ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal0a01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X63052.1|HVCP29 Hordeum vulgare gene for CP29 precursor for ... 829 0.0
2dbj|AK104824.1| Oryza sativa (japonica cultivar-group) cDNA clon... 442 e-121
3dbj|AK098872.1| Oryza sativa (japonica cultivar-group) cDNA clon... 442 e-121
4dbj|AK061295.1| Oryza sativa (japonica cultivar-group) cDNA clon... 442 e-121
5gb|AY105650.1| Zea mays PCO135935 mRNA sequence 377 e-101
6gb|U23188.1|ZMU23188 Zea mays chlorophyll a/b-binding apoprotein... 369 6e-99
7gb|U23189.1|ZMU23189 Zea mays chlorophyll a/b-binding apoprotein... 339 5e-90
8gb|AC135460.3| Oryza sativa (japonica cultivar-group) chromosome... 337 2e-89
9dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 337 2e-89
10gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 337 2e-89
11dbj|D85512.1| Oryza sativa (japonica cultivar-group) CP26 mRNA, ... 274 3e-70
12gb|AY855171.1| Eleusine coracana subsp. coracana clone 1 light h... 216 5e-53
13gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II ch... 123 6e-25
14dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 121 2e-24
15dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic D... 121 2e-24
16dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic D... 121 2e-24
17dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 2e-24
18dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 2e-24
19dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 2e-24
20dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 2e-24
21dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 2e-24
22gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene... 119 9e-24
23gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genom... 117 4e-23
24gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 117 4e-23
25dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 117 4e-23
26dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 4e-23
27dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 4e-23
28dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRN... 117 4e-23
29ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predic... 115 1e-22
30dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 115 1e-22
31dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic D... 115 1e-22
32dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 1e-22
33dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 1e-22
34emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chloro... 115 1e-22
35dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRN... 113 6e-22
36ref|XM_478729.1| Oryza sativa (japonica cultivar-group), mRNA 111 2e-21
37ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group... 111 2e-21
38ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group... 111 2e-21
39ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group... 111 2e-21
40ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group... 111 2e-21
41ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group... 111 2e-21
42ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group... 111 2e-21
43ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group... 111 2e-21
44emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chloro... 111 2e-21
45dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 111 2e-21
46dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic D... 111 2e-21
47dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clon... 111 2e-21
48dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clon... 111 2e-21
49dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clon... 111 2e-21
50dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clon... 111 2e-21
51dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clon... 111 2e-21
52dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clon... 111 2e-21
53dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clon... 111 2e-21
54dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clon... 111 2e-21
55dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clon... 111 2e-21
56gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding prot... 111 2e-21
57gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds 107 4e-20
58gb|AY112240.1| Zea mays CL187_6 mRNA sequence 107 4e-20
59ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predic... 103 6e-19
60gb|AY100470.1| Oryza sativa (indica cultivar-group) putative sol... 103 6e-19
61dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue... 103 6e-19
62dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic D... 103 6e-19
63emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b bin... 103 6e-19
64emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chl... 103 6e-19
65dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clon... 103 6e-19
66dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clon... 103 6e-19
67dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clon... 103 6e-19
68dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clon... 103 6e-19
69dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 103 6e-19
70dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clon... 103 6e-19
71gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting ... 101 2e-18
72gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting ... 101 2e-18
73gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvestin... 101 2e-18
74dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvest... 101 2e-18
75dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvest... 101 2e-18
76dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clon... 100 9e-18
77emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting... 96 1e-16
78gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b ... 96 1e-16
79ref|NM_117102.3| Arabidopsis thaliana LHCB5 (LIGHT HARVESTING CO... 94 5e-16
80gb|AF104631.3| Chlamydomonas reinhardtii light harvesting comple... 94 5e-16
81gb|AF339718.1| Arabidopsis thaliana putative chlorophyll a/b-bin... 94 5e-16
82gb|AF326900.1| Arabidopsis thaliana putative chlorophyll a/b-bin... 94 5e-16
83gb|AY070466.1| Arabidopsis thaliana AT4g10340/F24G24_140 mRNA, c... 94 5e-16
84gb|AF424597.1|AF424597 Arabidopsis thaliana AT4g10340/F24G24_140... 94 5e-16
85gb|AY054126.1| Arabidopsis thaliana AT4g10340/F24G24_140 mRNA, c... 94 5e-16
86gb|AF380631.1|AF380631 Arabidopsis thaliana AT4g10340/F24G24_140... 94 5e-16
87emb|BX829238.1|CNS0A4DW Arabidopsis thaliana Full-length cDNA Co... 94 5e-16
88emb|BX826540.1|CNS0A4GD Arabidopsis thaliana Full-length cDNA Co... 94 5e-16
89emb|BX826592.1|CNS0A355 Arabidopsis thaliana Full-length cDNA Co... 94 5e-16
90gb|AF330793.1|AF330793 Chlamydomonas reinhardtii light-harvestin... 94 5e-16
91gb|AF134129.1| Arabidopsis thaliana Lhcb5 protein (Lhcb5) mRNA, ... 94 5e-16
92dbj|AB051209.1| Chlamydomonas reinhardtii mRNA for light-harvest... 94 5e-16
93dbj|AB051205.1| Chlamydomonas reinhardtii gene for light-harvest... 94 5e-16
94gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting comple... 92 2e-15
95emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding... 92 2e-15
96gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding prot... 92 2e-15
97dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvest... 92 2e-15
98gb|AF495473.1| Chlamydomonas reinhardtii major light-harvesting ... 90 8e-15
99dbj|AB051206.1| Chlamydomonas reinhardtii gene for light-harvest... 90 8e-15
100dbj|AB050007.2| Chlamydomonas reinhardtii lhcb5 mRNA for CP26, c... 88 3e-14
101emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlo... 88 3e-14
102gb|AY087939.1| Arabidopsis thaliana clone 39765 mRNA, complete s... 86 1e-13
103dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light... 84 5e-13
104emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chloro... 84 5e-13
105gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast c... 84 5e-13
106gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chl... 82 2e-12
107gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b... 80 8e-12
108gb|AY617092.1| Pinus monophylla chloroplast light harvesting chl... 80 8e-12
109gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvestin... 80 8e-12
110gb|AY646197.1| Chlorella pyrenoidosa chloroplast light-harvestin... 78 3e-11
111gb|AF495472.1| Chlamydomonas reinhardtii major light-harvesting ... 78 3e-11
112gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding p... 78 3e-11
113gb|M24072.1|CRECABA C.reinhardtii encoding chlorophyll a/b-bindi... 78 3e-11
114emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chl... 76 1e-10
115emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll... 76 1e-10
116gb|DQ018376.1| Pinus krempfii chloroplast putative light harvest... 76 1e-10
117gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlor... 76 1e-10
118gb|AY617093.1| Pinus remota chloroplast light harvesting chlorop... 76 1e-10
119gb|AY617084.1| Pinus contorta chloroplast light harvesting chlor... 76 1e-10
120gb|AY617083.1| Pinus radiata chloroplast light harvesting chloro... 76 1e-10
121gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlo... 76 1e-10
122gb|AY617081.1| Pinus echinata chloroplast light harvesting chlor... 76 1e-10
123emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b bind... 76 1e-10
124gb|AY109324.1| Zea mays CL187_1 mRNA sequence 76 1e-10
125gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chl... 76 1e-10
126gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protei... 76 1e-10
127emb|X61915.1|PTCABP P.thunbergii cab gene 74 5e-10
128gb|M37489.1|PINCABII2 Pinus sylvestris chlorophyll a/b-binding p... 74 5e-10
129gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-bindi... 74 5e-10
130gb|AF139465.2|AF139465 Vigna radiata LHCII type III chlorophyll ... 74 5e-10
131emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putativ... 74 5e-10
132gb|AY786530.1| Haematococcus pluvialis chloroplast major light-h... 72 2e-09
133gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlor... 72 2e-09
134emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b bindi... 72 2e-09
135gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b bin... 72 2e-09
136gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding p... 72 2e-09
137gb|U51634.1|PPU51634 Pinus palustris type 2 light-harvesting chl... 70 8e-09
138emb|AL161517.2|ATCHRIV29 Arabidopsis thaliana DNA chromosome 4, ... 68 3e-08
139emb|AL049488.1|ATF24G24 Arabidopsis thaliana DNA chromosome 4, B... 68 3e-08
140emb|AJ843976.1| Plantago major partial mRNA for light harvesting... 68 3e-08
141gb|DQ018375.1| Pinus gerardiana chloroplast putative light harve... 68 3e-08
142gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlor... 68 3e-08
143gb|AY617091.1| Pinus strobus chloroplast light harvesting chloro... 68 3e-08
144gb|AY617090.1| Pinus monticola chloroplast light harvesting chlo... 68 3e-08
145gb|AY617089.1| Pinus lambertiana chloroplast light harvesting ch... 68 3e-08
146gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chl... 68 3e-08
147gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlor... 68 3e-08
148gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (L... 68 3e-08
149emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chl... 68 3e-08
150emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-h... 68 3e-08
151emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chloro... 68 3e-08
152emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putat... 68 3e-08
153gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein... 68 3e-08
154dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-b... 68 3e-08
155emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab bindin... 66 1e-07
156gb|AY267624.1| Bigelowiella natans chlorophyll a/b-binding prote... 66 1e-07
157gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting ... 66 1e-07
158emb|X13407.1|PTCAB Pinus thunbergii cab mRNA for light-harvestin... 66 1e-07
159emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein 66 1e-07
160emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for lig... 66 1e-07
161emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for ligh... 66 1e-07
162gb|AY554168.1| Nicotiana tabacum chloroplast chlorophyll a-b bin... 66 1e-07
163emb|X95727.1|BJMCAB1GE B.juncea mRNA for chlorophyll a/b-binding... 64 5e-07
164emb|X06602.1|EGLHCPAB Euglena gracilis mRNA for light harvesting... 64 5e-07
165gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein g... 64 5e-07
166emb|X61361.1|EGLHCAB E.gracilis gene for light harvesting chloro... 62 2e-06
167gb|AF398746.1|AF398746 Carlquistia muirii ASCAB9 (ASCAB9) gene, ... 62 2e-06
168gb|AF398740.1|AF398740 Wilkesia gymnoxiphium ASCAB9-B (ASCAB9-B)... 62 2e-06
169emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB p... 62 2e-06
170gb|L29644.1|EGRLHCPII Euglena gracilis chlorophyll a/b binding p... 62 2e-06
171gb|AY617096.1| Picea sitchensis chloroplast light harvesting chl... 60 7e-06
172gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chl... 60 7e-06
173dbj|AP006706.1| Lotus japonicus genomic DNA, chromosome 3, clone... 60 7e-06
174gb|M60049.1|DUNCAB D.tertiolecta 28.5-kDa LHCII apoprotein mRNA,... 60 7e-06
175gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding... 58 3e-05
176emb|AJ538464.1|NTA538464 Nicotiana tabacum cDNA-AFLP-fragment BC... 58 3e-05
177dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene... 58 3e-05
178emb|AJ234428.1|HVU234428 Hordeum vulgare partial mRNA; clone cMW... 58 3e-05
179emb|Z16408.1|PSLHCB51 P.sylvestris Lhcb5*1 mRNA encoding Lhcb5 p... 58 3e-05
180emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding pr... 58 3e-05
181gb|AY104614.1| Zea mays PCO084486 mRNA sequence 58 3e-05
182gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab... 58 3e-05
183dbj|AB122118.1| Chlamydomonas reinhardtii LhcI-5 gene for light-... 56 1e-04
184emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll... 56 1e-04
185gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-... 56 1e-04
186gb|AY267623.1| Bigelowiella natans chlorophyll a/b-binding prote... 54 5e-04
187gb|AF398747.1|AF398747 Anisocarpus scabridus ASCAB9 (ASCAB9) gen... 54 5e-04
188gb|AF398745.1|AF398745 Osmadenia tenella ASCAB9 (ASCAB9) gene, e... 54 5e-04
189gb|AF398744.1|AF398744 Madia nutans ASCAB9 (ASCAB9) gene, exons ... 54 5e-04
190gb|AF398743.1|AF398743 Deinandra lobbii ASCAB9 (ASCAB9) gene, ex... 54 5e-04
191gb|AF398741.1|AF398741 Wilkesia gymnoxiphium ASCAB9-C (ASCAB9-C)... 54 5e-04
192gb|AF398739.1|AF398739 Dubautia scabra ASCAB9-C (ASCAB9-C) gene,... 54 5e-04
193gb|AF398738.1|AF398738 Dubautia plantaginea ASCAB9-B (ASCAB9-B) ... 54 5e-04
194gb|AF398737.1|AF398737 Dubautia laxa ASCAB9-C (ASCAB9-C) gene, e... 54 5e-04
195gb|AF398736.1|AF398736 Dubautia latifolia ASCAB9-C (ASCAB9-C) ge... 54 5e-04
196gb|AF398735.1|AF398735 Dubautia laevigata ASCAB9-B (ASCAB9-B) ge... 54 5e-04
197gb|AF398734.1|AF398734 Argyroxiphium sandwicense ASCAB9-C (ASCAB... 54 5e-04
198gb|AF398733.1|AF398733 Argyroxiphium sandwicense ASCAB9-B (ASCAB... 54 5e-04
199gb|AF398732.1|AF398732 Argyroxiphium caliginis ASCAB9-B (ASCAB9-... 54 5e-04
200gb|AF398731.1|AF398731 Wilkesia gymnoxiphium ASCAB9-A (ASCAB9-A)... 54 5e-04
201gb|AF398730.1|AF398730 Dubautia sherffiana ASCAB9-A (ASCAB9-A) g... 54 5e-04
202gb|AF398729.1|AF398729 Dubautia raillardioides ASCAB9-A (ASCAB9-... 54 5e-04
203gb|AF398728.1|AF398728 Dubautia plantaginea ASCAB9-A (ASCAB9-A) ... 54 5e-04
204gb|AF398726.1|AF398726 Dubautia latifolia ASCAB9-A (ASCAB9-A) ge... 54 5e-04
205gb|AF398725.1|AF398725 Dubautia laevigata ASCAB9-A (ASCAB9-A) ge... 54 5e-04
206gb|AF398723.1|AF398723 Argyroxiphium caliginis ASCAB9-A (ASCAB9-... 54 5e-04
207gb|AF268321.1|AF268321 Chlorarachnion CCMP621 light-harvesting c... 54 5e-04
208gb|AF268320.1|AF268320 Chlorarachnion CCMP621 light-harvesting c... 54 5e-04
209gb|AF268319.1|AF268319 Chlorarachnion CCMP621 light-harvesting c... 54 5e-04
210emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll ... 54 5e-04
211gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll... 54 5e-04
212ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll bindin... 52 0.002
213ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2... 52 0.002
214ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2... 52 0.002
215ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll bindin... 52 0.002
216ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) ... 52 0.002
217gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 52 0.002
218gb|AY142513.1| Arabidopsis thaliana putative photosystem II type... 52 0.002
219gb|AY045806.1| Arabidopsis thaliana putative photosystem II type... 52 0.002
220gb|AF339687.1| Arabidopsis thaliana putative photosystem II type... 52 0.002
221gb|AF326864.1| Arabidopsis thaliana putative photosystem II type... 52 0.002
222gb|AY120776.1| Arabidopsis thaliana putative photosystem II type... 52 0.002
223gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 ma... 52 0.002
224gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 ma... 52 0.002
225gb|AY081587.1| Arabidopsis thaliana photosystem II type I chloro... 52 0.002
226gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 52 0.002
227gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 52 0.002
228gb|AY065125.1| Arabidopsis thaliana photosystem II type I chloro... 52 0.002
229gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 ... 52 0.002
230gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 ... 52 0.002
231gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 ... 52 0.002
232gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 52 0.002
233gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 ... 52 0.002
234gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430... 52 0.002
235emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Co... 52 0.002
236emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Co... 52 0.002
237emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Co... 52 0.002
238emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Co... 52 0.002
239emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Co... 52 0.002
240emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Co... 52 0.002
241gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete s... 52 0.002
242gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/... 52 0.002
243emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II ... 52 0.002
244emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II c... 52 0.002
245gb|BT002103.1| Arabidopsis thaliana putative photosystem II type... 52 0.002
246gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosyste... 52 0.002
247ref|NM_126537.2| Arabidopsis thaliana LHCB2.2; chlorophyll bindi... 50 0.007
248ref|NM_001036246.1| Arabidopsis thaliana ATP binding / kinase/ p... 50 0.007
249gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 50 0.007
250gb|DQ226725.1| Boechera divaricarpa isolate SLW-A-F06 mRNA sequence 50 0.007
251gb|BT014450.1| Lycopersicon esculentum clone 133776F, mRNA sequence 50 0.007
252emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding ... 50 0.007
253gb|AF517869.1| Griffithsia japonica isolate Gj446 light-harvest ... 50 0.007
254gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein... 50 0.007
255gb|AY093372.1| Arabidopsis thaliana putative chlorophyll a/b bin... 50 0.007
256gb|AC007211.6| Arabidopsis thaliana chromosome 2 BAC F1O13 genom... 50 0.007
257gb|AY066036.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, com... 50 0.007
258gb|AY062563.1| Arabidopsis thaliana putative chlorophyll a/b bin... 50 0.007
259gb|AY054218.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, com... 50 0.007
260gb|AF398727.1|AF398727 Dubautia laxa ASCAB9-A (ASCAB9-A) gene, e... 50 0.007
261gb|AF398724.1|AF398724 Argyroxiphium sandwicense ASCAB9-A (ASCAB... 50 0.007
262emb|BX819347.1|CNS0A9RX Arabidopsis thaliana Full-length cDNA Co... 50 0.007
263emb|BX819270.1|CNS0A9RF Arabidopsis thaliana Full-length cDNA Co... 50 0.007
264emb|BX820206.1|CNS0A9D7 Arabidopsis thaliana Full-length cDNA Co... 50 0.007
265emb|BX820202.1|CNS0A9FS Arabidopsis thaliana Full-length cDNA Co... 50 0.007
266emb|BX819668.1|CNS0A9CZ Arabidopsis thaliana Full-length cDNA Co... 50 0.007
267emb|BX819509.1|CNS0A82Q Arabidopsis thaliana Full-length cDNA Co... 50 0.007
268dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chloro... 50 0.007
269gb|AF134123.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.2) mRNA... 50 0.007
270gb|AF134122.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.1) mRNA... 50 0.007
271emb|X61287.1|LECAB9 L.esculentum Cab9 gene for type I (26 kD) CP... 50 0.007
272emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding pr... 50 0.007
273emb|X17697.1|MDCHBP Apple light-harvesting chlorophyll a/b bindi... 50 0.007
274emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-bi... 50 0.007
275emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b... 50 0.007
276emb|X52743.1|NTCAB21 Tabacco Cab21 mRNA for major chlorophyll a/... 50 0.007
277emb|X16535.1|GMCAB4 G.max DNA for Cab4 50 0.007
278gb|K00975.1|PETCAB10 Petunia major chlorophyll a/b binding prote... 50 0.007
279gb|K00973.1|PETCAB3 Petunia major chlorophyll a/b binding protei... 50 0.007
280gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-... 50 0.007
281gb|M21396.1|SOYCBPA Soybean light-harvesting chlorophyll a/b-bin... 50 0.007
282dbj|D14002.1|LAUCAB Lettuce mRNA for light-harvesting chlorophyl... 50 0.007
283dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for ... 50 0.007
284ref|NM_124807.2| Arabidopsis thaliana LHCB3 (LIGHT-HARVESTING CH... 48 0.028
285ref|NM_124808.3| Arabidopsis thaliana ATM2 (ARABIDOPSIS THALIANA... 48 0.028
286ref|XM_473418.1| Oryza sativa (japonica cultivar-group), predic... 48 0.028
287gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence 48 0.028
288gb|DQ185425.1| Rosa roxburghii clone C40 defense-related mRNA, p... 48 0.028
289emb|X61610.1|BNLHCB3C B.napus gene for LHCII Type III chlorophyl... 48 0.028
290gb|AF104633.2| Chlamydomonas reinhardtii light harvesting comple... 48 0.028
291emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4,... 48 0.028
292gb|AF361858.1| Arabidopsis thaliana AT5g54270/MDK4_9 mRNA, compl... 48 0.028
293gb|AY057735.1| Arabidopsis thaliana AT5g54270/MDK4_9 mRNA, compl... 48 0.028
294gb|S68728.1| LHC Ib-21=light-harvesting complex I [Hordeum vulga... 48 0.028
295gb|AF372917.1|AF372917 Arabidopsis thaliana AT5g54270/MDK4_9 mRN... 48 0.028
296dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.028
297emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Co... 48 0.028
298emb|BX830083.1|CNS0A1XR Arabidopsis thaliana Full-length cDNA Co... 48 0.028
299emb|BX831260.1|CNS09ZEV Arabidopsis thaliana Full-length cDNA Co... 48 0.028
300emb|BX831139.1|CNS09ZGL Arabidopsis thaliana Full-length cDNA Co... 48 0.028
301gb|AF110786.1|AF110786 Volvox carteri f. nagariensis clone G18 l... 48 0.028
302gb|AF195794.1|AF195794 Chlamydomonas reinhardtii chlorophyll A-B... 48 0.028
303gb|AF134126.1| Arabidopsis thaliana chromosome V Lhcb3 protein (... 48 0.028
304dbj|AP004756.2| Oryza sativa (japonica cultivar-group) genomic D... 48 0.028
305emb|X61609.1|BNLHCB3B B.napus gene for LHC II Type III chlorophy... 48 0.028
306dbj|AB122119.1| Chlamydomonas reinhardtii LhcI-6 gene for light-... 48 0.028
307dbj|AB122114.1| Chlamydomonas reinhardtii LhcI-1 gene for light-... 48 0.028
308dbj|AB010695.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 48 0.028
309emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding p... 48 0.028
310emb|X65119.1|CRCABI1MR C.reinhardtii cabI-1 mRNA for light harve... 48 0.028
311dbj|AK109771.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.028
312gb|AF218305.1|AF218305 Hordeum vulgare chlorophyll a/b binding p... 48 0.028
313dbj|AK066997.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.028
314gb|AF143691.1|AF143691 Arabidopsis thaliana type III chlorophyll... 48 0.028
315gb|K00976.1|PETCAB102 Petunia major chlorophyll a/b binding prot... 48 0.028
316gb|K00974.1|PETCAB4 Petunia major chlorophyll a/b binding protei... 48 0.028
317dbj|AP008949.1| Lotus japonicus genomic DNA, chromosome 2, clone... 48 0.028
318gb|M34396.1|PMJCABF3 Polystichum munitum chlorophyll a/b-binding... 48 0.028
319gb|M23531.1|DUNCBP D.salina major chlorophyll binding protein mR... 48 0.028
320gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence 46 0.11
321gb|AF517872.1| Griffithsia japonica isolate Gj241 light-harvest ... 46 0.11
322gb|U21113.1|STU21113 Solanum tuberosum chlorophyll a/b binding p... 46 0.11
323gb|M30618.1|TOMCBPD2 Tomato chlorophyll a/b-binding protein Cab-... 46 0.11
324gb|M14443.1|TOMCBPA Tomato chlorophyll a/b-binding protein gene ... 46 0.11
325dbj|AU066541.1| Chlamydomonas sp. HS-5 mRNA for hypothetical pro... 46 0.11
326gb|U03392.1|EGU03392 Euglena gracilis var. bacillaris PSII chlor... 46 0.11
327ref|XM_550136.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.44
328ref|XM_507384.1| PREDICTED Oryza sativa (japonica cultivar-group... 44 0.44
329ref|XM_507383.1| PREDICTED Oryza sativa (japonica cultivar-group... 44 0.44
330ref|XM_507382.1| PREDICTED Oryza sativa (japonica cultivar-group... 44 0.44
331ref|XM_478841.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.44
332ref|XM_507381.1| PREDICTED Oryza sativa (japonica cultivar-group... 44 0.44
333ref|XM_507380.1| PREDICTED Oryza sativa (japonica cultivar-group... 44 0.44
334ref|XM_507379.1| PREDICTED Oryza sativa (japonica cultivar-group... 44 0.44
335ref|XM_506426.2| PREDICTED Oryza sativa (japonica cultivar-group... 44 0.44
336gb|AY954738.1| Ostreococcus tauri chloroplast chlorophyll a/b-bi... 44 0.44
337gb|DQ124219.1| Fagus sylvatica putative chlorophyll a/b-binding ... 44 0.44
338emb|AJ639921.1| Uncultured bacterium partial pks4 gene for polyk... 44 0.44
339gb|AF398742.1|AF398742 Centromadia pungens ASCAB9 (ASCAB9) gene,... 44 0.44
340dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.44
341dbj|AP002872.2| Oryza sativa (japonica cultivar-group) genomic D... 44 0.44
342dbj|AP003804.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.44
343dbj|AP003511.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.44
344dbj|AP002540.2| Oryza sativa (japonica cultivar-group) genomic D... 44 0.44
345dbj|AB122116.1| Chlamydomonas reinhardtii LhcI-3 gene for light-... 44 0.44
346dbj|AK121921.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.44
347dbj|AK119176.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.44
348emb|X84308.1|HVLHCA2 H.vulgare mRNA for photosysteme I antenna p... 44 0.44
349dbj|AK106463.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.44
350dbj|AK104651.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.44
351dbj|AK104608.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.44
352dbj|AK104283.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.44
353dbj|AK104177.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.44
354dbj|AK104127.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.44
355dbj|AK104016.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.44
356dbj|AK103966.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.44
357dbj|AK098864.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.44
358dbj|AK070051.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.44
359dbj|AK060904.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.44
360dbj|AK060987.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.44
361dbj|AK060800.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.44
362gb|AY105356.1| Zea mays PCO075138 mRNA sequence 44 0.44
363gb|AY105333.1| Zea mays PCO095488 mRNA sequence 44 0.44
364dbj|AP005228.3| Homo sapiens genomic DNA, chromosome 18 clone:RP... 44 0.44
365gb|U22329.1|VCU22329 Volvox carteri light harvesting complex a m... 44 0.44
366dbj|AP000874.4| Homo sapiens genomic DNA, chromosome 18 clone:RP... 44 0.44
367gb|AY845254.1| Pisum sativum light-harvesting chlorophyll-a/b bi... 42 1.7
368ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BIND... 42 1.7
369ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BIND... 42 1.7
370ref|NM_126540.2| Arabidopsis thaliana LHCB2.1; chlorophyll bindi... 42 1.7
371gb|AY954742.1| Ostreococcus tauri chloroplast prasinophyte chlor... 42 1.7
372gb|AY954741.1| Ostreococcus tauri chloroplast prasinophyte chlor... 42 1.7
373gb|AY954733.1| Ostreococcus tauri chloroplast prasinophyte chlor... 42 1.7
374gb|AY954730.1| Ostreococcus tauri chloroplast prasinophyte chlor... 42 1.7
375emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 42 1.7
376gb|AC003084.1| Homo sapiens BAC clone CTB-84D4 from 7, complete ... 42 1.7
377gb|AY045787.1| Arabidopsis thaliana At2g05100 mRNA sequence 42 1.7
378gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-bin... 42 1.7
379gb|AY050935.1| Arabidopsis thaliana putative photosystem II type... 42 1.7
380emb|AL939113.1|SCO939113 Streptomyces coelicolor A3(2) complete ... 42 1.7
381gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 42 1.7
382gb|AE011676.1| Xanthomonas axonopodis pv. citri str. 306, secti... 42 1.7
383gb|DQ427744.1| Sorghum propinquum locus HHU11 genomic sequence 42 1.7
384gb|DQ427743.1| Sorghum bicolor voucher PI585454 locus HHU11 geno... 42 1.7
385gb|DQ427742.1| Sorghum bicolor voucher PI267539 locus HHU11 geno... 42 1.7
386gb|DQ427741.1| Sorghum bicolor voucher PI267408 locus HHU11 geno... 42 1.7
387gb|DQ427740.1| Sorghum bicolor voucher PI221607 locus HHU11 geno... 42 1.7
388gb|DQ427739.1| Sorghum bicolor voucher PI152702 locus HHU11 geno... 42 1.7
389gb|DQ427738.1| Sorghum bicolor voucher NSL92371 locus HHU11 geno... 42 1.7
390gb|DQ427737.1| Sorghum bicolor voucher NSL87902b locus HHU11 gen... 42 1.7
391gb|DQ427736.1| Sorghum bicolor voucher NSL87902a locus HHU11 gen... 42 1.7
392gb|DQ427735.1| Sorghum bicolor voucher NSL87666 locus HHU11 geno... 42 1.7
393gb|DQ427734.1| Sorghum bicolor voucher NSL77217 locus HHU11 geno... 42 1.7
394gb|DQ427733.1| Sorghum bicolor voucher NSL77034 locus HHU11 geno... 42 1.7
395gb|DQ427732.1| Sorghum bicolor voucher NSL56174 locus HHU11 geno... 42 1.7
396gb|DQ427731.1| Sorghum bicolor voucher NSL55243 locus HHU11 geno... 42 1.7
397gb|DQ427730.1| Sorghum bicolor voucher NSL51365 locus HHU11 geno... 42 1.7
398gb|DQ427729.1| Sorghum bicolor voucher NSL51030 locus HHU11 geno... 42 1.7
399gb|DQ427728.1| Sorghum bicolor voucher NSL50875 locus HHU11 geno... 42 1.7
400gb|AC007443.5| Arabidopsis thaliana chromosome 2 clone F15L11 ma... 42 1.7
401gb|AY027524.1| Frankia sp. CpI1 plasmid pFQ12, complete plasmid ... 42 1.7
402gb|AC145591.5| Mus musculus BAC clone RP24-176N2 from chromosome... 42 1.7
403gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 42 1.7
404gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 42 1.7
405gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 m... 42 1.7
406gb|AY052348.1| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, com... 42 1.7
407gb|AY052275.1| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, com... 42 1.7
408gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 42 1.7
409gb|DQ356257.1| Homo sapiens isolate cftr10471_A cystic fibrosis ... 42 1.7
410emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Co... 42 1.7
411emb|BX817619.1|CNS0AAVV Arabidopsis thaliana Full-length cDNA Co... 42 1.7
412emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Co... 42 1.7
413emb|BX819843.1|CNS0A9GW Arabidopsis thaliana Full-length cDNA Co... 42 1.7
414emb|BX819702.1|CNS0A9H1 Arabidopsis thaliana Full-length cDNA Co... 42 1.7
415emb|BX821844.1|CNS0A936 Arabidopsis thaliana Full-length cDNA Co... 42 1.7
416emb|BX821132.1|CNS0A9BI Arabidopsis thaliana Full-length cDNA Co... 42 1.7
417emb|BX819861.1|CNS0A9DS Arabidopsis thaliana Full-length cDNA Co... 42 1.7
418emb|BX819751.1|CNS0A9F6 Arabidopsis thaliana Full-length cDNA Co... 42 1.7
419emb|BX819688.1|CNS0A9G4 Arabidopsis thaliana Full-length cDNA Co... 42 1.7
420emb|BX819687.1|CNS0A9G3 Arabidopsis thaliana Full-length cDNA Co... 42 1.7
421emb|BX819683.1|CNS0A80L Arabidopsis thaliana Full-length cDNA Co... 42 1.7
422emb|BX842010.1|CNS09YA7 Arabidopsis thaliana Full-length cDNA Co... 42 1.7
423gb|DP000025.1| Gorilla gorilla gorilla target 1 genomic scaffold 42 1.7
424gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P... 42 1.7
425gb|AF312227.1|AF312227 Citrus reticulata light-harvesting chloro... 42 1.7
426gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N... 42 1.7
427gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete s... 42 1.7
428gb|AF134124.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.3) mRNA... 42 1.7
429emb|AJ538931.1|NTA538931 Nicotiana tabacum cDNA-AFLP-fragment BT... 42 1.7
430emb|AJ538874.1|NTA538874 Nicotiana tabacum cDNA-AFLP-fragment BT... 42 1.7
431emb|AJ538840.1|NTA538840 Nicotiana tabacum cDNA-AFLP-fragment BT... 42 1.7
432emb|AJ538493.1|NTA538493 Nicotiana tabacum cDNA-AFLP-fragment BC... 42 1.7
433dbj|AP003629.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
434dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene... 42 1.7
435emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding pr... 42 1.7
436emb|X58230.1|NTCAB36 Tobacco CAB36 gene for chlorophyll a/b bind... 42 1.7
437emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b bindin... 42 1.7
438emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophy... 42 1.7
439emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophy... 42 1.7
440emb|Z29965.1|TRLHCABBP T.repens (Huia) mRNA for light-harvesting... 42 1.7
441emb|X16536.1|GMCAB5 G.max DNA for Cab5 42 1.7
442emb|X57082.1|PSCABII P.sativum Cab II gene for chlorophyll a/b-b... 42 1.7
443dbj|AK105694.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.7
444gb|AY103838.1| Zea mays PCO113775 mRNA sequence 42 1.7
445gb|BT001933.1| Arabidopsis thaliana clone C105385 putative chlor... 42 1.7
446gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding pro... 42 1.7
447gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll... 42 1.7
448gb|U25812.1|PSU25812 Pseudomonas syringae pv. syringae hrp gene ... 42 1.7
449gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I ... 42 1.7
450dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harv... 42 1.7
451dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harv... 42 1.7
452dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 g... 42 1.7
453dbj|AB012636.1| Nicotiana sylvestris Lhcb1*1 gene for light harv... 42 1.7
454dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding p... 42 1.7
455ref|NM_122728.1| Arabidopsis thaliana chlorophyll binding AT5G28... 40 6.9
456ref|NM_116012.2| Arabidopsis thaliana LHCA2; chlorophyll binding... 40 6.9
457ref|XM_481492.1| Oryza sativa (japonica cultivar-group), mRNA 40 6.9
458ref|XM_463821.1| Oryza sativa (japonica cultivar-group), mRNA 40 6.9
459ref|XM_478415.1| Oryza sativa (japonica cultivar-group), mRNA 40 6.9
460gb|AY360387.2| Oryza sativa (japonica cultivar-group) chromosome... 40 6.9
461gb|AC139637.17| Mus musculus chromosome 15, clone RP24-253M12, c... 40 6.9
462gb|AC008228.5| Drosophila melanogaster clone BACR23E23, complete... 40 6.9
463gb|AC010123.9| Drosophila melanogaster clone BACR35O22, complete... 40 6.9
464ref|NM_001039970.1| Homo sapiens protein tyrosine phosphatase, n... 40 6.9
465ref|NM_032781.3| Homo sapiens protein tyrosine phosphatase, non-... 40 6.9
466ref|NM_006906.1| Homo sapiens protein tyrosine phosphatase, non-... 40 6.9
467gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 40 6.9
468gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome 40 6.9
469gb|BT013404.1| Lycopersicon esculentum clone 135718R, mRNA sequence 40 6.9
470gb|BT012757.1| Lycopersicon esculentum clone 113701F, mRNA sequence 40 6.9
471gb|BT012040.1| Arabidopsis thaliana At5g28450 mRNA sequence 40 6.9
472gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome 40 6.9
473gb|AC142474.4| Mus musculus BAC clone RP24-362N7 from chromosome... 40 6.9
474ref|XM_815799.1| Trypanosoma cruzi strain CL Brener hypothetical... 40 6.9
475ref|XM_883654.1| Candida albicans SC5314 hypothetical protein (C... 40 6.9
476ref|XM_707383.1| Candida albicans SC5314 potential guanine nucle... 40 6.9
477gb|BC046435.1| Homo sapiens protein tyrosine phosphatase, non-re... 40 6.9
478gb|BC064807.1| Homo sapiens protein tyrosine phosphatase, non-re... 40 6.9
479gb|AY340220.1| Oryza sativa (japonica cultivar-group) hydroperox... 40 6.9
480gb|BC039897.1| Homo sapiens protein tyrosine phosphatase, non-re... 40 6.9
481emb|Z22873.1|TABETGLUA T.aestivum beta glucanase mRNA, complete CDS 40 6.9
482emb|CR555306.1| Azoarcus sp. EbN1 complete genome 40 6.9
483emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos... 40 6.9
484emb|AL832541.1|HSM803850 Homo sapiens mRNA; cDNA DKFZp547A0817 (... 40 6.9
485emb|AL132962.1|ATF2A19 Arabidopsis thaliana DNA chromosome 3, BA... 40 6.9
486gb|AY065429.1| Arabidopsis thaliana putative Lhca2 protein (At3g... 40 6.9
487emb|AL806524.10| Mouse DNA sequence from clone RP23-158E10 on ch... 40 6.9
488gb|DQ118580.1| Isochrysis galbana isolate 492 chloroplast light ... 40 6.9
489gb|AC123776.5| Homo sapiens chromosome 8, clone RP11-213I2, comp... 40 6.9
490gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 40 6.9
491dbj|AK127312.1| Homo sapiens cDNA FLJ45381 fis, clone BRHIP30210... 40 6.9
492dbj|AK090923.1| Homo sapiens cDNA FLJ33604 fis, clone BRAMY20152... 40 6.9
493dbj|AK027333.1| Homo sapiens cDNA FLJ14427 fis, clone HEMBA1006173 40 6.9
494dbj|AK055450.1| Homo sapiens cDNA FLJ30888 fis, clone FEBRA20050... 40 6.9
495gb|AE012146.1| Xanthomonas campestris pv. campestris str. ATCC 3... 40 6.9
496gb|AY113201.1| Drosophila melanogaster AT04225 full insert cDNA 40 6.9
497gb|AC103974.6| Homo sapiens chromosome 11, clone RP11-1081L13, c... 40 6.9
498ref|NM_164403.1| Drosophila melanogaster Star CG4385-RA, transcr... 40 6.9
499gb|BC028338.1| Homo sapiens, clone IMAGE:5195357, mRNA 40 6.9
500ref|NM_078726.2| Drosophila melanogaster Star CG4385-RB, transcr... 40 6.9

>emb|X63052.1|HVCP29 Hordeum vulgare gene for CP29 precursor for core chlorophyll a/b
            binding (CAB) protein of photosystem II (PSII)
          Length = 2689

 Score =  829 bits (418), Expect = 0.0
 Identities = 418/418 (100%)
 Strand = Plus / Minus

                                                                        
Query: 1    tgtttcttctgcccttgataatttacacgtacggcacattcgtactctcatacttttccc 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2402 tgtttcttctgcccttgataatttacacgtacggcacattcgtactctcatacttttccc 2343

                                                                        
Query: 61   cggtaaaattcacacagcacatcatgctgcatcgcacgcacgcatgcagctgagcatcaa 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2342 cggtaaaattcacacagcacatcatgctgcatcgcacgcacgcatgcagctgagcatcaa 2283

                                                                        
Query: 121  cagccgacggcggcggacgggcaatcaacggccagctcacaggctgggcaccctctcggc 180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2282 cagccgacggcggcggacgggcaatcaacggccagctcacaggctgggcaccctctcggc 2223

                                                                        
Query: 181  ggcgccggagatgacggtgagcaggttgttgccgaaggggtcgctgaggtgggcgcacag 240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2222 ggcgccggagatgacggtgagcaggttgttgccgaaggggtcgctgaggtgggcgcacag 2163

                                                                        
Query: 241  gttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggagaa 300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2162 gttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggagaa 2103

                                                                        
Query: 301  catggccagccgtccgttcttgatctccttcaccttgagcagcgccgcctggtcggggtc 360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2102 catggccagccgtccgttcttgatctccttcaccttgagcagcgccgcctggtcggggtc 2043

                                                                      
Query: 361  ggtggcgaggccgagcgggtcgaacgggccgcctgggtggagcttgtcatcgaattcc 418
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2042 ggtggcgaggccgagcgggtcgaacgggccgcctgggtggagcttgtcatcgaattcc 1985



 Score =  184 bits (93), Expect = 2e-43
 Identities = 93/93 (100%)
 Strand = Plus / Minus

                                                                        
Query: 417  ccagtccgttggtgatcctgtagtactcggcgcctccgacgaggacgacctcggcgacga 476
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1901 ccagtccgttggtgatcctgtagtactcggcgcctccgacgaggacgacctcggcgacga 1842

                                             
Query: 477  cggcgaggatcaggttgatagggatgctgttgc 509
            |||||||||||||||||||||||||||||||||
Sbjct: 1841 cggcgaggatcaggttgatagggatgctgttgc 1809



to top

>dbj|AK104824.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-041-F05, full
           insert sequence
          Length = 1157

 Score =  442 bits (223), Expect = e-121
 Identities = 319/351 (90%)
 Strand = Plus / Minus

                                                                       
Query: 159 acaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 218
           |||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 940 acaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 881

                                                                       
Query: 219 ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctgga 278
           |||||||||||||   | | |||||||||| ||| |||||||||||||||||||||||||
Sbjct: 880 ggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgga 821

                                                                       
Query: 279 tgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 338
           ||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
Sbjct: 820 tgaagaaccccagcatggagaacatggccagccgcccgttcttgatctccttcaccttca 761

                                                                       
Query: 339 gcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaacgggccgcctgggt 398
           |||||||||||||||| |||||| | || || || ||||||||||| ||||| |||||||
Sbjct: 760 gcagcgccgcctggtccgggtcgctcgccagccccagcgggtcgaatgggccacctgggt 701

                                                                       
Query: 399 ggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcctccgacga 458
           |||||||||| || |  ||||| |||||| |||||| ||||||||||||||| |||||||
Sbjct: 700 ggagcttgtcctccagatccaggccgttgatgatccggtagtactcggcgccgccgacga 641

                                                              
Query: 459 ggacgacctcggcgacgacggcgaggatcaggttgatagggatgctgttgc 509
           |||||||||||||| ||||||||| ||| |||||||| |||||||||||||
Sbjct: 640 ggacgacctcggcggcgacggcgacgatgaggttgatggggatgctgttgc 590



to top

>dbj|AK098872.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001B10, full
           insert sequence
          Length = 1101

 Score =  442 bits (223), Expect = e-121
 Identities = 319/351 (90%)
 Strand = Plus / Minus

                                                                       
Query: 159 acaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 218
           |||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 930 acaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 871

                                                                       
Query: 219 ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctgga 278
           |||||||||||||   | | |||||||||| ||| |||||||||||||||||||||||||
Sbjct: 870 ggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgga 811

                                                                       
Query: 279 tgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 338
           ||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
Sbjct: 810 tgaagaaccccagcatggagaacatggccagccgcccgttcttgatctccttcaccttca 751

                                                                       
Query: 339 gcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaacgggccgcctgggt 398
           |||||||||||||||| |||||| | || || || ||||||||||| ||||| |||||||
Sbjct: 750 gcagcgccgcctggtccgggtcgctcgccagccccagcgggtcgaatgggccacctgggt 691

                                                                       
Query: 399 ggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcctccgacga 458
           |||||||||| || |  ||||| |||||| |||||| ||||||||||||||| |||||||
Sbjct: 690 ggagcttgtcctccagatccaggccgttgatgatccggtagtactcggcgccgccgacga 631

                                                              
Query: 459 ggacgacctcggcgacgacggcgaggatcaggttgatagggatgctgttgc 509
           |||||||||||||| ||||||||| ||| |||||||| |||||||||||||
Sbjct: 630 ggacgacctcggcggcgacggcgacgatgaggttgatggggatgctgttgc 580



to top

>dbj|AK061295.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-D05, full
           insert sequence
          Length = 1186

 Score =  442 bits (223), Expect = e-121
 Identities = 319/351 (90%)
 Strand = Plus / Minus

                                                                       
Query: 159 acaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 218
           |||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 941 acaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 882

                                                                       
Query: 219 ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctgga 278
           |||||||||||||   | | |||||||||| ||| |||||||||||||||||||||||||
Sbjct: 881 ggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgga 822

                                                                       
Query: 279 tgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 338
           ||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
Sbjct: 821 tgaagaaccccagcatggagaacatggccagccgcccgttcttgatctccttcaccttca 762

                                                                       
Query: 339 gcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaacgggccgcctgggt 398
           |||||||||||||||| |||||| | || || || ||||||||||| ||||| |||||||
Sbjct: 761 gcagcgccgcctggtccgggtcgctcgccagccccagcgggtcgaatgggccacctgggt 702

                                                                       
Query: 399 ggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcctccgacga 458
           |||||||||| || |  ||||| |||||| |||||| ||||||||||||||| |||||||
Sbjct: 701 ggagcttgtcctccagatccaggccgttgatgatccggtagtactcggcgccgccgacga 642

                                                              
Query: 459 ggacgacctcggcgacgacggcgaggatcaggttgatagggatgctgttgc 509
           |||||||||||||| ||||||||| ||| |||||||| |||||||||||||
Sbjct: 641 ggacgacctcggcggcgacggcgacgatgaggttgatggggatgctgttgc 591



to top

>gb|AY105650.1| Zea mays PCO135935 mRNA sequence
          Length = 1366

 Score =  377 bits (190), Expect = e-101
 Identities = 313/354 (88%)
 Strand = Plus / Minus

                                                                        
Query: 156  ctcacaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccga 215
            ||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1028 ctcacaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccga 969

                                                                        
Query: 216  aggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcct 275
            ||||||||||||||||   |   |||||||||| ||| || |||||||||||||||||||
Sbjct: 968  aggggtcgctgaggtgcttggcgaggttctcgacggggccttcgccggtgacgtaggcct 909

                                                                        
Query: 276  ggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacct 335
            ||||||||||| | | ||||||||||||||| ||||| ||||||||||||||||||||||
Sbjct: 908  ggatgaagaaggcgaacatggagaacatggcgagccggccgttcttgatctccttcacct 849

                                                                        
Query: 336  tgagcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaacgggccgcctg 395
            |||| |  || ||||||||||||||| |||| ||||| || |||||||| ||||| || |
Sbjct: 848  tgaggatggcggcctggtcggggtcgctggccaggcccagggggtcgaaggggccaccgg 789

                                                                        
Query: 396  ggtggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcctccga 455
            |||| |||||||| ||||  |||||||||||| |||||| ||||||||||||||| ||||
Sbjct: 788  ggtgcagcttgtcctcgaggtccagtccgttgatgatccggtagtactcggcgccgccga 729

                                                                  
Query: 456  cgaggacgacctcggcgacgacggcgaggatcaggttgatagggatgctgttgc 509
            ||||||||||||| ||||  |||||||  | ||||||||| |||||||||||||
Sbjct: 728  cgaggacgacctccgcgatcacggcgaccaccaggttgatggggatgctgttgc 675



to top

>gb|U23188.1|ZMU23188 Zea mays chlorophyll a/b-binding apoprotein CP26 (Lhcb5-1) mRNA,
           complete cds
          Length = 957

 Score =  369 bits (186), Expect = 6e-99
 Identities = 312/354 (88%)
 Strand = Plus / Minus

                                                                       
Query: 156 ctcacaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccga 215
           ||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 886 ctcacaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccga 827

                                                                       
Query: 216 aggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcct 275
           ||||||||||||||||   |   |||||||||| ||| || |||||||||||||||||||
Sbjct: 826 aggggtcgctgaggtgcttggcgaggttctcgacggggccttcgccggtgacgtaggcct 767

                                                                       
Query: 276 ggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacct 335
           ||||||||||| | | ||||||||||||||| ||||| ||||||||||||||||||||||
Sbjct: 766 ggatgaagaaggcgaacatggagaacatggcgagccggccgttcttgatctccttcacct 707

                                                                       
Query: 336 tgagcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaacgggccgcctg 395
           |||| |  || ||||||||||||||| |||| | ||| || |||||||| ||||| || |
Sbjct: 706 tgaggatggcggcctggtcggggtcgctggccaagcccagggggtcgaaggggccaccgg 647

                                                                       
Query: 396 ggtggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcctccga 455
           |||| |||||||| ||||  |||||||||||| |||||| ||||||||||||||| ||||
Sbjct: 646 ggtgcagcttgtcctcgaggtccagtccgttgatgatccggtagtactcggcgccgccga 587

                                                                 
Query: 456 cgaggacgacctcggcgacgacggcgaggatcaggttgatagggatgctgttgc 509
           ||||||||||||| ||||  |||||||  | ||||||||| |||||||||||||
Sbjct: 586 cgaggacgacctccgcgatcacggcgaccaccaggttgatggggatgctgttgc 533



to top

>gb|U23189.1|ZMU23189 Zea mays chlorophyll a/b-binding apoprotein CP26 (Lhcb5-2) mRNA,
           complete cds
          Length = 1073

 Score =  339 bits (171), Expect = 5e-90
 Identities = 306/351 (87%)
 Strand = Plus / Minus

                                                                       
Query: 159 acaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 218
           ||||||| |||  |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 881 acaggctaggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 822

                                                                       
Query: 219 ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctgga 278
           |||||||||||||   |   |||||||| | ||| || ||||||||||||||||||||||
Sbjct: 821 ggtcgctgaggtgcttggcgaggttctccacggggccttcgccggtgacgtaggcctgga 762

                                                                       
Query: 279 tgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 338
           |||||||| | | |||||||||||| || ||||| |||||||||||||||||||||||||
Sbjct: 761 tgaagaaggcgaacatggagaacatcgcgagccggccgttcttgatctccttcaccttga 702

                                                                       
Query: 339 gcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaacgggccgcctgggt 398
           | |  || ||||||||||||||| |||| ||||| || |||||||| ||||| || ||||
Sbjct: 701 ggatggcggcctggtcggggtcgctggccaggcccagggggtcgaaggggccaccggggt 642

                                                                       
Query: 399 ggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcctccgacga 458
           | |||||||| || |  ||||||||||||||||||| ||||||||||||||| |||||||
Sbjct: 641 gcagcttgtcctcaaggtccagtccgttggtgatccggtagtactcggcgccgccgacga 582

                                                              
Query: 459 ggacgacctcggcgacgacggcgaggatcaggttgatagggatgctgttgc 509
           |||||||||| ||||  ||||| |  | ||||||||| |||||||||||||
Sbjct: 581 ggacgacctccgcgatcacggccaccaccaggttgatggggatgctgttgc 531



to top

>gb|AC135460.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0091I11, complete sequence
          Length = 135993

 Score =  337 bits (170), Expect = 2e-89
 Identities = 230/250 (92%)
 Strand = Plus / Minus

                                                                         
Query: 159   acaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 218
             |||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 40261 acaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 40202

                                                                         
Query: 219   ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctgga 278
             |||||||||||||   | | |||||||||| ||| |||||||||||||||||||||||||
Sbjct: 40201 ggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgga 40142

                                                                         
Query: 279   tgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 338
             ||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
Sbjct: 40141 tgaagaaccccagcatggagaacatggccagccgcccgttcttgatctccttcaccttca 40082

                                                                         
Query: 339   gcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaacgggccgcctgggt 398
             |||||||||||||||| |||||| | || || || ||||||||||| ||||| |||||||
Sbjct: 40081 gcagcgccgcctggtccgggtcgctcgccagccccagcgggtcgaatgggccacctgggt 40022

                       
Query: 399   ggagcttgtc 408
             ||||||||||
Sbjct: 40021 ggagcttgtc 40012



 Score =  121 bits (61), Expect = 2e-24
 Identities = 85/93 (91%)
 Strand = Plus / Minus

                                                                         
Query: 417   ccagtccgttggtgatcctgtagtactcggcgcctccgacgaggacgacctcggcgacga 476
             |||| |||||| |||||| ||||||||||||||| ||||||||||||||||||||| |||
Sbjct: 39571 ccaggccgttgatgatccggtagtactcggcgccgccgacgaggacgacctcggcggcga 39512

                                              
Query: 477   cggcgaggatcaggttgatagggatgctgttgc 509
             |||||| ||| |||||||| |||||||||||||
Sbjct: 39511 cggcgacgatgaggttgatggggatgctgttgc 39479



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score =  337 bits (170), Expect = 2e-89
 Identities = 230/250 (92%)
 Strand = Plus / Minus

                                                                           
Query: 159     acaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 218
               |||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 7581175 acaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 7581116

                                                                           
Query: 219     ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctgga 278
               |||||||||||||   | | |||||||||| ||| |||||||||||||||||||||||||
Sbjct: 7581115 ggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgga 7581056

                                                                           
Query: 279     tgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 338
               ||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
Sbjct: 7581055 tgaagaaccccagcatggagaacatggccagccgcccgttcttgatctccttcaccttca 7580996

                                                                           
Query: 339     gcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaacgggccgcctgggt 398
               |||||||||||||||| |||||| | || || || ||||||||||| ||||| |||||||
Sbjct: 7580995 gcagcgccgcctggtccgggtcgctcgccagccccagcgggtcgaatgggccacctgggt 7580936

                         
Query: 399     ggagcttgtc 408
               ||||||||||
Sbjct: 7580935 ggagcttgtc 7580926



 Score =  121 bits (61), Expect = 2e-24
 Identities = 85/93 (91%)
 Strand = Plus / Minus

                                                                           
Query: 417     ccagtccgttggtgatcctgtagtactcggcgcctccgacgaggacgacctcggcgacga 476
               |||| |||||| |||||| ||||||||||||||| ||||||||||||||||||||| |||
Sbjct: 7580485 ccaggccgttgatgatccggtagtactcggcgccgccgacgaggacgacctcggcggcga 7580426

                                                
Query: 477     cggcgaggatcaggttgatagggatgctgttgc 509
               |||||| ||| |||||||| |||||||||||||
Sbjct: 7580425 cggcgacgatgaggttgatggggatgctgttgc 7580393



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  337 bits (170), Expect = 2e-89
 Identities = 230/250 (92%)
 Strand = Plus / Minus

                                                                           
Query: 159     acaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 218
               |||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 7651262 acaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 7651203

                                                                           
Query: 219     ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctgga 278
               |||||||||||||   | | |||||||||| ||| |||||||||||||||||||||||||
Sbjct: 7651202 ggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgga 7651143

                                                                           
Query: 279     tgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 338
               ||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
Sbjct: 7651142 tgaagaaccccagcatggagaacatggccagccgcccgttcttgatctccttcaccttca 7651083

                                                                           
Query: 339     gcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaacgggccgcctgggt 398
               |||||||||||||||| |||||| | || || || ||||||||||| ||||| |||||||
Sbjct: 7651082 gcagcgccgcctggtccgggtcgctcgccagccccagcgggtcgaatgggccacctgggt 7651023

                         
Query: 399     ggagcttgtc 408
               ||||||||||
Sbjct: 7651022 ggagcttgtc 7651013



 Score =  121 bits (61), Expect = 2e-24
 Identities = 85/93 (91%)
 Strand = Plus / Minus

                                                                           
Query: 417     ccagtccgttggtgatcctgtagtactcggcgcctccgacgaggacgacctcggcgacga 476
               |||| |||||| |||||| ||||||||||||||| ||||||||||||||||||||| |||
Sbjct: 7650572 ccaggccgttgatgatccggtagtactcggcgccgccgacgaggacgacctcggcggcga 7650513

                                                
Query: 477     cggcgaggatcaggttgatagggatgctgttgc 509
               |||||| ||| |||||||| |||||||||||||
Sbjct: 7650512 cggcgacgatgaggttgatggggatgctgttgc 7650480



to top

>dbj|D85512.1| Oryza sativa (japonica cultivar-group) CP26 mRNA, partial sequence
          Length = 556

 Score =  274 bits (138), Expect = 3e-70
 Identities = 180/194 (92%)
 Strand = Plus / Minus

                                                                       
Query: 159 acaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 218
           |||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 395 acaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 336

                                                                       
Query: 219 ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctgga 278
           |||||||||||||   | | |||||||||| ||| |||||||||||||||||||||||||
Sbjct: 335 ggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgga 276

                                                                       
Query: 279 tgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 338
           ||||||| |||||||||||||||||||||||||| ||||||||||||||||||| ||| |
Sbjct: 275 tgaagaaccccagcatggagaacatggccagccgcccgttcttgatctccttcaacttca 216

                         
Query: 339 gcagcgccgcctgg 352
           ||||||||| ||||
Sbjct: 215 gcagcgccgtctgg 202



to top

>gb|AY855171.1| Eleusine coracana subsp. coracana clone 1 light harvesting protein
           mRNA, partial cds
          Length = 364

 Score =  216 bits (109), Expect = 5e-53
 Identities = 172/193 (89%)
 Strand = Plus / Minus

                                                                       
Query: 159 acaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 218
           ||||||||||  ||||||||||||| || |||||||||||||||||||||||||||||||
Sbjct: 193 acaggctgggtgccctctcggcggcaccagagatgacggtgagcaggttgttgccgaagg 134

                                                                       
Query: 219 ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctgga 278
           |||||||||||||   |   |||||||||| ||| ||| |||| ||||||||||||||||
Sbjct: 133 ggtcgctgaggtgcttggcgaggttctcgacgggacccccgcctgtgacgtaggcctgga 74

                                                                       
Query: 279 tgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 338
           | |||||| | | ||||||||||||||||||||  |||||||||||||||||||||||||
Sbjct: 73  taaagaaggcgaacatggagaacatggccagcctgccgttcttgatctccttcaccttga 14

                        
Query: 339 gcagcgccgcctg 351
           |||| ||||||||
Sbjct: 13  gcagagccgcctg 1



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 14  cttgataatttacacgtacggcacattcgtactctcat 51
           |||||||||||||||| |||| ||||||  ||||||||
Sbjct: 319 cttgataatttacacgcacggtacattcagactctcat 282



to top

>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding
           protein (CABII) mRNA, partial cds
          Length = 714

 Score =  123 bits (62), Expect = 6e-25
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||||| ||| |||| ||||||||||  |||||||| |||||| || | |||||||
Sbjct: 505 aggttctcgatgggtcccttgccggtgacgatggcctggacgaagaacccaaacatggag 446

                                                                       
Query: 299 aacatggccagccgtccgttcttgatctccttcaccttgagcagcgccgcctggtcgggg 358
           |||||||| || || |||||||||| ||||||||||||||||  ||| ||   |||||||
Sbjct: 445 aacatggcgaggcggccgttcttgagctccttcaccttgagctccgcggcggtgtcgggg 386

                                                             
Query: 359 tcggtggcgaggccgagcgggtcgaacgggccgcctgggtggagcttgtc 408
           ||   |||||| |||||||||||||||| |||||| |||| || ||||||
Sbjct: 385 tcatcggcgagcccgagcgggtcgaacgcgccgccggggtagaccttgtc 336



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  121 bits (61), Expect = 2e-24
 Identities = 139/165 (84%)
 Strand = Plus / Minus

                                                                            
Query: 239      aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
                |||||||||| ||| |||| ||||||||||  |||||||| ||||||||| | |||||||
Sbjct: 10793709 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 10793650

                                                                            
Query: 299      aacatggccagccgtccgttcttgatctccttcaccttgagcagcgccgcctggtcgggg 358
                |||||||| || || |||||||||||||||||||||||||||  |||   |   ||||||
Sbjct: 10793649 aacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaacgcctcgggg 10793590

                                                             
Query: 359      tcggtggcgaggccgagcgggtcgaacgggccgcctgggtggagc 403
                ||   ||||||||||||||||||||| | |||||| |||| ||||
Sbjct: 10793589 tcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagc 10793545



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                               
Query: 305     gccagccgtccgttcttgatctccttcacctt 336
               ||||| || |||||||||||||||||||||||
Sbjct: 7133596 gccaggcgaccgttcttgatctccttcacctt 7133565



to top

>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0512H04
          Length = 151049

 Score =  121 bits (61), Expect = 2e-24
 Identities = 139/165 (84%)
 Strand = Plus / Minus

                                                                         
Query: 239   aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
             |||||||||| ||| |||| ||||||||||  |||||||| ||||||||| | |||||||
Sbjct: 17432 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 17373

                                                                         
Query: 299   aacatggccagccgtccgttcttgatctccttcaccttgagcagcgccgcctggtcgggg 358
             |||||||| || || |||||||||||||||||||||||||||  |||   |   ||||||
Sbjct: 17372 aacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaacgcctcgggg 17313

                                                          
Query: 359   tcggtggcgaggccgagcgggtcgaacgggccgcctgggtggagc 403
             ||   ||||||||||||||||||||| | |||||| |||| ||||
Sbjct: 17312 tcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagc 17268



to top

>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBb0085I16
          Length = 141701

 Score =  121 bits (61), Expect = 2e-24
 Identities = 139/165 (84%)
 Strand = Plus / Minus

                                                                          
Query: 239    aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
              |||||||||| ||| |||| ||||||||||  |||||||| ||||||||| | |||||||
Sbjct: 130327 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 130268

                                                                          
Query: 299    aacatggccagccgtccgttcttgatctccttcaccttgagcagcgccgcctggtcgggg 358
              |||||||| || || |||||||||||||||||||||||||||  |||   |   ||||||
Sbjct: 130267 aacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaacgcctcgggg 130208

                                                           
Query: 359    tcggtggcgaggccgagcgggtcgaacgggccgcctgggtggagc 403
              ||   ||||||||||||||||||||| | |||||| |||| ||||
Sbjct: 130207 tcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagc 130163



to top

>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full
           insert sequence
          Length = 1013

 Score =  121 bits (61), Expect = 2e-24
 Identities = 139/165 (84%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||||| ||| |||| ||||||||||  |||||||| ||||||||| | |||||||
Sbjct: 777 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 718

                                                                       
Query: 299 aacatggccagccgtccgttcttgatctccttcaccttgagcagcgccgcctggtcgggg 358
           |||||||| || || |||||||||||||||||||||||||||  |||   |   ||||||
Sbjct: 717 aacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaacgcctcgggg 658

                                                        
Query: 359 tcggtggcgaggccgagcgggtcgaacgggccgcctgggtggagc 403
           ||   ||||||||||||||||||||| | |||||| |||| ||||
Sbjct: 657 tcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagc 613



to top

>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full
           insert sequence
          Length = 1021

 Score =  121 bits (61), Expect = 2e-24
 Identities = 139/165 (84%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||||| ||| |||| ||||||||||  |||||||| ||||||||| | |||||||
Sbjct: 782 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 723

                                                                       
Query: 299 aacatggccagccgtccgttcttgatctccttcaccttgagcagcgccgcctggtcgggg 358
           |||||||| || || |||||||||||||||||||||||||||  |||   |   ||||||
Sbjct: 722 aacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaacgcctcgggg 663

                                                        
Query: 359 tcggtggcgaggccgagcgggtcgaacgggccgcctgggtggagc 403
           ||   ||||||||||||||||||||| | |||||| |||| ||||
Sbjct: 662 tcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagc 618



to top

>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full
           insert sequence
          Length = 1056

 Score =  121 bits (61), Expect = 2e-24
 Identities = 139/165 (84%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||||| ||| |||| ||||||||||  |||||||| ||||||||| | |||||||
Sbjct: 784 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 725

                                                                       
Query: 299 aacatggccagccgtccgttcttgatctccttcaccttgagcagcgccgcctggtcgggg 358
           |||||||| || || |||||||||||||||||||||||||||  |||   |   ||||||
Sbjct: 724 aacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaacgcctcgggg 665

                                                        
Query: 359 tcggtggcgaggccgagcgggtcgaacgggccgcctgggtggagc 403
           ||   ||||||||||||||||||||| | |||||| |||| ||||
Sbjct: 664 tcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagc 620



to top

>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full
           insert sequence
          Length = 1235

 Score =  121 bits (61), Expect = 2e-24
 Identities = 139/165 (84%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||||| ||| |||| ||||||||||  |||||||| ||||||||| | |||||||
Sbjct: 782 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 723

                                                                       
Query: 299 aacatggccagccgtccgttcttgatctccttcaccttgagcagcgccgcctggtcgggg 358
           |||||||| || || |||||||||||||||||||||||||||  |||   |   ||||||
Sbjct: 722 aacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaacgcctcgggg 663

                                                        
Query: 359 tcggtggcgaggccgagcgggtcgaacgggccgcctgggtggagc 403
           ||   ||||||||||||||||||||| | |||||| |||| ||||
Sbjct: 662 tcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagc 618



to top

>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full
           insert sequence
          Length = 1045

 Score =  121 bits (61), Expect = 2e-24
 Identities = 139/165 (84%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||||| ||| |||| ||||||||||  |||||||| ||||||||| | |||||||
Sbjct: 782 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 723

                                                                       
Query: 299 aacatggccagccgtccgttcttgatctccttcaccttgagcagcgccgcctggtcgggg 358
           |||||||| || || |||||||||||||||||||||||||||  |||   |   ||||||
Sbjct: 722 aacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaacgcctcgggg 663

                                                        
Query: 359 tcggtggcgaggccgagcgggtcgaacgggccgcctgggtggagc 403
           ||   ||||||||||||||||||||| | |||||| |||| ||||
Sbjct: 662 tcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagc 618



to top

>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds
          Length = 1913

 Score =  119 bits (60), Expect = 9e-24
 Identities = 114/132 (86%)
 Strand = Plus / Minus

                                                                        
Query: 205  gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 264
            ||||||| ||| |||||||  || |||| ||  ||||||||||| ||| |||| ||||||
Sbjct: 1495 gttgttggcgacggggtcggcgatgtggtcggccaggttctcgatggggcccttgccggt 1436

                                                                        
Query: 265  gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 324
            ||||  |||||| | ||||||||| | ||||||||||||||||||||| |||||||||||
Sbjct: 1435 gacgatggcctgaacgaagaagccgaacatggagaacatggccagccgcccgttcttgat 1376

                        
Query: 325  ctccttcacctt 336
            ||||||||||||
Sbjct: 1375 ctccttcacctt 1364



to top

>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete
             sequence
          Length = 139771

 Score =  117 bits (59), Expect = 4e-23
 Identities = 163/195 (83%), Gaps = 2/195 (1%)
 Strand = Plus / Plus

                                                                         
Query: 205   gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 264
             ||||||| ||| |||||||  || |||| || | |||||||||| ||| |||| ||||||
Sbjct: 79011 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 79070

                                                                         
Query: 265   gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 324
             ||||  |||||||| ||||||||| | ||||||||||||||| || || |||||||||| 
Sbjct: 79071 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccgttcttgag 79130

                                                                         
Query: 325   ctccttcaccttgagcagcgccgcctg-gtcggggtcggtggcgaggccgagcgggtcga 383
             ||||||||||||||||  || ||   | ||| ||||||  ||||||||||||||||||||
Sbjct: 79131 ctccttcaccttgagc-tcggcgaaggtgtcagggtcgtcggcgaggccgagcgggtcga 79189

                            
Query: 384   acgggccgcctgggt 398
             | | |||||||||||
Sbjct: 79190 aggcgccgcctgggt 79204



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  117 bits (59), Expect = 4e-23
 Identities = 163/195 (83%), Gaps = 2/195 (1%)
 Strand = Plus / Minus

                                                                            
Query: 205      gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 264
                ||||||| ||| |||||||  || |||| || | |||||||||| ||| |||| ||||||
Sbjct: 21808805 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 21808746

                                                                            
Query: 265      gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 324
                ||||  |||||||| ||||||||| | ||||||||||||||| || || |||||||||| 
Sbjct: 21808745 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccgttcttgag 21808686

                                                                            
Query: 325      ctccttcaccttgagcagcgccgcctg-gtcggggtcggtggcgaggccgagcgggtcga 383
                ||||||||||||||||  || ||   | ||| ||||||  ||||||||||||||||||||
Sbjct: 21808685 ctccttcaccttgagc-tcggcgaaggtgtcagggtcgtcggcgaggccgagcgggtcga 21808627

                               
Query: 384      acgggccgcctgggt 398
                | | |||||||||||
Sbjct: 21808626 aggcgccgcctgggt 21808612



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  117 bits (59), Expect = 4e-23
 Identities = 163/195 (83%), Gaps = 2/195 (1%)
 Strand = Plus / Minus

                                                                            
Query: 205      gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 264
                ||||||| ||| |||||||  || |||| || | |||||||||| ||| |||| ||||||
Sbjct: 21801834 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 21801775

                                                                            
Query: 265      gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 324
                ||||  |||||||| ||||||||| | ||||||||||||||| || || |||||||||| 
Sbjct: 21801774 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccgttcttgag 21801715

                                                                            
Query: 325      ctccttcaccttgagcagcgccgcctg-gtcggggtcggtggcgaggccgagcgggtcga 383
                ||||||||||||||||  || ||   | ||| ||||||  ||||||||||||||||||||
Sbjct: 21801714 ctccttcaccttgagc-tcggcgaaggtgtcagggtcgtcggcgaggccgagcgggtcga 21801656

                               
Query: 384      acgggccgcctgggt 398
                | | |||||||||||
Sbjct: 21801655 aggcgccgcctgggt 21801641



to top

>dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I09, full
           insert sequence
          Length = 1106

 Score =  117 bits (59), Expect = 4e-23
 Identities = 163/195 (83%), Gaps = 2/195 (1%)
 Strand = Plus / Minus

                                                                       
Query: 205 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 264
           ||||||| ||| |||||||  || |||| || | |||||||||| ||| |||| ||||||
Sbjct: 804 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 745

                                                                       
Query: 265 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 324
           ||||  |||||||| ||||||||| | ||||||||||||||| || || |||||||||| 
Sbjct: 744 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccgttcttgag 685

                                                                       
Query: 325 ctccttcaccttgagcagcgccgcctg-gtcggggtcggtggcgaggccgagcgggtcga 383
           ||||||||||||||||  || ||   | ||| ||||||  ||||||||||||||||||||
Sbjct: 684 ctccttcaccttgagc-tcggcgaaggtgtcagggtcgtcggcgaggccgagcgggtcga 626

                          
Query: 384 acgggccgcctgggt 398
           | | |||||||||||
Sbjct: 625 aggcgccgcctgggt 611



to top

>dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-A06, full
           insert sequence
          Length = 685

 Score =  117 bits (59), Expect = 4e-23
 Identities = 163/195 (83%), Gaps = 2/195 (1%)
 Strand = Plus / Minus

                                                                       
Query: 205 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 264
           ||||||| ||| |||||||  || |||| || | |||||||||| ||| |||| ||||||
Sbjct: 379 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 320

                                                                       
Query: 265 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 324
           ||||  |||||||| ||||||||| | ||||||||||||||| || || |||||||||| 
Sbjct: 319 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccgttcttgag 260

                                                                       
Query: 325 ctccttcaccttgagcagcgccgcctg-gtcggggtcggtggcgaggccgagcgggtcga 383
           ||||||||||||||||  || ||   | ||| ||||||  ||||||||||||||||||||
Sbjct: 259 ctccttcaccttgagc-tcggcgaaggtgtcagggtcgtcggcgaggccgagcgggtcga 201

                          
Query: 384 acgggccgcctgggt 398
           | | |||||||||||
Sbjct: 200 aggcgccgcctgggt 186



to top

>dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRNA for type II
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 989

 Score =  117 bits (59), Expect = 4e-23
 Identities = 163/195 (83%), Gaps = 2/195 (1%)
 Strand = Plus / Minus

                                                                       
Query: 205 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 264
           ||||||| ||| ||||||| ||| |||| || | |||||||||| ||| |||| ||||||
Sbjct: 785 gttgttggcgacggggtcggtgacgtggtcgaagaggttctcgatggggcccttgccggt 726

                                                                       
Query: 265 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 324
           ||||  |||||||| |||||| || | ||||||||||||||| || || |||||||||| 
Sbjct: 725 gacgatggcctggacgaagaatccgaacatggagaacatggcgaggcggccgttcttgag 666

                                                                       
Query: 325 ctccttcaccttgagcagcgccgcctg-gtcggggtcggtggcgaggccgagcgggtcga 383
           ||||||||||||||||  || ||   | ||| ||||||  ||||||||||||||||||||
Sbjct: 665 ctccttcaccttgagc-tcggcgaaggtgtcagggtcgtcggcgaggccgagcgggtcga 607

                          
Query: 384 acgggccgcctgggt 398
           | | |||||||||||
Sbjct: 606 aggcgccgcctgggt 592



to top

>ref|NM_192636.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 789

 Score =  115 bits (58), Expect = 1e-22
 Identities = 91/102 (89%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||||| ||| |||| ||||||||||  |||||||| ||||||||| | |||||||
Sbjct: 713 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 654

                                                     
Query: 299 aacatggccagccgtccgttcttgatctccttcaccttgagc 340
           |||||||| || || |||||||||||||||||||||||||||
Sbjct: 653 aacatggcgaggcggccgttcttgatctccttcaccttgagc 612



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  115 bits (58), Expect = 1e-22
 Identities = 91/102 (89%)
 Strand = Plus / Minus

                                                                            
Query: 239      aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
                |||||||||| ||| |||| ||||||||||  |||||||| ||||||||| | |||||||
Sbjct: 23604256 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 23604197

                                                          
Query: 299      aacatggccagccgtccgttcttgatctccttcaccttgagc 340
                |||||||| || || |||||||||||||||||||||||||||
Sbjct: 23604196 aacatggcgaggcggccgttcttgatctccttcaccttgagc 23604155



 Score =  103 bits (52), Expect = 6e-19
 Identities = 139/168 (82%)
 Strand = Plus / Minus

                                                                            
Query: 217      ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctg 276
                |||||||  ||||||| ||  ||||||||| |  ||||||| ||||||||||  ||||||
Sbjct: 30025084 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 30025025

                                                                            
Query: 277      gatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 336
                || |||||| || | ||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 30025024 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 30024965

                                                                
Query: 337      gagcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaa 384
                ||||   ||   |   |||||||||  |||||||||||||||||||||
Sbjct: 30024964 gagctcggcgaacgcctcggggtcgtcggcgaggccgagcgggtcgaa 30024917



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 456     cgaggacgacctcggcgacgac 477
               ||||||||||||||||||||||
Sbjct: 2560192 cgaggacgacctcggcgacgac 2560213



to top

>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0518F01
          Length = 154541

 Score =  115 bits (58), Expect = 1e-22
 Identities = 91/102 (89%)
 Strand = Plus / Minus

                                                                         
Query: 239   aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
             |||||||||| ||| |||| ||||||||||  |||||||| ||||||||| | |||||||
Sbjct: 66955 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 66896

                                                       
Query: 299   aacatggccagccgtccgttcttgatctccttcaccttgagc 340
             |||||||| || || |||||||||||||||||||||||||||
Sbjct: 66895 aacatggcgaggcggccgttcttgatctccttcaccttgagc 66854



to top

>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full
           insert sequence
          Length = 1180

 Score =  115 bits (58), Expect = 1e-22
 Identities = 91/102 (89%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||||| ||| |||| ||||||||||  |||||||| ||||||||| | |||||||
Sbjct: 784 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 725

                                                     
Query: 299 aacatggccagccgtccgttcttgatctccttcaccttgagc 340
           |||||||| || || |||||||||||||||||||||||||||
Sbjct: 724 aacatggcgaggcggccgttcttgatctccttcaccttgagc 683



to top

>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full
           insert sequence
          Length = 1126

 Score =  115 bits (58), Expect = 1e-22
 Identities = 91/102 (89%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||||| ||| |||| ||||||||||  |||||||| ||||||||| | |||||||
Sbjct: 783 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 724

                                                     
Query: 299 aacatggccagccgtccgttcttgatctccttcaccttgagc 340
           |||||||| || || |||||||||||||||||||||||||||
Sbjct: 723 aacatggcgaggcggccgttcttgatctccttcaccttgagc 682



to top

>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1442

 Score =  115 bits (58), Expect = 1e-22
 Identities = 91/102 (89%)
 Strand = Plus / Minus

                                                                        
Query: 239  aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
            |||||||||| ||| |||| ||||||||||  |||||||| ||||||||| | |||||||
Sbjct: 1213 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 1154

                                                      
Query: 299  aacatggccagccgtccgttcttgatctccttcaccttgagc 340
            |||||||| || || |||||||||||||||||||||||||||
Sbjct: 1153 aacatggcgaggcggccgttcttgatctccttcaccttgagc 1112



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 364  ggcgaggccgagcgggtcgaacgggccgcctgggtggagc 403
            ||||||||||||||||||||| | |||||| |||| ||||
Sbjct: 1088 ggcgaggccgagcgggtcgaaggcgccgcccgggtagagc 1049



to top

>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 1022

 Score =  113 bits (57), Expect = 6e-22
 Identities = 138/165 (83%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||||| ||| |||| ||||||||||  |||||||| ||||||||| | |||||||
Sbjct: 763 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 704

                                                                       
Query: 299 aacatggccagccgtccgttcttgatctccttcaccttgagcagcgccgcctggtcgggg 358
           |||||||| || || || ||||||||||||||||||||||||  |||   |   ||||||
Sbjct: 703 aacatggcgaggcggcctttcttgatctccttcaccttgagctccgcgaacgcctcgggg 644

                                                        
Query: 359 tcggtggcgaggccgagcgggtcgaacgggccgcctgggtggagc 403
           ||   ||||||||||||||||||||| | |||||| |||| ||||
Sbjct: 643 tcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagc 599



to top

>ref|XM_478729.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 972

 Score =  111 bits (56), Expect = 2e-21
 Identities = 116/136 (85%)
 Strand = Plus / Minus

                                                                       
Query: 205 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 264
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 796 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 737

                                                                       
Query: 265 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 324
           ||||  |||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 736 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 677

                           
Query: 325 ctccttcaccttgagc 340
           |||||| |||||||||
Sbjct: 676 ctccttgaccttgagc 661



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 354 cggggtcggtggcgaggccgagcgggtcgaa 384
           ||||||||  |||||||||||||||||||||
Sbjct: 647 cggggtcgtcggcgaggccgagcgggtcgaa 617



to top

>ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 995

 Score =  111 bits (56), Expect = 2e-21
 Identities = 116/136 (85%)
 Strand = Plus / Minus

                                                                       
Query: 205 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 264
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 820 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 761

                                                                       
Query: 265 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 324
           ||||  |||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 760 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 701

                           
Query: 325 ctccttcaccttgagc 340
           |||||| |||||||||
Sbjct: 700 ctccttgaccttgagc 685



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 354 cggggtcggtggcgaggccgagcgggtcgaa 384
           ||||||||  |||||||||||||||||||||
Sbjct: 671 cggggtcgtcggcgaggccgagcgggtcgaa 641



to top

>ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1007

 Score =  111 bits (56), Expect = 2e-21
 Identities = 116/136 (85%)
 Strand = Plus / Minus

                                                                       
Query: 205 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 264
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 820 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 761

                                                                       
Query: 265 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 324
           ||||  |||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 760 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 701

                           
Query: 325 ctccttcaccttgagc 340
           |||||| |||||||||
Sbjct: 700 ctccttgaccttgagc 685



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 354 cggggtcggtggcgaggccgagcgggtcgaa 384
           ||||||||  |||||||||||||||||||||
Sbjct: 671 cggggtcgtcggcgaggccgagcgggtcgaa 641



to top

>ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1108

 Score =  111 bits (56), Expect = 2e-21
 Identities = 116/136 (85%)
 Strand = Plus / Minus

                                                                       
Query: 205 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 264
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 822 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 763

                                                                       
Query: 265 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 324
           ||||  |||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 762 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 703

                           
Query: 325 ctccttcaccttgagc 340
           |||||| |||||||||
Sbjct: 702 ctccttgaccttgagc 687



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 354 cggggtcggtggcgaggccgagcgggtcgaa 384
           ||||||||  |||||||||||||||||||||
Sbjct: 673 cggggtcgtcggcgaggccgagcgggtcgaa 643



to top

>ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1000

 Score =  111 bits (56), Expect = 2e-21
 Identities = 116/136 (85%)
 Strand = Plus / Minus

                                                                       
Query: 205 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 264
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766

                                                                       
Query: 265 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 324
           ||||  |||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 765 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 706

                           
Query: 325 ctccttcaccttgagc 340
           |||||| |||||||||
Sbjct: 705 ctccttgaccttgagc 690



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 354 cggggtcggtggcgaggccgagcgggtcgaa 384
           ||||||||  |||||||||||||||||||||
Sbjct: 676 cggggtcgtcggcgaggccgagcgggtcgaa 646



to top

>ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1012

 Score =  111 bits (56), Expect = 2e-21
 Identities = 116/136 (85%)
 Strand = Plus / Minus

                                                                       
Query: 205 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 264
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766

                                                                       
Query: 265 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 324
           ||||  |||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 765 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 706

                           
Query: 325 ctccttcaccttgagc 340
           |||||| |||||||||
Sbjct: 705 ctccttgaccttgagc 690



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 354 cggggtcggtggcgaggccgagcgggtcgaa 384
           ||||||||  |||||||||||||||||||||
Sbjct: 676 cggggtcgtcggcgaggccgagcgggtcgaa 646



to top

>ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1032

 Score =  111 bits (56), Expect = 2e-21
 Identities = 116/136 (85%)
 Strand = Plus / Minus

                                                                       
Query: 205 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 264
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 827 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 768

                                                                       
Query: 265 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 324
           ||||  |||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 767 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 708

                           
Query: 325 ctccttcaccttgagc 340
           |||||| |||||||||
Sbjct: 707 ctccttgaccttgagc 692



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 354 cggggtcggtggcgaggccgagcgggtcgaa 384
           ||||||||  |||||||||||||||||||||
Sbjct: 678 cggggtcgtcggcgaggccgagcgggtcgaa 648



to top

>ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1159

 Score =  111 bits (56), Expect = 2e-21
 Identities = 116/136 (85%)
 Strand = Plus / Minus

                                                                       
Query: 205 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 264
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 860 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 801

                                                                       
Query: 265 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 324
           ||||  |||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 800 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 741

                           
Query: 325 ctccttcaccttgagc 340
           |||||| |||||||||
Sbjct: 740 ctccttgaccttgagc 725



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 354 cggggtcggtggcgaggccgagcgggtcgaa 384
           ||||||||  |||||||||||||||||||||
Sbjct: 711 cggggtcgtcggcgaggccgagcgggtcgaa 681



to top

>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1664

 Score =  111 bits (56), Expect = 2e-21
 Identities = 134/160 (83%)
 Strand = Plus / Minus

                                                                        
Query: 239  aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
            |||||||||| ||| |||| ||||||||||  |||||||| ||||||||| | |||||||
Sbjct: 1174 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 1115

                                                                        
Query: 299  aacatggccagccgtccgttcttgatctccttcaccttgagcagcgccgcctggtcgggg 358
            |||||||| || || ||||||||||||| |||||||||||||  |||   |   ||||||
Sbjct: 1114 aacatggcgaggcggccgttcttgatcttcttcaccttgagctccgcgcacgcctcgggg 1055

                                                    
Query: 359  tcggtggcgaggccgagcgggtcgaacgggccgcctgggt 398
            ||   ||||||||||||||||||||| | |||||| ||||
Sbjct: 1054 tcatcggcgaggccgagcgggtcgaaggcgccgccggggt 1015



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  111 bits (56), Expect = 2e-21
 Identities = 116/136 (85%)
 Strand = Plus / Minus

                                                                            
Query: 205      gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 264
                ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 22434833 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 22434774

                                                                            
Query: 265      gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 324
                ||||  |||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 22434773 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 22434714

                                
Query: 325      ctccttcaccttgagc 340
                |||||| |||||||||
Sbjct: 22434713 ctccttgaccttgagc 22434698



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                               
Query: 354      cggggtcggtggcgaggccgagcgggtcgaa 384
                ||||||||  |||||||||||||||||||||
Sbjct: 22434684 cggggtcgtcggcgaggccgagcgggtcgaa 22434654



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                              
Query: 301      catggccagccgtccgttcttgatctcctt 330
                |||||| ||||| |||||||||||||||||
Sbjct: 23305209 catggcgagccgcccgttcttgatctcctt 23305180



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 343      cgccgcctggtcggggtcgg 362
                ||||||||||||||||||||
Sbjct: 19834168 cgccgcctggtcggggtcgg 19834187



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 465     cctcggcgacgacggcgagg 484
               ||||||||||||||||||||
Sbjct: 2026838 cctcggcgacgacggcgagg 2026857



to top

>dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0406F06
          Length = 144533

 Score =  111 bits (56), Expect = 2e-21
 Identities = 116/136 (85%)
 Strand = Plus / Minus

                                                                         
Query: 205   gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 264
             ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 95900 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 95841

                                                                         
Query: 265   gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 324
             ||||  |||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 95840 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 95781

                             
Query: 325   ctccttcaccttgagc 340
             |||||| |||||||||
Sbjct: 95780 ctccttgaccttgagc 95765



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                            
Query: 354   cggggtcggtggcgaggccgagcgggtcgaa 384
             ||||||||  |||||||||||||||||||||
Sbjct: 95751 cggggtcgtcggcgaggccgagcgggtcgaa 95721



to top

>dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C08, full
           insert sequence
          Length = 1111

 Score =  111 bits (56), Expect = 2e-21
 Identities = 116/136 (85%)
 Strand = Plus / Minus

                                                                       
Query: 205 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 264
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766

                                                                       
Query: 265 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 324
           ||||  |||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 765 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 706

                           
Query: 325 ctccttcaccttgagc 340
           |||||| |||||||||
Sbjct: 705 ctccttgaccttgagc 690



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 354 cggggtcggtggcgaggccgagcgggtcgaa 384
           ||||||||  |||||||||||||||||||||
Sbjct: 676 cggggtcgtcggcgaggccgagcgggtcgaa 646



to top

>dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-G05, full
           insert sequence
          Length = 1012

 Score =  111 bits (56), Expect = 2e-21
 Identities = 116/136 (85%)
 Strand = Plus / Minus

                                                                       
Query: 205 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 264
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766

                                                                       
Query: 265 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 324
           ||||  |||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 765 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 706

                           
Query: 325 ctccttcaccttgagc 340
           |||||| |||||||||
Sbjct: 705 ctccttgaccttgagc 690



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 354 cggggtcggtggcgaggccgagcgggtcgaa 384
           ||||||||  |||||||||||||||||||||
Sbjct: 676 cggggtcgtcggcgaggccgagcgggtcgaa 646



to top

>dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-F03, full
           insert sequence
          Length = 1000

 Score =  111 bits (56), Expect = 2e-21
 Identities = 116/136 (85%)
 Strand = Plus / Minus

                                                                       
Query: 205 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 264
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766

                                                                       
Query: 265 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 324
           ||||  |||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 765 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 706

                           
Query: 325 ctccttcaccttgagc 340
           |||||| |||||||||
Sbjct: 705 ctccttgaccttgagc 690



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 354 cggggtcggtggcgaggccgagcgggtcgaa 384
           ||||||||  |||||||||||||||||||||
Sbjct: 676 cggggtcgtcggcgaggccgagcgggtcgaa 646



to top

>dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-C03, full
           insert sequence
          Length = 973

 Score =  111 bits (56), Expect = 2e-21
 Identities = 116/136 (85%)
 Strand = Plus / Minus

                                                                       
Query: 205 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 264
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 796 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 737

                                                                       
Query: 265 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 324
           ||||  |||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 736 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 677

                           
Query: 325 ctccttcaccttgagc 340
           |||||| |||||||||
Sbjct: 676 ctccttgaccttgagc 661



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 354 cggggtcggtggcgaggccgagcgggtcgaa 384
           ||||||||  |||||||||||||||||||||
Sbjct: 647 cggggtcgtcggcgaggccgagcgggtcgaa 617



to top

>dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C07, full
           insert sequence
          Length = 1012

 Score =  111 bits (56), Expect = 2e-21
 Identities = 116/136 (85%)
 Strand = Plus / Minus

                                                                       
Query: 205 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 264
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766

                                                                       
Query: 265 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 324
           ||||  |||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 765 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 706

                           
Query: 325 ctccttcaccttgagc 340
           |||||| |||||||||
Sbjct: 705 ctccttgaccttgagc 690



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 354 cggggtcggtggcgaggccgagcgggtcgaa 384
           ||||||||  |||||||||||||||||||||
Sbjct: 676 cggggtcgtcggcgaggccgagcgggtcgaa 646



to top

>dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-E11, full
           insert sequence
          Length = 995

 Score =  111 bits (56), Expect = 2e-21
 Identities = 116/136 (85%)
 Strand = Plus / Minus

                                                                       
Query: 205 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 264
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 820 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 761

                                                                       
Query: 265 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 324
           ||||  |||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 760 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 701

                           
Query: 325 ctccttcaccttgagc 340
           |||||| |||||||||
Sbjct: 700 ctccttgaccttgagc 685



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 354 cggggtcggtggcgaggccgagcgggtcgaa 384
           ||||||||  |||||||||||||||||||||
Sbjct: 671 cggggtcgtcggcgaggccgagcgggtcgaa 641



to top

>dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-D10, full
           insert sequence
          Length = 1007

 Score =  111 bits (56), Expect = 2e-21
 Identities = 116/136 (85%)
 Strand = Plus / Minus

                                                                       
Query: 205 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 264
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 820 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 761

                                                                       
Query: 265 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 324
           ||||  |||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 760 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 701

                           
Query: 325 ctccttcaccttgagc 340
           |||||| |||||||||
Sbjct: 700 ctccttgaccttgagc 685



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 354 cggggtcggtggcgaggccgagcgggtcgaa 384
           ||||||||  |||||||||||||||||||||
Sbjct: 671 cggggtcgtcggcgaggccgagcgggtcgaa 641



to top

>dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D02, full
           insert sequence
          Length = 1000

 Score =  111 bits (56), Expect = 2e-21
 Identities = 116/136 (85%)
 Strand = Plus / Minus

                                                                       
Query: 205 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 264
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766

                                                                       
Query: 265 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 324
           ||||  |||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 765 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 706

                           
Query: 325 ctccttcaccttgagc 340
           |||||| |||||||||
Sbjct: 705 ctccttgaccttgagc 690



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 354 cggggtcggtggcgaggccgagcgggtcgaa 384
           ||||||||  |||||||||||||||||||||
Sbjct: 676 cggggtcgtcggcgaggccgagcgggtcgaa 646



to top

>dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-G12, full
           insert sequence
          Length = 1032

 Score =  111 bits (56), Expect = 2e-21
 Identities = 116/136 (85%)
 Strand = Plus / Minus

                                                                       
Query: 205 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 264
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 827 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 768

                                                                       
Query: 265 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 324
           ||||  |||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 767 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 708

                           
Query: 325 ctccttcaccttgagc 340
           |||||| |||||||||
Sbjct: 707 ctccttgaccttgagc 692



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 354 cggggtcggtggcgaggccgagcgggtcgaa 384
           ||||||||  |||||||||||||||||||||
Sbjct: 678 cggggtcgtcggcgaggccgagcgggtcgaa 648



to top

>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 1027

 Score =  111 bits (56), Expect = 2e-21
 Identities = 116/136 (85%)
 Strand = Plus / Minus

                                                                       
Query: 205 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 264
           ||||||| ||| |||||||  || |||| || | |||||||||| ||| |||| ||||||
Sbjct: 793 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 734

                                                                       
Query: 265 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 324
           ||||  |||||||| ||||||||| | ||||||||||||||| || || |||||||||| 
Sbjct: 733 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccgttcttgag 674

                           
Query: 325 ctccttcaccttgagc 340
           ||||||||||||||||
Sbjct: 673 ctccttcaccttgagc 658



to top

>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds
          Length = 1044

 Score =  107 bits (54), Expect = 4e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||||| ||| |||| ||||||||||  |||||| | ||||||||| | |||||||
Sbjct: 791 aggttctcgagggggcccttgccggtgacgatggcctgcacgaagaagccgaacatggag 732

                                                     
Query: 299 aacatggccagccgtccgttcttgatctccttcaccttgagc 340
           |||||||| || || |||||||||||||||||||||||||||
Sbjct: 731 aacatggcgaggcggccgttcttgatctccttcaccttgagc 690



to top

>gb|AY112240.1| Zea mays CL187_6 mRNA sequence
          Length = 770

 Score =  107 bits (54), Expect = 4e-20
 Identities = 159/194 (81%)
 Strand = Plus / Minus

                                                                       
Query: 205 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 264
           ||||||| ||| |||||||  || |||| || | |||||||||| ||| |||| ||||||
Sbjct: 437 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 378

                                                                       
Query: 265 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 324
           ||||  |||||| | ||||||||| | ||||||||||||||| || || |||||||||| 
Sbjct: 377 gacgatggcctgcacgaagaagccgaacatggagaacatggcaaggcggccgttcttgag 318

                                                                       
Query: 325 ctccttcaccttgagcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaa 384
           ||||||||||||||||   || ||   ||| ||||||  ||||||||| |||||||||||
Sbjct: 317 ctccttcaccttgagctcggcggcggtgtccgggtcgtcggcgaggcccagcgggtcgaa 258

                         
Query: 385 cgggccgcctgggt 398
            | |||||| ||||
Sbjct: 257 ggcgccgccggggt 244



to top

>ref|NM_191799.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score =  103 bits (52), Expect = 6e-19
 Identities = 139/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 217 ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctg 276
           |||||||  ||||||| ||  ||||||||| |  ||||||| ||||||||||  ||||||
Sbjct: 747 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 688

                                                                       
Query: 277 gatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 336
           || |||||| || | ||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 687 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 628

                                                           
Query: 337 gagcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaa 384
           ||||   ||   |   |||||||||  |||||||||||||||||||||
Sbjct: 627 gagctcggcgaacgcctcggggtcgtcggcgaggccgagcgggtcgaa 580



to top

>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase
             IV-1 gene, complete cds
          Length = 15000

 Score =  103 bits (52), Expect = 6e-19
 Identities = 139/168 (82%)
 Strand = Plus / Plus

                                                                         
Query: 217   ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctg 276
             |||||||  ||||||| ||  ||||||||| |  ||||||| ||||||||||  ||||||
Sbjct: 13927 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 13986

                                                                         
Query: 277   gatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 336
             || |||||| || | ||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 13987 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 14046

                                                             
Query: 337   gagcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaa 384
             ||||   ||   |   |||||||||  |||||||||||||||||||||
Sbjct: 14047 gagctcggcgaacgcctcggggtcgtcggcgaggccgagcgggtcgaa 14094



to top

>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds
          Length = 695

 Score =  103 bits (52), Expect = 6e-19
 Identities = 85/96 (88%)
 Strand = Plus / Minus

                                                                       
Query: 241 gttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggagaa 300
           |||||||| ||| |||| |||||| |||  |||||||| |||||| || | |||||||||
Sbjct: 634 gttctcgaggggtcccttgccggtcacgatggcctggacgaagaatccgaacatggagaa 575

                                               
Query: 301 catggccagccgtccgttcttgatctccttcacctt 336
           ||| ||||||||||||||||||||||||||||||||
Sbjct: 574 catcgccagccgtccgttcttgatctccttcacctt 539



to top

>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0690B02
          Length = 153116

 Score =  103 bits (52), Expect = 6e-19
 Identities = 139/168 (82%)
 Strand = Plus / Minus

                                                                         
Query: 217   ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctg 276
             |||||||  ||||||| ||  ||||||||| |  ||||||| ||||||||||  ||||||
Sbjct: 21074 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 21015

                                                                         
Query: 277   gatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 336
             || |||||| || | ||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 21014 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 20955

                                                             
Query: 337   gagcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaa 384
             ||||   ||   |   |||||||||  |||||||||||||||||||||
Sbjct: 20954 gagctcggcgaacgcctcggggtcgtcggcgaggccgagcgggtcgaa 20907



to top

>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor
          Length = 2780

 Score =  103 bits (52), Expect = 6e-19
 Identities = 106/124 (85%)
 Strand = Plus / Minus

                                                                        
Query: 217  ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctg 276
            ||||||| |||||||| ||   |||||||||| ||| |||| ||||||||||   |||||
Sbjct: 2670 ggggtcggtgaggtggtcggcgaggttctcgatggggcccttgccggtgacgatagcctg 2611

                                                                        
Query: 277  gatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 336
             | ||||||||| | ||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 2610 cacgaagaagccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 2551

                
Query: 337  gagc 340
            ||||
Sbjct: 2550 gagc 2547



to top

>emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chlorophyll a/b-binding
           protein
          Length = 1126

 Score =  103 bits (52), Expect = 6e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 205 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 264
           ||||||| ||| |||||||  || |||| || | |||||||||| ||| |||| ||||||
Sbjct: 789 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 730

                                                                       
Query: 265 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 324
           ||||  |||||| | ||||||||| | ||||||||||||||| || || |||||||||| 
Sbjct: 729 gacgatggcctgcacgaagaagccgaacatggagaacatggcaaggcggccgttcttgag 670

                           
Query: 325 ctccttcaccttgagc 340
           ||||||||||||||||
Sbjct: 669 ctccttcaccttgagc 654



to top

>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full
           insert sequence
          Length = 1055

 Score =  103 bits (52), Expect = 6e-19
 Identities = 139/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 217 ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctg 276
           |||||||  ||||||| ||  ||||||||| |  ||||||| ||||||||||  ||||||
Sbjct: 828 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 769

                                                                       
Query: 277 gatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 336
           || |||||| || | ||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 768 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 709

                                                           
Query: 337 gagcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaa 384
           ||||   ||   |   |||||||||  |||||||||||||||||||||
Sbjct: 708 gagctcggcgaacgcctcggggtcgtcggcgaggccgagcgggtcgaa 661



to top

>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full
           insert sequence
          Length = 1055

 Score =  103 bits (52), Expect = 6e-19
 Identities = 139/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 217 ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctg 276
           |||||||  ||||||| ||  ||||||||| |  ||||||| ||||||||||  ||||||
Sbjct: 828 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 769

                                                                       
Query: 277 gatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 336
           || |||||| || | ||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 768 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 709

                                                           
Query: 337 gagcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaa 384
           ||||   ||   |   |||||||||  |||||||||||||||||||||
Sbjct: 708 gagctcggcgaacgcctcggggtcgtcggcgaggccgagcgggtcgaa 661



to top

>dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023001G03, full
           insert sequence
          Length = 1107

 Score =  103 bits (52), Expect = 6e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 205 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 264
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 821 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 762

                                                                       
Query: 265 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 324
           ||||  || ||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 761 gacgatggtctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 702

                           
Query: 325 ctccttcaccttgagc 340
           |||||| |||||||||
Sbjct: 701 ctccttgaccttgagc 686



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 354 cggggtcggtggcgaggccgagcgggtcgaa 384
           ||||||||  |||||||||||||||||||||
Sbjct: 672 cggggtcgtcggcgaggccgagcgggtcgaa 642



to top

>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full
           insert sequence
          Length = 1057

 Score =  103 bits (52), Expect = 6e-19
 Identities = 106/124 (85%)
 Strand = Plus / Minus

                                                                       
Query: 217 ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctg 276
           |||||||  ||||||| ||  ||||||||| |  ||||||| ||||||||||  ||||||
Sbjct: 830 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 771

                                                                       
Query: 277 gatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 336
           || |||||| || | ||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 770 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 711

               
Query: 337 gagc 340
           ||||
Sbjct: 710 gagc 707



to top

>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full
           insert sequence
          Length = 1040

 Score =  103 bits (52), Expect = 6e-19
 Identities = 106/124 (85%)
 Strand = Plus / Minus

                                                                       
Query: 217 ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctg 276
           |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||||||  ||||||
Sbjct: 813 ggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggtgacgatggcctg 754

                                                                       
Query: 277 gatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 336
           || ||||||||| | ||||||||||||||| || || || |||||||||||||| |||||
Sbjct: 753 gacgaagaagccgaacatggagaacatggcgaggcggccattcttgatctccttgacctt 694

               
Query: 337 gagc 340
           ||||
Sbjct: 693 gagc 690



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 354 cggggtcggtggcgaggccgagcgggtcgaa 384
           ||||||||  |||||||||||||||||||||
Sbjct: 676 cggggtcgtcggcgaggccgagcgggtcgaa 646



to top

>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full
           insert sequence
          Length = 1057

 Score =  103 bits (52), Expect = 6e-19
 Identities = 139/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 217 ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctg 276
           |||||||  ||||||| ||  ||||||||| |  ||||||| ||||||||||  ||||||
Sbjct: 830 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 771

                                                                       
Query: 277 gatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 336
           || |||||| || | ||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 770 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 711

                                                           
Query: 337 gagcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaa 384
           ||||   ||   |   |||||||||  |||||||||||||||||||||
Sbjct: 710 gagctcggcgaacgcctcggggtcgtcggcgaggccgagcgggtcgaa 663



to top

>gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m7 (Lhcbm7) mRNA, complete cds
          Length = 1016

 Score =  101 bits (51), Expect = 2e-18
 Identities = 87/99 (87%)
 Strand = Plus / Minus

                                                                       
Query: 238 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatgga 297
           |||||||| || ||| |||| |||||| |||  |||||||| ||||||||| | ||||||
Sbjct: 719 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 660

                                                  
Query: 298 gaacatggccagccgtccgttcttgatctccttcacctt 336
           |||||||||||| || |||||||||||||||||||||||
Sbjct: 659 gaacatggccaggcggccgttcttgatctccttcacctt 621



to top

>gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m10 (Lhcbm10) mRNA, complete cds
          Length = 1077

 Score =  101 bits (51), Expect = 2e-18
 Identities = 87/99 (87%)
 Strand = Plus / Minus

                                                                       
Query: 238 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatgga 297
           |||||||| || ||| |||| |||||| |||  |||||||| ||||||||| | ||||||
Sbjct: 720 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 661

                                                  
Query: 298 gaacatggccagccgtccgttcttgatctccttcacctt 336
           |||||||||||| || |||||||||||||||||||||||
Sbjct: 660 gaacatggccaggcggccgttcttgatctccttcacctt 622



to top

>gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvesting chlorophyll-a/b
           binding protein (LhcII-1.3) mRNA, complete cds; nuclear
           gene for chloroplast product
          Length = 1100

 Score =  101 bits (51), Expect = 2e-18
 Identities = 87/99 (87%)
 Strand = Plus / Minus

                                                                       
Query: 238 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatgga 297
           |||||||| || ||| |||| |||||| |||  |||||||| ||||||||| | ||||||
Sbjct: 714 caggttctggacggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 655

                                                  
Query: 298 gaacatggccagccgtccgttcttgatctccttcacctt 336
           |||||||||||| || |||||||||||||||||||||||
Sbjct: 654 gaacatggccaggcggccgttcttgatctccttcacctt 616



to top

>dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-1.3, complete cds
          Length = 1107

 Score =  101 bits (51), Expect = 2e-18
 Identities = 87/99 (87%)
 Strand = Plus / Minus

                                                                       
Query: 238 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatgga 297
           |||||||| || ||| |||| |||||| |||  |||||||| ||||||||| | ||||||
Sbjct: 748 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 689

                                                  
Query: 298 gaacatggccagccgtccgttcttgatctccttcacctt 336
           |||||||||||| || |||||||||||||||||||||||
Sbjct: 688 gaacatggccaggcggccgttcttgatctccttcacctt 650



to top

>dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
            binding protein LhcII-1.3, complete cds
          Length = 1835

 Score =  101 bits (51), Expect = 2e-18
 Identities = 87/99 (87%)
 Strand = Plus / Minus

                                                                        
Query: 238  caggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatgga 297
            |||||||| || ||| |||| |||||| |||  |||||||| ||||||||| | ||||||
Sbjct: 1590 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 1531

                                                   
Query: 298  gaacatggccagccgtccgttcttgatctccttcacctt 336
            |||||||||||| || |||||||||||||||||||||||
Sbjct: 1530 gaacatggccaggcggccgttcttgatctccttcacctt 1492



to top

>dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-E02, full
           insert sequence
          Length = 650

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||||| ||| |||| ||||||||||  |||||||| |||| |||| | | |||||
Sbjct: 313 aggttctcgagggggcccttgccggtgacgatggcctggacgaagcagccgaacctggag 254

                                                     
Query: 299 aacatggccagccgtccgttcttgatctccttcaccttgagc 340
           |||||||| || || |||||||||||||||||||||||||||
Sbjct: 253 aacatggcgaggcggccgttcttgatctccttcaccttgagc 212



to top

>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b-
           binding protein ( LHCP )
          Length = 1030

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 84/96 (87%)
 Strand = Plus / Minus

                                                                       
Query: 241 gttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggagaa 300
           |||||||| ||||||||  |||||||||  |||||| | |||||| || | |||||||||
Sbjct: 900 gttctcgaggggccccttcccggtgacgatggcctgcacgaagaatccgaacatggagaa 841

                                               
Query: 301 catggccagccgtccgttcttgatctccttcacctt 336
           ||||||||| |||||||||||||||||||| |||||
Sbjct: 840 catggccaggcgtccgttcttgatctccttgacctt 805



to top

>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds
          Length = 1633

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 84/96 (87%)
 Strand = Plus / Minus

                                                                        
Query: 241  gttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggagaa 300
            |||||||| ||| ||||  |||||||||  |||||| | |||||| || | |||||||||
Sbjct: 1120 gttctcgagggggcccttcccggtgacgatggcctgcacgaagaacccgaacatggagaa 1061

                                                
Query: 301  catggccagccgtccgttcttgatctccttcacctt 336
            ||||||||| ||||||||||||||||||||||||||
Sbjct: 1060 catggccaggcgtccgttcttgatctccttcacctt 1025



to top

>ref|NM_117102.3| Arabidopsis thaliana LHCB5 (LIGHT HARVESTING COMPLEX OF PHOTOSYSTEM
           II 5); chlorophyll binding AT4G10340 (LHCB5) mRNA,
           complete cds
          Length = 1208

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 95/111 (85%)
 Strand = Plus / Minus

                                                                       
Query: 392 cctgggtggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcct 451
           |||||||| |||||||| ||||| |||| |||||||||||| |||||||||||||| || 
Sbjct: 792 cctgggtgtagcttgtcctcgaaatccaatccgttggtgattctgtagtactcggctcca 733

                                                              
Query: 452 ccgacgaggacgacctcggcgacgacggcgaggatcaggttgatagggatg 502
           |||| ||| || ||||| || || |||||||| |  |||||||||||||||
Sbjct: 732 ccgaggagaacaacctcagcaactacggcgagaacaaggttgatagggatg 682



to top

>gb|AF104631.3| Chlamydomonas reinhardtii light harvesting complex II protein
           precursor (Lhcb3) mRNA, complete cds
          Length = 1314

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 74/83 (89%)
 Strand = Plus / Minus

                                                                       
Query: 254 ccctcgccggtgacgtaggcctggatgaagaagcccagcatggagaacatggccagccgt 313
           |||| |||||| |||  |||||||| ||||||||| | |||||||||||||||||| || 
Sbjct: 758 cccttgccggtcacgatggcctggacgaagaagccgaacatggagaacatggccaggcgg 699

                                  
Query: 314 ccgttcttgatctccttcacctt 336
           |||||||||||||||||||||||
Sbjct: 698 ccgttcttgatctccttcacctt 676



to top

>gb|AF339718.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein
           (At4g10340) mRNA, complete cds
          Length = 893

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 95/111 (85%)
 Strand = Plus / Minus

                                                                       
Query: 392 cctgggtggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcct 451
           |||||||| |||||||| ||||| |||| |||||||||||| |||||||||||||| || 
Sbjct: 608 cctgggtgtagcttgtcctcgaaatccaatccgttggtgattctgtagtactcggctcca 549

                                                              
Query: 452 ccgacgaggacgacctcggcgacgacggcgaggatcaggttgatagggatg 502
           |||| ||| || ||||| || || |||||||| |  |||||||||||||||
Sbjct: 548 ccgaggagaacaacctcagcaactacggcgagaacaaggttgatagggatg 498



to top

>gb|AF326900.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein
           (At4g10340) mRNA, complete cds
          Length = 998

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 95/111 (85%)
 Strand = Plus / Minus

                                                                       
Query: 392 cctgggtggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcct 451
           |||||||| |||||||| ||||| |||| |||||||||||| |||||||||||||| || 
Sbjct: 660 cctgggtgtagcttgtcctcgaaatccaatccgttggtgattctgtagtactcggctcca 601

                                                              
Query: 452 ccgacgaggacgacctcggcgacgacggcgaggatcaggttgatagggatg 502
           |||| ||| || ||||| || || |||||||| |  |||||||||||||||
Sbjct: 600 ccgaggagaacaacctcagcaactacggcgagaacaaggttgatagggatg 550



to top

>gb|AY070466.1| Arabidopsis thaliana AT4g10340/F24G24_140 mRNA, complete cds
          Length = 1950

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 95/111 (85%)
 Strand = Plus / Plus

                                                                       
Query: 392 cctgggtggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcct 451
           |||||||| |||||||| ||||| |||| |||||||||||| |||||||||||||| || 
Sbjct: 45  cctgggtgtagcttgtcctcgaaatccaatccgttggtgattctgtagtactcggctcca 104

                                                              
Query: 452 ccgacgaggacgacctcggcgacgacggcgaggatcaggttgatagggatg 502
           |||| ||| || ||||| || || |||||||| |  |||||||||||||||
Sbjct: 105 ccgaggagaacaacctcagcaactacggcgagaacaaggttgatagggatg 155



to top

>gb|AF424597.1|AF424597 Arabidopsis thaliana AT4g10340/F24G24_140 mRNA, complete cds
          Length = 1027

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 95/111 (85%)
 Strand = Plus / Minus

                                                                       
Query: 392 cctgggtggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcct 451
           |||||||| |||||||| ||||| |||| |||||||||||| |||||||||||||| || 
Sbjct: 660 cctgggtgtagcttgtcctcgaaatccaatccgttggtgattctgtagtactcggctcca 601

                                                              
Query: 452 ccgacgaggacgacctcggcgacgacggcgaggatcaggttgatagggatg 502
           |||| ||| || ||||| || || |||||||| |  |||||||||||||||
Sbjct: 600 ccgaggagaacaacctcagcaactacggcgagaacaaggttgatagggatg 550



to top

>gb|AY054126.1| Arabidopsis thaliana AT4g10340/F24G24_140 mRNA, complete cds
          Length = 843

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 95/111 (85%)
 Strand = Plus / Minus

                                                                       
Query: 392 cctgggtggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcct 451
           |||||||| |||||||| ||||| |||| |||||||||||| |||||||||||||| || 
Sbjct: 608 cctgggtgtagcttgtcctcgaaatccaatccgttggtgattctgtagtactcggctcca 549

                                                              
Query: 452 ccgacgaggacgacctcggcgacgacggcgaggatcaggttgatagggatg 502
           |||| ||| || ||||| || || |||||||| |  |||||||||||||||
Sbjct: 548 ccgaggagaacaacctcagcaactacggcgagaacaaggttgatagggatg 498



to top

>gb|AF380631.1|AF380631 Arabidopsis thaliana AT4g10340/F24G24_140 mRNA, complete cds
          Length = 982

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 95/111 (85%)
 Strand = Plus / Minus

                                                                       
Query: 392 cctgggtggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcct 451
           |||||||| |||||||| ||||| |||| |||||||||||| |||||||||||||| || 
Sbjct: 660 cctgggtgtagcttgtcctcgaaatccaatccgttggtgattctgtagtactcggctcca 601

                                                              
Query: 452 ccgacgaggacgacctcggcgacgacggcgaggatcaggttgatagggatg 502
           |||| ||| || ||||| || || |||||||| |  |||||||||||||||
Sbjct: 600 ccgaggagaacaacctcagcaactacggcgagaacaaggttgatagggatg 550



to top

>emb|BX829238.1|CNS0A4DW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL83ZF07 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 996

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 95/111 (85%)
 Strand = Plus / Minus

                                                                       
Query: 392 cctgggtggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcct 451
           |||||||| |||||||| ||||| |||| |||||||||||| |||||||||||||| || 
Sbjct: 641 cctgggtgtagcttgtcctcgaaatccaatccgttggtgattctgtagtactcggctcca 582

                                                              
Query: 452 ccgacgaggacgacctcggcgacgacggcgaggatcaggttgatagggatg 502
           |||| ||| || ||||| || || |||||||| |  |||||||||||||||
Sbjct: 581 ccgaggagaacaacctcagcaactacggcgagaacaaggttgatagggatg 531



to top

>emb|BX826540.1|CNS0A4GD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB37ZC03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 989

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 95/111 (85%)
 Strand = Plus / Minus

                                                                       
Query: 392 cctgggtggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcct 451
           |||||||| |||||||| ||||| |||| |||||||||||| |||||||||||||| || 
Sbjct: 640 cctgggtgtagcttgtcctcgaaatccaatccgttggtgattctgtagtactcggctcca 581

                                                              
Query: 452 ccgacgaggacgacctcggcgacgacggcgaggatcaggttgatagggatg 502
           |||| ||| || ||||| || || |||||||| |  |||||||||||||||
Sbjct: 580 ccgaggagaacaacctcagcaactacggcgagaacaaggttgatagggatg 530



to top

>emb|BX826592.1|CNS0A355 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB45ZA02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 972

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 95/111 (85%)
 Strand = Plus / Minus

                                                                       
Query: 392 cctgggtggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcct 451
           |||||||| |||||||| ||||| |||| |||||||||||| |||||||||||||| || 
Sbjct: 647 cctgggtgtagcttgtcctcgaaatccaatccgttggtgattctgtagtactcggctcca 588

                                                              
Query: 452 ccgacgaggacgacctcggcgacgacggcgaggatcaggttgatagggatg 502
           |||| ||| || ||||| || || |||||||| |  |||||||||||||||
Sbjct: 587 ccgaggagaacaacctcagcaactacggcgagaacaaggttgatagggatg 537



to top

>gb|AF330793.1|AF330793 Chlamydomonas reinhardtii light-harvesting complex II protein
           precursor (cabII-2) mRNA, complete cds
          Length = 1068

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                       
Query: 238 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatgga 297
           |||||||| || ||| |||| |||||| |||  |||||||| ||||||||| | ||||||
Sbjct: 702 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 643

                                                  
Query: 298 gaacatggccagccgtccgttcttgatctccttcacctt 336
           |||||| ||||| || |||||||||||||||||||||||
Sbjct: 642 gaacatagccaggcggccgttcttgatctccttcacctt 604



to top

>gb|AF134129.1| Arabidopsis thaliana Lhcb5 protein (Lhcb5) mRNA, complete cds
          Length = 1029

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 95/111 (85%)
 Strand = Plus / Minus

                                                                       
Query: 392 cctgggtggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcct 451
           |||||||| |||||||| ||||| |||| |||||||||||| |||||||||||||| || 
Sbjct: 655 cctgggtgtagcttgtcctcgaaatccaatccgttggtgattctgtagtactcggctcca 596

                                                              
Query: 452 ccgacgaggacgacctcggcgacgacggcgaggatcaggttgatagggatg 502
           |||| ||| || ||||| || || |||||||| |  |||||||||||||||
Sbjct: 595 ccgaggagaacaacctcagcaactacggcgagaacaaggttgatagggatg 545



to top

>dbj|AB051209.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-3, complete cds
          Length = 1256

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                       
Query: 238 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatgga 297
           |||||||| || ||| |||| |||||| |||  |||||||| ||||||||| | ||||||
Sbjct: 718 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 659

                                                  
Query: 298 gaacatggccagccgtccgttcttgatctccttcacctt 336
           |||||| ||||| || |||||||||||||||||||||||
Sbjct: 658 gaacatagccaggcggccgttcttgatctccttcacctt 620



to top

>dbj|AB051205.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
            binding protein LhcII-3, complete cds
          Length = 1508

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                        
Query: 238  caggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatgga 297
            |||||||| || ||| |||| |||||| |||  |||||||| ||||||||| | ||||||
Sbjct: 1399 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 1340

                                                   
Query: 298  gaacatggccagccgtccgttcttgatctccttcacctt 336
            |||||| ||||| || |||||||||||||||||||||||
Sbjct: 1339 gaacatagccaggcggccgttcttgatctccttcacctt 1301



to top

>gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting complex II protein
           (Lhcb) mRNA, complete cds; nuclear gene for chloroplast
           product
          Length = 1024

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 94/110 (85%)
 Strand = Plus / Minus

                                                                       
Query: 227 aggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaag 286
           |||||| || |||||||||  | ||| |||| |||||| |||  |||||| | |||||||
Sbjct: 733 aggtggtcggacaggttctgcagggggcccttgccggtcacgatggcctgaacgaagaag 674

                                                             
Query: 287 cccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 336
           || | |||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 673 ccgaacatggagaacatggccaggcggccgttcttgatctccttcacctt 624



to top

>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein
          Length = 2100

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                        
Query: 239  aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
            ||||||||||  || |||| ||||||||||  |||||||| ||||||||| | |||||| 
Sbjct: 1607 aggttctcgagcgggcccttgccggtgacgatggcctggacgaagaagccgaacatggaa 1548

                                                      
Query: 299  aacatggccagccgtccgttcttgatctccttcaccttgagc 340
            |||||||| || || |||||||||| ||||||||||||||||
Sbjct: 1547 aacatggcgaggcggccgttcttgagctccttcaccttgagc 1506



to top

>gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds
          Length = 1100

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 85/98 (86%)
 Strand = Plus / Minus

                                                                       
Query: 241 gttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggagaa 300
           |||||||| ||| |||| ||||||||||  |||||||| |||||| |||| |||||||||
Sbjct: 764 gttctcgatggggcccttgccggtgacgatggcctggacgaagaaacccaacatggagaa 705

                                                 
Query: 301 catggccagccgtccgttcttgatctccttcaccttga 338
           |||||| || || ||||| |||| ||||||||||||||
Sbjct: 704 catggcgaggcggccgttattgaactccttcaccttga 667



to top

>dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-4, complete cds
          Length = 988

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 94/110 (85%)
 Strand = Plus / Minus

                                                                       
Query: 227 aggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaag 286
           |||||| || |||||||||  | ||| |||| |||||| |||  |||||| | |||||||
Sbjct: 717 aggtggtcggacaggttctgcagggggcccttgccggtcacgatggcctgaacgaagaag 658

                                                             
Query: 287 cccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 336
           || | |||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 657 ccgaacatggagaacatggccaggcggccgttcttgatctccttcacctt 608



to top

>gb|AF495473.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
            m1 gene, complete cds; nuclear gene for chloroplast
            product
          Length = 1934

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 87/101 (86%)
 Strand = Plus / Minus

                                                                        
Query: 236  cacaggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatg 295
            ||||||||||  | ||| |||| |||||| |||  |||||| | ||||||||| | ||||
Sbjct: 1432 cacaggttctgcagggggcccttgccggtcacgatggcctgaacgaagaagccgaacatg 1373

                                                     
Query: 296  gagaacatggccagccgtccgttcttgatctccttcacctt 336
            |||||||||||||| || |||||||||||||||||||||||
Sbjct: 1372 gagaacatggccaggcggccgttcttgatctccttcacctt 1332



to top

>dbj|AB051206.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
            binding protein LhcII-4, complete cds
          Length = 1781

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 87/101 (86%)
 Strand = Plus / Minus

                                                                        
Query: 236  cacaggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatg 295
            ||||||||||  | ||| |||| |||||| |||  |||||| | ||||||||| | ||||
Sbjct: 1345 cacaggttctgcagggggcccttgccggtcacgatggcctgaacgaagaagccgaacatg 1286

                                                     
Query: 296  gagaacatggccagccgtccgttcttgatctccttcacctt 336
            |||||||||||||| || |||||||||||||||||||||||
Sbjct: 1285 gagaacatggccaggcggccgttcttgatctccttcacctt 1245



to top

>dbj|AB050007.2| Chlamydomonas reinhardtii lhcb5 mRNA for CP26, complete cds
          Length = 952

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                       
Query: 249 agggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggagaacatggcca 308
           |||| ||||||||||| ||||||| ||||| |  ||||||||||| ||||| ||||||||
Sbjct: 827 aggggccctcgccggtcacgtaggactggacggcgaagcccagcacggagaccatggcca 768

                                       
Query: 309 gccgtccgttcttgatctccttcacctt 336
           | || ||||||||||||||||| |||||
Sbjct: 767 ggcggccgttcttgatctccttgacctt 740



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 193 gacggtgagcaggttgttgccgaaggggtcg 223
           |||||| |||||||||| |||||||||||||
Sbjct: 883 gacggtcagcaggttgtagccgaaggggtcg 853



to top

>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding
           protein
          Length = 869

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 86/100 (86%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           ||||||||||  || |||| ||||||||||  |||||||| |||||| || | |||||||
Sbjct: 737 aggttctcgagcgggcccttgccggtgacgatggcctggacgaagaacccgaacatggag 678

                                                   
Query: 299 aacatggccagccgtccgttcttgatctccttcaccttga 338
           |||||||| || || |||||||||| ||||||||||||||
Sbjct: 677 aacatggcgaggcggccgttcttgagctccttcaccttga 638



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 364 ggcgaggccgagcgggtcgaacgggccgcctgggtggagc 403
           ||||||||||||||||||||||| |||||| |||| ||||
Sbjct: 612 ggcgaggccgagcgggtcgaacgtgccgccggggtagagc 573



to top

>gb|AY087939.1| Arabidopsis thaliana clone 39765 mRNA, complete sequence
          Length = 1036

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 94/111 (84%)
 Strand = Plus / Minus

                                                                       
Query: 392 cctgggtggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcct 451
           |||||||| |||||||| ||||| |||| |||||||||||| |||||||||||||  || 
Sbjct: 702 cctgggtgtagcttgtcctcgaaatccaatccgttggtgattctgtagtactcggatcca 643

                                                              
Query: 452 ccgacgaggacgacctcggcgacgacggcgaggatcaggttgatagggatg 502
           |||| ||| || ||||| || || |||||||| |  |||||||||||||||
Sbjct: 642 ccgaggagaacaacctcagcaactacggcgagaacaaggttgatagggatg 592



to top

>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding
           protein, complete cds
          Length = 1055

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 51/54 (94%)
 Strand = Plus / Minus

                                                                 
Query: 280 gaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcac 333
           ||||||||| | ||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 785 gaagaagccgaacatggagaacatggccaaccgtccgttcttgatctccttcac 732



to top

>emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chlorophyll a/b-binding protein
          Length = 1083

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 51/54 (94%)
 Strand = Plus / Minus

                                                                 
Query: 280 gaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcac 333
           ||||||||| | ||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 778 gaagaagccgaacatggagaacatggccaaccgtccgttcttgatctccttcac 725



to top

>gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast chlorophyll a/b binding
           protein mRNA, complete cds
          Length = 997

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 84/98 (85%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||||| ||| || | ||||||||||  |||||||| |||||| || | |||||||
Sbjct: 798 aggttctcgatggggcctttgccggtgacgatggcctggacgaagaaaccgaacatggag 739

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||||||||| || |||||||||| |||||| |||||
Sbjct: 738 aacatggccaggcggccgttcttgagctccttaacctt 701



to top

>gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb2) mRNA, partial cds
          Length = 873

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                    
Query: 280 gaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 336
           ||||||||| | ||||||||||||||||||||| |||||||| ||||||||||||||
Sbjct: 627 gaagaagccgaacatggagaacatggccagccgcccgttctttatctccttcacctt 571



to top

>gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b-binding protein
           mRNA, partial cds
          Length = 575

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 82/96 (85%)
 Strand = Plus / Minus

                                                                       
Query: 241 gttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggagaa 300
           |||||| || ||||||| |||||| |||   ||||||| ||||||||| | |||||| ||
Sbjct: 397 gttctccaatggccccttgccggtcacgatcgcctggacgaagaagccgaacatggataa 338

                                               
Query: 301 catggccagccgtccgttcttgatctccttcacctt 336
           |||||||||||  || ||||||||||||||||||||
Sbjct: 337 catggccagcctgccattcttgatctccttcacctt 302



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 353 tcggggtcggtggcgaggccgagcgggtcgaa 384
           |||||||||  ||||||||| |||||||||||
Sbjct: 285 tcggggtcgtcggcgaggccaagcgggtcgaa 254



to top

>gb|AY617092.1| Pinus monophylla chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||||| ||| ||||  |||||||||  |||||| | |||||| || | |||||| 
Sbjct: 745 aggttctcgatgggtcccttcccggtgacgatggcctgkacgaagaatccgaacatggaa 686

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||||||||  || |||||||||||||||||||||||
Sbjct: 685 aacatggccaagcgcccgttcttgatctccttcacctt 648



to top

>gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvesting complex II protein
           precursor (Lhcb2) mRNA, complete cds
          Length = 1200

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 87/100 (87%), Gaps = 2/100 (2%)
 Strand = Plus / Minus

                                                                       
Query: 238 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatgga 297
           |||||||| || ||| |||| |||||| |||  |||||||| ||||||||| | ||||||
Sbjct: 726 caggttctggacggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 667

                                                   
Query: 298 gaacatggcc-agccgtccgttcttgatctccttcacctt 336
           |||||||||| || || |||||||||||||||||||||||
Sbjct: 666 gaacatggccaaggcg-ccgttcttgatctccttcacctt 628



to top

>gb|AY646197.1| Chlorella pyrenoidosa chloroplast light-harvesting complex II (Lhc
           II) mRNA, partial cds; nuclear gene for chloroplast
           product
          Length = 537

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                       
Query: 254 ccctcgccggtgacgtaggcctggatgaagaagcccagcatggagaacatggccagccgt 313
           |||| |||||| |||  |||||| | ||||||||| | ||||  |||||||||||| || 
Sbjct: 476 ccctggccggtcacgatggcctgcacgaagaagccgaacatgctgaacatggccagacga 417

                                      
Query: 314 ccgttcttgatctccttcaccttgagc 340
           |||||||||||||||||||||||||||
Sbjct: 416 ccgttcttgatctccttcaccttgagc 390



to top

>gb|AF495472.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m6 mRNA, complete cds; nuclear gene for chloroplast
           product
          Length = 1094

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 84/99 (84%)
 Strand = Plus / Minus

                                                                       
Query: 238 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatgga 297
           |||||||| || ||| |||| |||||| |||  |||||||| ||||||||| | ||||||
Sbjct: 729 caggttctggacggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 670

                                                  
Query: 298 gaacatggccagccgtccgttcttgatctccttcacctt 336
           ||||   ||||| || |||||||||||||||||||||||
Sbjct: 669 gaacgatgccaggcggccgttcttgatctccttcacctt 631



to top

>gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 986

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                       
Query: 254 ccctcgccggtgacgtaggcctggatgaagaagcccagcatggagaacatggccagccgt 313
           |||| ||||||||||  |||||||| |||||| || | |||||||||||| || |||| |
Sbjct: 761 cccttgccggtgacgatggcctggacgaagaatccgaacatggagaacatagctagcctt 702

                                      
Query: 314 ccgttcttgatctccttcaccttgagc 340
           || ||||||| ||||||||||||||||
Sbjct: 701 ccattcttgagctccttcaccttgagc 675



to top

>gb|M24072.1|CRECABA C.reinhardtii encoding chlorophyll a/b-binding protein (cabII-1)
            gene, complete cds
          Length = 2290

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 84/99 (84%)
 Strand = Plus / Minus

                                                                        
Query: 238  caggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatgga 297
            |||||||| || ||| |||| |||||| |||  |||||||| ||||||||| | ||||||
Sbjct: 1750 caggttctggacggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 1691

                                                   
Query: 298  gaacatggccagccgtccgttcttgatctccttcacctt 336
            ||||   ||||| || |||||||||||||||||||||||
Sbjct: 1690 gaacgatgccaggcggccgttcttgatctccttcacctt 1652



to top

>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding
            protein
          Length = 2261

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 86/102 (84%)
 Strand = Plus / Minus

                                                                        
Query: 239  aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
            ||||||||||  || ||||  |||||||||  |||||||| |||||| || | |||||||
Sbjct: 1737 aggttctcgagcgggcccttcccggtgacgatggcctggacgaagaatccgaacatggag 1678

                                                      
Query: 299  aacatggccagccgtccgttcttgatctccttcaccttgagc 340
            |||||||| || || || ||||||| ||||||||||||||||
Sbjct: 1677 aacatggcgaggcggcccttcttgagctccttcaccttgagc 1636



to top

>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein
          Length = 1197

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||||| ||| || |  |||||||||  |||||| | |||||| || | |||||| 
Sbjct: 815 aggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaa 756

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           |||||||||| ||| |||||||||||||||||||||||
Sbjct: 755 aacatggccaaccgcccgttcttgatctccttcacctt 718



to top

>gb|DQ018376.1| Pinus krempfii chloroplast putative light harvesting chlorophyll
           a/b binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 752

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||||| ||| |||| ||||||||||  |||||| | |||||| || | |||||| 
Sbjct: 742 aggttctcgatgggtcccttgccggtgacgatggcctgcacgaagaatccgaacatggaa 683

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||||||||  || |||||||||| ||||||||||||
Sbjct: 682 aacatggccaagcgcccgttcttgagctccttcacctt 645



to top

>gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||||| ||| ||||  |||||||||  |||||| | |||||| || | |||||| 
Sbjct: 745 aggttctcgatgggtccctttccggtgacgatggcctgaacgaagaatccgaacatggaa 686

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||||||||  || |||||||||||||||||||||||
Sbjct: 685 aacatggccaagcgcccgttcttgatctccttcacctt 648



to top

>gb|AY617093.1| Pinus remota chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||||| ||| ||||  |||||||||  |||||| | |||||| || | |||||| 
Sbjct: 745 aggttctcgatgggtcccttcccggtgacgatggcctgaacgaagaatccgaacatggaa 686

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||||||||  || |||||||||||||||||||||||
Sbjct: 685 aacatggccaagcgcccgttcttgatctccttcacctt 648



to top

>gb|AY617084.1| Pinus contorta chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||||| ||| || |  |||||||||  |||||| | |||||| || | |||||| 
Sbjct: 745 aggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaa 686

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           |||||||||| ||| |||||||||||||||||||||||
Sbjct: 685 aacatggccaaccgcccgttcttgatctccttcacctt 648



to top

>gb|AY617083.1| Pinus radiata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||||| ||| || |  |||||||||  |||||| | |||||| || | |||||| 
Sbjct: 745 aggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaa 686

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           |||||||||| ||| |||||||||||||||||||||||
Sbjct: 685 aacatggccaaccgcccgttcttgatctccttcacctt 648



to top

>gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||||| ||| || |  |||||||||  |||||| | |||||| || | |||||| 
Sbjct: 745 aggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaa 686

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           |||||||||| ||| |||||||||||||||||||||||
Sbjct: 685 aacatggccaaccgcccgttcttgatctccttcacctt 648



to top

>gb|AY617081.1| Pinus echinata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 762

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||||| ||| || |  |||||||||  |||||| | |||||| || | |||||| 
Sbjct: 745 aggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaa 686

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           |||||||||| ||| |||||||||||||||||||||||
Sbjct: 685 aacatggccaaccgcccgttcttgatctccttcacctt 648



to top

>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein
          Length = 2574

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 239  aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
            |||||||||| ||| || |  |||||||||  |||||| | |||||| || | |||||| 
Sbjct: 1893 aggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaa 1834

                                                  
Query: 299  aacatggccagccgtccgttcttgatctccttcacctt 336
            |||||||||| ||| |||||||||||||||||||||||
Sbjct: 1833 aacatggccaaccgcccgttcttgatctccttcacctt 1796



to top

>gb|AY109324.1| Zea mays CL187_1 mRNA sequence
          Length = 2262

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 86/102 (84%)
 Strand = Plus / Minus

                                                                        
Query: 239  aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
            ||||||||||  || ||||  |||||||||  |||||||| |||||| || | |||||||
Sbjct: 1737 aggttctcgagcgggcccttcccggtgacgatggcctggacgaagaatccgaacatggag 1678

                                                      
Query: 299  aacatggccagccgtccgttcttgatctccttcaccttgagc 340
            |||||||| || || || ||||||| ||||||||||||||||
Sbjct: 1677 aacatggcgaggcggcccttcttgagctccttcaccttgagc 1636



to top

>gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb1) mRNA, partial cds
          Length = 414

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||||| ||| || |  |||||||||  |||||| | |||||| || | |||||| 
Sbjct: 216 aggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaa 157

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           |||||||||| ||| |||||||||||||||||||||||
Sbjct: 156 aacatggccaaccgcccgttcttgatctccttcacctt 119



to top

>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA,
           complete cds
          Length = 1022

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 251 ggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggagaacatggccagc 310
           ||||||| ||||||||||  ||||||||  || || || | |||||| |||||||| || 
Sbjct: 755 ggccccttgccggtgacgatggcctggacaaaaaacccgaacatggataacatggcgagg 696

                                         
Query: 311 cgtccgttcttgatctccttcaccttgagc 340
           || |||||||||||||||||||||||||||
Sbjct: 695 cggccgttcttgatctccttcaccttgagc 666



to top

>emb|X61915.1|PTCABP P.thunbergii cab gene
          Length = 5419

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 43/45 (95%)
 Strand = Plus / Minus

                                                         
Query: 292  catggagaacatggccagccgtccgttcttgatctccttcacctt 336
            ||||||||||||||||||||| |||||||| ||||||||||||||
Sbjct: 2943 catggagaacatggccagccgaccgttcttaatctccttcacctt 2899



to top

>gb|M37489.1|PINCABII2 Pinus sylvestris chlorophyll a/b-binding protein (Cab) mRNA,
           partial cds
          Length = 583

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 43/45 (95%)
 Strand = Plus / Minus

                                                        
Query: 292 catggagaacatggccagccgtccgttcttgatctccttcacctt 336
           ||||||||||||||||||||| |||||||| ||||||||||||||
Sbjct: 329 catggagaacatggccagccgaccgttcttaatctccttcacctt 285



to top

>gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 1096

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 52/57 (91%)
 Strand = Plus / Minus

                                                                    
Query: 280 gaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 336
           ||||||||| | ||||||||||||||||||||| |||||||| | ||||||||||||
Sbjct: 760 gaagaagccgaacatggagaacatggccagccgcccgttctttagctccttcacctt 704



to top

>gb|AF139465.2|AF139465 Vigna radiata LHCII type III chlorophyll a/b binding protein
           (CipLhcb3) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 1047

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                            
Query: 292 catggagaacatggccagccgtccgttcttgatctccttcaccttgagc 340
           |||||||||||||||||||| ||| ||||||||||||||||| ||||||
Sbjct: 745 catggagaacatggccagccttccattcttgatctccttcactttgagc 697



to top

>emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putative chlorophyll A-B binding
           protein type I
          Length = 684

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 52/57 (91%)
 Strand = Plus / Minus

                                                                    
Query: 280 gaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 336
           ||||||||| | |||||||||||| |||||||| |||||||| ||||||||||||||
Sbjct: 476 gaagaagccgaacatggagaacatcgccagccgcccgttcttaatctccttcacctt 420



to top

>gb|AY786530.1| Haematococcus pluvialis chloroplast major light-harvesting complex
           II protein m9 mRNA, partial cds; nuclear gene for
           chloroplast product
          Length = 577

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 86/100 (86%), Gaps = 2/100 (2%)
 Strand = Plus / Minus

                                                                       
Query: 238 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagccca-gcatgg 296
           |||||||| || ||| |||| |||||| |||  |||||||| ||||||||| | ||||| 
Sbjct: 391 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaagcatg- 333

                                                   
Query: 297 agaacatggccagccgtccgttcttgatctccttcacctt 336
           |||||||||||| ||| ||||||||||||||||| |||||
Sbjct: 332 agaacatggccaaccgcccgttcttgatctccttgacctt 293



to top

>gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||||| ||| ||||  |||||||||  |||||| | |||||| || | |||||| 
Sbjct: 745 aggttctcgatgggtccctttccggtgacgatggcctgcacgaagaatccgaacatggaa 686

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||||||||  || |||||||||| ||||||||||||
Sbjct: 685 aacatggccaagcgyccgttcttgagctccttcacctt 648



to top

>emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b binding protein
          Length = 1011

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 89/104 (85%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                       
Query: 238 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagccca-gcatgg 296
           |||||||| || ||| |||| |||||| |||  |||||| | ||||||||| | ||| ||
Sbjct: 731 caggttctggatggggcccttgccggtcacgatggcctgcacgaagaagccgaagca-gg 673

                                                       
Query: 297 agaacatggccagccgtccgttcttgatctccttcaccttgagc 340
           |||||||||| || || |||||||||||||||||||||||||||
Sbjct: 672 agaacatggcaaggcggccgttcttgatctccttcaccttgagc 629



to top

>gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b binding protein (LHCPII) gene,
            complete cds
          Length = 2095

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 84/100 (84%)
 Strand = Plus / Minus

                                                                        
Query: 241  gttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggagaa 300
            |||||| | ||| |||| |||||||||   |||||| | |||||| || | |||||||||
Sbjct: 1671 gttctcaacggggcccttgccggtgacaatggcctgcacgaagaacccaaacatggagaa 1612

                                                    
Query: 301  catggccagccgtccgttcttgatctccttcaccttgagc 340
            ||| || || || |||||||||||||||||||||||||||
Sbjct: 1611 catagcgagacgcccgttcttgatctccttcaccttgagc 1572



to top

>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor
           (Wcab) mRNA, complete cds
          Length = 918

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                       
Query: 281 aagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttgagc 340
           |||||||| | ||| ||||||||||| || || |||||||||||||||||||||||||||
Sbjct: 695 aagaagccaaacattgagaacatggcaaggcgaccgttcttgatctccttcaccttgagc 636



to top

>gb|U51634.1|PPU51634 Pinus palustris type 2 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb2) mRNA, partial cds
          Length = 252

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 292 catggagaacatggccagccgtccgttcttgatctccttcacc 334
           ||||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 43  catggagaacatggccagccgaccgttcttaatctccttcacc 1



to top

>emb|AL161517.2|ATCHRIV29 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 29
          Length = 199861

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 70/82 (85%)
 Strand = Plus / Minus

                                                                         
Query: 421   tccgttggtgatcctgtagtactcggcgcctccgacgaggacgacctcggcgacgacggc 480
             |||||||||||| |||||||||||||| || |||| ||| || ||||| || || |||||
Sbjct: 41384 tccgttggtgattctgtagtactcggctccaccgaggagaacaacctcagcaactacggc 41325

                                   
Query: 481   gaggatcaggttgatagggatg 502
             ||| |  |||||||||||||||
Sbjct: 41324 gagaacaaggttgatagggatg 41303



to top

>emb|AL049488.1|ATF24G24 Arabidopsis thaliana DNA chromosome 4, BAC clone  F24G24 (ESSA project)
          Length = 99856

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 70/82 (85%)
 Strand = Plus / Minus

                                                                         
Query: 421   tccgttggtgatcctgtagtactcggcgcctccgacgaggacgacctcggcgacgacggc 480
             |||||||||||| |||||||||||||| || |||| ||| || ||||| || || |||||
Sbjct: 54716 tccgttggtgattctgtagtactcggctccaccgaggagaacaacctcagcaactacggc 54657

                                   
Query: 481   gaggatcaggttgatagggatg 502
             ||| |  |||||||||||||||
Sbjct: 54656 gagaacaaggttgatagggatg 54635



to top

>emb|AJ843976.1| Plantago major partial mRNA for light harvesting protein 1 (lhc1
           gene)
          Length = 688

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 85/102 (83%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||| || || ||||  |||||||||   ||||||| |||||| || | |||||||
Sbjct: 617 aggttctccaacgggccctttccggtgacgatagcctggacgaagaatccgaacatggag 558

                                                     
Query: 299 aacatggccagccgtccgttcttgatctccttcaccttgagc 340
           |||||||| ||||  |||||||||| |||||| |||||||||
Sbjct: 557 aacatggcaagcctgccgttcttgagctccttaaccttgagc 516



to top

>gb|DQ018375.1| Pinus gerardiana chloroplast putative light harvesting chlorophyll
           a/b binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 760

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||||| ||| ||||  ||||||||   |||||| | |||||| || | |||||| 
Sbjct: 745 aggttctcgatgggtccctttccggtgacaatggcctgcacgaagaatccgaacatggaa 686

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||||||||  || |||||||||||||||||||||||
Sbjct: 685 aacatggccaagcgcccgttcttgatctccttcacctt 648



to top

>gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 759

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||||| ||| ||||  ||||||||   |||||| | |||||| || | |||||| 
Sbjct: 734 aggttctcgatgggtcccttcccggtgacaatggcctgaacgaagaatccgaacatggaa 675

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||||||||  || |||||||||||||||||||||||
Sbjct: 674 aacatggccaagcgcccgttcttgatctccttcacctt 637



to top

>gb|AY617091.1| Pinus strobus chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||||| ||| ||||  |||||||||  |||||| | |||||| || | |||||| 
Sbjct: 745 aggttctcgatgggtccctttccggtgacgatggcctgcacgaagaatccgaacatggaa 686

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||||||||  || |||||||||| ||||||||||||
Sbjct: 685 aacatggccaagcgcccgttcttgagctccttcacctt 648



to top

>gb|AY617090.1| Pinus monticola chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||||| ||| ||||  |||||||||  |||||| | |||||| || | |||||| 
Sbjct: 745 aggttctcgatgggtccctttccggtgacgatggcctgcacgaagaatccgaacatggaa 686

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||||||||  || |||||||||| ||||||||||||
Sbjct: 685 aacatggccaagcgcccgttcttgagctccttcacctt 648



to top

>gb|AY617089.1| Pinus lambertiana chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||||| ||| ||||  |||||||||  |||||| | |||||| || | |||||| 
Sbjct: 745 aggttctcgatgggtccctttccggtgacgatggcctgcacgaagaatccgaacatggaa 686

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||||||||  || |||||||||| ||||||||||||
Sbjct: 685 aacatggccaagcgcccgttcttgagctccttcacctt 648



to top

>gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 271 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 330
           |||||| | |||||| || | |||||| |||||||||| ||| |||||||||||||||||
Sbjct: 713 ggcctgcacgaagaatccgaacatggaaaacatggccaaccgcccgttcttgatctcctt 654

                 
Query: 331 cacctt 336
           ||||||
Sbjct: 653 cacctt 648



to top

>gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 271 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 330
           |||||| | |||||| || | |||||| |||||||||| ||| |||||||||||||||||
Sbjct: 713 ggcctgcacgaagaatccgaacatggaaaacatggccaaccgcccgttcttgatctcctt 654

                 
Query: 331 cacctt 336
           ||||||
Sbjct: 653 cacctt 648



to top

>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA,
           complete cds
          Length = 998

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 271 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 330
           |||||| | |||||| || | |||||| |||||||||| ||| |||||||||||||||||
Sbjct: 759 ggcctgcacgaagaatccgaacatggaaaacatggccaaccgcccgttcttgatctcctt 700

                 
Query: 331 cacctt 336
           ||||||
Sbjct: 699 cacctt 694



to top

>emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chlorophyll a/b binding
           protein of photosystem II
          Length = 772

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           ||||| |||| ||| |||| |||||| |||   ||||| | ||||||||| | |||||||
Sbjct: 634 aggttttcgatggggcccttgccggtcacgattgcctgcacgaagaagccgaacatggag 575

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||| |||||||| |||||||| | ||||||||||||
Sbjct: 574 aacatcgccagccgcccgttctttagctccttcacctt 537



to top

>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1078

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 271 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 330
           |||||||| |||||| || | ||||||||||||||||| ||| |||||||| | ||||||
Sbjct: 733 ggcctggacgaagaacccgaacatggagaacatggccaaccgcccgttctttagctcctt 674

                 
Query: 331 cacctt 336
           ||||||
Sbjct: 673 cacctt 668



to top

>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein
          Length = 1006

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 271 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 330
           |||||| | |||||| || | |||||| |||||||||| ||| |||||||||||||||||
Sbjct: 768 ggcctgcacgaagaatccgaacatggaaaacatggccaaccgcccgttcttgatctcctt 709

                 
Query: 331 cacctt 336
           ||||||
Sbjct: 708 cacctt 703



to top

>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b
           binding protein (cab gene)
          Length = 760

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 85/102 (83%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||| || || |||| |||||||||   |||||| |  |||||||| | |||||||
Sbjct: 723 aggttctccaatgggcccttgccggtgacaatggcctgcacaaagaagccaaacatggag 664

                                                     
Query: 299 aacatggccagccgtccgttcttgatctccttcaccttgagc 340
           |||||||| || || || |||||||||||||| |||||||||
Sbjct: 663 aacatggcgaggcggccattcttgatctccttaaccttgagc 622



to top

>gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein of PS II mRNA, partial
           cds
          Length = 551

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 271 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 330
           |||||||| |||||| || | ||||||||||||||||| ||| |||||||| | ||||||
Sbjct: 291 ggcctggacgaagaacccgaacatggagaacatggccaaccgcccgttctttagctcctt 232

                 
Query: 331 cacctt 336
           ||||||
Sbjct: 231 cacctt 226



to top

>dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-binding protein
           precursor, complete cds
          Length = 964

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 271 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 330
           |||||||| |||||| || | ||| |||||||||||||  || |||||||||||||||||
Sbjct: 741 ggcctggacgaagaacccgaacattgagaacatggccaatcggccgttcttgatctcctt 682

                 
Query: 331 cacctt 336
           ||||||
Sbjct: 681 cacctt 676



to top

>emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab binding protein
          Length = 1746

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                        
Query: 272  gcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttc 331
            ||||||| |||||| || | |||||||||||| ||||| || ||||||||||||||||| 
Sbjct: 1235 gcctggacgaagaacccaaacatggagaacattgccaggcggccgttcttgatctcctta 1176

                 
Query: 332  acctt 336
            |||||
Sbjct: 1175 acctt 1171



to top

>gb|AY267624.1| Bigelowiella natans chlorophyll a/b-binding protein II 2 mRNA,
           complete cds; nuclear gene for plastid product
          Length = 1147

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttc 331
           ||||| ||| ||||||| |||||||||||||| || || || ||||||||||||||||| 
Sbjct: 936 gcctgaatgtagaagccgagcatggagaacatagcaagacggccgttcttgatctccttg 877

                
Query: 332 acctt 336
           |||||
Sbjct: 876 acctt 872



to top

>gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m9 (Lhcbm9) mRNA, complete cds
          Length = 1221

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 296 gagaacatggccagccgtccgttcttgatctccttcacctt 336
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 663 gagaacatggccaggcggccgttcttgatctccttcacctt 623



to top

>emb|X13407.1|PTCAB Pinus thunbergii cab mRNA for light-harvesting chlorophyll a/b
           binding protein
          Length = 978

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 292 catggagaacatggccagccgtccgttcttgatctccttcacctt 336
           ||||||||||||||||||||| |||||||| ||||| ||||||||
Sbjct: 724 catggagaacatggccagccgaccgttcttaatctctttcacctt 680



to top

>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein
          Length = 934

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 296 gagaacatggccagccgtccgttcttgatctccttcaccttgagc 340
           ||||||||||| || || |||||||||||||||||||||||||||
Sbjct: 689 gagaacatggcaaggcggccgttcttgatctccttcaccttgagc 645



to top

>emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1050

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 260 ccggtgacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttc 319
           |||||||||  |||||||| |||||| || | ||| || |||||||||| ||| ||||||
Sbjct: 758 ccggtgacgatggcctggacgaagaatccgaacatagaaaacatggccaaccgcccgttc 699

                            
Query: 320 ttgatctccttcacctt 336
           |||| ||||||||||||
Sbjct: 698 ttgagctccttcacctt 682



to top

>emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1062

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 260 ccggtgacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttc 319
           |||||||||  |||||||| |||||| || | ||| || |||||||||| ||| ||||||
Sbjct: 755 ccggtgacgatggcctggacgaagaatccgaacatagaaaacatggccaaccgcccgttc 696

                            
Query: 320 ttgatctccttcacctt 336
           |||| ||||||||||||
Sbjct: 695 ttgagctccttcacctt 679



to top

>gb|AY554168.1| Nicotiana tabacum chloroplast chlorophyll a-b binding protein mRNA,
           partial cds; nuclear gene for chloroplast product
          Length = 600

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 292 catggagaacatggccagccgtccgttcttgatctccttcaccttgagc 340
           |||||||||||| ||||  | ||||||||||||||||||||||||||||
Sbjct: 474 catggagaacatagccaatcttccgttcttgatctccttcaccttgagc 426



to top

>emb|X95727.1|BJMCAB1GE B.juncea mRNA for chlorophyll a/b-binding protein
          Length = 1033

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 377 gggtcgaacgggccgcctgggtggagcttgtcatcgaattccagtccgttggtgatcctg 436
           |||||||| ||||| |||||||| |||||||| ||||| ||||  ||||||||||| | |
Sbjct: 641 gggtcgaatgggcctcctgggtgaagcttgtcttcgaagtccaagccgttggtgattcgg 582

                   
Query: 437 tagtactc 444
           ||||||||
Sbjct: 581 tagtactc 574



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 275 tggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacc 334
           |||||||||||  | | |||||| ||||||||||  |  |||||||||||||| || |||
Sbjct: 743 tggatgaagaaagcaaacatggaaaacatggccaatctcccgttcttgatctctttaacc 684

                
Query: 335 ttgag 339
           |||||
Sbjct: 683 ttgag 679



to top

>emb|X06602.1|EGLHCPAB Euglena gracilis mRNA for light harvesting chlorophyll a/b protein
          Length = 681

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 80/96 (83%)
 Strand = Plus / Minus

                                                                       
Query: 241 gttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggagaa 300
           |||||| | ||| ||||||||||| |||  ||||||   | ||||||||||||||     
Sbjct: 296 gttctccacggggccctcgccggtcacgatggcctgtgcgtagaagcccagcatgccact 237

                                               
Query: 301 catggccagccgtccgttcttgatctccttcacctt 336
           |||||||||||| |||||||||||||||||||||||
Sbjct: 236 catggccagccggccgttcttgatctccttcacctt 201



to top

>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds
          Length = 1191

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 281 aagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttgagc 340
           |||||||| | ||||||||||||||| || || || |||||||||||||| |||||||||
Sbjct: 886 aagaagccaaacatggagaacatggcgaggcggccattcttgatctccttaaccttgagc 827



to top

>emb|X61361.1|EGLHCAB E.gracilis gene for light harvesting chlorophyll a/b binding protein
            of photosystem II
          Length = 7650

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 282  agaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttgagc 340
            |||||||||||||||  | ||||||||| || |||||||| | ||||||||||||||||
Sbjct: 4919 agaagcccagcatggccaccatggccaggcggccgttcttcagctccttcaccttgagc 4861



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 282  agaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttgagc 340
            |||||||||||||||  | ||||||||| || |||||||| | ||||||||||||||||
Sbjct: 1476 agaagcccagcatggccaccatggccaggcggccgttcttcagctccttcaccttgagc 1418



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                
Query: 301  catggccagccgtccgttcttgatctccttcacctt 336
            |||||||||||| |||||||||| ||||||||||||
Sbjct: 7000 catggccagccggccgttcttgacctccttcacctt 6965



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 301 catggccagccgtccgttcttgatctccttcacctt 336
           |||||||||||| |||||||||| ||||||||||||
Sbjct: 216 catggccagccggccgttcttgacctccttcacctt 181



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                
Query: 286  gcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttg 337
            |||||||||||  | ||||||||| || |||||||| | |||||||||||||
Sbjct: 3759 gcccagcatggccagcatggccaggcggccgttcttcacctccttcaccttg 3708



to top

>gb|AF398746.1|AF398746 Carlquistia muirii ASCAB9 (ASCAB9) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1100

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 266 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 325
           ||||| ||||||||||| ||  | | ||||||||||||||| ||||  || |||||||||
Sbjct: 986 acgtacgcctggatgaaaaacgcgaacatggagaacatggctagcctgccattcttgatc 927

                      
Query: 326 tccttcacctt 336
           |||||||||||
Sbjct: 926 tccttcacctt 916



to top

>gb|AF398740.1|AF398740 Wilkesia gymnoxiphium ASCAB9-B (ASCAB9-B) gene, exons 4, 5 and 6
           and partial cds
          Length = 1103

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 266 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 325
           ||||| ||||||||||| ||  | | ||||||||||||||| ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcgaacatggagaacatggctagcctgccattcttgatc 930

                      
Query: 326 tccttcacctt 336
           |||||||||||
Sbjct: 929 tccttcacctt 919



to top

>emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB precursor protein
          Length = 928

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 226 gaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaa 285
           ||||||| || |||||||||| || || |||| ||||||||||   || || | ||||||
Sbjct: 777 gaggtggtcgaacaggttctccaatgggcccttgccggtgacgatagcttgcacgaagaa 718

                                                              
Query: 286 gcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 336
            || | ||| ||||||||||| || || || ||||||||||||||||||||
Sbjct: 717 cccgaacatagagaacatggcaagacggccattcttgatctccttcacctt 667



to top

>gb|L29644.1|EGRLHCPII Euglena gracilis chlorophyll a/b binding protein (LHCPII) gene exons
            1-5, 5' end
          Length = 3122

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 282  agaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttgagc 340
            |||||||||||||||  | ||||||||| || |||||||| | ||||||||||||||||
Sbjct: 2928 agaagcccagcatggccaccatggccagacggccgttcttcacctccttcaccttgagc 2870



to top

>gb|AY617096.1| Picea sitchensis chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 763

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 260 ccggtgacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttc 319
           |||||||||  |||||||  |||||| || | ||| || |||||||||| ||| ||||||
Sbjct: 724 ccggtgacgatggcctggncgaagaatccgaacatagaaaacatggccaaccgcccgttc 665

                            
Query: 320 ttgatctccttcacctt 336
           |||| ||||||||||||
Sbjct: 664 ttgagctccttcacctt 648



to top

>gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 81/98 (82%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||||| ||| ||||  |||||||||   ||||| | |||||| || | |||||| 
Sbjct: 745 aggttctcgatgggtccctttccggtgacgattgcctgcacgaagaatccgaacatggaa 686

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||||||||  || |||||||||| ||||||||||||
Sbjct: 685 aacatggccaagcgcccgttcttgagctccttcacctt 648



to top

>dbj|AP006706.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT09I23, TM0590a,
             complete sequence
          Length = 16141

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                       
Query: 292   catggagaacatggccagccgtccgttcttgatctccttcac 333
             ||||||||||||||||| || ||| |||||||||||||||||
Sbjct: 11294 catggagaacatggccaaccttccattcttgatctccttcac 11335



to top

>gb|M60049.1|DUNCAB D.tertiolecta 28.5-kDa LHCII apoprotein mRNA, complete cds
          Length = 1041

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 271 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 330
           |||||| | ||||||||||||    |||||||||||||| || |||||||||||||||||
Sbjct: 702 ggcctgcacgaagaagcccaggcaagagaacatggccaggcggccgttcttgatctcctt 643

                 
Query: 331 cacctt 336
            |||||
Sbjct: 642 gacctt 637



to top

>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 980

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 296 gagaacatggccagccgtccgttcttgatctccttcacctt 336
           |||||||| |||| || ||||||||||||||||||||||||
Sbjct: 713 gagaacatagccaaccttccgttcttgatctccttcacctt 673



to top

>emb|AJ538464.1|NTA538464 Nicotiana tabacum cDNA-AFLP-fragment BC2-M14-017
          Length = 330

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 292 catggagaacatggccagccgtccgttcttgatctccttcaccttgagc 340
           ||||||||||||||| || |  ||||||||||||||||| |||||||||
Sbjct: 251 catggagaacatggcaagtctgccgttcttgatctcctttaccttgagc 203



to top

>dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene for light-harvesting
            chlorophyll a/b-binding protein 2, complete cds
          Length = 3125

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 296  gagaacatggccagccgtccgttcttgatctccttcacctt 336
            |||||||||||||  || |||||||||||||||||||||||
Sbjct: 2894 gagaacatggccaatcgcccgttcttgatctccttcacctt 2854



to top

>emb|AJ234428.1|HVU234428 Hordeum vulgare partial mRNA; clone cMWG0701.rev
          Length = 326

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 292 catggagaacatggccagccgtccgttcttgatctccttcaccttgagc 340
           |||||| ||||| || || || |||||||||||||||||||||||||||
Sbjct: 72  catggaaaacattgcaagacgaccgttcttgatctccttcaccttgagc 120



to top

>emb|Z16408.1|PSLHCB51 P.sylvestris Lhcb5*1 mRNA encoding Lhcb5 protein
          Length = 1193

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 280 gaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 336
           ||||||||| ||||| ||||||||||||| || ||| || || ||||||||||||||
Sbjct: 834 gaagaagccgagcattgagaacatggccaaccttccatttttaatctccttcacctt 778



to top

>emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding protein of photosystem II
          Length = 518

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 296 gagaacatggccagccgtccgttcttgatctccttcacctt 336
           |||||||| |||| || ||||||||||||||||||||||||
Sbjct: 245 gagaacatagccaaccttccgttcttgatctccttcacctt 205



to top

>gb|AY104614.1| Zea mays PCO084486 mRNA sequence
          Length = 1214

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 116/145 (80%)
 Strand = Plus / Minus

                                                                       
Query: 196 ggtgagcaggttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggccc 255
           |||||||| |||||||  || |||||||  ||||||| ||  |||||||| ||| || ||
Sbjct: 963 ggtgagcacgttgttgttgacggggtcggcgaggtggtcgagcaggttctggaacgggcc 904

                                                                       
Query: 256 ctcgccggtgacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtcc 315
             |||||||||||    ||||||||||| | || || |||| || |||||| ||||  ||
Sbjct: 903 gacgccggtgacgagcccctggatgaagtaaccgaggatggcgagcatggcgagcctgcc 844

                                    
Query: 316 gttcttgatctccttcaccttgagc 340
           ||||||||||||||| | |||||||
Sbjct: 843 gttcttgatctccttgagcttgagc 819



to top

>gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab-C) gene, complete cds
          Length = 1240

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                             
Query: 292  catggagaacatggccagccgtccgttcttgatctccttcaccttgagc 340
            ||||||||||||||| || |  ||||||||||||||||| |||||||||
Sbjct: 1114 catggagaacatggcaagtctgccgttcttgatctcctttaccttgagc 1066



to top

>dbj|AB122118.1| Chlamydomonas reinhardtii LhcI-5 gene for light-harvesting
            chlorophyll-a/b protein of photosystem I, complete cds
          Length = 1886

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 301  catggccagccgtccgttcttgatctccttcaccttgagc 340
            ||||||||| || ||||||||||||||||| |||||||||
Sbjct: 1442 catggccaggcggccgttcttgatctccttaaccttgagc 1403



to top

>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein
          Length = 1361

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 281 aagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 336
           |||||||| | ||| |||||||||||||  |||||||||||||  |||||||||||
Sbjct: 927 aagaagccaaacatagagaacatggccaatcgtccgttcttgagttccttcacctt 872



to top

>gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-3B gene, 3' end
          Length = 351

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                       
Query: 281 aagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttgagc 340
           |||||||| | |||||||||||| || || |  |||||||||||||||||||| ||||||
Sbjct: 236 aagaagccaaacatggagaacatagcaagtctgccgttcttgatctccttcactttgagc 177



to top

>gb|AY267623.1| Bigelowiella natans chlorophyll a/b-binding protein II 1 mRNA,
           complete cds; nuclear gene for plastid product
          Length = 1284

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 290 agcatggagaacatggccagccgtccgttcttgatctccttcacctt 336
           |||||||||||||| || || || ||||||||||||||||| |||||
Sbjct: 924 agcatggagaacatagcgagacggccgttcttgatctccttaacctt 878



to top

>gb|AF398747.1|AF398747 Anisocarpus scabridus ASCAB9 (ASCAB9) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1103

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 266 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 325
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 326 tccttcacctt 336
           |||||||||||
Sbjct: 929 tccttcacctt 919



to top

>gb|AF398745.1|AF398745 Osmadenia tenella ASCAB9 (ASCAB9) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1103

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 266 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 325
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 326 tccttcacctt 336
           |||||||||||
Sbjct: 929 tccttcacctt 919



to top

>gb|AF398744.1|AF398744 Madia nutans ASCAB9 (ASCAB9) gene, exons 4, 5 and 6 and partial cds
          Length = 1103

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 266 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 325
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 326 tccttcacctt 336
           |||||||||||
Sbjct: 929 tccttcacctt 919



to top

>gb|AF398743.1|AF398743 Deinandra lobbii ASCAB9 (ASCAB9) gene, exons 4, 5 and 6 and partial
           cds
          Length = 1103

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 266 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 325
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 326 tccttcacctt 336
           |||||||||||
Sbjct: 929 tccttcacctt 919



to top

>gb|AF398741.1|AF398741 Wilkesia gymnoxiphium ASCAB9-C (ASCAB9-C) gene, exons 4, 5 and 6
           and partial cds
          Length = 1083

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 266 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 325
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 969 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 910

                      
Query: 326 tccttcacctt 336
           |||||||||||
Sbjct: 909 tccttcacctt 899



to top

>gb|AF398739.1|AF398739 Dubautia scabra ASCAB9-C (ASCAB9-C) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1037

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 266 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 325
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 923 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 864

                      
Query: 326 tccttcacctt 336
           |||||||||||
Sbjct: 863 tccttcacctt 853



to top

>gb|AF398738.1|AF398738 Dubautia plantaginea ASCAB9-B (ASCAB9-B) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1102

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 266 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 325
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 988 acgtacgcctggatgaaaaacgcgaacatggagaacattgctagcctgccattcttgatc 929

                      
Query: 326 tccttcacctt 336
           |||||||||||
Sbjct: 928 tccttcacctt 918



to top

>gb|AF398737.1|AF398737 Dubautia laxa ASCAB9-C (ASCAB9-C) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1083

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 266 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 325
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 969 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 910

                      
Query: 326 tccttcacctt 336
           |||||||||||
Sbjct: 909 tccttcacctt 899



to top

>gb|AF398736.1|AF398736 Dubautia latifolia ASCAB9-C (ASCAB9-C) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1085

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 266 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 325
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 971 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 912

                      
Query: 326 tccttcacctt 336
           |||||||||||
Sbjct: 911 tccttcacctt 901



to top

>gb|AF398735.1|AF398735 Dubautia laevigata ASCAB9-B (ASCAB9-B) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1101

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 266 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 325
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 987 acgtacgcctggatgaaaaacgcgaacatggagaacattgctagcctgccattcttgatc 928

                      
Query: 326 tccttcacctt 336
           |||||||||||
Sbjct: 927 tccttcacctt 917



to top

>gb|AF398734.1|AF398734 Argyroxiphium sandwicense ASCAB9-C (ASCAB9-C) gene, exons 4, 5 and
           6 and partial cds
          Length = 1083

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 266 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 325
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 969 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 910

                      
Query: 326 tccttcacctt 336
           |||||||||||
Sbjct: 909 tccttcacctt 899



to top

>gb|AF398733.1|AF398733 Argyroxiphium sandwicense ASCAB9-B (ASCAB9-B) gene, exons 4, 5 and
           6 and partial cds
          Length = 1103

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 266 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 325
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcgaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 326 tccttcacctt 336
           |||||||||||
Sbjct: 929 tccttcacctt 919



to top

>gb|AF398732.1|AF398732 Argyroxiphium caliginis ASCAB9-B (ASCAB9-B) gene, exons 4, 5 and 6
           and partial cds
          Length = 1103

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 266 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 325
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcgaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 326 tccttcacctt 336
           |||||||||||
Sbjct: 929 tccttcacctt 919



to top

>gb|AF398731.1|AF398731 Wilkesia gymnoxiphium ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and 6
           and partial cds
          Length = 1103

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 266 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 325
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 326 tccttcacctt 336
           |||||||||||
Sbjct: 929 tccttcacctt 919



to top

>gb|AF398730.1|AF398730 Dubautia sherffiana ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1103

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 266 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 325
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 326 tccttcacctt 336
           |||||||||||
Sbjct: 929 tccttcacctt 919



to top

>gb|AF398729.1|AF398729 Dubautia raillardioides ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and 6
           and partial cds
          Length = 1103

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 266 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 325
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 326 tccttcacctt 336
           |||||||||||
Sbjct: 929 tccttcacctt 919



to top

>gb|AF398728.1|AF398728 Dubautia plantaginea ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1103

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 266 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 325
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 326 tccttcacctt 336
           |||||||||||
Sbjct: 929 tccttcacctt 919



to top

>gb|AF398726.1|AF398726 Dubautia latifolia ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1103

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 266 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 325
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 326 tccttcacctt 336
           |||||||||||
Sbjct: 929 tccttcacctt 919



to top

>gb|AF398725.1|AF398725 Dubautia laevigata ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1103

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 266 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 325
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 326 tccttcacctt 336
           |||||||||||
Sbjct: 929 tccttcacctt 919



to top

>gb|AF398723.1|AF398723 Argyroxiphium caliginis ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and 6
           and partial cds
          Length = 1103

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 266 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 325
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 326 tccttcacctt 336
           |||||||||||
Sbjct: 929 tccttcacctt 919



to top

>gb|AF268321.1|AF268321 Chlorarachnion CCMP621 light-harvesting complex protein LHCG12
           mRNA, complete cds
          Length = 1170

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 290 agcatggagaacatggccagccgtccgttcttgatctccttcacctt 336
           |||||||||||||| || || || ||||||||||||||||| |||||
Sbjct: 922 agcatggagaacatagcgagacggccgttcttgatctccttaacctt 876



to top

>gb|AF268320.1|AF268320 Chlorarachnion CCMP621 light-harvesting complex protein LHCG11
           mRNA, complete cds
          Length = 1128

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 290 agcatggagaacatggccagccgtccgttcttgatctccttcacctt 336
           |||||||||||||| || || || ||||||||||||||||| |||||
Sbjct: 879 agcatggagaacatagcgagacggccgttcttgatctccttaacctt 833



to top

>gb|AF268319.1|AF268319 Chlorarachnion CCMP621 light-harvesting complex protein LHCG4 mRNA,
           complete cds
          Length = 1191

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 290 agcatggagaacatggccagccgtccgttcttgatctccttcacctt 336
           |||||||||||||| || || || ||||||||||||||||| |||||
Sbjct: 919 agcatggagaacatagcgagacggccgttcttgatctccttaacctt 873



to top

>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein
           LHCP
          Length = 967

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 119/147 (80%), Gaps = 2/147 (1%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           ||||||||||  || ||||  |||||||||  |||||||| |||||| || | |||||| 
Sbjct: 789 aggttctcgagcgggcccttcccggtgacgatggcctggacgaagaatccgaacatggac 730

                                                                       
Query: 299 aacatggccagccgtccgttcttgatctccttcaccttgagcagcgccgcctgg-tcggg 357
           |||||||| || || || ||||||| |||||| |||||||||  |||||   |  |||||
Sbjct: 729 aacatggcgaggcggcccttcttgagctccttgaccttgagct-cgccgaaggcctcggg 671

                                      
Query: 358 gtcggtggcgaggccgagcgggtcgaa 384
           ||||  ||||||||| |||||||||||
Sbjct: 670 gtcgtcggcgaggcccagcgggtcgaa 644



to top

>gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB2) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1027

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 314 ccgttcttgatctccttcaccttgagc 340
           |||||||||||||||||||||||||||
Sbjct: 668 ccgttcttgatctccttcaccttgagc 642



to top

>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1)
           mRNA, complete cds
          Length = 1008

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                       
Query: 271 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 330
           |||||| | |||||| || | ||| |||||||| |||| || ||||||||||| ||||||
Sbjct: 758 ggcctgaacgaagaatccaaacatagagaacatagccaaccttccgttcttgagctcctt 699

                 
Query: 331 cacctt 336
           ||||||
Sbjct: 698 cacctt 693



to top

>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.3 mRNA, complete cds
          Length = 3299

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Plus

                                                                        
Query: 239  aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
            |||||||| || || ||||  |||||||||  ||| || | |||||| || | ||| |||
Sbjct: 2558 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 2617

                                                  
Query: 299  aacatggccagccgtccgttcttgatctccttcacctt 336
            ||||| |||| || ||||||||||| ||||||||||||
Sbjct: 2618 aacatagccaaccttccgttcttgagctccttcacctt 2655



to top

>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.2 mRNA, complete cds
          Length = 3338

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Plus

                                                                        
Query: 239  aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
            |||||||| || || ||||  |||||||||  ||| || | |||||| || | ||| |||
Sbjct: 2558 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 2617

                                                  
Query: 299  aacatggccagccgtccgttcttgatctccttcacctt 336
            ||||| |||| || ||||||||||| ||||||||||||
Sbjct: 2618 aacatagccaaccttccgttcttgagctccttcacctt 2655



to top

>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2)
           transcript variant AT2G34420.1 mRNA, complete cds
          Length = 1354

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||| || || ||||  |||||||||  ||| || | |||||| || | ||| |||
Sbjct: 780 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 721

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||| |||| || ||||||||||| ||||||||||||
Sbjct: 720 aacatagccaaccttccgttcttgagctccttcacctt 683



to top

>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant
           AT2G34420.2 mRNA, complete cds
          Length = 1312

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||| || || ||||  |||||||||  ||| || | |||||| || | ||| |||
Sbjct: 738 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 679

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||| |||| || ||||||||||| ||||||||||||
Sbjct: 678 aacatagccaaccttccgttcttgagctccttcacctt 641



to top

>gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           40 mRNA, complete cds
          Length = 859

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 42/46 (91%), Gaps = 1/46 (2%)
 Strand = Plus / Minus

                                                         
Query: 292 catggagaacatggcca-gccgtccgttcttgatctccttcacctt 336
           ||||||||||| ||||| |||  |||||||||||||||||||||||
Sbjct: 732 catggagaacagggccaagcctgccgttcttgatctccttcacctt 687



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 353 tcggggtcggtggcgaggccgagcgggtcgaa 384
           |||||||||  ||||||||| |||||||||||
Sbjct: 670 tcggggtcgtcggcgaggccaagcgggtcgaa 639



to top

>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 829

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||| || || ||||  |||||||||  ||| || | |||||| || | ||| |||
Sbjct: 725 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 666

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||| |||| || ||||||||||| ||||||||||||
Sbjct: 665 aacatagccaaccttccgttcttgagctccttcacctt 628



to top

>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 1015

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||| || || ||||  |||||||||  ||| || | |||||| || | ||| |||
Sbjct: 780 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 721

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||| |||| || ||||||||||| ||||||||||||
Sbjct: 720 aacatagccaaccttccgttcttgagctccttcacctt 683



to top

>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 851

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                       
Query: 271 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 330
           |||||| | |||||| || | ||| |||||||| |||| || ||||||||||| ||||||
Sbjct: 696 ggcctgaacgaagaatccaaacatagagaacatagccaaccttccgttcttgagctcctt 637

                 
Query: 331 cacctt 336
           ||||||
Sbjct: 636 cacctt 631



to top

>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 1019

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                       
Query: 271 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 330
           |||||| | |||||| || | ||| |||||||| |||| || ||||||||||| ||||||
Sbjct: 758 ggcctgaacgaagaatccaaacatagagaacatagccaaccttccgttcttgagctcctt 699

                 
Query: 331 cacctt 336
           ||||||
Sbjct: 698 cacctt 693



to top

>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 1003

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                       
Query: 271 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 330
           |||||| | |||||| || | ||| |||||||| |||| || ||||||||||| ||||||
Sbjct: 758 ggcctgaacgaagaatccaaacatagagaacatagccaaccttccgttcttgagctcctt 699

                 
Query: 331 cacctt 336
           ||||||
Sbjct: 698 cacctt 693



to top

>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete
             sequence
          Length = 112763

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                         
Query: 271   ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 330
             |||||| | |||||| || | ||| |||||||| |||| || ||||||||||| ||||||
Sbjct: 96000 ggcctgaacgaagaatccaaacatagagaacatagccaaccttccgttcttgagctcctt 95941

                   
Query: 331   cacctt 336
             ||||||
Sbjct: 95940 cacctt 95935



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Plus

                                                                         
Query: 239   aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
             |||||||| || || ||||  |||||||||  ||| || | |||||| || | ||| |||
Sbjct: 93276 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 93335

                                                   
Query: 299   aacatggccagccgtccgttcttgatctccttcacctt 336
             ||||| |||| || ||||||||||| ||||||||||||
Sbjct: 93336 aacatagccaaccttccgttcttgagctccttcacctt 93373



to top

>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete
             sequence
          Length = 93060

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                         
Query: 239   aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
             |||||||| || || ||||  |||||||||  ||| || | |||||| || | ||| |||
Sbjct: 80926 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 80867

                                                   
Query: 299   aacatggccagccgtccgttcttgatctccttcacctt 336
             ||||| |||| || ||||||||||| ||||||||||||
Sbjct: 80866 aacatagccaaccttccgttcttgagctccttcacctt 80829



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                         
Query: 271   ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 330
             |||||| | |||||| || | ||| |||||||| |||| || ||||||||||| ||||||
Sbjct: 78202 ggcctgaacgaagaatccaaacatagagaacatagccaaccttccgttcttgagctcctt 78261

                   
Query: 331   cacctt 336
             ||||||
Sbjct: 78262 cacctt 78267



to top

>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420) mRNA, complete cds
          Length = 883

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||| || || ||||  |||||||||  ||| || | |||||| || | ||| |||
Sbjct: 725 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 666

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||| |||| || ||||||||||| ||||||||||||
Sbjct: 665 aacatagccaaccttccgttcttgagctccttcacctt 628



to top

>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||| || || ||||  |||||||||  ||| || | |||||| || | ||| |||
Sbjct: 725 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 666

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||| |||| || ||||||||||| ||||||||||||
Sbjct: 665 aacatagccaaccttccgttcttgagctccttcacctt 628



to top

>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||| || || ||||  |||||||||  ||| || | |||||| || | ||| |||
Sbjct: 725 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 666

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||| |||| || ||||||||||| ||||||||||||
Sbjct: 665 aacatagccaaccttccgttcttgagctccttcacctt 628



to top

>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420; T31E10.24) mRNA, complete cds
          Length = 969

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||| || || ||||  |||||||||  ||| || | |||||| || | ||| |||
Sbjct: 776 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 717

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||| |||| || ||||||||||| ||||||||||||
Sbjct: 716 aacatagccaaccttccgttcttgagctccttcacctt 679



to top

>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||| || || ||||  |||||||||  ||| || | |||||| || | ||| |||
Sbjct: 776 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 717

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||| |||| || ||||||||||| ||||||||||||
Sbjct: 716 aacatagccaaccttccgttcttgagctccttcacctt 679



to top

>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||| || || ||||  |||||||||  ||| || | |||||| || | ||| |||
Sbjct: 776 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 717

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||| |||| || ||||||||||| ||||||||||||
Sbjct: 716 aacatagccaaccttccgttcttgagctccttcacctt 679



to top

>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 1024

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||| || || ||||  |||||||||  ||| || | |||||| || | ||| |||
Sbjct: 776 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 717

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||| |||| || ||||||||||| ||||||||||||
Sbjct: 716 aacatagccaaccttccgttcttgagctccttcacctt 679



to top

>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 995

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||| || || ||||  |||||||||  ||| || | |||||| || | ||| |||
Sbjct: 776 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 717

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||| |||| || ||||||||||| ||||||||||||
Sbjct: 716 aacatagccaaccttccgttcttgagctccttcacctt 679



to top

>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||| || || ||||  |||||||||  ||| || | |||||| || | ||| |||
Sbjct: 776 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 717

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||| |||| || ||||||||||| ||||||||||||
Sbjct: 716 aacatagccaaccttccgttcttgagctccttcacctt 679



to top

>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete
           cds
          Length = 1009

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                       
Query: 271 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 330
           |||||| | |||||| || | ||| |||||||| |||| || ||||||||||| ||||||
Sbjct: 764 ggcctgaacgaagaatccaaacatagagaacatagccaaccttccgttcttgagctcctt 705

                 
Query: 331 cacctt 336
           ||||||
Sbjct: 704 cacctt 699



to top

>emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS41ZH03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 638

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                       
Query: 271 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 330
           |||||| | |||||| || | ||| |||||||| |||| || ||||||||||| ||||||
Sbjct: 416 ggcctgaacgaagaatccaaacatagagaacatagccaaccttccgttcttgagctcctt 357

                 
Query: 331 cacctt 336
           ||||||
Sbjct: 356 cacctt 351



to top

>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 959

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||| || || ||||  |||||||||  ||| || | |||||| || | ||| |||
Sbjct: 767 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 708

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||| |||| || ||||||||||| ||||||||||||
Sbjct: 707 aacatagccaaccttccgttcttgagctccttcacctt 670



to top

>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS62ZC05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 903

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||| || || ||||  |||||||||  ||| || | |||||| || | ||| |||
Sbjct: 757 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 698

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||| |||| || ||||||||||| ||||||||||||
Sbjct: 697 aacatagccaaccttccgttcttgagctccttcacctt 660



to top

>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS5ZF09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 885

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||| || || ||||  |||||||||  ||| || | |||||| || | ||| |||
Sbjct: 760 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 701

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||| |||| || ||||||||||| ||||||||||||
Sbjct: 700 aacatagccaaccttccgttcttgagctccttcacctt 663



to top

>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 911

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||| || || ||||  |||||||||  ||| || | |||||| || | ||| |||
Sbjct: 760 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 701

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||| |||| || ||||||||||| ||||||||||||
Sbjct: 700 aacatagccaaccttccgttcttgagctccttcacctt 663



to top

>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB71ZG07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 919

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Plus

                                                                       
Query: 239 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
           |||||||| || || ||||  |||||||||  ||| || | |||||| || | ||| |||
Sbjct: 159 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 218

                                                 
Query: 299 aacatggccagccgtccgttcttgatctccttcacctt 336
           ||||| |||| || ||||||||||| ||||||||||||
Sbjct: 219 aacatagccaaccttccgttcttgagctccttcacctt 256



to top

>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence
          Length = 979

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                       
Query: 271 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 330
           |||||| | |||||| || | ||| |||||||| |||| || ||||||||||| ||||||
Sbjct: 758 ggcctgaacgaagaatccaaacatagagaacatagccaaccttccgttcttgagctcctt 699

                 
Query: 331 cacctt 336
           ||||||
Sbjct: 698 cacctt 693



to top

>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein
           (CipLhcb1) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 975

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                       
Query: 271 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 330
           |||||||| |||||| || | || |||||||||||||| ||  ||||||||||  |||||
Sbjct: 745 ggcctggacgaagaacccgaacacggagaacatggccaacctaccgttcttgagttcctt 686

                     
Query: 331 caccttgagc 340
            |||||||||
Sbjct: 685 gaccttgagc 676



to top

>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b
           binding protein
          Length = 1301

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                       
Query: 271 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 330
           |||||| | |||||| || | ||| |||||||| |||| || ||||||||||| ||||||
Sbjct: 996 ggcctgaacgaagaatccaaacatagagaacatagccaaccttccgttcttgagctcctt 937

                 
Query: 331 cacctt 336
           ||||||
Sbjct: 936 cacctt 931



to top

>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding
            protein
          Length = 1405

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                        
Query: 239  aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 298
            |||||||| || || ||||  |||||||||  ||| || | |||||| || | ||| |||
Sbjct: 1025 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 966

                                                  
Query: 299  aacatggccagccgtccgttcttgatctccttcacctt 336
            ||||| |||| || ||||||||||| ||||||||||||
Sbjct: 965  aacatagccaaccttccgttcttgagctccttcacctt 928



to top

>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 853

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                       
Query: 271 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 330
           |||||| | |||||| || | ||| |||||||| |||| || ||||||||||| ||||||
Sbjct: 696 ggcctgaacgaagaatccaaacatagagaacatagccaaccttccgttcttgagctcctt 637

                 
Query: 331 cacctt 336
           ||||||
Sbjct: 636 cacctt 631



to top

>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll
           A/B-binding protein gene, complete cds
          Length = 1260

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                       
Query: 271 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 330
           |||||| | |||||| || | ||| |||||||| |||| ||  |||||||||||||| ||
Sbjct: 887 ggcctgaacgaagaacccgaacattgagaacatagccaacctaccgttcttgatctcttt 828

                     
Query: 331 caccttgagc 340
           ||||||||||
Sbjct: 827 caccttgagc 818



to top

>ref|NM_126537.2| Arabidopsis thaliana LHCB2.2; chlorophyll binding AT2G05070
           (LHCB2.2) mRNA, complete cds
          Length = 1060

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 296 gagaacatggccagccgtccgttcttgatctccttcacctt 336
           ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 728 gagaacatggcaagacgaccgttcttgagctccttcacctt 688



to top

>ref|NM_001036246.1| Arabidopsis thaliana ATP binding / kinase/ protein kinase/ protein
            serine/threonine kinase/ protein-tyrosine kinase
            AT2G05060 transcript variant AT2G05060.2 mRNA, complete
            cds
          Length = 2130

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 296  gagaacatggccagccgtccgttcttgatctccttcacctt 336
            ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 1412 gagaacatggcaagacgaccgttcttgagctccttcacctt 1452



to top

>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           3C (LHCP) mRNA, partial cds
          Length = 661

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 296 gagaacatggccagccgtccgttcttgatctccttcacctt 336
           |||||||| |||||||  || ||||||||||||||||||||
Sbjct: 544 gagaacatagccagcctgccattcttgatctccttcacctt 504



to top

>gb|DQ226725.1| Boechera divaricarpa isolate SLW-A-F06 mRNA sequence
          Length = 452

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 292 catggagaacatggccagccgtccgttcttgatctccttcacctt 336
           ||||||||||||||| || || |||||||||| |||||| |||||
Sbjct: 270 catggagaacatggcaagacgaccgttcttgagctcctttacctt 226


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,027,776
Number of Sequences: 3902068
Number of extensions: 4027776
Number of successful extensions: 88702
Number of sequences better than 10.0: 559
Number of HSP's better than 10.0 without gapping: 566
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 84766
Number of HSP's gapped (non-prelim): 3926
length of query: 509
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 487
effective length of database: 17,147,199,772
effective search space: 8350686288964
effective search space used: 8350686288964
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top