA 44 0.53
184emb|CR669102.2|CNS0FF90 Tetraodon nigroviridis full-length cDNA 44 0.53
185emb|CR662543.2|CNS0FA6T Tetraodon nigroviridis full-length cDNA 44 0.53
186emb|CR662776.2|CNS0FADA Tetraodon nigroviridis full-length cDNA 44 0.53
187emb|CR658057.2|CNS0F6Q7 Tetraodon nigroviridis full-length cDNA 44 0.53
188gb|AC107769.7| Mus musculus chromosome 16, clone RP23-130N20, co... 44 0.53
189gb|AC119848.8| Mus musculus chromosome 7, clone RP23-73B20, comp... 44 0.53
190gb|AC165338.3| Mus musculus BAC clone RP24-456K15 from chromosom... 44 0.53
191emb|AL390248.10| Human DNA sequence from clone RP11-492M23 on ch... 44 0.53
192emb|AL807736.6| Human DNA sequence from clone RP1-248F5 on chrom... 44 0.53
193emb|AL592067.4| Human DNA sequence from clone RP11-361H7 on chro... 44 0.53
194emb|AL450427.11| Human DNA sequence from clone RP11-372H19 on ch... 44 0.53
195emb|AL513189.13| Human DNA sequence from clone RP11-339I11 on ch... 44 0.53
196gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome 44 0.53
197emb|AL583830.7| Human DNA sequence from clone RP11-172L10 on chr... 44 0.53
198emb|AL442636.3| Human DNA sequence from clone RP11-322F18 on chr... 44 0.53
199emb|AL360015.25| Human DNA sequence from clone RP11-344F20 on ch... 44 0.53
200emb|AL357129.11| Human DNA sequence from clone RP11-114A21 on ch... 44 0.53
201gb|AC112406.5| Rattus norvegicus 11 BAC CH230-329D3 (Children's ... 44 0.53
202emb|AL161724.10| Human DNA sequence from clone RP11-114E4 on chr... 44 0.53
203gb|AC099563.3| Homo sapiens chromosome 1 clone RP11-323K10, comp... 44 0.53
204gb|AC163635.5| Mus musculus BAC clone RP23-183F13 from chromosom... 44 0.53
205emb|CR382400.1| Plasmodium falciparum chromosome 6, complete seq... 44 0.53
206emb|AL596096.7| Mouse DNA sequence from clone RP23-42P20 on chro... 44 0.53
207gb|AC163678.3| Mus musculus BAC clone RP24-104D14 from chromosom... 44 0.53
208gb|AC182032.3| Spermophilus tridecemlineatus clone VMRC20-712F8,... 44 0.53
209gb|AC162392.9| Mus musculus 6 BAC RP23-197G11 (Roswell Park Canc... 44 0.53
210emb|AL592080.26| Mouse DNA sequence from clone RP23-102H10 on ch... 44 0.53
211emb|AL928625.5| Mouse DNA sequence from clone RP24-528P17 on chr... 44 0.53
212emb|BX511201.3|RN177J12 Rattus norvegicus chromosome 1 BAC RP32-... 44 0.53
213gb|AC091973.4| Homo sapiens chromosome 5 clone RP11-51B6, comple... 44 0.53
214gb|AF461688.1| Drosophila virilis even-skipped 5' cis-regulatory... 44 0.53
215gb|AC084768.4| Homo sapiens chromosome 8, clone RP11-281H11, com... 44 0.53
216ref|NM_176778.1| Drosophila melanogaster lethal (1) G0196 CG1461... 44 0.53
217gb|AC107022.4| Homo sapiens 3 BAC RP11-417H23 (Roswell Park Canc... 44 0.53
218gb|AC100768.2| Homo sapiens chromosome 11, clone RP11-945A11, co... 44 0.53
219gb|AF449447.1| Mus musculus C3H chromosome 3 hyplip1 region 44 0.53
220gb|AC063944.25| Homo sapiens 3 BAC RP11-446H18 (Roswell Park Can... 44 0.53
221gb|AC023886.7| Homo sapiens BAC clone RP11-402J6 from 4, complet... 44 0.53
222gb|AC007425.16| Homo sapiens 12q24.1-120.5-B PAC RPCI5-1048I22 (... 44 0.53
223gb|AC092694.6| Homo sapiens 3q BAC RP11-172A10 (Roswell Park Can... 44 0.53
224gb|AC073878.7| Homo sapiens BAC clone RP11-744I24 from 7, comple... 44 0.53
225gb|AC097379.2| Homo sapiens BAC clone RP11-277G18 from 4, comple... 44 0.53
226gb|AC099542.2| Homo sapiens chromosome 3 clone RP11-520D19, comp... 44 0.53
227gb|AC109466.2| Homo sapiens chromosome 5 clone RP11-308N24, comp... 44 0.53
228dbj|AK141195.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE... 44 0.53
229gb|AC104515.1| Drosophila melanogaster, chromosome X, region 20B... 44 0.53
230gb|AC010471.4| Homo sapiens chromosome 5 clone CTD-2300P22, comp... 44 0.53
231gb|AC022313.5| Homo sapiens BAC clone RP11-437G1 from 4, complet... 44 0.53
232gb|AC153134.5| Mus musculus BAC clone RP24-202N2 from chromosome... 44 0.53
233gb|AC162182.2| Mus musculus BAC clone RP23-73B23 from chromosome... 44 0.53
234gb|AC146740.3| Callithrix jacchus clone CH259-204H2, complete se... 44 0.53
235gb|AC007145.10| Drosophila melanogaster, chromosome 2L, region 3... 44 0.53
236gb|AC020937.6| Homo sapiens chromosome 5 clone CTD-2299I21, comp... 44 0.53
237emb|CR405841.1| Gallus gallus finished cDNA, clone ChEST885e19 44 0.53
238dbj|AK032932.1| Mus musculus 12 days embryo male wolffian duct i... 44 0.53
239gb|AC159809.2| Mus musculus BAC clone RP24-216P6 from chromosome... 44 0.53
240gb|AC008502.8| Homo sapiens chromosome 5 clone CTC-442G11, compl... 44 0.53
241gb|AC008680.5|AC008680 Homo sapiens chromosome 5 clone CTB-53I9,... 44 0.53
242dbj|AK048247.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 44 0.53
243ref|NG_004818.1| Gallus gallus cadherin-related neuronal recepto... 44 0.53
244dbj|AK085615.1| Mus musculus 0 day neonate kidney cDNA, RIKEN fu... 44 0.53
245gb|AC018694.4|AC018694 Homo sapiens BAC clone RP11-563P16 from 1... 44 0.53
246dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.53
247dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.53
248gb|AC106895.5| Homo sapiens BAC clone RP11-161D15 from 4, comple... 44 0.53
249gb|AC007709.4|AC007709 Drosophila melanogaster, chromosome 3R, r... 44 0.53
250gb|AC010744.7| Homo sapiens BAC clone RP11-548D17 from 2, comple... 44 0.53
251gb|AC153948.5| Mus musculus 10 BAC RP24-507K2 (Roswell Park Canc... 44 0.53
252gb|AC017033.5| Homo sapiens BAC clone RP11-297J22 from 2, comple... 44 0.53
253gb|AC012361.10| Homo sapiens BAC clone RP11-348P18 from 2, compl... 44 0.53
254gb|AC004944.1|AC004944 Homo sapiens PAC clone RP5-991O23 from 8,... 44 0.53
255gb|AC138779.2| Homo sapiens BAC clone RP11-601I15 from 4, comple... 44 0.53
256gb|AC010384.4|AC010384 Homo sapiens chromosome 5 clone CTD-2071N... 44 0.53
257gb|AC108112.2| Homo sapiens chromosome 5 clone RP11-267A15, comp... 44 0.53
258gb|AC126673.3| Mus musculus BAC clone RP24-491A6 from chromosome... 44 0.53
259dbj|AP005836.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.53
260dbj|AP005508.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.53
261emb|AL954678.8| Zebrafish DNA sequence from clone CH211-207E14 i... 44 0.53
262emb|BX679665.3| Mouse DNA sequence from clone RP23-247J17 on chr... 44 0.53
263gb|AC156934.1| Mus musculus BAC clone RP24-425B15 from 7, comple... 44 0.53
264gb|AC124129.13| Mus musculus chromosome 5, clone RP23-198B3, com... 44 0.53
265gb|AC120854.15| Mus musculus chromosome 7, clone RP23-329B6, com... 44 0.53
266emb|CT010479.25| Mouse DNA sequence from clone RP23-233G23 on ch... 44 0.53
267emb|CT010474.12| Mouse DNA sequence from clone RP23-199B14 on ch... 44 0.53
268gb|AC007176.1|AC007176 Drosophila melanogaster, chromosome 2L, r... 44 0.53
269gb|AE003691.4| Drosophila melanogaster chromosome 3R, section 29... 44 0.53
270gb|AE003662.3| Drosophila melanogaster chromosome 2L, section 71... 44 0.53
271gb|AE003574.6| Drosophila melanogaster chromosome X, section 73 ... 44 0.53
272gb|AC138765.9| Mus musculus chromosome 15, clone RP23-30B1, comp... 44 0.53
273emb|AL929248.12| Mouse DNA sequence from clone RP23-354I18 on ch... 44 0.53
274emb|BX510318.4| Mouse DNA sequence from clone RP23-29O1 on chrom... 44 0.53
275gb|AC105072.9| Mus musculus chromosome 5, clone RP24-167C6, comp... 44 0.53
276emb|AJ488904.1|MMU488904 Mus musculus partial Sall4 gene for Sal... 44 0.53
277gb|AC005515.1|AC005515 Homo sapiens chromosome 19, cosmid F19346... 44 0.53
278dbj|AP003158.1| Mus musculus genomic DNA, chromosome 16q clone:R... 44 0.53
279dbj|AP003156.1| Mus musculus genomic DNA, chromosome 16q clone:R... 44 0.53
280emb|AL645602.14| Mouse DNA sequence from clone RP23-79E13 on chr... 44 0.53
281emb|AL672073.8| Mouse DNA sequence from clone RP23-333P16 on chr... 44 0.53
282gb|AC004104.1|AC004104 Homo sapiens 12q24 PAC RPCI5-942N13 (Rosw... 44 0.53
283gb|AC132481.4| Mus musculus BAC clone RP23-14I14 from 17, comple... 44 0.53
284gb|AC148007.3| Mus musculus BAC clone RP23-273G4 from 1, complet... 44 0.53
285gb|AC140308.2| Mus musculus BAC clone RP23-424G15 from 1, comple... 44 0.53
286gb|AC134463.3| Mus musculus BAC clone RP23-425N12 from 5, comple... 44 0.53
287emb|CR936841.11| Mouse DNA sequence from clone DN-491F10 on chro... 44 0.53
288gb|AC171211.1| Mus musculus BAC clone RP23-34I14 from chromosome... 44 0.53
289gb|AC170913.2| Mus musculus BAC clone RP23-197F6 from chromosome... 44 0.53
290emb|AL626783.16| Mouse DNA sequence from clone RP23-406B13 on ch... 44 0.53
291emb|AL627211.13| Mouse DNA sequence from clone RP23-104G20 on ch... 44 0.53
292emb|AL807779.12| Mouse DNA sequence from clone RP23-82E21 on chr... 44 0.53
293emb|AL845283.4| Mouse DNA sequence from clone RP23-151F21 on chr... 44 0.53
294emb|AL732478.7| Mouse DNA sequence from clone RP23-42N14 on chro... 44 0.53
295emb|AJ250736.1|TAV250736 Trypanosoma avium mini-exon, strain LSH... 44 0.53
296emb|AL663032.9| Mouse DNA sequence from clone RP23-27I6 on chrom... 44 0.53
297gb|AY870329.1| Homo sapiens thyroid autoantigen 70kDa (Ku antige... 42 2.1
298gb|AC120405.7| Mus musculus chromosome 1, clone RP24-409F22, com... 42 2.1
299gb|AC114644.10| Mus musculus chromosome 1, clone RP24-128L10, co... 42 2.1
300gb|AC113493.9| Mus musculus chromosome 15, clone RP23-359H23, co... 42 2.1
301gb|AC130283.8| Mus musculus chromosome 15, clone RP23-136E18, co... 42 2.1
302gb|AC153802.1| Mus musculus 6 NOVECTOR RP24-79H20 (Roswell Park ... 42 2.1
303gb|AC102616.7| Mus musculus chromosome 18, clone RP23-425L21, co... 42 2.1
304gb|AC165299.13| Mus musculus chromosome 15, clone RP23-266F2, co... 42 2.1
305gb|AC110195.14| Mus musculus chromosome 3, clone RP24-291L17, co... 42 2.1
306gb|AC168306.7| Mus musculus chromosome 18, clone RP23-225N9, com... 42 2.1
307gb|AC155712.8| Mus musculus 10 BAC RP24-183O8 (Roswell Park Canc... 42 2.1
308gb|AC113300.7| Mus musculus chromosome 5, clone RP23-430C4, comp... 42 2.1
309gb|AC113586.14| Mus musculus chromosome 8, clone RP23-17D24, com... 42 2.1
310gb|AC114917.2| Mus musculus chromosome 8 clone RP23-84K6, comple... 42 2.1
311gb|AC139064.13| Mus musculus chromosome 1, clone RP23-76C20, com... 42 2.1
312gb|AC163684.5| Mus musculus BAC clone RP23-8N10 from chromosome ... 42 2.1
313gb|AC154520.3| Mus musculus BAC clone RP23-471P16 from chromosom... 42 2.1
314gb|AC169129.2| Mus musculus BAC clone RP23-259N3 from chromosome... 42 2.1
315gb|AC165236.5| Mus musculus chromosome 5, clone RP23-348C18, com... 42 2.1
316gb|AC007441.9| Drosophila melanogaster clone BACR10E03, complete... 42 2.1
317ref|NM_197968.1| Homo sapiens zinc finger protein 198 (ZNF198), ... 42 2.1
318ref|NM_003453.2| Homo sapiens zinc finger protein 198 (ZNF198), ... 42 2.1
319gb|AC115846.7| Mus musculus chromosome 1, clone RP24-245O4, comp... 42 2.1
320gb|DP000016.1| Pan troglodytes target 1 genomic scaffold 42 2.1
321gb|AF033804.1|AH006117S3 Tilapia mossambica insulin-like growth ... 42 2.1
322gb|AC161799.5| Mus musculus chromosome 15, clone RP23-304B13, co... 42 2.1
323gb|AC161210.5| Mus musculus chromosome 3, clone RP23-71N6, compl... 42 2.1
324gb|AC158767.3| Mus musculus chromosome 1, clone RP24-128E5, comp... 42 2.1
325gb|CP000081.1| Leishmania major chromosome 35, complete sequence 42 2.1
326gb|AY534123.1|SEG_AY534122S2 Aegilops tauschii transposons Caspa... 42 2.1
327gb|AF076671.1| Zosterops lateralis chlorocephala clone ZL37, mic... 42 2.1
328gb|AY024131.1| Oryza sativa microsatellite MRG6456 containing (T... 42 2.1
329gb|AY023747.1| Oryza sativa microsatellite MRG6072 containing (A... 42 2.1
330gb|CP000069.1| Trypanosoma brucei chromosome 6, complete sequence 42 2.1
331gb|CP000066.1| Trypanosoma brucei chromosome 3, complete sequence 42 2.1
332gb|AC074259.14| Trypanosoma brucei chromosome 6 clone RPCI93-4M1... 42 2.1
333gb|AC138196.3| Oryza sativa (japonica cultivar-group) chromosome... 42 2.1
334gb|AC116949.11| Oryza sativa (japonica cultivar-group) chromosom... 42 2.1
335gb|AC105379.11| Trypanosoma brucei chromosome 3 clone RPCI93-30P... 42 2.1
336gb|AC007865.8| Trypanosoma brucei chromosome 2 clone RPCI93-30M2... 42 2.1
337gb|AC007863.15| Trypanosoma brucei chromosome 6 clone RPCI93-26G... 42 2.1
338gb|AE017150.2| Trypanosoma brucei chromosome 2, complete sequence 42 2.1
339gb|AC130666.9| Mus musculus chromosome 5, clone RP24-79O7, compl... 42 2.1
340gb|AC161262.2| Mus musculus BAC clone RP23-325G1 from chromosome... 42 2.1
341gb|AC157570.5| Mus musculus BAC clone RP23-105H5 from chromosome... 42 2.1
342gb|AC161587.2| Mus musculus BAC clone RP24-492G17 from chromosom... 42 2.1
343gb|AC154641.2| Mus musculus BAC clone RP23-276C17 from chromosom... 42 2.1
344gb|AC147187.2| Pan troglodytes clone CH251-116A11, complete sequ... 42 2.1
345gb|AC120555.9| Mus musculus chromosome 12, clone RP24-311D18, co... 42 2.1
346gb|AC132835.7| Mus musculus chromosome 1, clone RP24-490C20, com... 42 2.1
347gb|AC003067.59| Mus musculus Chromosome 16 BAC Clone tbx3 Synten... 42 2.1
348gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genom... 42 2.1
349gb|BC070803.1| Xenopus laevis hypothetical protein MGC83869, mRN... 42 2.1
350gb|AC146029.4| Pan troglodytes BAC clone RP43-124D5 from 7, comp... 42 2.1
351gb|AC087841.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 42 2.1
352gb|AC119952.12| Mus musculus chromosome 14, clone RP24-448F1, co... 42 2.1
353gb|AC095825.6| Rattus norvegicus 4 BAC CH230-9J6 (Children's Hos... 42 2.1
354gb|AC121307.7| Mus musculus chromosome 15, clone RP24-209E20, co... 42 2.1
355gb|AC161473.5| Pan troglodytes BAC clone CH251-460F23 from chrom... 42 2.1
356ref|NM_182899.3| Homo sapiens cAMP responsive element binding pr... 42 2.1
357ref|NM_182898.2| Homo sapiens cAMP responsive element binding pr... 42 2.1
358ref|NM_001011666.1| Homo sapiens cAMP responsive element binding... 42 2.1
359ref|NM_004904.2| Homo sapiens cAMP responsive element binding pr... 42 2.1
360gb|AC120554.12| Mus musculus chromosome 1, clone RP24-285E3, com... 42 2.1
361gb|AC147381.3| Pan troglodytes BAC clone RP43-162H15 from 7, com... 42 2.1
362gb|AC147087.3| Pan troglodytes BAC clone RP43-59E13 from 7, comp... 42 2.1
363gb|AC115297.7| Mus musculus BAC clone RP23-205H11 from chromosom... 42 2.1
364gb|AC147020.2| Mus musculus BAC clone RP23-267A11 from chromosom... 42 2.1
365gb|AC140482.2| Mus musculus BAC clone RP24-133E1 from chromosome... 42 2.1
366gb|AC148078.2| Mus musculus BAC clone RP24-186K12 from chromosom... 42 2.1
367gb|AC147124.2| Mus musculus BAC clone RP24-163K4 from chromosome... 42 2.1
368gb|AC124361.4| Mus musculus BAC clone RP24-528I8 from chromosome... 42 2.1
369gb|AC157901.4| Mus musculus chromosome 18, clone RP23-189P21, co... 42 2.1
370gb|AC109262.13| Mus musculus chromosome 1, clone RP23-31H15, com... 42 2.1
371gb|AC132844.7| Mus musculus chromosome 17, clone RP24-481P13, co... 42 2.1
372gb|AC137691.7| Mus musculus chromosome 13, clone RP23-104G24, co... 42 2.1
373gb|AC133908.7| Mus musculus chromosome 5, clone RP24-299L9, comp... 42 2.1
374gb|AC099594.6| Mus musculus chromosome 15, clone RP23-458G7, com... 42 2.1
375gb|AC115000.7| Mus musculus chromosome 1, clone RP24-103F2, comp... 42 2.1
376gb|AC123711.14| Mus musculus chromosome 3, clone RP23-378N16, co... 42 2.1
377gb|AF268619.5| Homo sapiens chromosome 8 clone RP11-122C21 map q... 42 2.1
378gb|AC153378.4| Mus musculus 6 BAC RP23-106C18 (Roswell Park Canc... 42 2.1
379gb|AC162313.5| Mus musculus chr BAC RP24-478I22 (Roswell Park Ca... 42 2.1
380gb|AC034254.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 42 2.1
381gb|AC114634.14| Mus musculus chromosome 8, clone RP24-116E2, com... 42 2.1
382gb|AC157549.4| Mus musculus chromosome 8, clone RP24-374O12, com... 42 2.1
383gb|AC144522.12| Homo sapiens 12 BAC RP11-481J8 (Roswell Park Can... 42 2.1
384gb|AC162887.5| Mus musculus chromosome 19, clone RP23-414O6, com... 42 2.1
385gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 42 2.1
386gb|AC113970.8| Mus musculus chromosome 1, clone RP23-125E16, com... 42 2.1
387gb|AC159631.2| Mus musculus BAC clone RP24-177F21 from chromosom... 42 2.1
388gb|AC124826.8| Mus musculus chromosome 12, clone RP23-455F18, co... 42 2.1
389gb|AC116421.8| Mus musculus chromosome 9, clone RP24-142L1, comp... 42 2.1
390gb|AC145795.2| Xenopus tropicalis chromosome CH216-18M1, complet... 42 2.1
391gb|AC139939.6| Mus musculus chromosome 1, clone RP23-458O23, com... 42 2.1
392gb|AC124128.11| Mus musculus chromosome 6, clone RP23-158O11, co... 42 2.1
393gb|AC112030.4| Rattus norvegicus 4 BAC CH230-100K8 (Children's H... 42 2.1
394gb|AC122903.4| Mus musculus BAC clone RP23-44N5 from chromosome ... 42 2.1
395gb|AC146611.2| Mus musculus BAC clone RP23-57A17 from chromosome... 42 2.1
396gb|AC124168.3| Mus musculus BAC clone RP23-143G9 from chromosome... 42 2.1
397gb|AC129773.4| Mus musculus BAC clone RP24-73D4 from chromosome ... 42 2.1
398gb|AC132093.3| Mus musculus BAC clone RP24-506H13 from chromosom... 42 2.1
399gb|AC129570.10| Mus musculus chromosome 14, clone RP23-343H21, c... 42 2.1
400emb|CR450748.10| Zebrafish DNA sequence from clone CH211-157P5, ... 42 2.1
401emb|CR974571.9| Mouse DNA sequence from clone RP23-145P19 on chr... 42 2.1
402emb|BX927165.18| Zebrafish DNA sequence from clone DKEYP-120H9 i... 42 2.1
403emb|CR457459.9| Zebrafish DNA sequence from clone DKEY-25P11 in ... 42 2.1
404emb|CR352236.17| Zebrafish DNA sequence from clone DKEYP-123E12 ... 42 2.1
405emb|CR931785.6| Zebrafish DNA sequence from clone DKEY-230N5 in ... 42 2.1
406gb|AC146115.2| Pan troglodytes BAC clone RP43-38M17 from 7, comp... 42 2.1
407emb|CR388060.19| Zebrafish DNA sequence from clone DKEY-208J8 in... 42 2.1
408gb|AC112950.9| Mus musculus chromosome 1, clone RP23-288K15, com... 42 2.1
409emb|CR381597.7| Zebrafish DNA sequence from clone CH211-182L5 in... 42 2.1
410gb|AY466112.1| Homo sapiens tumor necrosis factor receptor super... 42 2.1
411gb|AC124499.3| Mus musculus BAC clone RP24-68G23 from chromosome... 42 2.1
412gb|AC134331.2| Mus musculus BAC clone RP24-344O12 from chromosom... 42 2.1
413gb|AC129304.6| Mus musculus BAC clone RP24-462H23 from chromosom... 42 2.1
414gb|AC127251.4| Mus musculus BAC clone RP24-482M10 from chromosom... 42 2.1
415gb|AC124376.4| Mus musculus BAC clone RP24-573J18 from chromosom... 42 2.1
416gb|AC130818.3| Mus musculus BAC clone RP23-89F9 from chromosome ... 42 2.1
417gb|AC122288.4| Mus musculus BAC clone RP23-254F4 from chromosome... 42 2.1
418gb|AC116322.5| Mus musculus BAC clone RP23-273O16 from chromosom... 42 2.1
419gb|AC122342.4| Mus musculus BAC clone RP23-357O17 from chromosom... 42 2.1
420gb|AC130219.3| Mus musculus BAC clone RP23-126O16 from chromosom... 42 2.1
421gb|AC132386.3| Mus musculus BAC clone RP23-438O22 from chromosom... 42 2.1
422gb|AC133207.3| Mus musculus BAC clone RP23-116L23 from chromosom... 42 2.1
423gb|AC099315.3| Papio anubis clone RP41-403I2, complete sequence 42 2.1
424gb|AC120837.6| Mus musculus Strain C57BL6/J chromosome 11 BAC, R... 42 2.1
425gb|AC125108.3| Mus musculus BAC clone RP24-226A8 from chromosome... 42 2.1
426gb|AC122018.4| Mus musculus BAC clone RP24-361O20 from chromosom... 42 2.1
427gb|AC133080.3| Mus musculus BAC clone RP24-280M20 from chromosom... 42 2.1
428gb|AC123823.3| Mus musculus BAC clone RP24-63C11 from chromosome... 42 2.1
429gb|AC127282.3| Mus musculus BAC clone RP23-318O24 from chromosom... 42 2.1
430emb|CR457445.15| Zebrafish DNA sequence from clone CH211-204C5 i... 42 2.1
431gb|AC125040.4| Mus musculus BAC clone RP23-335C9 from chromosome... 42 2.1
432gb|AC124740.4| Mus musculus BAC clone RP23-356M1 from chromosome... 42 2.1
433gb|AC124582.4| Mus musculus BAC clone RP23-120A15 from 6, comple... 42 2.1
434emb|CR847928.12| Zebrafish DNA sequence from clone DKEYP-67E7 in... 42 2.1
435gb|AC125217.3| Mus musculus BAC clone RP23-112D14 from 8, comple... 42 2.1
436gb|AC125206.3| Mus musculus BAC clone RP23-240G3 from 10, comple... 42 2.1
437gb|AC122799.4| Mus musculus BAC clone RP23-308K11 from 16, compl... 42 2.1
438emb|BX470264.22| Zebrafish DNA sequence from clone CH211-252F13 ... 42 2.1
439emb|CR626904.15| Zebrafish DNA sequence from clone DKEY-53D10 in... 42 2.1
440gb|AC112151.3| Mus musculus BAC clone RP24-86M8 from 2, complete... 42 2.1
441gb|AC122802.2| Mus musculus BAC clone RP24-136N24 from 6, comple... 42 2.1
442gb|AC107862.10| Mus musculus chromosome 7, clone RP23-378D16, co... 42 2.1
443gb|AC137921.2| Oryza sativa chromosome 3 BAC OSJNBa0027H16 genom... 42 2.1
444gb|AC112943.12| Mus musculus chromosome 16, clone RP23-424C7, co... 42 2.1
445gb|AC104889.10| Mus musculus chromosome 5, clone RP23-201D22, co... 42 2.1
446gb|AC099648.5| Homo sapiens BAC clone RP11-589K15 from 7, comple... 42 2.1
447gb|AC092448.6| Homo sapiens BAC clone RP11-776E7 from 7, complet... 42 2.1
448gb|AC005228.1| Homo sapiens PAC clone RP5-1100A7 from 7, complet... 42 2.1
449gb|AC113275.8| Mus musculus chromosome 8, clone RP23-383K23, com... 42 2.1
450gb|AC113524.9| Mus musculus chromosome 6, clone RP23-120I17, com... 42 2.1
451gb|AC021709.12| Mus musculus chromosome 10, clone RP23-194I3, co... 42 2.1
452gb|AC102441.6| Mus musculus chromosome 18, clone RP24-160I12, co... 42 2.1
453gb|AC163650.2| Mus musculus BAC clone RP24-383A20 from chromosom... 42 2.1
454gb|AC112662.7| Mus musculus chromosome 5, clone RP23-467F2, comp... 42 2.1
455gb|AC158684.7| Mus musculus 6 BAC RP23-332N21 (Roswell Park Canc... 42 2.1
456gb|AC102781.5| Mus musculus chromosome 1, clone RP23-271G2, comp... 42 2.1
457gb|AC165082.2| Mus musculus BAC clone RP23-412H17 from chromosom... 42 2.1
458gb|AY376979.1| Litopenaeus vannamei microsatellite TUGAPv7-9.94F... 42 2.1
459gb|AC148397.13| Medicago truncatula clone mth2-22h4, complete se... 42 2.1
460gb|AC124360.5| Mus musculus BAC clone RP24-502M22 from chromosom... 42 2.1
461emb|CR450821.7| Zebrafish DNA sequence from clone CH211-156B7 in... 42 2.1
462emb|Z98048.1|HS408N23 Human DNA sequence from clone RP3-408N23 o... 42 2.1
463emb|Z83840.7|HS216E10 Human DNA sequence from clone CTA-216E10 o... 42 2.1
464emb|AL731537.8| Human DNA sequence from clone RP11-96B5 on chrom... 42 2.1
465emb|AL929288.4| Human DNA sequence from clone RP11-669M2 on chro... 42 2.1
466emb|AL683871.15| Human DNA sequence from clone RP13-76L22 on chr... 42 2.1
467emb|AL591291.1| Human DNA sequence from clone RP11-99J16 on chro... 42 2.1
468emb|AL590822.36| Human DNA sequence from clone RP11-181G12 on ch... 42 2.1
469gb|AC183606.2| Pan troglodytes BAC clone CH251-286M5 from chromo... 42 2.1
470emb|AL589727.4| Human DNA sequence from clone RP11-104N13 on chr... 42 2.1
471emb|AL512642.18| Human DNA sequence from clone RP11-469L23 on ch... 42 2.1
472emb|AL513534.17| Human DNA sequence from clone RP11-119F7 on chr... 42 2.1
473emb|AL450490.6| Human DNA sequence from clone RP11-124N4 on chro... 42 2.1
474emb|AL442064.10| Human DNA sequence from clone RP11-272D1 on chr... 42 2.1
475emb|AL445669.9| Human DNA sequence from clone RP11-163G10 on chr... 42 2.1
476emb|AL391821.7| Human DNA sequence from clone RP11-212B22 on chr... 42 2.1
477emb|AL450328.6| Human DNA sequence from clone RP11-193H22 on chr... 42 2.1
478emb|AL365222.24| Human DNA sequence from clone RP11-274E6 on chr... 42 2.1
479emb|AL365508.19| Human DNA sequence from clone RP11-301B7 on chr... 42 2.1
480emb|AL390036.17| Human DNA sequence from clone RP11-356N1 on chr... 42 2.1
481emb|AL360220.12| Human DNA sequence from clone RP11-173B15 on ch... 42 2.1
482gb|AC134384.6| Mus musculus strain C57BL/6J clone rp23-393d21, c... 42 2.1
483gb|AC134383.11| Mus musculus strain C57BL/6J clone rp23-348k4, c... 42 2.1
484emb|AL358196.11| Human DNA sequence from clone RP11-596L14 on ch... 42 2.1
485gb|AC093578.3| Homo sapiens chromosome 1 clone RP11-76N22, compl... 42 2.1
486emb|AL356476.13| Human DNA sequence from clone RP11-655H13 on ch... 42 2.1
487emb|AL355522.11| Human DNA sequence from clone RP11-546O15 on ch... 42 2.1
488emb|AL162576.27| Human DNA sequence from clone RP11-568F20 on ch... 42 2.1
489emb|AL353575.24| Human DNA sequence from clone RP3-433O4 on chro... 42 2.1
490emb|AL354744.13| Human DNA sequence from clone RP11-635N21 on ch... 42 2.1
491gb|AC096626.31| Mus musculus strain C57BL/6J clone rp23-423p15 m... 42 2.1
492gb|AC095402.7| Rattus norvegicus 2 BAC CH230-7A22 (Children's Ho... 42 2.1
493emb|AL353643.10| Human DNA sequence from clone RP11-359J23 on ch... 42 2.1
494emb|AL161612.13| Human DNA sequence from clone RP11-196P2 on chr... 42 2.1
495emb|AL160159.12| Human DNA sequence from clone RP11-71K7 on chro... 42 2.1
496emb|AL161904.7| Human DNA sequence from clone RP11-440G9 on chro... 42 2.1
497emb|AL139826.15| Human DNA sequence from clone RP11-60H7 on chro... 42 2.1
498emb|AL138688.27| Human DNA sequence from clone RP11-264J4 on chr... 42 2.1
499gb|AC011276.12| Homo sapiens chromosome , clone RP11-13J17, comp... 42 2.1
500emb|AL135793.13| Human DNA sequence from clone RP11-296H2 on chr... 42 2.1

>emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene
          Length = 1567

 Score = 1100 bits (555), Expect = 0.0
 Identities = 593/607 (97%), Gaps = 2/607 (0%)
 Strand = Plus / Minus

                                                                        
Query: 1    acagtgcacatgttacaaagtacaataaactcataggtcccctcaaagggagtgaaggaa 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1253 acagtgcacatgttacaaagtacaataaactcataggtcccctcaaagggagtgaaggaa 1194

                                                                        
Query: 61   caaccaaacatcgatagtacagtatggccggccatgcagaactggctcaacatacgcact 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1193 caaccaaacatcgatagtacagtatggccggccatgcagaactggctcaacatacgcact 1134

                                                                        
Query: 121  cnnnnnnnnnnnnatatcccacatgaagataatattgtgcatttattcatatatatgtat 180
            |            |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1133 cctctctctctctatatcccacatgaagataatattgtgcatttattcatatatatgtat 1074

                                                                        
Query: 181  gtatgtgtgacctcaacgtactcagcgtcgatcgctggggctataggcagcaagtggttg 240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1073 gtatgtgtgacctcaacgtactcagcgtcgatcgctggggctataggcagcaagtggttg 1014

                                                                        
Query: 241  atcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgctgacgccgc 300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1013 atcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgctgacgccgc 954

                                                                        
Query: 301  acatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgc 360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 953  acatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgc 894

                                                                        
Query: 361  acttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacac 420
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 893  acttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacac 834

                                                                        
Query: 421  cgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaggggc 480
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 833  cgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaggggc 774

                                                                        
Query: 481  tcaaggcagagctcacctgaccgcaggagatggccgcgtcggtagctacgatgagcatgg 540
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 773  tcaaggcagagctcacctgaccgcaggagatggccgcgtcggtagctacgatgagcatgg 714

                                                                        
Query: 541  cggccaccatggcgaccagcacgagnctgagtagctgcagcgcgagccatccctnaagga 600
            ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||
Sbjct: 713  cggccaccatggcgaccagcacgag-ctgagtagctgcagcgcgagccatccct-aagga 656

                   
Query: 601  gtttgca 607
            |||||||
Sbjct: 655  gtttgca 649



to top

>gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt4.9) gene, complete cds
          Length = 3238

 Score = 1100 bits (555), Expect = 0.0
 Identities = 593/607 (97%), Gaps = 2/607 (0%)
 Strand = Plus / Minus

                                                                        
Query: 1    acagtgcacatgttacaaagtacaataaactcataggtcccctcaaagggagtgaaggaa 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2649 acagtgcacatgttacaaagtacaataaactcataggtcccctcaaagggagtgaaggaa 2590

                                                                        
Query: 61   caaccaaacatcgatagtacagtatggccggccatgcagaactggctcaacatacgcact 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2589 caaccaaacatcgatagtacagtatggccggccatgcagaactggctcaacatacgcact 2530

                                                                        
Query: 121  cnnnnnnnnnnnnatatcccacatgaagataatattgtgcatttattcatatatatgtat 180
            |            |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2529 cctctctctctctatatcccacatgaagataatattgtgcatttattcatatatatgtat 2470

                                                                        
Query: 181  gtatgtgtgacctcaacgtactcagcgtcgatcgctggggctataggcagcaagtggttg 240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2469 gtatgtgtgacctcaacgtactcagcgtcgatcgctggggctataggcagcaagtggttg 2410

                                                                        
Query: 241  atcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgctgacgccgc 300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2409 atcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgctgacgccgc 2350

                                                                        
Query: 301  acatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgc 360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2349 acatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgc 2290

                                                                        
Query: 361  acttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacac 420
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2289 acttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacac 2230

                                                                        
Query: 421  cgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaggggc 480
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2229 cgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaggggc 2170

                                                                        
Query: 481  tcaaggcagagctcacctgaccgcaggagatggccgcgtcggtagctacgatgagcatgg 540
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2169 tcaaggcagagctcacctgaccgcaggagatggccgcgtcggtagctacgatgagcatgg 2110

                                                                        
Query: 541  cggccaccatggcgaccagcacgagnctgagtagctgcagcgcgagccatccctnaagga 600
            ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||
Sbjct: 2109 cggccaccatggcgaccagcacgag-ctgagtagctgcagcgcgagccatccct-aagga 2052

                   
Query: 601  gtttgca 607
            |||||||
Sbjct: 2051 gtttgca 2045



to top

>emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA
          Length = 705

 Score =  757 bits (382), Expect = 0.0
 Identities = 444/462 (96%), Gaps = 2/462 (0%)
 Strand = Plus / Minus

                                                                       
Query: 134 atatcccacatgaagataatatt-gtgcatttattcatatatatgtatgtatgtgtgacc 192
           ||||||||||||||||||||||  | ||||||||||||||||||||||||||||||||||
Sbjct: 516 atatcccacatgaagataatatgagagcatttattcatatatatgtatgtatgtgtgacc 457

                                                                       
Query: 193 tcaacgtactcagcgtcgatcgctggggctataggcagcaagtggttgatcagcgaatct 252
           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 456 tcaacgtactcagcgtcgattgctggggctataggcagcaagtggttgatcagcgaatct 397

                                                                       
Query: 253 tagagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggagggga 312
           |||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 396 tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 337

                                                                       
Query: 313 ttccggcggccttgccagcgtttagcccacccgcagcgctcttgatgcacttgcacgccg 372
           | ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 336 tgccggcggccttgccagcgtttagcccaccagcagcgctcttgatgcacttgcacgccg 277

                                                                       
Query: 373 cttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacaccgctgcagcagg 432
           |||| |||||||||||||||||||| |||||||||||||||||||| |||||||||||||
Sbjct: 276 cttgtttgtcagcggtgctctgggcagcgccggccagtctcttgacgccgctgcagcagg 217

                                                                       
Query: 433 ccacaggcggtttggcgccgttgccgcgggcataggagatgcaggggctcaaggcagagc 492
           || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 216 ccgcaggcggtttggcgccgttgccgcgggcataggagatgcaggggctcaaggcagagc 157

                                                                       
Query: 493 tcacctgaccgcaggagatggccgcgtcggtagctacgatgagcatggcggccaccatgg 552
           ||||||||||||||||||||||||||||||  ||||||| ||||||||||||||||| ||
Sbjct: 156 tcacctgaccgcaggagatggccgcgtcggcggctacgaggagcatggcggccaccaggg 97

                                                     
Query: 553 cgaccagcacgagnctgagtagctgcagcgcgagccatccct 594
           ||||||||||||| |||| |||||||||||||||||||||||
Sbjct: 96  cgaccagcacgag-ctgactagctgcagcgcgagccatccct 56



 Score =  178 bits (90), Expect = 1e-41
 Identities = 108/114 (94%)
 Strand = Plus / Minus

                                                                       
Query: 1   acagtgcacatgttacaaagtacaataaactcataggtcccctcaaagggagtgaaggaa 60
           |||||||||||| |||||| |||||||||||| | |||||||||||||||||||||||||
Sbjct: 667 acagtgcacatggtacaaaatacaataaactcttgggtcccctcaaagggagtgaaggaa 608

                                                                 
Query: 61  caaccaaacatcgatagtacagtatggccggccatgcagaactggctcaacata 114
           ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 607 caaccaaacatggatagaacagtatggccggccatgcagaactggctcaacata 554



to top

>emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene
          Length = 1862

 Score =  640 bits (323), Expect = e-180
 Identities = 354/363 (97%), Gaps = 1/363 (0%)
 Strand = Plus / Minus

                                                                        
Query: 228  cagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtagggg 287
            ||||||||||| ||||||||||||||||||||||| |||||||| |||||||||||||||
Sbjct: 1391 cagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 1332

                                                                        
Query: 288  acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 347
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1331 acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 1272

                                                                        
Query: 348  gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 407
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1271 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 1212

                                                                        
Query: 408  agtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 467
            ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1211 agtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 1152

                                                                        
Query: 468  gagatgcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtagct 527
            |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 1151 gagatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggct 1092

                                                                        
Query: 528  acgatgagcatggcggccaccatggcgaccagcacgagnctgagtagctgcagcgcgagc 587
            |||| |||||| |||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 1091 acgaggagcatagcggccaccatggcgaccagcacgag-ctgagtagctgcagcgcgagc 1033

               
Query: 588  cat 590
            |||
Sbjct: 1032 cat 1030



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 3    agtgcacatgttacaaagtacaataaactca 33
            |||||||||| |||||||||||| |||||||
Sbjct: 1649 agtgcacatggtacaaagtacaacaaactca 1619



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 87   gccggccatgcagaactggctcaacatacg 116
            |||||||||||||| |||||||||| ||||
Sbjct: 1566 gccggccatgcagagctggctcaacgtacg 1537



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 159  gcatttattcatatatatgtatgtatgtgt 188
            |||||||||||||||||||| ||| |||||
Sbjct: 1489 gcatttattcatatatatgtgtgtgtgtgt 1460



to top

>emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid transfer protein precursor
          Length = 691

 Score =  517 bits (261), Expect = e-143
 Identities = 331/353 (93%), Gaps = 1/353 (0%)
 Strand = Plus / Minus

                                                                       
Query: 228 cagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtagggg 287
           ||||||||||| ||||||||||||||||||||||| |||||||| |||||||||||||||
Sbjct: 376 cagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 317

                                                                       
Query: 288 acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 347
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 316 acgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccacccgca 257

                                                                       
Query: 348 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 407
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 256 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgcgctgcgccggcc 197

                                                                       
Query: 408 agtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 467
           | ||||||||| |||||||||||||||  |||| |  || |||||||||||| |||||||
Sbjct: 196 aatctcttgacgccgctgcagcaggccggaggcaggatgccgccgttgccgctggcatag 137

                                                                       
Query: 468 gagatgcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtagct 527
           || |||||||||| ||||||||||||||||||||||||||||||||| |||||||  |||
Sbjct: 136 gaaatgcaggggcgcaaggcagagctcacctgaccgcaggagatggctgcgtcggcggct 77

                                                                
Query: 528 acgatgagcatggcggccaccatggcgaccagcacgagnctgagtagctgcag 580
           |||| |||||| |||||||||||||||||||||||||| ||||||||||||||
Sbjct: 76  acgaggagcatagcggccaccatggcgaccagcacgag-ctgagtagctgcag 25



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 3   agtgcacatgttacaaagtacaataaactca 33
           |||||||||| |||||||||||| |||||||
Sbjct: 647 agtgcacatggtacaaagtacaacaaactca 617



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 159 gcatttattcatatatatgtatgtatgtgtg 189
           |||||||||||||||||||| ||| ||||||
Sbjct: 487 gcatttattcatatatatgtgtgtgtgtgtg 457



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 201 ctcagcgtcgatcgctggggctataggcagcaag 234
           |||||| ||||| ||||| |||||||||||||||
Sbjct: 415 ctcagcatcgatagctggagctataggcagcaag 382



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 190 acctcaacgtactcagcgtc 209
           ||||||||||||||||||||
Sbjct: 434 acctcaacgtactcagcgtc 415



to top

>gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer protein precursor gene,
           complete cds
          Length = 573

 Score =  458 bits (231), Expect = e-125
 Identities = 325/355 (91%), Gaps = 1/355 (0%)
 Strand = Plus / Minus

                                                                       
Query: 226 ggcagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtagg 285
           ||||||||||||| |||||| |||||||||||||||| |||||||  ||||||| |||||
Sbjct: 449 ggcagcaagtggtcgatcagtgaatcttagagcagtcgacggaagtgctgatggagtagg 390

                                                                       
Query: 286 ggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccg 345
           ||||||||||||||||| |||||||||| |||||||||||||||||||||| |||| | |
Sbjct: 389 ggacgctgacgccgcacttggaggggatgccggcggccttgccagcgtttaacccagcgg 330

                                                                       
Query: 346 cagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccgg 405
           ||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||
Sbjct: 329 cagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccgg 270

                                                                       
Query: 406 ccagtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcat 465
           ||| ||||||||| |||||||||||||||  |||| |  || |||||||||||| |||||
Sbjct: 269 ccaatctcttgacgccgctgcagcaggccggaggcaggatgccgccgttgccgctggcat 210

                                                                       
Query: 466 aggagatgcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtag 525
           |||| |||||||||| ||||||||||||||||||||||||||||||||| |||||||  |
Sbjct: 209 aggaaatgcaggggcgcaaggcagagctcacctgaccgcaggagatggctgcgtcggcgg 150

                                                                  
Query: 526 ctacgatgagcatggcggccaccatggcgaccagcacgagnctgagtagctgcag 580
           |||||| |||||| |||||||||||||||||||||||||| ||||||||||||||
Sbjct: 149 ctacgaggagcatagcggccaccatggcgaccagcacgag-ctgagtagctgcag 96



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 160 catttattcatatatatgtatgtatgtgtg 189
           ||||||||||||||||||| ||| ||||||
Sbjct: 555 catttattcatatatatgtgtgtgtgtgtg 526



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 190 acctcaacgtactcagcgtc 209
           ||||||||||||||||||||
Sbjct: 505 acctcaacgtactcagcgtc 486



to top

>emb|X68656.1|HVCW19 H.vulgare Cw-19 mRNA
          Length = 660

 Score =  406 bits (205), Expect = e-110
 Identities = 233/241 (96%), Gaps = 1/241 (0%)
 Strand = Plus / Minus

                                                                       
Query: 350 gctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccag 409
           |||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 285 gctcttgaggcacctgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccag 226

                                                                       
Query: 410 tctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatagga 469
           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 225 tctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatagga 166

                                                                       
Query: 470 gatgcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtagctac 529
           |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 165 gatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggctac 106

                                                                       
Query: 530 gatgagcatggcggccaccatggcgaccagcacgagnctgagtagctgcagcgcgagcca 589
           || |||||| |||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 105 gaggagcatagcggccaccatggcgaccagcacgag-ctgagtagctgcagcgcgagcca 47

            
Query: 590 t 590
           |
Sbjct: 46  t 46



to top

>gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  347 bits (175), Expect = 3e-92
 Identities = 286/323 (88%)
 Strand = Plus / Minus

                                                                       
Query: 242 tcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgctgacgccgca 301
           ||||||||||||||||||||| || ||||  |||||||||||||||||||| ||||||||
Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289

                                                                       
Query: 302 catggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgca 361
           | | | |||||| || ||||||||||||||||| |||||| | |||||||||||||| ||
Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229

                                                                       
Query: 362 cttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacacc 421
           ||||||||||||||||||||||||||||||| |||||| || ||| || ||| | || ||
Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacgcc 169

                                                                       
Query: 422 gctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaggggct 481
           ||||||||||||| ||| ||| ||||||||||||||||| ||||||||||||||||||||
Sbjct: 168 gctgcagcaggccgcagacgggttggcgccgttgccgcgtgcataggagatgcaggggct 109

                                                                       
Query: 482 caaggcagagctcacctgaccgcaggagatggccgcgtcggtagctacgatgagcatggc 541
           |||||||||||||||||||||||| || | |||||| || || ||| ||| |||||| ||
Sbjct: 108 caaggcagagctcacctgaccgcacgatacggccgcctccgtggctgcgaggagcatagc 49

                                  
Query: 542 ggccaccatggcgaccagcacga 564
           |||||||| |||||| |||||||
Sbjct: 48  ggccaccacggcgacgagcacga 26



to top

>gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  347 bits (175), Expect = 3e-92
 Identities = 286/323 (88%)
 Strand = Plus / Minus

                                                                       
Query: 242 tcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgctgacgccgca 301
           ||||||||||||||||||||| || ||||  |||||||||||||||||||| ||||||||
Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289

                                                                       
Query: 302 catggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgca 361
           | | | |||||| || ||||||||||||||||| |||||| | |||||||||||||| ||
Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229

                                                                       
Query: 362 cttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacacc 421
           ||||||||||||||||||||||||||||||| |||||| || ||| || ||| | || ||
Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacgcc 169

                                                                       
Query: 422 gctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaggggct 481
           ||||||||||||| ||| ||| ||||||||||||||||| ||||||||||||||||||||
Sbjct: 168 gctgcagcaggccgcagacgggttggcgccgttgccgcgtgcataggagatgcaggggct 109

                                                                       
Query: 482 caaggcagagctcacctgaccgcaggagatggccgcgtcggtagctacgatgagcatggc 541
           |||||||||||||||||||||||| || | |||||| || || ||| ||| |||||| ||
Sbjct: 108 caaggcagagctcacctgaccgcacgatacggccgcctccgtggctgcgaggagcatagc 49

                                  
Query: 542 ggccaccatggcgaccagcacga 564
           |||||||| |||||| |||||||
Sbjct: 48  ggccaccacggcgacgagcacga 26



to top

>emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non specific lipid transfer
            protein precursor
          Length = 2122

 Score =  347 bits (175), Expect = 3e-92
 Identities = 298/339 (87%)
 Strand = Plus / Minus

                                                                        
Query: 226  ggcagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtagg 285
            ||||||||||| | ||||||||||||||||||||||| || ||||  |||||||||||||
Sbjct: 1633 ggcagcaagtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgtagg 1574

                                                                        
Query: 286  ggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccg 345
            ||||||| ||||||||| | | |||||| |||||||||||||||||||| |||||| | |
Sbjct: 1573 ggacgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccagcag 1514

                                                                        
Query: 346  cagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccgg 405
            ||||||||||||||||||||||||||||||||||||||||||||||| |||||| || ||
Sbjct: 1513 cagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctccgggctgagctgg 1454

                                                                        
Query: 406  ccagtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcat 465
            | || ||| | || ||||||||||||||| |||  ||  |||||||||||||||| ||||
Sbjct: 1453 ctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgttgccgcgtgcat 1394

                                                                        
Query: 466  aggagatgcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtag 525
            |||||||||||||||||||||||||||||||||||||||| || |  ||||| || ||  
Sbjct: 1393 aggagatgcaggggctcaaggcagagctcacctgaccgcacgatacagccgcctccgtga 1334

                                                   
Query: 526  ctacgatgagcatggcggccaccatggcgaccagcacga 564
            || ||| |||||| |||||||||| |||||| |||||||
Sbjct: 1333 ctgcgaggagcatagcggccaccacggcgacgagcacga 1295



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                 
Query: 48   gggagtgaaggaacaaccaaacatcgatagtacagtatggccggccatgcaga 100
            ||||||| |||||||||||||||||||||  ||||| ||||||||||||||||
Sbjct: 1838 gggagtggaggaacaaccaaacatcgatacaacagtgtggccggccatgcaga 1786



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 186  tgtgacctcaacgtactcagcgtcgatc 213
            ||||||||||||||||| ||||| ||||
Sbjct: 1702 tgtgacctcaacgtactaagcgtagatc 1675



to top

>emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific lipid transfer
           protein precursor (ltp9.2 gene)
          Length = 708

 Score =  331 bits (167), Expect = 2e-87
 Identities = 296/339 (87%)
 Strand = Plus / Minus

                                                                       
Query: 226 ggcagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtagg 285
           ||||||| ||| | ||||||||||||||||||||||| || ||||  |||||||||||||
Sbjct: 430 ggcagcatgtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgtagg 371

                                                                       
Query: 286 ggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccg 345
           ||| ||| ||||||||| | | |||||| |||||||||||||||||||| |||||| | |
Sbjct: 370 ggatgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccagcag 311

                                                                       
Query: 346 cagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccgg 405
           ||||||||||||| ||||||||||||||||||||||||||||||||| |||||| || ||
Sbjct: 310 cagcgctcttgatacacttgcacgccgcttgcttgtcagcggtgctccgggctgagctgg 251

                                                                       
Query: 406 ccagtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcat 465
           | || ||| | || ||||||||||||||| ||| |||  |||||||||||||||| ||||
Sbjct: 250 ctagactcctaacgccgctgcagcaggccgcagacgggctggcgccgttgccgcgtgcat 191

                                                                       
Query: 466 aggagatgcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtag 525
           |||||||||||||||||||||||||||||||||||||||| || |  ||||| || ||  
Sbjct: 190 aggagatgcaggggctcaaggcagagctcacctgaccgcacgatacagccgcctccgtga 131

                                                  
Query: 526 ctacgatgagcatggcggccaccatggcgaccagcacga 564
           || ||| |||||| |||||||||| |||||| |||||||
Sbjct: 130 ctgcgaggagcatagcggccaccacggcgacgagcacga 92



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 48  gggagtgaaggaacaaccaaacatcgatagtacagtatggccggccatgcaga 100
           ||||||| | |||||||||||||||||||  ||||| ||||||||||||||||
Sbjct: 638 gggagtggaagaacaaccaaacatcgatacaacagtgtggccggccatgcaga 586



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 184 tgtgtgacctcaacgtactcagcgtcgatc 213
           ||||||||||||||||||| ||||| ||||
Sbjct: 501 tgtgtgacctcaacgtactaagcgtagatc 472



to top

>emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non specific lipid transfer
            protein precursor
          Length = 2087

 Score =  331 bits (167), Expect = 2e-87
 Identities = 296/339 (87%)
 Strand = Plus / Minus

                                                                        
Query: 226  ggcagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtagg 285
            ||||||||||| | |||||| |||||||||||||||| || ||||  |||||||||||||
Sbjct: 1621 ggcagcaagtgctcgatcagtgaatcttagagcagtcgaccgaagagctgatggcgtagg 1562

                                                                        
Query: 286  ggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccg 345
            ||||||| ||||||||| | | |||||| ||||||||||||||||| || |||||| | |
Sbjct: 1561 ggacgctaacgccgcactttgtggggatgccggcggccttgccagcattgagcccagcag 1502

                                                                        
Query: 346  cagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccgg 405
            ||||||||||||||||||||||| ||||||||||||||||||||||| |||||| || ||
Sbjct: 1501 cagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctccgggctgagctgg 1442

                                                                        
Query: 406  ccagtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcat 465
            | || ||| | || ||||||||||||||| |||  ||  |||||||||||||||| ||||
Sbjct: 1441 ctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgttgccgcgtgcat 1382

                                                                        
Query: 466  aggagatgcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtag 525
            |||||||||||||||||||||||||||||||||||||||| || | |||||| || ||  
Sbjct: 1381 aggagatgcaggggctcaaggcagagctcacctgaccgcacgatacggccgcctccgtga 1322

                                                   
Query: 526  ctacgatgagcatggcggccaccatggcgaccagcacga 564
            || ||| |||||| |||||||||| |||||| |||||||
Sbjct: 1321 ctgcgaggagcatagcggccaccacggcgacgagcacga 1283



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                 
Query: 48   gggagtgaaggaacaaccaaacatcgatagtacagtatggccggccatgcaga 100
            ||||||| |||||||||||||||||||||  ||||| ||||||||||||||||
Sbjct: 1826 gggagtggaggaacaaccaaacatcgatataacagtgtggccggccatgcaga 1774



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 184  tgtgtgacctcaacgtactcagcgtcgatc 213
            ||||||||||||||||||| ||||| ||||
Sbjct: 1692 tgtgtgacctcaacgtactaagcgtagatc 1663



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 159  gcatttattcatatatatgtatgtatgtg 187
            |||||||||||||||||||| ||| ||||
Sbjct: 1725 gcatttattcatatatatgtgtgtgtgtg 1697



to top

>emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for type 1 non-specific
           lipid transfer protein precursor (ltp9.2 gene)
          Length = 604

 Score =  325 bits (164), Expect = 1e-85
 Identities = 251/280 (89%)
 Strand = Plus / Minus

                                                                       
Query: 226 ggcagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtagg 285
           ||||||||||| | ||||||||||||||||||||||| || ||||  ||||||||||| |
Sbjct: 329 ggcagcaagtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgtaag 270

                                                                       
Query: 286 ggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccg 345
           ||||||| ||||||||| | | |||||| |||||||||||||||||||| |||||| | |
Sbjct: 269 ggacgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccagcag 210

                                                                       
Query: 346 cagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccgg 405
           ||||||||||||||||||||||||||||||||||||||||||||||| |||||| || ||
Sbjct: 209 cagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctccgggctgagctgg 150

                                                                       
Query: 406 ccagtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcat 465
           | || ||| | || ||||||||||||||| |||  ||  |||||||||||||||| ||||
Sbjct: 149 ctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgttgccgcgtgcat 90

                                                   
Query: 466 aggagatgcaggggctcaaggcagagctcacctgaccgca 505
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 89  aggagatgcaggggctcaaggcagagctcacctgaccgca 50



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 48  gggagtgaaggaacaaccaaacatcgatagtacagtatggccggccatgcaga 100
           ||||||| | |||||||||||||||||||  ||||| ||||||||||||||||
Sbjct: 535 gggagtggaagaacaaccaaacatcgatacaacagtgtggccggccatgcaga 483



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 184 tgtgtgacctcaacgtactcagcgtcgatc 213
           ||||||||||||||||||| ||||| ||||
Sbjct: 396 tgtgtgacctcaacgtactaagcgtagatc 367



to top

>gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  323 bits (163), Expect = 4e-85
 Identities = 250/279 (89%)
 Strand = Plus / Minus

                                                                       
Query: 242 tcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgctgacgccgca 301
           ||||||||||||||||||||||||||| |  || ||||||||||||| ||||||||||||
Sbjct: 348 tcagcgaatcttagagcagtccacggatgagctaatggcgtaggggatgctgacgccgca 289

                                                                       
Query: 302 catggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgca 361
           | |||||||||| || |||||||| |||||||| |||||||| ||||| ||||| |||||
Sbjct: 288 cttggaggggatgcctgcggcctttccagcgttgagcccaccagcagcactcttaatgca 229

                                                                       
Query: 362 cttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacacc 421
           ||||||||||||||||||||||||||||||| | |||||||||||||| ||| |||||||
Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgcgctgcgccggccagactcctgacacc 169

                                                                       
Query: 422 gctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaggggct 481
            |||||||||||| |||| ||  ||| |||| ||||||| ||||||||||||||||||||
Sbjct: 168 actgcagcaggccgcaggtgggctggagccgctgccgcgtgcataggagatgcaggggct 109

                                                  
Query: 482 caaggcagagctcacctgaccgcaggagatggccgcgtc 520
           |||||||||||||||||| || |||||||| || |||||
Sbjct: 108 caaggcagagctcacctggccacaggagattgcagcgtc 70



to top

>gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) gene, complete cds
          Length = 3448

 Score =  214 bits (108), Expect = 3e-52
 Identities = 292/352 (82%), Gaps = 1/352 (0%)
 Strand = Plus / Minus

                                                                        
Query: 240  gatcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgctgacgccg 299
            |||||| | |||||||||||||||||||| || ||||||| |||||||| ||||||||||
Sbjct: 3206 gatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccg 3147

                                                                        
Query: 300  cacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatg 359
            ||| |||||||||| |  || ||||| || | ||| |||||||| ||||| |||||||||
Sbjct: 3146 cacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttgatg 3087

                                                                        
Query: 360  cacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgaca 419
            ||| |||| |||||||||||||| ||||||||| | |||  |||||||| |||| | || 
Sbjct: 3086 cacctgcatgccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaact 3027

                                                                        
Query: 420  ccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcagggg 479
            |||   ||||||||| |||||||  |||| ||| ||||    || ||||||| ||||| |
Sbjct: 3026 ccggaacagcaggccccaggcgggctggccccgctgccttttgcgtaggagacgcaggag 2967

                                                                        
Query: 480  ctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtagctacgatgagcatg 539
              || ||||||| ||||||||||||||||||| ||||||||||  ||||| | |||||| 
Sbjct: 2966 gccagggcagagttcacctgaccgcaggagatcgccgcgtcggaggctaccaggagcatt 2907

                                                                
Query: 540  gcggccaccatggcgaccagcacgagnctgagtagctgcagcgcgagccatc 591
            || ||||||| ||||||||||||||| ||  || ||||||| ||||||||||
Sbjct: 2906 gccgccaccagggcgaccagcacgag-ctttgttgctgcagtgcgagccatc 2856



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 169  atatatatgtatgtatgtgtgacctcaacgtactcagcgtcgatcgctggggctata 225
            |||||||| | ||| |||||||||||||||||||| || || |||||||| ||||||
Sbjct: 3289 atatatatatgtgtgtgtgtgacctcaacgtactcggcatctatcgctggagctata 3233



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 42   ctcaaagggagtgaaggaacaaccaaac 69
            ||||||||||||||| |||||| |||||
Sbjct: 3436 ctcaaagggagtgaacgaacaatcaaac 3409



to top

>gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein precursor (LTP1) mRNA,
           complete cds
          Length = 737

 Score =  214 bits (108), Expect = 3e-52
 Identities = 292/352 (82%), Gaps = 1/352 (0%)
 Strand = Plus / Minus

                                                                       
Query: 240 gatcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgctgacgccg 299
           |||||| | |||||||||||||||||||| || ||||||| |||||||| ||||||||||
Sbjct: 410 gatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccg 351

                                                                       
Query: 300 cacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatg 359
           ||| |||||||||| |  || ||||| || | ||| |||||||| ||||| |||||||||
Sbjct: 350 cacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttgatg 291

                                                                       
Query: 360 cacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgaca 419
           ||| |||| |||||||||||||| ||||||||| | |||  |||||||| |||| | || 
Sbjct: 290 cacctgcatgccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaact 231

                                                                       
Query: 420 ccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcagggg 479
           |||   ||||||||| |||||||  |||| ||| ||||    || ||||||| ||||| |
Sbjct: 230 ccggaacagcaggccccaggcgggctggccccgctgccttttgcgtaggagacgcaggag 171

                                                                       
Query: 480 ctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtagctacgatgagcatg 539
             || ||||||| ||||||||||||||||||| ||||||||||  ||||| | |||||| 
Sbjct: 170 gccagggcagagttcacctgaccgcaggagatcgccgcgtcggaggctaccaggagcatt 111

                                                               
Query: 540 gcggccaccatggcgaccagcacgagnctgagtagctgcagcgcgagccatc 591
           || ||||||| ||||||||||||||| ||  || ||||||| ||||||||||
Sbjct: 110 gccgccaccagggcgaccagcacgag-ctttgttgctgcagtgcgagccatc 60



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 169 atatatatgtatgtatgtgtgacctcaacgtactcagcgtcgatcgctggggctata 225
           |||||||| | ||| |||||||||||||||||||| || || |||||||| ||||||
Sbjct: 493 atatatatatgtgtgtgtgtgacctcaacgtactcggcatctatcgctggagctata 437



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                       
Query: 3   agtgcacatgttacaaagtacaataaactcataggtcccctcaaagggagtgaaggaaca 62
           |||||||||| |||||||||||| ||||||     ||  ||||||||||||||| |||||
Sbjct: 679 agtgcacatggtacaaagtacaacaaactcccgtctctgctcaaagggagtgaacgaaca 620

                  
Query: 63  accaaac 69
           | |||||
Sbjct: 619 atcaaac 613



to top

>gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) mRNA, complete cds
          Length = 348

 Score =  210 bits (106), Expect = 4e-51
 Identities = 284/342 (83%), Gaps = 1/342 (0%)
 Strand = Plus / Minus

                                                                       
Query: 249 atcttagagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggag 308
           |||||||||||||||||||| || ||||||| |||||||| ||||||||||||| |||||
Sbjct: 341 atcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282

                                                                       
Query: 309 gggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgcacttgcac 368
           ||||| |  || ||||| || | ||| |||||||| ||||| |||||||||||| |||| 
Sbjct: 281 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 222

                                                                       
Query: 369 gccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacaccgctgcag 428
           |||||||||||||| ||||||||| | |||  |||||||| |||| | || |||   |||
Sbjct: 221 gccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaactccggaacag 162

                                                                       
Query: 429 caggccacaggcggtttggcgccgttgccgcgggcataggagatgcaggggctcaaggca 488
           |||||| |||||||  |||| ||| ||||    || ||||||| ||||| |  || ||||
Sbjct: 161 caggccccaggcgggctggccccgctgccttttgcgtaggagacgcaggaggccagggca 102

                                                                       
Query: 489 gagctcacctgaccgcaggagatggccgcgtcggtagctacgatgagcatggcggccacc 548
           ||| ||||||||||||||||||| ||||||||||  ||||| | |||||| || ||||||
Sbjct: 101 gagttcacctgaccgcaggagatcgccgcgtcggaggctaccaggagcattgccgccacc 42

                                                     
Query: 549 atggcgaccagcacgagnctgagtagctgcagcgcgagccat 590
           | ||||||||||||||| ||  || ||||||| |||||||||
Sbjct: 41  agggcgaccagcacgag-ctttgttgctgcagtgcgagccat 1



to top

>gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein precursor (LTP2) mRNA,
           complete cds
          Length = 730

 Score =  206 bits (104), Expect = 6e-50
 Identities = 291/352 (82%), Gaps = 1/352 (0%)
 Strand = Plus / Minus

                                                                       
Query: 240 gatcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgctgacgccg 299
           |||||| | |||||||||||||||||||| || ||||| | |||||||||||||||||||
Sbjct: 429 gatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccg 370

                                                                       
Query: 300 cacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatg 359
           ||| ||||||| || || |||||||||   | ||| ||||| || ||| | ||||||| |
Sbjct: 369 cacttggagggaatgcctgcggccttgttggggttgagccctccggcaacactcttgagg 310

                                                                       
Query: 360 cacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgaca 419
           ||| |||| |  ||||||||||| ||||||||| | |||  |||||||| | || |||| 
Sbjct: 309 cacctgcatgtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctgacg 250

                                                                       
Query: 420 ccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcagggg 479
           ||||||||||||||| ||| |||  |||  ||| ||||    ||||||| || |||||||
Sbjct: 249 ccgctgcagcaggccccagacgggctggtcccgctgcccttcgcataggcgacgcagggg 190

                                                                       
Query: 480 ctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtagctacgatgagcatg 539
            ||||||||||||||||||| ||||||  ||||||||||||||  ||| ||| || ||| 
Sbjct: 189 gtcaaggcagagctcacctggccgcagctgatggccgcgtcggaggctgcgaggatcatt 130

                                                               
Query: 540 gcggccaccatggcgaccagcacgagnctgagtagctgcagcgcgagccatc 591
           || ||||||| ||||||||||||||| || ||||||||||| ||||||||||
Sbjct: 129 gccgccaccagggcgaccagcacgag-cttagtagctgcagtgcgagccatc 79



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 56/66 (84%), Gaps = 6/66 (9%)
 Strand = Plus / Minus

                                                                       
Query: 159 gcatttattcatatatatgtatgtatgtgt------gacctcaacgtactcagcgtcgat 212
           |||||||||||| ||||||||| |||||||      |||||||||||||||||| || ||
Sbjct: 528 gcatttattcatgtatatgtatatatgtgtgtgtgagacctcaacgtactcagcatcaat 469

                 
Query: 213 cgctgg 218
           ||||||
Sbjct: 468 cgctgg 463



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 42  ctcaaagggagtgaaggaacaaccaaac 69
           ||||||||||||||| |||||| |||||
Sbjct: 645 ctcaaagggagtgaacgaacaatcaaac 618



to top

>emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non specific lipid
           transfer protein precursor
          Length = 496

 Score =  206 bits (104), Expect = 6e-50
 Identities = 291/352 (82%), Gaps = 1/352 (0%)
 Strand = Plus / Minus

                                                                       
Query: 240 gatcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgctgacgccg 299
           |||||| | |||||||||||||||||||| || ||||| | |||||||||||||||||||
Sbjct: 370 gatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccg 311

                                                                       
Query: 300 cacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatg 359
           ||| ||||||| || || |||||||||   | ||| ||||| || ||| | ||||||| |
Sbjct: 310 cacttggagggaatgcctgcggccttgttggggttgagccctccggcaacactcttgagg 251

                                                                       
Query: 360 cacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgaca 419
           ||| |||| |  ||||||||||| ||||||||| | |||  |||||||| | || |||| 
Sbjct: 250 cacctgcatgtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctgacg 191

                                                                       
Query: 420 ccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcagggg 479
           ||||||||||||||| ||| |||  |||  ||| ||||    ||||||| || |||||||
Sbjct: 190 ccgctgcagcaggccccagacgggctggtcccgctgcccttcgcataggcgacgcagggg 131

                                                                       
Query: 480 ctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtagctacgatgagcatg 539
            ||||||||||||||||||| ||||||  ||||||||||||||  ||| ||| || ||| 
Sbjct: 130 gtcaaggcagagctcacctggccgcagctgatggccgcgtcggaggctgcgaggatcatt 71

                                                               
Query: 540 gcggccaccatggcgaccagcacgagnctgagtagctgcagcgcgagccatc 591
           || ||||||| ||||||||||||||| || ||||||||||| ||||||||||
Sbjct: 70  gccgccaccagggcgaccagcacgag-cttagtagctgcagtgcgagccatc 20



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 56/66 (84%), Gaps = 6/66 (9%)
 Strand = Plus / Minus

                                                                       
Query: 159 gcatttattcatatatatgtatgtatgtgt------gacctcaacgtactcagcgtcgat 212
           |||||||||||| ||||||||| |||||||      |||||||||||||||||| || ||
Sbjct: 469 gcatttattcatgtatatgtatatatgtgtgtgtgagacctcaacgtactcagcatcaat 410

                 
Query: 213 cgctgg 218
           ||||||
Sbjct: 409 cgctgg 404



to top

>gb|AY754742.1| Triticum aestivum lipid transfer protein (LTP2) mRNA, complete cds
          Length = 348

 Score =  196 bits (99), Expect = 6e-47
 Identities = 282/342 (82%), Gaps = 1/342 (0%)
 Strand = Plus / Minus

                                                                       
Query: 249 atcttagagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggag 308
           |||||||||||||||||||| || ||||| | |||||||||||||||||||||| |||||
Sbjct: 341 atcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccgcacttggag 282

                                                                       
Query: 309 gggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgcacttgcac 368
           || || || |||||||||   | ||| ||||| || ||| | ||||||| |||| |||| 
Sbjct: 281 ggaatgcctgcggccttgttggggttgagccctccggcaacactcttgaggcacctgcat 222

                                                                       
Query: 369 gccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacaccgctgcag 428
           |  ||||||||||| ||||||||| | |||  |||||||| | || |||| |||||||||
Sbjct: 221 gtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctgacgccgctgcag 162

                                                                       
Query: 429 caggccacaggcggtttggcgccgttgccgcgggcataggagatgcaggggctcaaggca 488
           |||||| ||| |||  |||  ||| ||||    ||||||| || ||||||| ||||||||
Sbjct: 161 caggccccagacgggctggtcccgctgcccttcgcataggcgacgcagggggtcaaggca 102

                                                                       
Query: 489 gagctcacctgaccgcaggagatggccgcgtcggtagctacgatgagcatggcggccacc 548
           ||||||||||| ||||||  ||||||||||||||  ||| ||| || ||| || ||||||
Sbjct: 101 gagctcacctggccgcagctgatggccgcgtcggaggctgcgaggatcattgccgccacc 42

                                                     
Query: 549 atggcgaccagcacgagnctgagtagctgcagcgcgagccat 590
           | |||||||||||||||  | ||||||||||| |||||||||
Sbjct: 41  agggcgaccagcacgagt-ttagtagctgcagtgcgagccat 1



to top

>gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  194 bits (98), Expect = 2e-46
 Identities = 282/342 (82%), Gaps = 1/342 (0%)
 Strand = Plus / Minus

                                                                       
Query: 249 atcttagagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggag 308
           ||||||||||| |||||||| || ||||||| |||||||| ||||||||||||| |||||
Sbjct: 341 atcttagagcaatccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282

                                                                       
Query: 309 gggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgcacttgcac 368
           ||||| |  || ||||| || | ||| |||||||| ||||| |||||||||||| |||| 
Sbjct: 281 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 222

                                                                       
Query: 369 gccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacaccgctgcag 428
           |||||||||||||| ||||||||| | |||  |||||||| |||| | || |||   |||
Sbjct: 221 gccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaactccggaacag 162

                                                                       
Query: 429 caggccacaggcggtttggcgccgttgccgcgggcataggagatgcaggggctcaaggca 488
           |||||| |||||||  |||| ||| ||||    || ||||||| ||||| |  || ||||
Sbjct: 161 caggccccaggcgggctggccccgctgccttttgcgtaggagacgcaggaggccagggca 102

                                                                       
Query: 489 gagctcacctgaccgcaggagatggccgcgtcggtagctacgatgagcatggcggccacc 548
           ||| ||||||||||||||| ||| ||||||||||  ||||| | |||||| || ||||||
Sbjct: 101 gagttcacctgaccgcaggggatcgccgcgtcggaggctaccaggagcattgccgccacc 42

                                                     
Query: 549 atggcgaccagcacgagnctgagtagctgcagcgcgagccat 590
           | ||||||||||||||| ||  || ||||||| |||||||||
Sbjct: 41  agggcgaccagcacgag-ctttgttgctgcagtgcgagccat 1



to top

>gb|AY789644.1| Triticum aestivum lipid transfer protein 4 (LTP4) mRNA, complete
           cds
          Length = 345

 Score =  186 bits (94), Expect = 6e-44
 Identities = 257/310 (82%), Gaps = 1/310 (0%)
 Strand = Plus / Minus

                                                                       
Query: 281 gtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagccc 340
           ||||||||||||||||| |||| ||||||||||  | |||||| ||||  | || | |||
Sbjct: 309 gtaggggacgctgacgcggcacttggaggggatctctgcggccgtgccttctttgacccc 250

                                                                       
Query: 341 acccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgc 400
           ||| ||||| ||||||||||||  ||||||||||| |||||||||||   ||||  ||  
Sbjct: 249 accggcagcactcttgatgcacaggcacgccgctttcttgtcagcggcagtctgcacttg 190

                                                                       
Query: 401 gccggccagtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcg 460
           |||||||| |||| |||| ||||||||||||||| ||| |||  ||||||||||||||||
Sbjct: 189 gccggccaatctcctgacgccgctgcagcaggccgcagacgggctggcgccgttgccgcg 130

                                                                       
Query: 461 ggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtc 520
            |||||||| | ||| ||||  | ||| ||||||||||| ||||||||||| ||||||||
Sbjct: 129 tgcataggaaaggcacgggccaagggcggagctcacctggccgcaggagattgccgcgtc 70

                                                                       
Query: 521 ggtagctacgatgagcatggcggccaccatggcgaccagcacgagnctgagtagctgcag 580
           ||  ||||| | ||| |  || ||||||| ||||||||||||||| || |||||||| ||
Sbjct: 69  ggaggctacaaggaggagtgccgccaccagggcgaccagcacgag-cttagtagctgtag 11

                     
Query: 581 cgcgagccat 590
            |||||||||
Sbjct: 10  tgcgagccat 1



to top

>emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid transfer protein precursor
          Length = 627

 Score =  159 bits (80), Expect = 1e-35
 Identities = 254/311 (81%), Gaps = 1/311 (0%)
 Strand = Plus / Minus

                                                                       
Query: 281 gtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagccc 340
           |||||||||||||||||||||| |||||||||| || |||||| |||| |||||   | |
Sbjct: 311 gtaggggacgctgacgccgcacctggaggggatgcctgcggccctgccggcgttgtacgc 252

                                                                       
Query: 341 acccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgc 400
            || ||  | ||||||| |||| ||||||  ||||||||||| ||||||||| | |||  
Sbjct: 251 gccggcgacactcttgaggcacctgcacgtagcttgcttgtcggcggtgctccgcgctaa 192

                                                                       
Query: 401 gccggccagtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcg 460
           |||||||| ||||||||| ||||| |||||| || |||  ||  ||| |||| ||||   
Sbjct: 191 gccggccaatctcttgactccgctacagcagcccgcagaagggctggtgccgctgccttt 132

                                                                       
Query: 461 ggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtc 520
            || |||| |  |||||||| |||||||||||||||||| ||||||| ||||||||||||
Sbjct: 131 tgcgtaggcggcgcaggggcccaaggcagagctcacctggccgcaggtgatggccgcgtc 72

                                                                       
Query: 521 ggtagctacgatgagcatggcggccaccatggcgaccagcacgagnctgagtagctgcag 580
           ||  ||||||| |||||| || ||||||| |||||||||| ||||  || || |||||||
Sbjct: 71  ggcggctacgaggagcattgccgccaccagggcgaccagcgcgagcttg-gttgctgcag 13

                      
Query: 581 cgcgagccatc 591
            ||||||||||
Sbjct: 12  tgcgagccatc 2



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 52/62 (83%), Gaps = 4/62 (6%)
 Strand = Plus / Minus

                                                                       
Query: 161 atttattcatatatatgtatgtatg----tgtgacctcaacgtactcagcgtcgatcgct 216
           |||||||||| ||||||||| ||||    |||||||||||| | |  |||||||||||||
Sbjct: 447 atttattcatgtatatgtatatatgcgtatgtgacctcaacctgccaagcgtcgatcgct 388

             
Query: 217 gg 218
           ||
Sbjct: 387 gg 386



to top

>emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA
          Length = 732

 Score =  143 bits (72), Expect = 8e-31
 Identities = 252/311 (81%), Gaps = 1/311 (0%)
 Strand = Plus / Minus

                                                                       
Query: 281 gtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagccc 340
           ||||||||||||||| |||||| |||||||||| || |||||| | || |||||   | |
Sbjct: 382 gtaggggacgctgaccccgcacctggaggggatgcctgcggcccttccggcgttgtacgc 323

                                                                       
Query: 341 acccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgc 400
            || ||  | ||||||| |||| ||||||  ||||||||||| ||||||||| | |||  
Sbjct: 322 gccggcgacactcttgaggcacctgcacgtagcttgcttgtcggcggtgctccgcgctaa 263

                                                                       
Query: 401 gccggccagtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcg 460
           |||||||| ||||||||| ||||| |||||| || |||  ||  ||| |||| ||||   
Sbjct: 262 gccggccaatctcttgactccgctacagcagcccgcagaagggctggtgccgctgccttt 203

                                                                       
Query: 461 ggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtc 520
            || |||| |  |||||||| |||||||||||||||||| ||||||| ||||||||||||
Sbjct: 202 tgcgtaggcggcgcaggggcccaaggcagagctcacctggccgcaggtgatggccgcgtc 143

                                                                       
Query: 521 ggtagctacgatgagcatggcggccaccatggcgaccagcacgagnctgagtagctgcag 580
           ||  ||||||| |||||| || ||||||| |||||||||| ||||  || || |||||||
Sbjct: 142 ggcggctacgaggagcattgccgccaccagggcgaccagcgcgagcttg-gttgctgcag 84

                      
Query: 581 cgcgagccatc 591
            ||||||||||
Sbjct: 83  tgcgagccatc 73



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 52/62 (83%), Gaps = 4/62 (6%)
 Strand = Plus / Minus

                                                                       
Query: 161 atttattcatatatatgtatgtatg----tgtgacctcaacgtactcagcgtcgatcgct 216
           |||||||||| ||||||||| ||||    |||||||||||| | |  |||||||||||||
Sbjct: 518 atttattcatgtatatgtatatatgcgtatgtgacctcaaccttccaagcgtcgatcgct 459

             
Query: 217 gg 218
           ||
Sbjct: 458 gg 457



to top

>emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA
          Length = 724

 Score =  131 bits (66), Expect = 3e-27
 Identities = 224/275 (81%), Gaps = 5/275 (1%)
 Strand = Plus / Minus

                                                                       
Query: 161 atttattcatatatatgtatgtatgtgt----gacctcaacgtactcagcgtcgatcgct 216
           |||||||||| ||||||||| |||||||    ||||||||| |||  |||||||||||||
Sbjct: 503 atttattcatgtatatgtatatatgtgtatgtgacctcaacctaccaagcgtcgatcgct 444

                                                                       
Query: 217 ggggctataggcagcaagtggttgatcagcgaatcttagagcagtccacggaagcactga 276
           || | ||| || |||| ||| | |||||| | |||||||||||||| ||    || ||||
Sbjct: 443 ggagatatggggagcacgtgttcgatcagtggatcttagagcagtcgacactggcgctga 384

                                                                       
Query: 277 tggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgttta 336
           | | |||||||||||||||||||||| |||||||||| || |||||| |||| |||||  
Sbjct: 383 tcgtgtaggggacgctgacgccgcacctggaggggatgcctgcggccctgccggcgttgt 324

                                                                       
Query: 337 gcccacccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctggg 396
            | | || ||| | ||||||| |||| ||||||  ||||||||||| ||||||||| | |
Sbjct: 323 acgcgccggca-cactcttgaggcacctgcacgtagcttgcttgtcggcggtgctccgcg 265

                                              
Query: 397 ctgcgccggccagtctcttgacaccgctgcagcag 431
           ||  |||||||| ||||||||| ||||| ||||||
Sbjct: 264 ctaagccggccaatctcttgactccgctacagcag 230



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 100/119 (84%), Gaps = 3/119 (2%)
 Strand = Plus / Minus

                                                                       
Query: 473 gcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtagctacgat 532
           |||||||| |||||||||||||||||| ||||||| ||||  ||||||||  ||||||| 
Sbjct: 189 gcaggggcccaaggcagagctcacctggccgcaggtgatg--cgcgtcggcggctacgag 132

                                                                      
Query: 533 gagcatggcggccaccatggcgaccagcacgagnctgagtagctgcagcgcgagccatc 591
           |||||| || ||||||| ||  |||||| ||||  || || ||||||| ||||||||||
Sbjct: 131 gagcattgccgccaccaggggcaccagcgcgagcttg-gttgctgcagtgcgagccatc 74



to top

>gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0086N07 map S790A, complete sequence
          Length = 178523

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 78/88 (88%)
 Strand = Plus / Plus

                                                                         
Query: 253   tagagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggagggga 312
             |||||||||| | |||||| ||||||| |||||||||||||||||||||| |||||||||
Sbjct: 94021 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 94080

                                         
Query: 313   ttccggcggccttgccagcgtttagccc 340
             | | |||||| ||||| ||||| |||||
Sbjct: 94081 tgctggcggcgttgccggcgttgagccc 94108



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 78/88 (88%)
 Strand = Plus / Minus

                                                                            
Query: 253      tagagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggagggga 312
                |||||||||| | |||||| ||||||| |||||||||||||||||||||| |||||||||
Sbjct: 13090059 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13090000

                                            
Query: 313      ttccggcggccttgccagcgtttagccc 340
                | | |||||| ||||| ||||| |||||
Sbjct: 13089999 tgctggcggcgttgccggcgttgagccc 13089972



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 75/86 (87%)
 Strand = Plus / Minus

                                                                          
Query: 255    gagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggaggggatt 314
              |||||||| | |||||| ||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382

                                        
Query: 315    ccggcggccttgccagcgtttagccc 340
              | |||||| ||||| ||||| |||||
Sbjct: 702381 ctggcggcgttgccggcgttgagccc 702356



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                          
Query: 273    ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
              ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 692746 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcg 692687

                
Query: 333    tt 334
              ||
Sbjct: 692686 tt 692685



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                              
Query: 273    ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 320
              |||||||||||||||| | ||||| ||||| |||||||||| ||||||
Sbjct: 679451 ctgatggcgtaggggatgttgacgtcgcacttggaggggatgccggcg 679404



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 169     atatatatgtatgtatgtgtg 189
               |||||||||||||||||||||
Sbjct: 2482379 atatatatgtatgtatgtgtg 2482399



to top

>dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086A05, full
           insert sequence
          Length = 843

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 78/88 (88%)
 Strand = Plus / Minus

                                                                       
Query: 253 tagagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggagggga 312
           |||||||||| | |||||| ||||||| |||||||||||||||||||||| |||||||||
Sbjct: 459 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 400

                                       
Query: 313 ttccggcggccttgccagcgtttagccc 340
           | | |||||| ||||| ||||| |||||
Sbjct: 399 tgctggcggcgttgccggcgttgagccc 372



to top

>dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-H12, full
           insert sequence
          Length = 846

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 78/88 (88%)
 Strand = Plus / Minus

                                                                       
Query: 253 tagagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggagggga 312
           |||||||||| | |||||| ||||||| |||||||||||||||||||||| |||||||||
Sbjct: 458 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 399

                                       
Query: 313 ttccggcggccttgccagcgtttagccc 340
           | | |||||| ||||| ||||| |||||
Sbjct: 398 tgctggcggcgttgccggcgttgagccc 371



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 78/88 (88%)
 Strand = Plus / Minus

                                                                            
Query: 253      tagagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggagggga 312
                |||||||||| | |||||| ||||||| |||||||||||||||||||||| |||||||||
Sbjct: 13170238 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13170179

                                            
Query: 313      ttccggcggccttgccagcgtttagccc 340
                | | |||||| ||||| ||||| |||||
Sbjct: 13170178 tgctggcggcgttgccggcgttgagccc 13170151



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 75/86 (87%)
 Strand = Plus / Minus

                                                                          
Query: 255    gagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggaggggatt 314
              |||||||| | |||||| ||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382

                                        
Query: 315    ccggcggccttgccagcgtttagccc 340
              | |||||| ||||| ||||| |||||
Sbjct: 702381 ctggcggcgttgccggcgttgagccc 702356



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                          
Query: 273    ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
              ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 692746 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcg 692687

                
Query: 333    tt 334
              ||
Sbjct: 692686 tt 692685



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                              
Query: 273    ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 320
              |||||||||||||||| | ||||| ||||| |||||||||| ||||||
Sbjct: 679451 ctgatggcgtaggggatgttgacgtcgcacttggaggggatgccggcg 679404



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 169     atatatatgtatgtatgtgtg 189
               |||||||||||||||||||||
Sbjct: 2491453 atatatatgtatgtatgtgtg 2491473



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12,
              complete sequence
          Length = 27566993

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 76/86 (88%)
 Strand = Plus / Minus

                                                                          
Query: 255    gagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggaggggatt 314
              |||||||| | |||||| ||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684

                                        
Query: 315    ccggcggccttgccagcgtttagccc 340
              | |||||| ||||| ||||| |||||
Sbjct: 736683 ctggcggcgttgccggcgttgagccc 736658



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                          
Query: 273    ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
              ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 732598 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcg 732539

                
Query: 333    tt 334
              ||
Sbjct: 732538 tt 732537



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                              
Query: 273    ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 320
              ||||| |||||||||| | ||||||||||| |||||||||| ||||||
Sbjct: 722709 ctgatagcgtaggggatgttgacgccgcacttggaggggatgccggcg 722662



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 170     tatatatgtatgtatgtgtg 189
               ||||||||||||||||||||
Sbjct: 9389648 tatatatgtatgtatgtgtg 9389667



to top

>emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15
          Length = 511

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 76/86 (88%)
 Strand = Plus / Minus

                                                                       
Query: 255 gagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggaggggatt 314
           |||||||| | |||||| ||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 413 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 354

                                     
Query: 315 ccggcggccttgccagcgtttagccc 340
           | |||||| ||||| ||||| |||||
Sbjct: 353 ctggcggcgttgccggcgttgagccc 328



to top

>dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-A04, full
           insert sequence
          Length = 995

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 76/86 (88%)
 Strand = Plus / Minus

                                                                       
Query: 255 gagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggaggggatt 314
           |||||||| | |||||| ||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 670 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 611

                                     
Query: 315 ccggcggccttgccagcgtttagccc 340
           | |||||| ||||| ||||| |||||
Sbjct: 610 ctggcggcgttgccggcgttgagccc 585



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 76/86 (88%)
 Strand = Plus / Minus

                                                                          
Query: 255    gagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggaggggatt 314
              |||||||| | |||||| ||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684

                                        
Query: 315    ccggcggccttgccagcgtttagccc 340
              | |||||| ||||| ||||| |||||
Sbjct: 736683 ctggcggcgttgccggcgttgagccc 736658



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                          
Query: 273    ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
              ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 732598 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcg 732539

                
Query: 333    tt 334
              ||
Sbjct: 732538 tt 732537



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                              
Query: 273    ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 320
              ||||| |||||||||| | ||||||||||| |||||||||| ||||||
Sbjct: 722709 ctgatagcgtaggggatgttgacgccgcacttggaggggatgccggcg 722662



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 170     tatatatgtatgtatgtgtg 189
               ||||||||||||||||||||
Sbjct: 9389533 tatatatgtatgtatgtgtg 9389552



to top

>emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136_E08 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 118211

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 76/86 (88%)
 Strand = Plus / Plus

                                                                         
Query: 255   gagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggaggggatt 314
             |||||||| | |||||| ||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 42391 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 42450

                                       
Query: 315   ccggcggccttgccagcgtttagccc 340
             | |||||| ||||| ||||| |||||
Sbjct: 42451 ctggcggcgttgccggcgttgagccc 42476



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                         
Query: 273   ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
             ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 46536 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcg 46595

               
Query: 333   tt 334
             ||
Sbjct: 46596 tt 46597



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                             
Query: 273   ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 320
             ||||| |||||||||| | ||||||||||| |||||||||| ||||||
Sbjct: 56425 ctgatagcgtaggggatgttgacgccgcacttggaggggatgccggcg 56472



to top

>emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein
          Length = 799

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 67/75 (89%)
 Strand = Plus / Minus

                                                                       
Query: 266 ggaagcactgatggcgtaggggacgctgacgccgcacatggaggggattccggcggcctt 325
           |||||| ||||||| |||||||||||||||||||||| |||||||||| | |||||| ||
Sbjct: 427 ggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcggcgtt 368

                          
Query: 326 gccagcgtttagccc 340
           ||| ||||| |||||
Sbjct: 367 gccggcgttgagccc 353



to top

>gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) mRNA, complete cds
          Length = 799

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 67/75 (89%)
 Strand = Plus / Minus

                                                                       
Query: 266 ggaagcactgatggcgtaggggacgctgacgccgcacatggaggggattccggcggcctt 325
           |||||| ||||||| |||||||||||||||||||||| |||||||||| | |||||| ||
Sbjct: 427 ggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcggcgtt 368

                          
Query: 326 gccagcgtttagccc 340
           ||| ||||| |||||
Sbjct: 367 gccggcgttgagccc 353



to top

>gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LT1
           mRNA, complete cds
          Length = 530

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 75/86 (87%)
 Strand = Plus / Minus

                                                                       
Query: 255 gagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggaggggatt 314
           |||||||| | |||||| ||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 426 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 367

                                     
Query: 315 ccggcggccttgccagcgtttagccc 340
           | |||||| ||||| ||||| |||||
Sbjct: 366 ctggcggcgttgccggcgttgagccc 341



to top

>dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023053H09, full
            insert sequence
          Length = 2882

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 75/86 (87%)
 Strand = Plus / Minus

                                                                        
Query: 255  gagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggaggggatt 314
            |||||||| | |||||| ||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 2445 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 2386

                                      
Query: 315  ccggcggccttgccagcgtttagccc 340
            | |||||| ||||| ||||| |||||
Sbjct: 2385 ctggcggcgttgccggcgttgagccc 2360



to top

>dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-003-B09, full
           insert sequence
          Length = 551

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 75/86 (87%)
 Strand = Plus / Minus

                                                                       
Query: 255 gagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggaggggatt 314
           |||||||| | |||||| ||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 322 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 263

                                     
Query: 315 ccggcggccttgccagcgtttagccc 340
           | |||||| ||||| ||||| |||||
Sbjct: 262 ctggcggcgttgccggcgttgagccc 237



to top

>emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa0025K19 of library OSJNBa from
             chromosome 11 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 181322

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 75/86 (87%)
 Strand = Plus / Plus

                                                                         
Query: 255   gagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggaggggatt 314
             |||||||| | |||||| ||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 40531 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 40590

                                       
Query: 315   ccggcggccttgccagcgtttagccc 340
             | |||||| ||||| ||||| |||||
Sbjct: 40591 ctggcggcgttgccggcgttgagccc 40616



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                         
Query: 273   ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
             ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 50226 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcg 50285

               
Query: 333   tt 334
             ||
Sbjct: 50286 tt 50287



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                             
Query: 273   ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 320
             |||||||||||||||| | ||||| ||||| |||||||||| ||||||
Sbjct: 63521 ctgatggcgtaggggatgttgacgtcgcacttggaggggatgccggcg 63568



to top

>gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT IV mRNA, complete cds
          Length = 507

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 66/75 (88%)
 Strand = Plus / Minus

                                                                       
Query: 266 ggaagcactgatggcgtaggggacgctgacgccgcacatggaggggattccggcggcctt 325
           |||||| ||||||| |||||||||||||||||||||| | |||||||| | |||||| ||
Sbjct: 362 ggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatgctggcggcgtt 303

                          
Query: 326 gccagcgtttagccc 340
           ||| ||||| |||||
Sbjct: 302 gccggcgttgagccc 288



to top

>gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA, complete cds
          Length = 695

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 255 gagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggaggggatt 314
           ||||||| ||| ||||  ||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 337 gagcagtacacagaagggctgatggtgtaggggatgctgacgccgcacttggaggggatg 278

                                  
Query: 315 ccggcggccttgccagcgtttag 337
           | |||||| ||||| ||||||||
Sbjct: 277 ctggcggcattgccggcgtttag 255



to top

>emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA
          Length = 717

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||||||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 276 ctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcggcgttgccggcg 217

             
Query: 333 tt 334
           ||
Sbjct: 216 tt 215



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 489 gagctcacctgaccgcaggagatggccgc 517
           ||||||||||| |||||||||||||||||
Sbjct: 54  gagctcacctgcccgcaggagatggccgc 26



to top

>emb|X71667.1|SVLTP1 S.vulgare ltp1 gene
          Length = 1499

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||||||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 979 ctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcggcgttgccggcg 920

             
Query: 333 tt 334
           ||
Sbjct: 919 tt 918



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 489 gagctcacctgaccgcaggagatggccgc 517
           ||||||||||| |||||||||||||||||
Sbjct: 754 gagctcacctgcccgcaggagatggccgc 726



to top

>gb|AF017360.1|AF017360 Oryza sativa lipid transfer protein LPT III mRNA, complete cds
          Length = 805

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 75/86 (87%), Gaps = 1/86 (1%)
 Strand = Plus / Minus

                                                                       
Query: 255 gagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggaggggatt 314
           |||||||| | |||||| ||||||| |||||| ||||||||||||||| |||||||||| 
Sbjct: 412 gagcagtcgatggaagcgctgatggtgtaggg-acgctgacgccgcacttggaggggatg 354

                                     
Query: 315 ccggcggccttgccagcgtttagccc 340
           | |||||| ||||| ||||| |||||
Sbjct: 353 ctggcggcgttgccggcgttgagccc 328



to top

>emb|X71668.1|SVLTP2 S.vulgare ltp2 gene
          Length = 1800

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                   
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgcc 328
           ||||||| |||||||| ||||||||||||| |||||||||| | ||||||||||||
Sbjct: 947 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggccttgcc 892



to top

>gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LPT1
           mRNA, complete cds
          Length = 647

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 451 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcg 392

             
Query: 333 tt 334
           ||
Sbjct: 391 tt 390



to top

>emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, complete CDS
          Length = 1485

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 683 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcg 624

             
Query: 333 tt 334
           ||
Sbjct: 623 tt 622



to top

>emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1
          Length = 692

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 313 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcg 254

             
Query: 333 tt 334
           ||
Sbjct: 253 tt 252



to top

>dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-C01, full
           insert sequence
          Length = 718

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 98  ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcg 157

             
Query: 333 tt 334
           ||
Sbjct: 158 tt 159



to top

>dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-C07, full
           insert sequence
          Length = 1003

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 636 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcg 577

             
Query: 333 tt 334
           ||
Sbjct: 576 tt 575



to top

>dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-G08, full
           insert sequence
          Length = 840

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 419 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcg 360

             
Query: 333 tt 334
           ||
Sbjct: 359 tt 358



to top

>gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT II mRNA, complete cds
          Length = 845

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 401 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcg 342

             
Query: 333 tt 334
           ||
Sbjct: 341 tt 340



to top

>gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA, complete cds
          Length = 770

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 405 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 346

             
Query: 333 tt 334
           ||
Sbjct: 345 tt 344



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 454 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 513
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 215 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 156

            
Query: 514 c 514
           |
Sbjct: 155 c 155



to top

>gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transfer protein 1
           (plt1) gene, partial cds
          Length = 698

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 315 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 256

             
Query: 333 tt 334
           ||
Sbjct: 255 tt 254



to top

>gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfer protein 1 (plt1)
           gene, partial cds
          Length = 514

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 307 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 248

             
Query: 333 tt 334
           ||
Sbjct: 247 tt 246



to top

>gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transfer protein 1
           (plt1) gene, partial cds
          Length = 514

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 307 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 248

             
Query: 333 tt 334
           ||
Sbjct: 247 tt 246



to top

>gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 804

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 416 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 357

             
Query: 333 tt 334
           ||
Sbjct: 356 tt 355



to top

>gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 831

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 433 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 374

             
Query: 333 tt 334
           ||
Sbjct: 373 tt 372



to top

>gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 639

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 326 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 267

             
Query: 333 tt 334
           ||
Sbjct: 266 tt 265



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 454 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 513
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 136 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 77

            
Query: 514 c 514
           |
Sbjct: 76  c 76



to top

>gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 326 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 267

             
Query: 333 tt 334
           ||
Sbjct: 266 tt 265



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 454 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 513
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 136 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 77

            
Query: 514 c 514
           |
Sbjct: 76  c 76



to top

>gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 326 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 267

             
Query: 333 tt 334
           ||
Sbjct: 266 tt 265



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 454 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 513
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 136 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 77

            
Query: 514 c 514
           |
Sbjct: 76  c 76



to top

>gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 326 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 267

             
Query: 333 tt 334
           ||
Sbjct: 266 tt 265



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 454 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 513
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 136 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 77

            
Query: 514 c 514
           |
Sbjct: 76  c 76



to top

>gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 326 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 267

             
Query: 333 tt 334
           ||
Sbjct: 266 tt 265



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 454 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 513
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 136 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 77

            
Query: 514 c 514
           |
Sbjct: 76  c 76



to top

>gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 635

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 326 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 267

             
Query: 333 tt 334
           ||
Sbjct: 266 tt 265



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 454 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 513
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 136 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 77

            
Query: 514 c 514
           |
Sbjct: 76  c 76



to top

>gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 326 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 267

             
Query: 333 tt 334
           ||
Sbjct: 266 tt 265



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 454 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 513
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 136 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 77

            
Query: 514 c 514
           |
Sbjct: 76  c 76



to top

>gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 326 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 267

             
Query: 333 tt 334
           ||
Sbjct: 266 tt 265



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 454 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 513
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 136 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 77

            
Query: 514 c 514
           |
Sbjct: 76  c 76



to top

>gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 326 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 267

             
Query: 333 tt 334
           ||
Sbjct: 266 tt 265



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 454 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 513
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 136 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 77

            
Query: 514 c 514
           |
Sbjct: 76  c 76



to top

>gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 613

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 300 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 241

             
Query: 333 tt 334
           ||
Sbjct: 240 tt 239



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 454 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 513
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 110 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 51

            
Query: 514 c 514
           |
Sbjct: 50  c 50



to top

>gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transfer protein 2 (pl2)
           gene, partial cds
          Length = 613

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 300 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 241

             
Query: 333 tt 334
           ||
Sbjct: 240 tt 239



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 454 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 513
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 110 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 51

            
Query: 514 c 514
           |
Sbjct: 50  c 50



to top

>gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 826

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 397 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 338

             
Query: 333 tt 334
           ||
Sbjct: 337 tt 336



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 454 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 513
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 514 c 514
           |
Sbjct: 147 c 147



to top

>gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 822

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 397 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 338

             
Query: 333 tt 334
           ||
Sbjct: 337 tt 336



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 454 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 513
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 514 c 514
           |
Sbjct: 147 c 147



to top

>gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 829

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 396 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 337

             
Query: 333 tt 334
           ||
Sbjct: 336 tt 335



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 454 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 513
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 206 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 147

            
Query: 514 c 514
           |
Sbjct: 146 c 146



to top

>gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 816

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 397 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 338

             
Query: 333 tt 334
           ||
Sbjct: 337 tt 336



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 454 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 513
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 514 c 514
           |
Sbjct: 147 c 147



to top

>gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 397 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 338

             
Query: 333 tt 334
           ||
Sbjct: 337 tt 336



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 454 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 513
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 514 c 514
           |
Sbjct: 147 c 147



to top

>gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 826

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 397 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 338

             
Query: 333 tt 334
           ||
Sbjct: 337 tt 336



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 454 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 513
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 514 c 514
           |
Sbjct: 147 c 147



to top

>gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 818

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 397 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 338

             
Query: 333 tt 334
           ||
Sbjct: 337 tt 336



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 454 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 513
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 514 c 514
           |
Sbjct: 147 c 147



to top

>gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 822

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 397 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 338

             
Query: 333 tt 334
           ||
Sbjct: 337 tt 336



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 454 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 513
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 514 c 514
           |
Sbjct: 147 c 147



to top

>gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 397 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 338

             
Query: 333 tt 334
           ||
Sbjct: 337 tt 336



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 454 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 513
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 514 c 514
           |
Sbjct: 147 c 147



to top

>gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 832

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 397 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 338

             
Query: 333 tt 334
           ||
Sbjct: 337 tt 336



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 454 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 513
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 514 c 514
           |
Sbjct: 147 c 147



to top

>gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 820

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 397 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 338

             
Query: 333 tt 334
           ||
Sbjct: 337 tt 336



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 454 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 513
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 514 c 514
           |
Sbjct: 147 c 147



to top

>gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 397 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 338

             
Query: 333 tt 334
           ||
Sbjct: 337 tt 336



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 454 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 513
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 514 c 514
           |
Sbjct: 147 c 147



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                                
Query: 273      ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 320
                |||||||||||||||| | ||||||||||| |||||||||| ||||||
Sbjct: 14437046 ctgatggcgtaggggatgttgacgccgcacttggaggggatgccggcg 14436999



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 163      ttattcatatatatgtatgtatgt 186
                |||| |||||||||||||||||||
Sbjct: 13185988 ttatacatatatatgtatgtatgt 13186011



to top

>dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1116_C12
          Length = 116758

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                             
Query: 273   ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 320
             |||||||||||||||| | ||||||||||| |||||||||| ||||||
Sbjct: 45544 ctgatggcgtaggggatgttgacgccgcacttggaggggatgccggcg 45497



to top

>gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence
          Length = 827

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggc 322
           ||||||| |||||||| ||||||||||||| |||||||||| | ||||||
Sbjct: 416 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 367



to top

>gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfer protein 1 (plt1)
           gene, partial cds
          Length = 699

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| ||||||| || | |||||| ||||| |||
Sbjct: 300 ctgatggtgtaggggatgctgacgccgcacttggagggtatgctggcggcgttgccggcg 241

             
Query: 333 tt 334
           ||
Sbjct: 240 tt 239



to top

>gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 780

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggc 322
           ||||||| |||||||| ||||||||||||| |||||||||| | ||||||
Sbjct: 398 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 349



to top

>gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 714

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggc 322
           ||||||| |||||||| ||||||||||||| |||||||||| | ||||||
Sbjct: 323 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 274



to top

>gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 648

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggc 322
           ||||||| |||||||| ||||||||||||| |||||||||| | ||||||
Sbjct: 422 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 373



to top

>gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 829

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggc 322
           ||||||| |||||||| ||||||||||||| |||||||||| | ||||||
Sbjct: 435 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 386



to top

>gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 831

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggc 322
           ||||||| |||||||| ||||||||||||| |||||||||| | ||||||
Sbjct: 437 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 388



to top

>gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 821

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggc 322
           ||||||| |||||||| ||||||||||||| |||||||||| | ||||||
Sbjct: 432 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 383



to top

>gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 832

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggc 322
           ||||||| |||||||| ||||||||||||| |||||||||| | ||||||
Sbjct: 435 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 386



to top

>gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 835

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggc 322
           ||||||| |||||||| ||||||||||||| |||||||||| | ||||||
Sbjct: 432 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 383



to top

>gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 814

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggc 322
           ||||||| |||||||| ||||||||||||| |||||||||| | ||||||
Sbjct: 432 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 383



to top

>gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||| ||||| | |||||| ||||| |||
Sbjct: 397 ctgatggtgtaggggatgctgacgccgcacttggacgggatgctggcggcgttgccggcg 338

             
Query: 333 tt 334
           ||
Sbjct: 337 tt 336



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 454 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 513
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 514 c 514
           |
Sbjct: 147 c 147



to top

>gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| |||||||| ||||||||||||| |||| ||||| | |||||| ||||| |||
Sbjct: 397 ctgatggtgtaggggatgctgacgccgcacttggacgggatgctggcggcgttgccggcg 338

             
Query: 333 tt 334
           ||
Sbjct: 337 tt 336



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 454 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 513
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 514 c 514
           |
Sbjct: 147 c 147



to top

>gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3' end
          Length = 677

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggc 322
           ||||||| |||||||| ||||||||||||| |||||||||| | ||||||
Sbjct: 246 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 197



to top

>gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, complete cds. of clone
           9C2
          Length = 813

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggc 322
           ||||||| |||||||| ||||||||||||| |||||||||| | ||||||
Sbjct: 433 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 384



to top

>dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-125-E10, full
           insert sequence
          Length = 793

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 320
           ||||| |||||||||| | ||||||||||| |||||||||| ||||||
Sbjct: 412 ctgatagcgtaggggatgttgacgccgcacttggaggggatgccggcg 365



to top

>dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033094A19, full
            insert sequence
          Length = 3876

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 273  ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 320
            ||||| |||||||||| | ||||||||||| |||||||||| ||||||
Sbjct: 3498 ctgatagcgtaggggatgttgacgccgcacttggaggggatgccggcg 3451



to top

>dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044B21, full
           insert sequence
          Length = 792

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 320
           ||||| |||||||||| | ||||||||||| |||||||||| ||||||
Sbjct: 414 ctgatagcgtaggggatgttgacgccgcacttggaggggatgccggcg 367



to top

>dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-E10, full
           insert sequence
          Length = 745

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 320
           |||||||||||||||| | ||||| ||||| |||||||||| ||||||
Sbjct: 416 ctgatggcgtaggggatgttgacgtcgcacttggaggggatgccggcg 369



to top

>gb|AC131676.2| Mus musculus BAC clone RP23-330L3 from chromosome 6, complete sequence
          Length = 200673

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 164    tattcatatatatgtatgtatgtgtg 189
              ||||||||||||||||||||||||||
Sbjct: 131928 tattcatatatatgtatgtatgtgtg 131903



to top

>emb|CT025614.7| Mouse DNA sequence from clone RP23-418B18 on chromosome 13, complete
              sequence
          Length = 183907

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 162    tttattcatatatatgtatgtatgtg 187
              ||||||||||||||||||||||||||
Sbjct: 118142 tttattcatatatatgtatgtatgtg 118117



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 169   atatatatgtatgtatgtgtg 189
             |||||||||||||||||||||
Sbjct: 84210 atatatatgtatgtatgtgtg 84230



to top

>gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precursor (LTP2) mRNA, complete
           cds
          Length = 840

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 332
           ||||||| ||||||||   ||||||||||| |||||||||| | |||||| ||||| |||
Sbjct: 396 ctgatggtgtaggggatcgtgacgccgcacttggaggggatgctggcggcattgccggcg 337

             
Query: 333 tt 334
           ||
Sbjct: 336 tt 335



to top

>gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer
           protein 1 (plt1) gene, partial cds
          Length = 709

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 273 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggc 322
           |||||||  ||||||| ||||||||||||| |||||||||| | ||||||
Sbjct: 301 ctgatggtataggggatgctgacgccgcacttggaggggatgctggcggc 252



to top

>gb|AC131678.4| Mus musculus BAC clone RP23-333L1 from chromosome 3, complete sequence
          Length = 203750

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 161   atttattcatatatatgtatgtatgtgtg 189
             |||||||||||| ||||||||||||||||
Sbjct: 29729 atttattcatatgtatgtatgtatgtgtg 29701



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 160    catttattcatatatatgtatgtatgtgtg 189
              |||| |||||||||||||||||| ||||||
Sbjct: 123704 cattcattcatatatatgtatgtgtgtgtg 123733



to top

>gb|AC147066.2| Pan troglodytes BAC clone RP43-164F2 from 7, complete sequence
          Length = 149431

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 156   tgtgcatttattcatatatatgtatgtat 184
             ||||||| |||||||||||||||||||||
Sbjct: 78712 tgtgcatgtattcatatatatgtatgtat 78740



to top

>gb|AC146512.2| Pan troglodytes BAC clone RP43-16E21 from 7, complete sequence
          Length = 178648

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 156    tgtgcatttattcatatatatgtatgtat 184
              ||||||| |||||||||||||||||||||
Sbjct: 105788 tgtgcatgtattcatatatatgtatgtat 105760



to top

>gb|AC006332.3| Homo sapiens BAC clone RP11-376O14 from 7, complete sequence
          Length = 153477

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 156   tgtgcatttattcatatatatgtatgtat 184
             ||||||| |||||||||||||||||||||
Sbjct: 75748 tgtgcatgtattcatatatatgtatgtat 75720



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tattcatatatatgtatgtat 184
             |||||||||||||||||||||
Sbjct: 75722 tattcatatatatgtatgtat 75702



to top

>gb|AC102367.35| Mus musculus chromosome 3, clone RP23-211J6, complete sequence
          Length = 185452

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 161   atttattcatatatatgtatgtatgtgtg 189
             |||||||||||| ||||||||||||||||
Sbjct: 59063 atttattcatatgtatgtatgtatgtgtg 59091



to top

>gb|AC099975.11| Mus musculus chromosome 5, clone RP23-23A2, complete sequence
          Length = 213359

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 162    tttattcatatatatgtatgtatg 185
              ||||||||||||||||||||||||
Sbjct: 201655 tttattcatatatatgtatgtatg 201632



to top

>gb|AC122011.3| Mus musculus chromosome 10 clone RP24-352E6, complete sequence
          Length = 181468

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 166   ttcatatatatgtatgtatgtgtg 189
             ||||||||||||||||||||||||
Sbjct: 91974 ttcatatatatgtatgtatgtgtg 91951



to top

>gb|AC166342.3| Mus musculus BAC clone RP24-340A12 from chromosome 9, complete
            sequence
          Length = 174085

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 168  catatatatgtatgtatgtgtgac 191
            ||||||||||||||||||||||||
Sbjct: 1083 catatatatgtatgtatgtgtgac 1106



to top

>gb|AC129336.4| Mus musculus BAC clone RP23-113I7 from chromosome 10, complete
           sequence
          Length = 215437

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 166 ttcatatatatgtatgtatgtgtg 189
           ||||||||||||||||||||||||
Sbjct: 230 ttcatatatatgtatgtatgtgtg 207



to top

>gb|AC116383.11| Mus musculus chromosome 5, clone RP23-15P21, complete sequence
          Length = 259299

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 162    tttattcatatatatgtatgtatg 185
              ||||||||||||||||||||||||
Sbjct: 103346 tttattcatatatatgtatgtatg 103323



to top

>gb|AC100506.17| Mus musculus chromosome 9, clone RP23-144D3, complete sequence
          Length = 198388

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 168    catatatatgtatgtatgtgtgac 191
              ||||||||||||||||||||||||
Sbjct: 118371 catatatatgtatgtatgtgtgac 118394



to top

>gb|AC161590.2| Mus musculus BAC clone RP24-300B21 from chromosome 9, complete sequence
          Length = 162840

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 161    atttattcatatatatgtatgtat 184
              ||||||||||||||||||||||||
Sbjct: 121866 atttattcatatatatgtatgtat 121889



to top

>emb|AL683843.9| Mouse DNA sequence from clone RP23-217E1 on chromosome 11 Contains part
              of the Ranbp17 gene for RAN binding protein 17, an acidic
              (leucine-rich) nuclear phosphoprotein 32 family, member E
              (Anp32e) pseudogene and a high mobility group box 1 (Hmgb1)
              pseudogene, complete sequence
          Length = 198926

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 158    tgcatttattcatatatatgtatgtatgtgtg 189
              |||||||||  |||||||||||||||||||||
Sbjct: 125883 tgcatttatgaatatatatgtatgtatgtgtg 125914



to top

>gb|AC009205.6|AC009205 Drosophila melanogaster, chromosome 2L, region 36E-37C, BAC clone
             BACR04C20, complete sequence
          Length = 166918

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 155   ttgtgcatttattcatatatatgtatgtatgt 186
             |||||| |||||| ||||||||||||||||||
Sbjct: 57344 ttgtgcgtttattgatatatatgtatgtatgt 57375



to top

>gb|AC011756.5|AC011756 Drosophila melanogaster, chromosome 2L, region 36E-37C, BAC clone
              BACR17A06, complete sequence
          Length = 170546

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 155    ttgtgcatttattcatatatatgtatgtatgt 186
              |||||| |||||| ||||||||||||||||||
Sbjct: 142912 ttgtgcgtttattgatatatatgtatgtatgt 142943



to top

>gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid transfer protein 6
            (Ltp6) gene, promoter and complete cds
          Length = 3257

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                            
Query: 273  ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 320
            |||||||||||||||| | ||||||||||| ||  |||||| ||||||
Sbjct: 2769 ctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 2722



to top

>gb|AC005126.4|AC005126 Drosophila melanogaster, chromosome 2L, region 37B9-37C7, P1 clone
            DS04995, complete sequence
          Length = 63571

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                            
Query: 155  ttgtgcatttattcatatatatgtatgtatgt 186
            |||||| |||||| ||||||||||||||||||
Sbjct: 9299 ttgtgcgtttattgatatatatgtatgtatgt 9330



to top

>gb|AE003661.3| Drosophila melanogaster chromosome 2L, section 70 of 83 of the complete
              sequence
          Length = 265558

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 155    ttgtgcatttattcatatatatgtatgtatgt 186
              |||||| |||||| ||||||||||||||||||
Sbjct: 108050 ttgtgcgtttattgatatatatgtatgtatgt 108081



to top

>emb|AL451076.14| Mouse DNA sequence from clone RP23-43O20 on chromosome X, complete
              sequence
          Length = 203581

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 161    atttattcatatatatgtatgtatgtgt 188
              |||||||||||| |||||||||||||||
Sbjct: 198854 atttattcatatgtatgtatgtatgtgt 198827



to top

>gb|AC164875.14| Mus musculus chromosome 1, clone RP23-59P14, complete sequence
          Length = 250957

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 160    catttattcatatatatgtatgtatgtg 187
              |||| |||||||||||||||||||||||
Sbjct: 140060 cattcattcatatatatgtatgtatgtg 140087



to top

>emb|AL732451.8| Mouse DNA sequence from clone RP23-85G19 on chromosome X, complete
             sequence
          Length = 213822

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 165   attcatatatatgtatgtatgtgt 188
             ||||||||||||||||||||||||
Sbjct: 14549 attcatatatatgtatgtatgtgt 14526



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 169   atatatatgtatgtatgtgtg 189
             |||||||||||||||||||||
Sbjct: 14408 atatatatgtatgtatgtgtg 14428



to top

>gb|AC129931.19| Mus musculus chromosome 15, clone RP23-136I22, complete sequence
          Length = 186914

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 167   tcatatatatgtatgtatgtgtg 189
             |||||||||||||||||||||||
Sbjct: 63583 tcatatatatgtatgtatgtgtg 63561



to top

>gb|AC131596.10| Mus musculus chromosome 10, clone RP23-476G10, complete sequence
          Length = 178668

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 164    tattcatatatatgtatgtatgt 186
              |||||||||||||||||||||||
Sbjct: 109912 tattcatatatatgtatgtatgt 109934



to top

>gb|AC146296.3| Mus musculus BAC clone RP23-277D1 from chromosome 9, complete sequence
          Length = 177641

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 164   tattcatatatatgtatgtatgt 186
             |||||||||||||||||||||||
Sbjct: 91375 tattcatatatatgtatgtatgt 91353



to top

>gb|AC122928.4| Mus musculus BAC clone RP23-10G8 from 9, complete sequence
          Length = 205725

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 164   tattcatatatatgtatgtatgt 186
             |||||||||||||||||||||||
Sbjct: 32985 tattcatatatatgtatgtatgt 33007



to top

>gb|AC121605.3| Mus musculus BAC clone RP23-312E16 from 1, complete sequence
          Length = 196494

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 164   tattcatatatatgtatgtatgt 186
             |||||||||||||||||||||||
Sbjct: 39306 tattcatatatatgtatgtatgt 39328



to top

>emb|AL391870.16| Human DNA sequence from clone RP11-491C24 on chromosome 9 Contains part
             of the CDK5RAP2 gene for CDK5 regulatory subunit
             associated protein 2 (C48) and a CpG island, complete
             sequence
          Length = 46372

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 164   tattcatatatatgtatgtatgt 186
             |||||||||||||||||||||||
Sbjct: 13639 tattcatatatatgtatgtatgt 13617



to top

>emb|AL390785.15| Human DNA sequence from clone RP11-325N9 on chromosome 10, complete
              sequence
          Length = 203169

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 164    tattcatatatatgtatgtatgt 186
              |||||||||||||||||||||||
Sbjct: 119047 tattcatatatatgtatgtatgt 119025



to top

>gb|AC159096.2| Mus musculus chromosome 1, clone RP24-95N15, complete sequence
          Length = 189668

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 164    tattcatatatatgtatgtatgt 186
              |||||||||||||||||||||||
Sbjct: 139373 tattcatatatatgtatgtatgt 139351



to top

>gb|AC098971.2| Homo sapiens chromosome 3 clone RP11-118N13, complete sequence
          Length = 175409

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 166    ttcatatatatgtatgtatgtgt 188
              |||||||||||||||||||||||
Sbjct: 155851 ttcatatatatgtatgtatgtgt 155873



to top

>gb|AC113370.2| Homo sapiens chromosome 5 clone RP11-124O5, complete sequence
          Length = 189590

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 164    tattcatatatatgtatgtatgtgtga 190
              ||||||||||||||||||| |||||||
Sbjct: 167821 tattcatatatatgtatgtgtgtgtga 167795



to top

>gb|AC109469.2| Homo sapiens chromosome 5 clone RP11-349F8, complete sequence
          Length = 184776

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 164   tattcatatatatgtatgtatgtgtga 190
             ||||||||||||||||||| |||||||
Sbjct: 76982 tattcatatatatgtatgtgtgtgtga 76956



to top

>gb|AC010474.5| Homo sapiens chromosome 5 clone CTD-2306F13, complete sequence
          Length = 88069

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 164   tattcatatatatgtatgtatgtgtga 190
             ||||||||||||||||||| |||||||
Sbjct: 80840 tattcatatatatgtatgtgtgtgtga 80866



to top

>emb|BX855592.19| Zebrafish DNA sequence from clone CH211-232K3, complete sequence
          Length = 159646

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 162    tttattcatatatatgtatgtat 184
              |||||||||||||||||||||||
Sbjct: 141945 tttattcatatatatgtatgtat 141967



to top

>gb|AC107028.5| Homo sapiens 3 BAC RP11-547K2 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 126716

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 161    atttattcatatatatgtatgtatgtg 187
              |||||||||||||||||||||| ||||
Sbjct: 109602 atttattcatatatatgtatgtgtgtg 109628



to top

>gb|AC104823.4| Homo sapiens BAC clone RP11-762E8 from 2, complete sequence
          Length = 46638

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 163  ttattcatatatatgtatgtatg 185
            |||||||||||||||||||||||
Sbjct: 8434 ttattcatatatatgtatgtatg 8456



to top

>gb|AC012450.9| Homo sapiens BAC clone RP11-351J7 from 2, complete sequence
          Length = 183695

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 162    tttattcatatatatgtatgtatgtgt 188
              |||||||||||||||||||| ||||||
Sbjct: 146967 tttattcatatatatgtatgaatgtgt 146941



to top

>gb|AC093927.3| Homo sapiens chromosome 3 clone RP11-81I24, complete sequence
          Length = 183190

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 166    ttcatatatatgtatgtatgtgt 188
              |||||||||||||||||||||||
Sbjct: 168554 ttcatatatatgtatgtatgtgt 168532



to top

>gb|AC139299.3| Mus musculus BAC clone RP23-335D20 from 1, complete sequence
          Length = 204848

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 162    tttattcatatatatgtatgtatgtgt 188
              |||||| ||||||||||||||||||||
Sbjct: 167582 tttatttatatatatgtatgtatgtgt 167556



to top

>gb|AC160762.4| Mus musculus BAC clone RP24-330E8 from chromosome 1, complete sequence
          Length = 149232

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 162   tttattcatatatatgtatgtatgtgt 188
             |||||| ||||||||||||||||||||
Sbjct: 17539 tttatttatatatatgtatgtatgtgt 17513



to top

>emb|AL772393.11| Mouse DNA sequence from clone RP23-398D18 on chromosome 4, complete
              sequence
          Length = 207495

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 164    tattcatatatatgtatgtatgt 186
              |||||||||||||||||||||||
Sbjct: 138493 tattcatatatatgtatgtatgt 138515



to top

>gb|AC153526.13| Mus musculus 10 BAC RP23-383C2 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 200117

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 168    catatatatgtatgtatgtgtg 189
              ||||||||||||||||||||||
Sbjct: 170990 catatatatgtatgtatgtgtg 171011



to top

>gb|DP000014.1| Callithrix jacchus target 1 genomic scaffold
          Length = 1952403

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 168    catatatatgtatgtatgtgtg 189
              ||||||||||||||||||||||
Sbjct: 182234 catatatatgtatgtatgtgtg 182255



to top

>gb|AC145272.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0002L02,
              complete sequence
          Length = 165685

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 168    catatatatgtatgtatgtgtg 189
              ||||||||||||||||||||||
Sbjct: 146182 catatatatgtatgtatgtgtg 146203



to top

>gb|AC158148.5| Mus musculus chromosome 1, clone RP24-353B6, complete sequence
          Length = 158895

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 168   catatatatgtatgtatgtgtg 189
             ||||||||||||||||||||||
Sbjct: 28104 catatatatgtatgtatgtgtg 28083



to top

>gb|AE014849.1| Plasmodium falciparum 3D7 chromosome 12, section 6 of 9 of the complete
             sequence
          Length = 250421

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 169   atatatatgtatgtatgtgtga 190
             ||||||||||||||||||||||
Sbjct: 76637 atatatatgtatgtatgtgtga 76616



to top

>gb|AY020626.1| Oryza sativa microsatellite MRG2951 containing (TA)X12, genomic
           sequence
          Length = 224

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 168 catatatatgtatgtatgtgtg 189
           ||||||||||||||||||||||
Sbjct: 71  catatatatgtatgtatgtgtg 92



to top

>gb|AC128597.3| Rattus norvegicus  BAC CH230-62C6 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 198520

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 168    catatatatgtatgtatgtgtg 189
              ||||||||||||||||||||||
Sbjct: 184703 catatatatgtatgtatgtgtg 184682



to top

>gb|AC115061.20| Mus musculus chromosome 1, clone RP24-399G3, complete sequence
          Length = 203058

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 168    catatatatgtatgtatgtgtg 189
              ||||||||||||||||||||||
Sbjct: 141363 catatatatgtatgtatgtgtg 141342



to top

>gb|AC137612.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
            OSJNBa0022B03, complete sequence
          Length = 151814

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 168  catatatatgtatgtatgtgtg 189
            ||||||||||||||||||||||
Sbjct: 9018 catatatatgtatgtatgtgtg 9039



to top

>gb|AC166816.2| Mus musculus chromosome 5, clone RP24-321O22, complete sequence
          Length = 156357

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 168   catatatatgtatgtatgtgtg 189
             ||||||||||||||||||||||
Sbjct: 33285 catatatatgtatgtatgtgtg 33264



to top

>gb|BT015295.1| Drosophila melanogaster GH02989 full insert cDNA
          Length = 4587

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 161  atttattcatatatatgtatgtatgt 186
            |||||| |||||||||||||||||||
Sbjct: 4454 atttatgcatatatatgtatgtatgt 4479



to top

>gb|AC130649.2| Drosophila melanogaster clone BACR06L03, complete sequence
          Length = 144234

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 161   atttattcatatatatgtatgtatgt 186
             |||||| |||||||||||||||||||
Sbjct: 45244 atttatgcatatatatgtatgtatgt 45219



to top

>gb|AC132440.3| Mus musculus BAC clone RP23-239I24 from chromosome 8, complete sequence
          Length = 183218

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 161   atttattcatatatatgtatgtatgt 186
             |||||||||||| |||||||||||||
Sbjct: 57251 atttattcatatgtatgtatgtatgt 57276



to top

>gb|AC142111.3| Mus musculus BAC clone RP24-63G9 from chromosome 9, complete sequence
          Length = 185361

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 165    attcatatatatgtatgtatgt 186
              ||||||||||||||||||||||
Sbjct: 114691 attcatatatatgtatgtatgt 114670



to top

>gb|AC158789.4| Mus musculus chromosome 5, clone RP23-192C21, complete sequence
          Length = 218871

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 168    catatatatgtatgtatgtgtg 189
              ||||||||||||||||||||||
Sbjct: 194564 catatatatgtatgtatgtgtg 194543



to top

>gb|AY519500.1| Gallus gallus CNR/Pcdh-alpha gene cluster, complete sequence
          Length = 187517

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 168    catatatatgtatgtatgtgtg 189
              ||||||||||||||||||||||
Sbjct: 151166 catatatatgtatgtatgtgtg 151187



to top

>gb|AY190953.1| Drosophila virilis clone DVIF01_19_E15 (D1419) genomic sequence
          Length = 43320

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 164  tattcatatatatgtatgtatgtgtg 189
            |||| |||||||||||||||||||||
Sbjct: 5312 tatttatatatatgtatgtatgtgtg 5337



to top

>gb|AC144808.2| Mus musculus BAC clone RP24-434O1 from chromosome 5, complete sequence
          Length = 152463

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 164    tattcatatatatgtatgtatgtgtg 189
              ||||||||||||||||| ||||||||
Sbjct: 100028 tattcatatatatgtatatatgtgtg 100003



to top

>gb|AC134434.4| Mus musculus BAC clone RP24-420E8 from chromosome 7, complete sequence
          Length = 214856

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 168    catatatatgtatgtatgtgtg 189
              ||||||||||||||||||||||
Sbjct: 127196 catatatatgtatgtatgtgtg 127175



to top

>gb|AC122386.3| Mus musculus BAC clone RP24-72H18 from chromosome 7, complete sequence
          Length = 161949

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 164   tattcatatatatgtatgtatgtgtg 189
             ||||||||| ||||||||||||||||
Sbjct: 71743 tattcatatgtatgtatgtatgtgtg 71768



to top

>gb|AC133210.3| Mus musculus chromosome UNK clone RP23-27L12, complete sequence
          Length = 210702

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 168    catatatatgtatgtatgtgtg 189
              ||||||||||||||||||||||
Sbjct: 182395 catatatatgtatgtatgtgtg 182374



to top

>gb|AC125234.4| Mus musculus BAC clone RP23-14K16 from 13, complete sequence
          Length = 209715

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 168   catatatatgtatgtatgtgtg 189
             ||||||||||||||||||||||
Sbjct: 35368 catatatatgtatgtatgtgtg 35347



to top

>gb|AC122187.3| Mus musculus BAC clone RP23-21P2 from 1, complete sequence
          Length = 252095

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 168   catatatatgtatgtatgtgtg 189
             ||||||||||||||||||||||
Sbjct: 35804 catatatatgtatgtatgtgtg 35783



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 170    tatatatgtatgtatgtgtg 189
              ||||||||||||||||||||
Sbjct: 233644 tatatatgtatgtatgtgtg 233663



to top

>gb|AC122037.2| Mus musculus BAC clone RP24-426D9 from 3, complete sequence
          Length = 185938

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 168   catatatatgtatgtatgtgtg 189
             ||||||||||||||||||||||
Sbjct: 34233 catatatatgtatgtatgtgtg 34212



to top

>gb|AC112261.4| Mus musculus BAC clone RP23-204O17 from 3, complete sequence
          Length = 186290

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 168    catatatatgtatgtatgtgtg 189
              ||||||||||||||||||||||
Sbjct: 164722 catatatatgtatgtatgtgtg 164701



to top

>emb|CR695648.1|CNS0FZPO Tetraodon nigroviridis full-length cDNA
          Length = 1323

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 168  catatatatgtatgtatgtgtg 189
            ||||||||||||||||||||||
Sbjct: 1134 catatatatgtatgtatgtgtg 1155



to top

>emb|CR692447.2|CNS0FX8R Tetraodon nigroviridis full-length cDNA
          Length = 1173

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 168  catatatatgtatgtatgtgtg 189
            ||||||||||||||||||||||
Sbjct: 1007 catatatatgtatgtatgtgtg 1028



to top

>emb|CR691712.2|CNS0FWOC Tetraodon nigroviridis full-length cDNA
          Length = 1335

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 168  catatatatgtatgtatgtgtg 189
            ||||||||||||||||||||||
Sbjct: 1146 catatatatgtatgtatgtgtg 1167



to top

>emb|CR683623.2|CNS0FQFN Tetraodon nigroviridis full-length cDNA
          Length = 1267

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 168  catatatatgtatgtatgtgtg 189
            ||||||||||||||||||||||
Sbjct: 1117 catatatatgtatgtatgtgtg 1138



to top

>gb|AC092108.4| Homo sapiens BAC clone RP11-1263I10 from 7, complete sequence
          Length = 26349

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 168  catatatatgtatgtatgtgtg 189
            ||||||||||||||||||||||
Sbjct: 5825 catatatatgtatgtatgtgtg 5804



to top

>emb|CR681376.2|CNS0FOP8 Tetraodon nigroviridis full-length cDNA
          Length = 581

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 168 catatatatgtatgtatgtgtg 189
           ||||||||||||||||||||||
Sbjct: 405 catatatatgtatgtatgtgtg 426



to top

>emb|CR678828.2|CNS0FMQG Tetraodon nigroviridis full-length cDNA
          Length = 1058

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 168 catatatatgtatgtatgtgtg 189
           ||||||||||||||||||||||
Sbjct: 883 catatatatgtatgtatgtgtg 904



to top

>emb|CR675215.2|CNS0FJYT Tetraodon nigroviridis full-length cDNA
          Length = 1244

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 168  catatatatgtatgtatgtgtg 189
            ||||||||||||||||||||||
Sbjct: 1091 catatatatgtatgtatgtgtg 1112



to top

>emb|CR675000.2|CNS0FJSU Tetraodon nigroviridis full-length cDNA
          Length = 1072

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 168 catatatatgtatgtatgtgtg 189
           ||||||||||||||||||||||
Sbjct: 896 catatatatgtatgtatgtgtg 917



to top

>emb|CR669102.2|CNS0FF90 Tetraodon nigroviridis full-length cDNA
          Length = 1070

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 168 catatatatgtatgtatgtgtg 189
           ||||||||||||||||||||||
Sbjct: 894 catatatatgtatgtatgtgtg 915



to top

>emb|CR662543.2|CNS0FA6T Tetraodon nigroviridis full-length cDNA
          Length = 1302

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 168  catatatatgtatgtatgtgtg 189
            ||||||||||||||||||||||
Sbjct: 1126 catatatatgtatgtatgtgtg 1147



to top

>emb|CR662776.2|CNS0FADA Tetraodon nigroviridis full-length cDNA
          Length = 1294

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 168  catatatatgtatgtatgtgtg 189
            ||||||||||||||||||||||
Sbjct: 1117 catatatatgtatgtatgtgtg 1138



to top

>emb|CR658057.2|CNS0F6Q7 Tetraodon nigroviridis full-length cDNA
          Length = 1072

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 168 catatatatgtatgtatgtgtg 189
           ||||||||||||||||||||||
Sbjct: 896 catatatatgtatgtatgtgtg 917



to top

>gb|AC107769.7| Mus musculus chromosome 16, clone RP23-130N20, complete sequence
          Length = 192682

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 168    catatatatgtatgtatgtgtg 189
              ||||||||||||||||||||||
Sbjct: 101087 catatatatgtatgtatgtgtg 101108



to top

>gb|AC119848.8| Mus musculus chromosome 7, clone RP23-73B20, complete sequence
          Length = 239297

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 168   catatatatgtatgtatgtgtg 189
             ||||||||||||||||||||||
Sbjct: 61265 catatatatgtatgtatgtgtg 61286



to top

>gb|AC165338.3| Mus musculus BAC clone RP24-456K15 from chromosome 10, complete
             sequence
          Length = 165515

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 168   catatatatgtatgtatgtgtg 189
             ||||||||||||||||||||||
Sbjct: 79851 catatatatgtatgtatgtgtg 79830



to top

>emb|AL390248.10| Human DNA sequence from clone RP11-492M23 on chromosome 10 Contains
            the gene for a novel protein and a ribosomal protein L21
            (RPL21)(L21) pseudogene, complete sequence
          Length = 125798

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 168  catatatatgtatgtatgtgtg 189
            ||||||||||||||||||||||
Sbjct: 9882 catatatatgtatgtatgtgtg 9903



to top

>emb|AL807736.6| Human DNA sequence from clone RP1-248F5 on chromosome X Contains the
             gene for PRO0659 protein (FLJ33130 FLJ35046 FLJ34279
             FLJ38843 DFKZp667C0711) and a CpG island, complete
             sequence
          Length = 84792

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 168   catatatatgtatgtatgtgtg 189
             ||||||||||||||||||||||
Sbjct: 74561 catatatatgtatgtatgtgtg 74582



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 168   catatatatgtatgtatgtgtg 189
             ||||||||||||||||||||||
Sbjct: 74523 catatatatgtatgtatgtgtg 74544



to top

>emb|AL592067.4| Human DNA sequence from clone RP11-361H7 on chromosome 13, complete
             sequence
          Length = 83141

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 168   catatatatgtatgtatgtgtg 189
             ||||||||||||||||||||||
Sbjct: 18628 catatatatgtatgtatgtgtg 18607



to top

>emb|AL450427.11| Human DNA sequence from clone RP11-372H19 on chromosome 6, complete
            sequence
          Length = 68843

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 168  catatatatgtatgtatgtgtg 189
            ||||||||||||||||||||||
Sbjct: 7770 catatatatgtatgtatgtgtg 7749



to top

>emb|AL513189.13| Human DNA sequence from clone RP11-339I11 on chromosome 1 Contains part
             of a novel gene, complete sequence
          Length = 59522

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 168   catatatatgtatgtatgtgtg 189
             ||||||||||||||||||||||
Sbjct: 12695 catatatatgtatgtatgtgtg 12674



to top

>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome
          Length = 4406967

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 536     catggcggccaccatggcgaccagca 561
               ||||||||||||||||||| ||||||
Sbjct: 1979245 catggcggccaccatggcgcccagca 1979270



to top

>emb|AL583830.7| Human DNA sequence from clone RP11-172L10 on chromosome 1 Contains the 5'
              end of a variant of the KCNK2 gene for potassium channel
              subfamily K member 2 and a translocase of inner
              mitochondrial membrane 17 homolog A (yeast) (TIMM17A)
              pseudogene, complete sequence
          Length = 151469

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 168    catatatatgtatgtatgtgtg 189
              ||||||||||||||||||||||
Sbjct: 120123 catatatatgtatgtatgtgtg 120102



to top

>emb|AL442636.3| Human DNA sequence from clone RP11-322F18 on chromosome 13 Contains a
             CpG island, complete sequence
          Length = 165618

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 165   attcatatatatgtatgtatgtgtga 190
             |||||||||||||||||||| |||||
Sbjct: 40008 attcatatatatgtatgtatttgtga 39983



to top

>emb|AL360015.25| Human DNA sequence from clone RP11-344F20 on chromosome 6 Contains a
            CGI-35 pseudogene, complete sequence
          Length = 153072

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  tattcatatatatgtatgtatgtgtg 189
            ||||||||||||||||| ||||||||
Sbjct: 7155 tattcatatatatgtatatatgtgtg 7130



to top

>emb|AL357129.11| Human DNA sequence from clone RP11-114A21 on chromosome Xq21.31-22.1,
              complete sequence
          Length = 145380

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 168    catatatatgtatgtatgtgtg 189
              ||||||||||||||||||||||
Sbjct: 140947 catatatatgtatgtatgtgtg 140968



to top

>gb|AC112406.5| Rattus norvegicus 11 BAC CH230-329D3 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 182245

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 168   catatatatgtatgtatgtgtg 189
             ||||||||||||||||||||||
Sbjct: 45065 catatatatgtatgtatgtgtg 45044



to top

>emb|AL161724.10| Human DNA sequence from clone RP11-114E4 on chromosome 9, complete
             sequence
          Length = 130767

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 160   catttattcatatatatgtatgtatgtgtg 189
             |||| |||||||||||||||||||| ||||
Sbjct: 45460 cattcattcatatatatgtatgtatatgtg 45489



to top

>gb|AC099563.3| Homo sapiens chromosome 1 clone RP11-323K10, complete sequence
          Length = 91282

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 168   catatatatgtatgtatgtgtg 189
             ||||||||||||||||||||||
Sbjct: 33182 catatatatgtatgtatgtgtg 33203



to top

>gb|AC163635.5| Mus musculus BAC clone RP23-183F13 from chromosome 17, complete
             sequence
          Length = 185844

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 168   catatatatgtatgtatgtgtg 189
             ||||||||||||||||||||||
Sbjct: 28060 catatatatgtatgtatgtgtg 28081



to top

>emb|CR382400.1| Plasmodium falciparum chromosome 6, complete sequence; segment 3/5
          Length = 348034

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 168    catatatatgtatgtatgtgtg 189
              ||||||||||||||||||||||
Sbjct: 200069 catatatatgtatgtatgtgtg 200090



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 169    atatatatgtatgtatgtgt 188
              ||||||||||||||||||||
Sbjct: 153551 atatatatgtatgtatgtgt 153532



to top

>emb|AL596096.7| Mouse DNA sequence from clone RP23-42P20 on chromosome 11 Contains the
             5' end of the Alox12e gene for epidermal arachidonate
             lipoxygenase, the gene for arachidonate 15-lipoxygenase, a
             novel pseudogene, two genes for novel proteins
             (4930563C04Rik, 1110030J09Rik), a Mitochondrial 28S
             ribosomal protein pseudogene, a NADH dehydrogenase
             (ubiquinone) 1 beta subcomplex 8 (Ndufb8) pseudogene, the
             gene for a novel protein similar to Beta-arrestin 2
             (Arrestin, beta 2) (LOC216869), the Cxcl16 gene for
             chemokine (C-X-C motif) ligand 16, the gene for a novel
             protein similar to human zinc finger MYND domain containg
             15 (ZMYND15), the 5' end of the gene for a novel protein
             (2010003F10Rik) and three CpG islands, complete sequence
          Length = 193277

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 165   attcatatatatgtatgtatgt 186
             ||||||||||||||||||||||
Sbjct: 72588 attcatatatatgtatgtatgt 72609



to top

>gb|AC163678.3| Mus musculus BAC clone RP24-104D14 from chromosome 10, complete
             sequence
          Length = 196603

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 168   catatatatgtatgtatgtgtg 189
             ||||||||||||||||||||||
Sbjct: 43198 catatatatgtatgtatgtgtg 43177



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 169    atatatatgtatgtatgtgtg 189
              |||||||||||||||||||||
Sbjct: 153891 atatatatgtatgtatgtgtg 153871



to top

>gb|AC182032.3| Spermophilus tridecemlineatus clone VMRC20-712F8, complete sequence
          Length = 172253

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 168  catatatatgtatgtatgtgtg 189
            ||||||||||||||||||||||
Sbjct: 1421 catatatatgtatgtatgtgtg 1442



to top

>gb|AC162392.9| Mus musculus 6 BAC RP23-197G11 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 195176

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 161    atttattcatatatatgtatgtatgtgtga 190
              |||||||||||||| | |||||||||||||
Sbjct: 114449 atttattcatatatgtatatgtatgtgtga 114478



to top

>emb|AL592080.26| Mouse DNA sequence from clone RP23-102H10 on chromosome 11 Contains a
              endothelial differentiation-related factor 1 (Edf1)
              pseudogene, the 3' end of the gene for a novel protein
              similar to human sperm antigen HCMOGT-1 (B230396K10Rik) and
              a CpG island, complete sequence
          Length = 216023

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 160    catttattcatatatatgtatgtatgtgtg 189
              ||||||| ||||||||||||||||| ||||
Sbjct: 176322 catttatgcatatatatgtatgtatatgtg 176293



to top

>emb|AL928625.5| Mouse DNA sequence from clone RP24-528P17 on chromosome 4, complete
              sequence
          Length = 170639

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 169    atatatatgtatgtatgtgtga 190
              ||||||||||||||||||||||
Sbjct: 104414 atatatatgtatgtatgtgtga 104435



to top

>emb|BX511201.3|RN177J12 Rattus norvegicus chromosome 1 BAC RP32-177J12, complete sequence
          Length = 138052

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 168   catatatatgtatgtatgtgtg 189
             ||||||||||||||||||||||
Sbjct: 30348 catatatatgtatgtatgtgtg 30327



to top

>gb|AC091973.4| Homo sapiens chromosome 5 clone RP11-51B6, complete sequence
          Length = 156257

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 164   tattcatatatatgtatgtatgtgtg 189
             ||||||||||||||||| ||||||||
Sbjct: 92027 tattcatatatatgtatatatgtgtg 92002



to top

>gb|AF461688.1| Drosophila virilis even-skipped 5' cis-regulatory region sequence
          Length = 13238

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 164  tattcatatatatgtatgtatgtgtg 189
            |||| |||||||||||||||||||||
Sbjct: 8307 tatttatatatatgtatgtatgtgtg 8332



to top

>gb|AC084768.4| Homo sapiens chromosome 8, clone RP11-281H11, complete sequence
          Length = 173677

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 168   catatatatgtatgtatgtgtg 189
             ||||||||||||||||||||||
Sbjct: 38634 catatatatgtatgtatgtgtg 38655



to top

>ref|NM_176778.1| Drosophila melanogaster lethal (1) G0196 CG14616-RD, transcript
            variant D (l(1)G0196), mRNA
          Length = 4724

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 161  atttattcatatatatgtatgtatgt 186
            |||||| |||||||||||||||||||
Sbjct: 4616 atttatgcatatatatgtatgtatgt 4641



to top

>gb|AC107022.4| Homo sapiens 3 BAC RP11-417H23 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 116557

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 168   catatatatgtatgtatgtgtg 189
             ||||||||||||||||||||||
Sbjct: 30378 catatatatgtatgtatgtgtg 30357



to top

>gb|AC100768.2| Homo sapiens chromosome 11, clone RP11-945A11, complete sequence
          Length = 190183

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 168    catatatatgtatgtatgtgtg 189
              ||||||||||||||||||||||
Sbjct: 114690 catatatatgtatgtatgtgtg 114711



to top

>gb|AF449447.1| Mus musculus C3H chromosome 3 hyplip1 region
          Length = 176641

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 168   catatatatgtatgtatgtgtg 189
             ||||||||||||||||||||||
Sbjct: 90088 catatatatgtatgtatgtgtg 90109



to top

>gb|AC063944.25| Homo sapiens 3 BAC RP11-446H18 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 180389

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 168   catatatatgtatgtatgtgtg 189
             ||||||||||||||||||||||
Sbjct: 30492 catatatatgtatgtatgtgtg 30471



to top

>gb|AC023886.7| Homo sapiens BAC clone RP11-402J6 from 4, complete sequence
          Length = 179697

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 168    catatatatgtatgtatgtgtg 189
              ||||||||||||||||||||||
Sbjct: 157923 catatatatgtatgtatgtgtg 157902



to top

>gb|AC007425.16| Homo sapiens 12q24.1-120.5-B PAC RPCI5-1048I22 (Roswell Park Cancer
              Institute Human PAC Library) complete sequence
          Length = 139971

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 168    catatatatgtatgtatgtgtg 189
              ||||||||||||||||||||||
Sbjct: 124555 catatatatgtatgtatgtgtg 124534



to top

>gb|AC092694.6| Homo sapiens 3q BAC RP11-172A10 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 151549

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 168    catatatatgtatgtatgtgtg 189
              ||||||||||||||||||||||
Sbjct: 132135 catatatatgtatgtatgtgtg 132156



to top

>gb|AC073878.7| Homo sapiens BAC clone RP11-744I24 from 7, complete sequence
          Length = 111375

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 168  catatatatgtatgtatgtgtg 189
            ||||||||||||||||||||||
Sbjct: 1306 catatatatgtatgtatgtgtg 1327



to top

>gb|AC097379.2| Homo sapiens BAC clone RP11-277G18 from 4, complete sequence
          Length = 96080

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 168   catatatatgtatgtatgtgtg 189
             ||||||||||||||||||||||
Sbjct: 36129 catatatatgtatgtatgtgtg 36150



to top

>gb|AC099542.2| Homo sapiens chromosome 3 clone RP11-520D19, complete sequence
          Length = 178351

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 168   catatatatgtatgtatgtgtg 189
             ||||||||||||||||||||||
Sbjct: 70304 catatatatgtatgtatgtgtg 70283



to top

>gb|AC109466.2| Homo sapiens chromosome 5 clone RP11-308N24, complete sequence
          Length = 153815

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 164    tattcatatatatgtatgtatgtgtg 189
              ||||||||||||||||| ||||||||
Sbjct: 130419 tattcatatatatgtatatatgtgtg 130444



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 169   atatatatgtatgtatgtgtg 189
             |||||||||||||||||||||
Sbjct: 40738 atatatatgtatgtatgtgtg 40718



to top

>dbj|AK141195.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:C230098G24 product:hypothetical
           protein, full insert sequence
          Length = 2397

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 168 catatatatgtatgtatgtgtg 189
           ||||||||||||||||||||||
Sbjct: 127 catatatatgtatgtatgtgtg 148



to top

>gb|AC104515.1| Drosophila melanogaster, chromosome X, region 20B-20C, BAC clone
              BACR27K09, complete sequence
          Length = 179386

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 161    atttattcatatatatgtatgtatgt 186
              |||||| |||||||||||||||||||
Sbjct: 109854 atttatgcatatatatgtatgtatgt 109829



to top

>gb|AC010471.4| Homo sapiens chromosome 5 clone CTD-2300P22, complete sequence
          Length = 112587

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 160   catttattcatatatatgtatgtatgtgtg 189
             |||| |||||||||||||||||||| ||||
Sbjct: 81088 cattcattcatatatatgtatgtatatgtg 81059



to top

>gb|AC022313.5| Homo sapiens BAC clone RP11-437G1 from 4, complete sequence
          Length = 183516

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 168    catatatatgtatgtatgtgtg 189
              ||||||||||||||||||||||
Sbjct: 114741 catatatatgtatgtatgtgtg 114762



to top

>gb|AC153134.5| Mus musculus BAC clone RP24-202N2 from chromosome 13, complete sequence
          Length = 177669

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 168    catatatatgtatgtatgtgtg 189
              ||||||||||||||||||||||
Sbjct: 172678 catatatatgtatgtatgtgtg 172657



to top

>gb|AC162182.2| Mus musculus BAC clone RP23-73B23 from chromosome 17, complete sequence
          Length = 205221

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 168    catatatatgtatgtatgtgtg 189
              ||||||||||||||||||||||
Sbjct: 112268 catatatatgtatgtatgtgtg 112247



to top

>gb|AC146740.3| Callithrix jacchus clone CH259-204H2, complete sequence
          Length = 224361

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 168    catatatatgtatgtatgtgtg 189
              ||||||||||||||||||||||
Sbjct: 182234 catatatatgtatgtatgtgtg 182255



to top

>gb|AC007145.10| Drosophila melanogaster, chromosome 2L, region 37D, BAC clone
            BACR10I09, complete sequence
          Length = 169289

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 164  tattcatatatatgtatgtatgtgtg 189
            ||||||||||||||||||||| ||||
Sbjct: 5892 tattcatatatatgtatgtatatgtg 5867



to top

>gb|AC020937.6| Homo sapiens chromosome 5 clone CTD-2299I21, complete sequence
          Length = 94161

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 165   attcatatatatgtatgtatgt 186
             ||||||||||||||||||||||
Sbjct: 91309 attcatatatatgtatgtatgt 91288



to top

>emb|CR405841.1| Gallus gallus finished cDNA, clone ChEST885e19
          Length = 1184

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 168 catatatatgtatgtatgtgtg 189
           ||||||||||||||||||||||
Sbjct: 740 catatatatgtatgtatgtgtg 761



to top

>dbj|AK032932.1| Mus musculus 12 days embryo male wolffian duct includes surrounding
            region cDNA, RIKEN full-length enriched library,
            clone:6720474J12 product:unclassifiable, full insert
            sequence
          Length = 2814

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 165  attcatatatatgtatgtatgt 186
            ||||||||||||||||||||||
Sbjct: 2630 attcatatatatgtatgtatgt 2609



to top

>gb|AC159809.2| Mus musculus BAC clone RP24-216P6 from chromosome 9, complete sequence
          Length = 160712

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 168   catatatatgtatgtatgtgtg 189
             ||||||||||||||||||||||
Sbjct: 83021 catatatatgtatgtatgtgtg 83042



to top

>gb|AC008502.8| Homo sapiens chromosome 5 clone CTC-442G11, complete sequence
          Length = 123495

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 165   attcatatatatgtatgtatgt 186
             ||||||||||||||||||||||
Sbjct: 21611 attcatatatatgtatgtatgt 21590



to top

>gb|AC008680.5|AC008680 Homo sapiens chromosome 5 clone CTB-53I9, complete sequence
          Length = 229045

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 168   catatatatgtatgtatgtgtg 189
             ||||||||||||||||||||||
Sbjct: 63056 catatatatgtatgtatgtgtg 63035



to top

>dbj|AK048247.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched
           library, clone:C130043D08 product:unclassifiable, full
           insert sequence
          Length = 2077

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 169 atatatatgtatgtatgtgtga 190
           ||||||||||||||||||||||
Sbjct: 491 atatatatgtatgtatgtgtga 470



to top

>ref|NG_004818.1| Gallus gallus cadherin-related neuronal receptor 10 pseudogene (CNRV10)
          Length = 98944

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 168   catatatatgtatgtatgtgtg 189
             ||||||||||||||||||||||
Sbjct: 72707 catatatatgtatgtatgtgtg 72728



to top

>dbj|AK085615.1| Mus musculus 0 day neonate kidney cDNA, RIKEN full-length enriched
           library, clone:D630047J16 product:unclassifiable, full
           insert sequence
          Length = 2297

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 168 catatatatgtatgtatgtgtg 189
           ||||||||||||||||||||||
Sbjct: 683 catatatatgtatgtatgtgtg 662



to top

>gb|AC018694.4|AC018694 Homo sapiens BAC clone RP11-563P16 from 11, complete sequence
          Length = 196832

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 168   catatatatgtatgtatgtgtg 189
             ||||||||||||||||||||||
Sbjct: 16979 catatatatgtatgtatgtgtg 17000



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 165      attcatatatatgtatgtatgt 186
                ||||||||||||||||||||||
Sbjct: 11599914 attcatatatatgtatgtatgt 11599893



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 169      atatatatgtatgtatgtgt 188
                ||||||||||||||||||||
Sbjct: 17161797 atatatatgtatgtatgtgt 17161816



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 161      atttattcatatatatgtat 180
                ||||||||||||||||||||
Sbjct: 11135084 atttattcatatatatgtat 11135103



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 169     atatatatgtatgtatgtgt 188
               ||||||||||||||||||||
Sbjct: 9547342 atatatatgtatgtatgtgt 9547361



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 168      catatatatgtatgtatgtgtg 189
                ||||||||||||||||||||||
Sbjct: 10023416 catatatatgtatgtatgtgtg 10023437



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 169      atatatatgtatgtatgtgt 188
                ||||||||||||||||||||
Sbjct: 15014823 atatatatgtatgtatgtgt 15014842



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 169      atatatatgtatgtatgtgt 188
                ||||||||||||||||||||
Sbjct: 11795059 atatatatgtatgtatgtgt 11795040



to top

>gb|AC106895.5| Homo sapiens BAC clone RP11-161D15 from 4, complete sequence
          Length = 135450

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 168   catatatatgtatgtatgtgtg 189
             ||||||||||||||||||||||
Sbjct: 29358 catatatatgtatgtatgtgtg 29379



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 169   atatatatgtatgtatgtgtg 189
             |||||||||||||||||||||
Sbjct: 75932 atatatatgtatgtatgtgtg 75912



to top

>gb|AC007709.4|AC007709 Drosophila melanogaster, chromosome 3R, region 86E-86E, BAC clone
             BACR13P08, complete sequence
          Length = 169707

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 168   catatatatgtatgtatgtgtg 189
             ||||||||||||||||||||||
Sbjct: 90871 catatatatgtatgtatgtgtg 90850



to top

>gb|AC010744.7| Homo sapiens BAC clone RP11-548D17 from 2, complete sequence
          Length = 186687

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 168   catatatatgtatgtatgtgtg 189
             ||||||||||||||||||||||
Sbjct: 85893 catatatatgtatgtatgtgtg 85872



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 169    atatatatgtatgtatgtgtg 189
              |||||||||||||||||||||
Sbjct: 134261 atatatatgtatgtatgtgtg 134281


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,200,807
Number of Sequences: 3902068
Number of extensions: 5200807
Number of successful extensions: 257990
Number of sequences better than 10.0: 1987
Number of HSP's better than 10.0 without gapping: 2004
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 242542
Number of HSP's gapped (non-prelim): 15191
length of query: 607
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 584
effective length of database: 17,143,297,704
effective search space: 10011685859136
effective search space used: 10011685859136
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top