| Clone Name | rbags20m13 |
|---|---|
| Clone Library Name | barley_pub |
>emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein Length = 1020 Score = 940 bits (474), Expect = 0.0 Identities = 474/474 (100%) Strand = Plus / Minus Query: 1 gttttacacaagcaaattgacagggtcgatcgtcacaggtttcacagcaccacaaactga 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1010 gttttacacaagcaaattgacagggtcgatcgtcacaggtttcacagcaccacaaactga 951 Query: 61 tggaccgatcgaccctgggaatgggatggattcattcattcaaagcaaacttaaacgact 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 950 tggaccgatcgaccctgggaatgggatggattcattcattcaaagcaaacttaaacgact 891 Query: 121 catgactggaagcaaggggagacgcgatcgaccacacggacggacgggcgggcggggggc 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 890 catgactggaagcaaggggagacgcgatcgaccacacggacggacgggcgggcggggggc 831 Query: 181 aggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaag 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 830 aggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaag 771 Query: 241 agcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacc 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 770 agcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacc 711 Query: 301 cactggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatg 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 710 cactggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatg 651 Query: 361 gacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcg 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 650 gacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcg 591 Query: 421 atgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtac 474 |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 590 atgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtac 537
>gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intrinsic protein mRNA, complete cds Length = 1133 Score = 511 bits (258), Expect = e-142 Identities = 273/278 (98%) Strand = Plus / Minus Query: 197 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 256 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 845 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 786 Query: 257 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccact 316 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 785 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccact 726 Query: 317 cccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaagg 376 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 725 cccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaagg 666 Query: 377 cgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgc 436 ||||||| || |||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 665 cgccgcccaccaggatgttggcgcccacgatgaagccgatggcgatgggcgcgatggtgc 606 Query: 437 ccaggctgcccttcttggggtcgacggcggtggcgtac 474 |||||||||||||||||||||| ||||| ||||||||| Sbjct: 605 ccaggctgcccttcttggggtccacggccgtggcgtac 568 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 103 aagcaaacttaaacgactcatg 124 |||||||||||||||||||||| Sbjct: 977 aagcaaacttaaacgactcatg 956 Score = 40.1 bits (20), Expect = 6.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 1 gttttacacaagcaaattgacagggtcg 28 |||||||| |||||||||||||| |||| Sbjct: 1054 gttttacagaagcaaattgacagtgtcg 1027
>gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, complete cds Length = 1039 Score = 436 bits (220), Expect = e-119 Identities = 265/280 (94%) Strand = Plus / Minus Query: 195 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 254 |||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 754 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 695 Query: 255 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 314 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 694 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtagcccca 635 Query: 315 ctcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaa 374 |||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| Sbjct: 634 ctcccagctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaa 575 Query: 375 ggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434 ||||||||| || ||||||||||| || ||||||||||||||||||||||| |||||||| Sbjct: 574 ggcgccgcccaccaggatgttggcccccacgatgaagccgatggcgatgggggcgatggt 515 Query: 435 gcccaggctgcccttcttggggtcgacggcggtggcgtac 474 |||||||||||||||||| ||||| || || ||||||||| Sbjct: 514 gcccaggctgcccttcttcgggtccaccgccgtggcgtac 475
>gb|BT016300.1| Zea mays clone Contig133 mRNA sequence Length = 1112 Score = 428 bits (216), Expect = e-117 Identities = 252/264 (95%) Strand = Plus / Minus Query: 195 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 254 |||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 850 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 791 Query: 255 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 314 |||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 790 gacgccggcgaggccgccgccgatgaggggcccgacccagtacacccactggtagcccca 731 Query: 315 ctcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaa 374 |||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| Sbjct: 730 ctcccagctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaa 671 Query: 375 ggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434 ||||||||| || |||||||||||||| ||||||||||||||||||||||| |||||||| Sbjct: 670 ggcgccgcccaccaggatgttggcgcccacgatgaagccgatggcgatgggggcgatggt 611 Query: 435 gcccaggctgcccttcttggggtc 458 |||||||||||||||||| ||||| Sbjct: 610 gcccaggctgcccttcttcgggtc 587
>gb|AY104464.1| Zea mays PCO114899 mRNA sequence Length = 1167 Score = 420 bits (212), Expect = e-114 Identities = 251/264 (95%) Strand = Plus / Minus Query: 195 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 254 |||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 849 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 790 Query: 255 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 314 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 789 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtagcccca 730 Query: 315 ctcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaa 374 |||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| Sbjct: 729 ctcccagctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaa 670 Query: 375 ggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434 ||||||||| || ||||||||||| || ||||||||||||||||| ||||| |||||||| Sbjct: 669 ggcgccgcccaccaggatgttggcccccacgatgaagccgatggcaatgggggcgatggt 610 Query: 435 gcccaggctgcccttcttggggtc 458 |||||||||||||||||| ||||| Sbjct: 609 gcccaggctgcccttcttcgggtc 586
>gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmTIP1) mRNA, complete cds Length = 1097 Score = 420 bits (212), Expect = e-114 Identities = 263/280 (93%) Strand = Plus / Minus Query: 195 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 254 |||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 846 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 787 Query: 255 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 314 |||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 786 gacgccggcgaggccgccgccgatgaggggcccgacccagtacacccactggtagcccca 727 Query: 315 ctcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaa 374 |||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| Sbjct: 726 ctcccagctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaa 667 Query: 375 ggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434 ||||||||| || ||||||||||| || ||||||||||||||||| ||||| |||||||| Sbjct: 666 ggcgccgcccaccaggatgttggcccccacgatgaagccgatggcaatgggggcgatggt 607 Query: 435 gcccaggctgcccttcttggggtcgacggcggtggcgtac 474 |||||||||||||||||| ||||| || || ||||||||| Sbjct: 606 gcccaggctgcccttcttcgggtccaccgccgtggcgtac 567
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 406 bits (205), Expect = e-110 Identities = 271/293 (92%) Strand = Plus / Plus Query: 182 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 241 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 2544716 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 2544775 Query: 242 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 301 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 2544776 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 2544835 Query: 302 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 361 ||||| || |||| ||||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 2544836 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 2544895 Query: 362 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 421 | |||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 2544896 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 2544955 Query: 422 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtac 474 |||| ||||||||||| |||||||||||||||||||| ||||||||||||||| Sbjct: 2544956 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtac 2545008 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 156 acggacggacgggcgggcggg 176 ||||||||||||||||||||| Sbjct: 8319519 acggacggacgggcgggcggg 8319499
>gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0067N01, from chromosome 3, complete sequence Length = 159636 Score = 406 bits (205), Expect = e-110 Identities = 271/293 (92%) Strand = Plus / Minus Query: 182 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 241 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 125378 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 125319 Query: 242 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 301 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 125318 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 125259 Query: 302 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 361 ||||| || |||| ||||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 125258 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 125199 Query: 362 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 421 | |||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 125198 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 125139 Query: 422 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtac 474 |||| ||||||||||| |||||||||||||||||||| ||||||||||||||| Sbjct: 125138 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtac 125086
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 406 bits (205), Expect = e-110 Identities = 271/293 (92%) Strand = Plus / Plus Query: 182 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 241 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 2544826 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 2544885 Query: 242 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 301 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 2544886 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 2544945 Query: 302 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 361 ||||| || |||| ||||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 2544946 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 2545005 Query: 362 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 421 | |||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 2545006 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 2545065 Query: 422 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtac 474 |||| ||||||||||| |||||||||||||||||||| ||||||||||||||| Sbjct: 2545066 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtac 2545118 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 156 acggacggacgggcgggcggg 176 ||||||||||||||||||||| Sbjct: 8317354 acggacggacgggcgggcggg 8317334
>dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, complete cds Length = 1080 Score = 406 bits (205), Expect = e-110 Identities = 271/293 (92%) Strand = Plus / Minus Query: 182 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 241 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 844 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 785 Query: 242 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 301 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 784 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 725 Query: 302 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 361 ||||| || |||| ||||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 724 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 665 Query: 362 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 421 | |||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 664 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 605 Query: 422 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtac 474 |||| ||||||||||| |||||||||||||||||||| ||||||||||||||| Sbjct: 604 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtac 552
>dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-C12, full insert sequence Length = 1034 Score = 406 bits (205), Expect = e-110 Identities = 271/293 (92%) Strand = Plus / Minus Query: 182 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 241 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 853 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 794 Query: 242 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 301 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 793 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 734 Query: 302 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 361 ||||| || |||| ||||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 733 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 674 Query: 362 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 421 | |||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 673 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 614 Query: 422 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtac 474 |||| ||||||||||| |||||||||||||||||||| ||||||||||||||| Sbjct: 613 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtac 561
>dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003E16, full insert sequence Length = 1082 Score = 406 bits (205), Expect = e-110 Identities = 271/293 (92%) Strand = Plus / Minus Query: 182 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 241 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 855 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 796 Query: 242 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 301 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 795 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 736 Query: 302 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 361 ||||| || |||| ||||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 735 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 676 Query: 362 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 421 | |||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 675 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 616 Query: 422 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtac 474 |||| ||||||||||| |||||||||||||||||||| ||||||||||||||| Sbjct: 615 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtac 563
>dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-G11, full insert sequence Length = 551 Score = 406 bits (205), Expect = e-110 Identities = 271/293 (92%) Strand = Plus / Minus Query: 182 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 241 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 379 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 320 Query: 242 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 301 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 319 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 260 Query: 302 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 361 ||||| || |||| ||||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 259 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 200 Query: 362 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 421 | |||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 199 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 140 Query: 422 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtac 474 |||| ||||||||||| |||||||||||||||||||| ||||||||||||||| Sbjct: 139 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtac 87
>dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B06, full insert sequence Length = 1055 Score = 406 bits (205), Expect = e-110 Identities = 271/293 (92%) Strand = Plus / Minus Query: 182 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 241 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 851 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 792 Query: 242 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 301 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 791 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 732 Query: 302 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 361 ||||| || |||| ||||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 731 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 672 Query: 362 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 421 | |||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 671 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 612 Query: 422 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtac 474 |||| ||||||||||| |||||||||||||||||||| ||||||||||||||| Sbjct: 611 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtac 559
>ref|XM_470213.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 753 Score = 389 bits (196), Expect = e-105 Identities = 259/280 (92%) Strand = Plus / Minus Query: 195 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 254 |||||||||||||||||||||||||||||||||| ||||||||||||| | ||||||||| Sbjct: 753 ttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaagaggacctcgtagat 694 Query: 255 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 314 ||||||||||||||| ||||||||||| ||||| |||||||||||||||||| || |||| Sbjct: 693 gacgccggcgaggccaccgccgatgagtgggccaacccagtacacccactgggactccca 634 Query: 315 ctcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaa 374 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||| ||| Sbjct: 633 ggaccagctgacgagggccgggccgaaggagacggccgggttcatggaggcgccgtcgaa 574 Query: 375 ggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434 |||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 573 cgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcgatgggggcgatggt 514 Query: 435 gcccaggctgcccttcttggggtcgacggcggtggcgtac 474 ||| |||||||||||||||||||| ||||||||||||||| Sbjct: 513 gccgaggctgcccttcttggggtcaacggcggtggcgtac 474
>emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative gamma tonoplast intrinsic protein (TIP) Length = 1146 Score = 283 bits (143), Expect = 3e-73 Identities = 250/285 (87%), Gaps = 3/285 (1%) Strand = Plus / Minus Query: 193 gcttagtagtcggtggtggggagctgctcgtgggtgcgggag---atgaagagcagctcg 249 |||||||||||||||||||||||||||||||||||| ||||| |||||||||| ||| Sbjct: 837 gcttagtagtcggtggtggggagctgctcgtgggtgtgggaggagatgaagagcatgtcg 778 Query: 250 tagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtac 309 || || | | ||||| | | ||||||| |||||||||||||||||||| |||| Sbjct: 777 tatataagtgcagcgagtgcagcaccgatgaacgggccgacccagtacacccagtggttg 718 Query: 310 ccccactcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccg 369 ||| |||||||||||| | |||||||||||| |||||||||||||||||||||||| Sbjct: 717 ttccaggaccagctgacgagcgaggggccgaaggacacggcggggttcatggacgcgccg 658 Query: 370 gagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcg 429 |||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| Sbjct: 657 tcgaaggcgccgccgacgaggatgttggcgcccacgatgaagccgatggcgatgggggcg 598 Query: 430 atggtgcccaggctgcccttcttggggtcgacggcggtggcgtac 474 |||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 597 atggtgcccaggctgcccttcttggggtcgaccgcggtggcgtac 553
>dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-170-E06, full insert sequence Length = 1024 Score = 260 bits (131), Expect = 4e-66 Identities = 182/199 (91%) Strand = Plus / Plus Query: 276 gatgagggggccgacccagtacacccactggtacccccactcccagctgacgagggcggg 335 |||||| ||||| |||||||||||||||||| || |||| ||||||||||||||| || Sbjct: 219 gatgagtgggccaacccagtacacccactgggactcccaggaccagctgacgagggccgg 278 Query: 336 gccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgtt 395 ||||||||||||||| ||||||||||| |||||| ||| |||||||||||||||||||| Sbjct: 279 gccgaaggagacggccgggttcatggaggcgccgtcgaacgcgccgccgacgaggatgtt 338 Query: 396 ggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggg 455 ||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| Sbjct: 339 cgcgccgacgatgaagccgatggcgatgggggcgatggtgccgaggctgcccttcttggg 398 Query: 456 gtcgacggcggtggcgtac 474 ||| ||||||||||||||| Sbjct: 399 gtcaacggcggtggcgtac 417 Score = 97.6 bits (49), Expect = 3e-17 Identities = 55/57 (96%) Strand = Plus / Plus Query: 182 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatga 238 ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 167 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatga 223
>gb|AF326500.1|AF326500 Zea mays tonoplast membrane integral protein ZmTIP1-2 mRNA, complete cds Length = 1021 Score = 190 bits (96), Expect = 3e-45 Identities = 168/192 (87%) Strand = Plus / Minus Query: 283 gggccgacccagtacacccactggtacccccactcccagctgacgagggcggggccgaag 342 |||||||||||||||||||| |||| | |||| | | | |||||| ||| ||||||||| Sbjct: 682 gggccgacccagtacacccagtggttctcccagacgccggtgacgacggccgggccgaag 623 Query: 343 gagacggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccg 402 |||||||||||||||||||| |||||| ||||||||| || | ||||||||||||||| Sbjct: 622 gagacggcggggttcatggaggcgccgtcgaaggcgccccccgccaggatgttggcgccg 563 Query: 403 acgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacg 462 |||||||||||||||||||||||||||||| ||| ||| ||||||||||||||| ||| Sbjct: 562 acgatgaagccgatggcgatgggcgcgatgacgccgaggtcgcccttcttggggtccacg 503 Query: 463 gcggtggcgtac 474 || ||||||||| Sbjct: 502 gccgtggcgtac 491
>ref|NM_189497.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 759 Score = 182 bits (92), Expect = 7e-43 Identities = 137/152 (90%) Strand = Plus / Minus Query: 323 tgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgc 382 |||||| ||||||||||||||||||||||||||||||||| |||||| ||||||||||| Sbjct: 628 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 569 Query: 383 cgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggc 442 || |||||||||||||||||||||||||||||||||||||||| |||||| || ||| Sbjct: 568 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 509 Query: 443 tgcccttcttggggtcgacggcggtggcgtac 474 |||||||||||| || || |||||||||||| Sbjct: 508 cgcccttcttgggatccaccgcggtggcgtac 477
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 182 bits (92), Expect = 7e-43 Identities = 137/152 (90%) Strand = Plus / Plus Query: 323 tgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgc 382 |||||| ||||||||||||||||||||||||||||||||| |||||| ||||||||||| Sbjct: 43108799 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 43108858 Query: 383 cgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggc 442 || |||||||||||||||||||||||||||||||||||||||| |||||| || ||| Sbjct: 43108859 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 43108918 Query: 443 tgcccttcttggggtcgacggcggtggcgtac 474 |||||||||||| || || |||||||||||| Sbjct: 43108919 cgcccttcttgggatccaccgcggtggcgtac 43108950 Score = 91.7 bits (46), Expect = 2e-15 Identities = 79/90 (87%) Strand = Plus / Minus Query: 326 cgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccga 385 ||||||| |||||||||||| ||| ||||||||||| ||||||||| ||| |||||| Sbjct: 7297479 cgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccgg 7297420 Query: 386 cgaggatgttggcgccgacgatgaagccga 415 ||||||||||||||||||||| || ||||| Sbjct: 7297419 cgaggatgttggcgccgacgacgaggccga 7297390 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 352 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacga 406 ||||||||||||||||||| || ||||||||| ||| | ||||||||||||||| Sbjct: 7302352 gggttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 7302298 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Plus Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 307 |||||||||||| ||||||||| ||| |||| |||||||||||| |||| Sbjct: 6644922 ccggcgaggccggcgccgatgaagggaccgagccagtacacccagtggt 6644970
>dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0459B04 Length = 142475 Score = 182 bits (92), Expect = 7e-43 Identities = 137/152 (90%) Strand = Plus / Plus Query: 323 tgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgc 382 |||||| ||||||||||||||||||||||||||||||||| |||||| ||||||||||| Sbjct: 105828 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 105887 Query: 383 cgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggc 442 || |||||||||||||||||||||||||||||||||||||||| |||||| || ||| Sbjct: 105888 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 105947 Query: 443 tgcccttcttggggtcgacggcggtggcgtac 474 |||||||||||| || || |||||||||||| Sbjct: 105948 cgcccttcttgggatccaccgcggtggcgtac 105979
>dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023066H10, full insert sequence Length = 1346 Score = 182 bits (92), Expect = 7e-43 Identities = 137/152 (90%) Strand = Plus / Minus Query: 323 tgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgc 382 |||||| ||||||||||||||||||||||||||||||||| |||||| ||||||||||| Sbjct: 652 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 593 Query: 383 cgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggc 442 || |||||||||||||||||||||||||||||||||||||||| |||||| || ||| Sbjct: 592 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 533 Query: 443 tgcccttcttggggtcgacggcggtggcgtac 474 |||||||||||| || || |||||||||||| Sbjct: 532 cgcccttcttgggatccaccgcggtggcgtac 501
>dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023050B20, full insert sequence Length = 1149 Score = 182 bits (92), Expect = 7e-43 Identities = 137/152 (90%) Strand = Plus / Minus Query: 323 tgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgc 382 |||||| ||||||||||||||||||||||||||||||||| |||||| ||||||||||| Sbjct: 701 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 642 Query: 383 cgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggc 442 || |||||||||||||||||||||||||||||||||||||||| |||||| || ||| Sbjct: 641 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 582 Query: 443 tgcccttcttggggtcgacggcggtggcgtac 474 |||||||||||| || || |||||||||||| Sbjct: 581 cgcccttcttgggatccaccgcggtggcgtac 550
>dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mRNA for tonoplast intrinsic protein, complete cds Length = 970 Score = 182 bits (92), Expect = 7e-43 Identities = 137/152 (90%) Strand = Plus / Minus Query: 323 tgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgc 382 |||||| ||||||||||||||||||||||||||||||||| |||||| ||||||||||| Sbjct: 638 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 579 Query: 383 cgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggc 442 || |||||||||||||||||||||||||||||||||||||||| |||||| || ||| Sbjct: 578 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 519 Query: 443 tgcccttcttggggtcgacggcggtggcgtac 474 |||||||||||| || || |||||||||||| Sbjct: 518 cgcccttcttgggatccaccgcggtggcgtac 487
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 178 bits (90), Expect = 1e-41 Identities = 138/154 (89%) Strand = Plus / Minus Query: 321 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 380 |||| ||| |||||||||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 13251010 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 13250951 Query: 381 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 440 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 13250950 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 13250891 Query: 441 gctgcccttcttggggtcgacggcggtggcgtac 474 ||||||||||||||| |||||||||||||| Sbjct: 13250890 cgaccccttcttggggtcggcggcggtggcgtac 13250857 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 249 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 296 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 13251082 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 13251035 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 399 gccgacgatgaagccgatggcgat 422 ||||| |||||||||||||||||| Sbjct: 26574317 gccgaggatgaagccgatggcgat 26574294
>dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0427E01 Length = 146395 Score = 178 bits (90), Expect = 1e-41 Identities = 138/154 (89%) Strand = Plus / Minus Query: 321 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 380 |||| ||| |||||||||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 12820 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 12761 Query: 381 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 440 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 12760 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 12701 Query: 441 gctgcccttcttggggtcgacggcggtggcgtac 474 ||||||||||||||| |||||||||||||| Sbjct: 12700 cgaccccttcttggggtcggcggcggtggcgtac 12667 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 249 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 296 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 12892 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 12845
>dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0012F14 Length = 168629 Score = 178 bits (90), Expect = 1e-41 Identities = 138/154 (89%) Strand = Plus / Minus Query: 321 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 380 |||| ||| |||||||||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 168198 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 168139 Query: 381 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 440 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 168138 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 168079 Query: 441 gctgcccttcttggggtcgacggcggtggcgtac 474 ||||||||||||||| |||||||||||||| Sbjct: 168078 cgaccccttcttggggtcggcggcggtggcgtac 168045 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 249 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 296 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 168270 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 168223
>dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C06, full insert sequence Length = 1194 Score = 178 bits (90), Expect = 1e-41 Identities = 138/154 (89%) Strand = Plus / Minus Query: 321 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 380 |||| ||| |||||||||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 710 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 651 Query: 381 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 440 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 650 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 591 Query: 441 gctgcccttcttggggtcgacggcggtggcgtac 474 ||||||||||||||| |||||||||||||| Sbjct: 590 cgaccccttcttggggtcggcggcggtggcgtac 557 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 249 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 296 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 782 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 735
>dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-F03, full insert sequence Length = 1214 Score = 178 bits (90), Expect = 1e-41 Identities = 138/154 (89%) Strand = Plus / Minus Query: 321 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 380 |||| ||| |||||||||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 712 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 653 Query: 381 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 440 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 652 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 593 Query: 441 gctgcccttcttggggtcgacggcggtggcgtac 474 ||||||||||||||| |||||||||||||| Sbjct: 592 cgaccccttcttggggtcggcggcggtggcgtac 559 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 249 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 296 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 784 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 737
>dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023036J06, full insert sequence Length = 1074 Score = 178 bits (90), Expect = 1e-41 Identities = 138/154 (89%) Strand = Plus / Minus Query: 321 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 380 |||| ||| |||||||||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 590 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 531 Query: 381 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 440 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 530 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 471 Query: 441 gctgcccttcttggggtcgacggcggtggcgtac 474 ||||||||||||||| |||||||||||||| Sbjct: 470 cgaccccttcttggggtcggcggcggtggcgtac 437 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 249 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 296 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 662 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 615
>dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013050J20, full insert sequence Length = 1197 Score = 178 bits (90), Expect = 1e-41 Identities = 138/154 (89%) Strand = Plus / Minus Query: 321 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 380 |||| ||| |||||||||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 713 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 654 Query: 381 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 440 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 653 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 594 Query: 441 gctgcccttcttggggtcgacggcggtggcgtac 474 ||||||||||||||| |||||||||||||| Sbjct: 593 cgaccccttcttggggtcggcggcggtggcgtac 560 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 249 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 296 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 785 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 738
>dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023055A02, full insert sequence Length = 1195 Score = 178 bits (90), Expect = 1e-41 Identities = 138/154 (89%) Strand = Plus / Minus Query: 321 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 380 |||| ||| |||||||||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 711 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 652 Query: 381 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 440 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 651 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 592 Query: 441 gctgcccttcttggggtcgacggcggtggcgtac 474 ||||||||||||||| |||||||||||||| Sbjct: 591 cgaccccttcttggggtcggcggcggtggcgtac 558 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 249 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 296 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 783 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 736
>dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116H02, full insert sequence Length = 1202 Score = 178 bits (90), Expect = 1e-41 Identities = 138/154 (89%) Strand = Plus / Minus Query: 321 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 380 |||| ||| |||||||||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 713 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 654 Query: 381 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 440 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 653 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 594 Query: 441 gctgcccttcttggggtcgacggcggtggcgtac 474 ||||||||||||||| |||||||||||||| Sbjct: 593 cgaccccttcttggggtcggcggcggtggcgtac 560 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 249 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 296 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 785 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 738
>dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044F19, full insert sequence Length = 1220 Score = 178 bits (90), Expect = 1e-41 Identities = 138/154 (89%) Strand = Plus / Minus Query: 321 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 380 |||| ||| |||||||||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 711 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 652 Query: 381 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 440 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 651 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 592 Query: 441 gctgcccttcttggggtcgacggcggtggcgtac 474 ||||||||||||||| |||||||||||||| Sbjct: 591 cgaccccttcttggggtcggcggcggtggcgtac 558 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 249 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 296 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 783 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 736
>gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;3 mRNA, complete cds Length = 829 Score = 176 bits (89), Expect = 4e-41 Identities = 131/145 (90%) Strand = Plus / Minus Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389 |||||||||||||||| || |||||||||||| |||||||||||| |||| ||||||| Sbjct: 663 ggcggggccgaaggagcgtgcagggttcatggacccgccggagaaggggccggcgacgag 604 Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 449 ||||||||||||||||||||||||||||||||| || ||||||||||| ||| ||||| Sbjct: 603 gatgttggcgccgacgatgaagccgatggcgattggagcgatggtgccgagggacccctt 544 Query: 450 cttggggtcgacggcggtggcgtac 474 |||||||||| |||||||||||||| Sbjct: 543 cttggggtcggcggcggtggcgtac 519 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 249 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 296 ||||| ||||||||||||||| ||||||||||| |||||| ||||||| Sbjct: 744 gtagacgacgccggcgaggccaccgccgatgagcgggccggcccagta 697
>gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;2 mRNA, complete cds Length = 853 Score = 176 bits (89), Expect = 4e-41 Identities = 131/145 (90%) Strand = Plus / Minus Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389 |||||||||||||||| || |||||||||||| |||||||||||| |||| | ||||| Sbjct: 666 ggcggggccgaaggagcgtgcagggttcatggacccgccggagaaggggccggcaacgag 607 Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 449 |||||||||||||||||||||||||||||||||||| ||||||||||| ||| ||||| Sbjct: 606 gatgttggcgccgacgatgaagccgatggcgatgggggcgatggtgccgagggaaccctt 547 Query: 450 cttggggtcgacggcggtggcgtac 474 |||||||||| |||||||||||||| Sbjct: 546 cttggggtcggcggcggtggcgtac 522 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 249 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 296 ||||| ||||||||||||||| ||||||||||| |||||| ||||||| Sbjct: 747 gtagacgacgccggcgaggccaccgccgatgagcgggccggcccagta 700
>gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;1 mRNA, complete cds Length = 817 Score = 176 bits (89), Expect = 4e-41 Identities = 131/145 (90%) Strand = Plus / Minus Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389 |||||||||||||||| || |||||||||||| |||||||||||| |||| | ||||| Sbjct: 667 ggcggggccgaaggagcgtgcagggttcatggacccgccggagaaggggccggccacgag 608 Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 449 |||||||||||||||||||||||||||||||||||| ||||||||||| ||| ||||| Sbjct: 607 gatgttggcgccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 548 Query: 450 cttggggtcgacggcggtggcgtac 474 |||||||||| |||||||||||||| Sbjct: 547 cttggggtcggcggcggtggcgtac 523 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 249 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 302 ||||| ||||||||||||||| ||||||||||| |||||| ||||||| ||||| Sbjct: 748 gtagacgacgccggcgaggccaccgccgatgagcgggccggcccagtagaccca 695
>dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-G09, full insert sequence Length = 1196 Score = 170 bits (86), Expect = 3e-39 Identities = 137/154 (88%) Strand = Plus / Minus Query: 321 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 380 |||| ||| |||||| ||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 712 gctggcgacggcgggaccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 653 Query: 381 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 440 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 652 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 593 Query: 441 gctgcccttcttggggtcgacggcggtggcgtac 474 ||||||||||||||| |||||||||||||| Sbjct: 592 cgaccccttcttggggtcggcggcggtggcgtac 559 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 249 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 296 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 784 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 737
>gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral protein ZmTIP2-2 mRNA, complete cds Length = 1073 Score = 168 bits (85), Expect = 1e-38 Identities = 130/145 (89%) Strand = Plus / Minus Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389 |||||||||||||||| ||||||||||||||| ||||| ||||| || || |||| Sbjct: 682 ggcggggccgaaggagcgggcggggttcatggagccgccgctgaagggccccgcggcgag 623 Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 449 |||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| Sbjct: 622 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagggagccctt 563 Query: 450 cttggggtcgacggcggtggcgtac 474 |||||||||| |||||||||||||| Sbjct: 562 cttggggtcggcggcggtggcgtac 538 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 248 cgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 302 |||||| || ||| ||||| |||||||||||||| |||||||||||||| ||||| Sbjct: 764 cgtagacgaggccagcgagtccgccgccgatgagcgggccgacccagtagaccca 710
>gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral protein ZmTIP2-1 mRNA, complete cds Length = 1110 Score = 161 bits (81), Expect = 3e-36 Identities = 129/145 (88%) Strand = Plus / Minus Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389 |||||||||||||||| ||||||||||||||| ||||| ||||| || || |||| Sbjct: 839 ggcggggccgaaggagcgggcggggttcatggagccgccgctgaagggccccgcggcgag 780 Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 449 |||||||||||||||||||||||||||||||||||||||||||||||| || |||||| Sbjct: 779 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgagccctt 720 Query: 450 cttggggtcgacggcggtggcgtac 474 |||||||||| |||||||||||||| Sbjct: 719 cttggggtcggcggcggtggcgtac 695 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 248 cgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 302 |||||| || ||| |||||||||||||||| ||| |||||||||||||| ||||| Sbjct: 921 cgtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagaccca 867
>gb|AY105015.1| Zea mays PCO137646 mRNA sequence Length = 1238 Score = 161 bits (81), Expect = 3e-36 Identities = 129/145 (88%) Strand = Plus / Minus Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389 |||||||||||||||| ||||||||||||||| ||||| ||||| || || |||| Sbjct: 838 ggcggggccgaaggagcgggcggggttcatggagccgccgctgaagggccccgcggcgag 779 Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 449 |||||||||||||||||||||||||||||||||||||||||||||||| || |||||| Sbjct: 778 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgagccctt 719 Query: 450 cttggggtcgacggcggtggcgtac 474 |||||||||| |||||||||||||| Sbjct: 718 cttggggtcggcggcggtggcgtac 694 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 248 cgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 302 |||||| || ||| |||||||||||||||| ||| |||||||||||||| ||||| Sbjct: 920 cgtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagaccca 866
>gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intrinsic protein mRNA, complete cds Length = 1067 Score = 161 bits (81), Expect = 3e-36 Identities = 129/145 (88%) Strand = Plus / Minus Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389 |||||||||||||||| || |||||||||||| ||||||| |||| |||| | ||||| Sbjct: 669 ggcggggccgaaggagcgtgcagggttcatggacccgccggaaaaggggccggccacgag 610 Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 449 ||||||||||||||| |||||||||||||||||||| ||||||||||| ||| ||||| Sbjct: 609 gatgttggcgccgacaatgaagccgatggcgatgggggcgatggtgccgagggatccctt 550 Query: 450 cttggggtcgacggcggtggcgtac 474 |||||||||| |||||||||||||| Sbjct: 549 cttggggtcggcggcggtggcgtac 525 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 255 gacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 302 ||||||||||||||| ||||||||||| |||||| ||||||| ||||| Sbjct: 744 gacgccggcgaggccaccgccgatgagcgggccggcccagtaaaccca 697
>gb|AY112388.1| Zea mays CL24208_1 mRNA sequence Length = 833 Score = 157 bits (79), Expect = 4e-35 Identities = 162/192 (84%) Strand = Plus / Plus Query: 283 gggccgacccagtacacccactggtacccccactcccagctgacgagggcggggccgaag 342 |||||||||||||||||||| |||| | |||| | | | |||||| || ||||||||| Sbjct: 329 gggccgacccagtacacccagtggttctcccagacgccggtgacgacagccgggccgaag 388 Query: 343 gagacggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccg 402 |||||||||| ||||||||| |||||| ||||||| | ||||||||||||||| Sbjct: 389 gagacggcggngttcatggaggcgccgtcgaaggcgnnnnnngccaggatgttggcgccg 448 Query: 403 acgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacg 462 |||||||||||||||||||||||||||||| ||| ||| ||||||||||||||| ||| Sbjct: 449 acgatgaagccgatggcgatgggcgcgatgacgccgaggtcgcccttcttggggtccacg 508 Query: 463 gcggtggcgtac 474 || ||||||||| Sbjct: 509 gccgtggcgtac 520
>dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-E02, full insert sequence Length = 870 Score = 155 bits (78), Expect = 2e-34 Identities = 93/98 (94%) Strand = Plus / Minus Query: 182 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 241 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 689 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 630 Query: 242 gcagctcgtagatgacgccggcgaggccgccgccgatg 279 | | |||||||||||||||||||||||| ||||||||| Sbjct: 629 ggacctcgtagatgacgccggcgaggccaccgccgatg 592 Score = 60.0 bits (30), Expect = 7e-06 Identities = 33/34 (97%) Strand = Plus / Minus Query: 441 gctgcccttcttggggtcgacggcggtggcgtac 474 |||||||||||||||||| ||||||||||||||| Sbjct: 592 gctgcccttcttggggtcaacggcggtggcgtac 559
>gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds Length = 968 Score = 145 bits (73), Expect = 2e-31 Identities = 127/145 (87%) Strand = Plus / Minus Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389 |||||||||||||||| ||| ||||||||||| ||||| ||||| |||| || | || Sbjct: 615 ggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccag 556 Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 449 |||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| Sbjct: 555 gatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggacccctt 496 Query: 450 cttggggtcgacggcggtggcgtac 474 ||| |||||| | |||||||||||| Sbjct: 495 cttcgggtcggccgcggtggcgtac 471 Score = 60.0 bits (30), Expect = 7e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 265 aggccgccgccgatgagggggccgacccagtacaccca 302 ||||| ||||||| |||||||||||||||||||||||| Sbjct: 680 aggccaccgccgacgagggggccgacccagtacaccca 643 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 330 ggcggggccgaaggagacggcggggttca 358 |||| ||||||||| |||||||||||||| Sbjct: 276 ggcgaggccgaaggtgacggcggggttca 248
>gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral protein ZmTIP2-3 mRNA, complete cds Length = 1042 Score = 145 bits (73), Expect = 2e-31 Identities = 127/145 (87%) Strand = Plus / Minus Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389 |||||||||||||||| ||| ||||||||||| ||||| ||||| |||| || | || Sbjct: 683 ggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccag 624 Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 449 |||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| Sbjct: 623 gatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggacccctt 564 Query: 450 cttggggtcgacggcggtggcgtac 474 ||| |||||| | |||||||||||| Sbjct: 563 cttcgggtcggccgcggtggcgtac 539 Score = 60.0 bits (30), Expect = 7e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 265 aggccgccgccgatgagggggccgacccagtacaccca 302 ||||| ||||||| |||||||||||||||||||||||| Sbjct: 748 aggccaccgccgacgagggggccgacccagtacaccca 711 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 330 ggcggggccgaaggagacggcggggttca 358 |||| ||||||||| |||||||||||||| Sbjct: 344 ggcgaggccgaaggtgacggcggggttca 316
>gb|AY106931.1| Zea mays PCO140073 mRNA sequence Length = 1069 Score = 145 bits (73), Expect = 2e-31 Identities = 127/145 (87%) Strand = Plus / Minus Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389 |||||||||||||||| ||| ||||||||||| ||||| ||||| |||| || | || Sbjct: 692 ggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccag 633 Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 449 |||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| Sbjct: 632 gatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggacccctt 573 Query: 450 cttggggtcgacggcggtggcgtac 474 ||| |||||| | |||||||||||| Sbjct: 572 cttcgggtcggccgcggtggcgtac 548 Score = 60.0 bits (30), Expect = 7e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 265 aggccgccgccgatgagggggccgacccagtacaccca 302 ||||| ||||||| |||||||||||||||||||||||| Sbjct: 757 aggccaccgccgacgagggggccgacccagtacaccca 720 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 330 ggcggggccgaaggagacggcggggttca 358 |||| ||||||||| |||||||||||||| Sbjct: 353 ggcgaggccgaaggtgacggcggggttca 325
>gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRNA, complete cds Length = 1060 Score = 145 bits (73), Expect = 2e-31 Identities = 127/145 (87%) Strand = Plus / Minus Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389 |||||||||||||||| ||| ||||||||||| ||||| ||||| |||| || | || Sbjct: 674 ggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccag 615 Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 449 |||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| Sbjct: 614 gatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggacccctt 555 Query: 450 cttggggtcgacggcggtggcgtac 474 ||| |||||| | |||||||||||| Sbjct: 554 cttcgggtcggccgcggtggcgtac 530 Score = 60.0 bits (30), Expect = 7e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 265 aggccgccgccgatgagggggccgacccagtacaccca 302 ||||| ||||||| |||||||||||||||||||||||| Sbjct: 739 aggccaccgccgacgagggggccgacccagtacaccca 702 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 330 ggcggggccgaaggagacggcggggttca 358 |||| ||||||||| |||||||||||||| Sbjct: 335 ggcgaggccgaaggtgacggcggggttca 307
>gb|AY389618.1| Hyacinthus orientalis mitochondrial tonoplast intrinsic protein (TIP1) mRNA, partial cds Length = 662 Score = 125 bits (63), Expect = 1e-25 Identities = 138/163 (84%) Strand = Plus / Minus Query: 312 ccactcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccgga 371 |||||||||||| || || | || |||||||| || || |||||||| ||||| ||| Sbjct: 632 ccactcccagctcaccagcggcggcccgaaggacaccgccgggttcatcgacgccccgtc 573 Query: 372 gaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 431 |||||| |||||| | ||||||||||| || |||||||||||||| |||||||||||||| Sbjct: 572 gaaggccccgccggccaggatgttggcccccacgatgaagccgatcgcgatgggcgcgat 513 Query: 432 ggtgcccaggctgcccttcttggggtcgacggcggtggcgtac 474 || |||||||| |||||||| ||||| | ||||||||||||| Sbjct: 512 cgtccccaggctccccttcttcgggtcaatggcggtggcgtac 470
>ref|XM_467137.1| Oryza sativa (japonica cultivar-group), mRNA Length = 747 Score = 111 bits (56), Expect = 2e-21 Identities = 95/108 (87%) Strand = Plus / Minus Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389 |||||||||||||||| || ||||||||||| ||||| ||| | |||| || |||| Sbjct: 612 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 553 Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 437 ||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 552 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgcc 505 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 302 |||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 683 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 640
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 111 bits (56), Expect = 2e-21 Identities = 95/108 (87%) Strand = Plus / Plus Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389 |||||||||||||||| || ||||||||||| ||||| ||| | |||| || |||| Sbjct: 26627254 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 26627313 Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 437 ||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 26627314 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgcc 26627361 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 302 |||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 26627183 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 26627226
>gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic protein 1 (TIP1), tonoplast intrinsic protein 2 (TIP2), and Rar1 (Rar1) genes, complete cds Length = 65979 Score = 111 bits (56), Expect = 2e-21 Identities = 95/108 (87%) Strand = Plus / Minus Query: 352 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaag 411 ||||||||||| ||||| ||||| ||| || |||||||||||||||||||||||||| Sbjct: 44819 gggttcatggagccgccgctgaagggcccggcggcgaggatgttggcgccgacgatgaag 44760 Query: 412 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcg 459 ||||| || ||||||||||||||||| ||| |||||||||||||||| Sbjct: 44759 ccgatcgccatgggcgcgatggtgccgagggagcccttcttggggtcg 44712 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 302 |||||||||||||| || ||||| || ||||||||||||||||| Sbjct: 44912 ccggcgaggccgccaccaatgagtggcccgacccagtacaccca 44869
>dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0519E06 Length = 170634 Score = 111 bits (56), Expect = 2e-21 Identities = 95/108 (87%) Strand = Plus / Plus Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389 |||||||||||||||| || ||||||||||| ||||| ||| | |||| || |||| Sbjct: 169635 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 169694 Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 437 ||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 169695 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgcc 169742 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 302 |||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 169564 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 169607
>dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1112_F09 Length = 139371 Score = 111 bits (56), Expect = 2e-21 Identities = 95/108 (87%) Strand = Plus / Plus Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389 |||||||||||||||| || ||||||||||| ||||| ||| | |||| || |||| Sbjct: 61415 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 61474 Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 437 ||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 61475 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgcc 61522 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 302 |||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 61344 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 61387
>dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mRNA for tonoplast intrinsic protein, complete cds Length = 1013 Score = 111 bits (56), Expect = 2e-21 Identities = 95/108 (87%) Strand = Plus / Minus Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389 |||||||||||||||| || ||||||||||| ||||| ||| | |||| || |||| Sbjct: 685 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 626 Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 437 ||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 625 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgcc 578 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 302 |||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 756 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 713
>dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-120-A10, full insert sequence Length = 873 Score = 111 bits (56), Expect = 2e-21 Identities = 95/108 (87%) Strand = Plus / Minus Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389 |||||||||||||||| || ||||||||||| ||||| ||| | |||| || |||| Sbjct: 487 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 428 Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 437 ||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 427 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgcc 380 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 302 |||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 558 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 515
>emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chromosome 2 Length = 339972 Score = 111 bits (56), Expect = 2e-21 Identities = 95/108 (87%) Strand = Plus / Minus Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389 |||||||||||||||| || ||||||||||| ||||| ||| | |||| || |||| Sbjct: 250580 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 250521 Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 437 ||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 250520 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgcc 250473 Score = 95.6 bits (48), Expect = 1e-16 Identities = 51/52 (98%) Strand = Plus / Plus Query: 386 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 437 ||||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 332124 cgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgcc 332175 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 302 |||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 250651 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 250608
>emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein Length = 1007 Score = 103 bits (52), Expect = 5e-19 Identities = 115/136 (84%) Strand = Plus / Minus Query: 338 cgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttgg 397 |||||||| ||||||||||||||| |||| ||||||| ||| || | | |||||||| Sbjct: 684 cgaaggagcgggcggggttcatggagccgccagagaaggggcccgcggccaagatgttgg 625 Query: 398 cgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggt 457 |||| ||||||||||| || || ||||| ||||||||||||||| ||||||||| |||| Sbjct: 624 cgcccacgatgaagccaatagcaatgggagcgatggtgcccaggtcgcccttcttcgggt 565 Query: 458 cgacggcggtggcgta 473 || | ||||||||||| Sbjct: 564 cggctgcggtggcgta 549 Score = 71.9 bits (36), Expect = 2e-09 Identities = 42/44 (95%) Strand = Plus / Minus Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 302 ||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 763 ccggcaaggccgcctccgatgagggggccgacccagtacaccca 720
>ref|NM_188624.1| Oryza sativa (japonica cultivar-group), Ozsa8227 predicted mRNA Length = 756 Score = 91.7 bits (46), Expect = 2e-15 Identities = 79/90 (87%) Strand = Plus / Minus Query: 326 cgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccga 385 ||||||| |||||||||||| ||| ||||||||||| ||||||||| ||| |||||| Sbjct: 616 cgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccgg 557 Query: 386 cgaggatgttggcgccgacgatgaagccga 415 ||||||||||||||||||||| || ||||| Sbjct: 556 cgaggatgttggcgccgacgacgaggccga 527
>gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral protein ZmTIP4-4 mRNA, complete cds Length = 955 Score = 91.7 bits (46), Expect = 2e-15 Identities = 73/82 (89%) Strand = Plus / Minus Query: 325 acgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccg 384 ||||| ||||||||||||||| |||||||||||||||||||||||||||| |||||| Sbjct: 714 acgagcgcggggccgaaggagcgcgcggggttcatggacgcgccggagaagggcccgccg 655 Query: 385 acgaggatgttggcgccgacga 406 |||| | |||||||||||||| Sbjct: 654 gcgagcacgttggcgccgacga 633
>dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0431F01 Length = 143209 Score = 91.7 bits (46), Expect = 2e-15 Identities = 79/90 (87%) Strand = Plus / Minus Query: 326 cgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccga 385 ||||||| |||||||||||| ||| ||||||||||| ||||||||| ||| |||||| Sbjct: 98909 cgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccgg 98850 Query: 386 cgaggatgttggcgccgacgatgaagccga 415 ||||||||||||||||||||| || ||||| Sbjct: 98849 cgaggatgttggcgccgacgacgaggccga 98820 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 352 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacga 406 ||||||||||||||||||| || ||||||||| ||| | ||||||||||||||| Sbjct: 103782 gggttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 103728
>dbj|AK069192.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023007E01, full insert sequence Length = 1112 Score = 91.7 bits (46), Expect = 2e-15 Identities = 79/90 (87%) Strand = Plus / Minus Query: 326 cgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccga 385 ||||||| |||||||||||| ||| ||||||||||| ||||||||| ||| |||||| Sbjct: 619 cgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccgg 560 Query: 386 cgaggatgttggcgccgacgatgaagccga 415 ||||||||||||||||||||| || ||||| Sbjct: 559 cgaggatgttggcgccgacgacgaggccga 530
>dbj|AB206104.1| Mimosa pudica tip1;1 mRNA for tonoplast intrinsic protein 1;1, complete cds Length = 1067 Score = 89.7 bits (45), Expect = 8e-15 Identities = 96/113 (84%) Strand = Plus / Minus Query: 195 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 254 |||||| ||||||||||||||||||||||||||| |||||||||||| | || ||||| Sbjct: 826 ttagtaatcggtggtggggagctgctcgtgggtgtgggagatgaagataacttcatagat 767 Query: 255 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 307 ||| || || ||||| || || || || |||||||||||||| ||||| |||| Sbjct: 766 gaccccagcaaggccacctccaataagtgggccgacccagtagacccagtggt 714
>gb|U43291.1|MCU43291 Mesembryanthemum crystallinum tonoplast intrinsic protein (TIP) mRNA, complete cds Length = 1235 Score = 89.7 bits (45), Expect = 8e-15 Identities = 180/225 (80%) Strand = Plus / Minus Query: 250 tagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtac 309 |||||||| |||||||| || || |||||||| |||||||||||||| ||||| |||| Sbjct: 752 tagatgactccggcgagccctcctccgatgagtgggccgacccagtagacccagtggttg 693 Query: 310 ccccactcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccg 369 ||| ||| ||||| ||||| || ||||| || ||||| ||||||||||| || ||| Sbjct: 692 ttccaggtccaactgactagggctggaccgaatgacacggccgggttcatggatgcaccg 633 Query: 370 gagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcg 429 | |||||| || ||||| | ||||||||| || |||||||| || ||||| || || || Sbjct: 632 gtgaaggctcctccgaccaagatgttggctccaacgatgaaaccaatggcaattggggca 573 Query: 430 atggtgcccaggctgcccttcttggggtcgacggcggtggcgtac 474 ||| | || ||| |||| ||||| |||||| ||| ||||||||| Sbjct: 572 atgattccgaggttgcctctcttgtggtcgatggccgtggcgtac 528
>ref|XM_473424.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2307 Score = 85.7 bits (43), Expect = 1e-13 Identities = 76/87 (87%) Strand = Plus / Minus Query: 388 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccc 447 ||||||||||| |||||||||||||||||||| |||||||||| |||||| ||| ||| Sbjct: 557 aggatgttggcaccgacgatgaagccgatggccatgggcgcgacggtgccgagggaaccc 498 Query: 448 ttcttggggtcgacggcggtggcgtac 474 ||||| |||||| | || ||||||||| Sbjct: 497 ttcttcgggtcggccgccgtggcgtac 471 Score = 48.1 bits (24), Expect = 0.026 Identities = 39/44 (88%) Strand = Plus / Minus Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 302 ||||| ||||| || ||||| || |||||||||||||||||||| Sbjct: 686 ccggccaggccaccaccgatcagtgggccgacccagtacaccca 643
>emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0034G17, complete sequence Length = 127259 Score = 85.7 bits (43), Expect = 1e-13 Identities = 76/87 (87%) Strand = Plus / Plus Query: 388 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccc 447 ||||||||||| |||||||||||||||||||| |||||||||| |||||| ||| ||| Sbjct: 92622 aggatgttggcaccgacgatgaagccgatggccatgggcgcgacggtgccgagggaaccc 92681 Query: 448 ttcttggggtcgacggcggtggcgtac 474 ||||| |||||| | || ||||||||| Sbjct: 92682 ttcttcgggtcggccgccgtggcgtac 92708 Score = 48.1 bits (24), Expect = 0.026 Identities = 39/44 (88%) Strand = Plus / Plus Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 302 ||||| ||||| || ||||| || |||||||||||||||||||| Sbjct: 92493 ccggccaggccaccaccgatcagtgggccgacccagtacaccca 92536
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 85.7 bits (43), Expect = 1e-13 Identities = 76/87 (87%) Strand = Plus / Plus Query: 388 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccc 447 ||||||||||| |||||||||||||||||||| |||||||||| |||||| ||| ||| Sbjct: 27568646 aggatgttggcaccgacgatgaagccgatggccatgggcgcgacggtgccgagggaaccc 27568705 Query: 448 ttcttggggtcgacggcggtggcgtac 474 ||||| |||||| | || ||||||||| Sbjct: 27568706 ttcttcgggtcggccgccgtggcgtac 27568732 Score = 58.0 bits (29), Expect = 3e-05 Identities = 125/157 (79%) Strand = Plus / Minus Query: 272 cgccgatgagggggccgacccagtacacccactggtacccccactcccagctgacgaggg 331 |||||||||| || |||| |||||| ||||| |||| | ||| | ||||| |||||| | Sbjct: 26354830 cgccgatgagcggcccgagccagtaaacccagtggtggcgccagttccagccgacgagcg 26354771 Query: 332 cggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgagga 391 | |||||||| | | || |||||||||| ||||||| ||| | ||| ||| |||||| Sbjct: 26354770 ccgggccgaacgcgcgcgccgggttcatggccgcgccgtcgaacgggcccccggcgagga 26354711 Query: 392 tgttggcgccgacgatgaagccgatggcgatgggcgc 428 |||| ||||| ||| ||||||||||||| |||||| Sbjct: 26354710 tgttcgcgcccgcgaccaagccgatggcgaggggcgc 26354674 Score = 48.1 bits (24), Expect = 0.026 Identities = 39/44 (88%) Strand = Plus / Plus Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 302 ||||| ||||| || ||||| || |||||||||||||||||||| Sbjct: 27568517 ccggccaggccaccaccgatcagtgggccgacccagtacaccca 27568560 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 455 ggtcgacggcggtggcgtac 474 |||||||||||||||||||| Sbjct: 26354650 ggtcgacggcggtggcgtac 26354631 Score = 40.1 bits (20), Expect = 6.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 255 gacgccggcgaggccgccgccgatgagg 282 ||||||| ||||||||||||||| |||| Sbjct: 19492802 gacgccgacgaggccgccgccgaggagg 19492775
>gb|AF326505.1|AF326505 Zea mays tonoplast membrane integral protein ZmTIP4-1 mRNA, complete cds Length = 1125 Score = 83.8 bits (42), Expect = 5e-13 Identities = 72/82 (87%) Strand = Plus / Minus Query: 328 agggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacg 387 ||||| |||||||||||| || ||||||||||||||||||| |||| ||||||| || Sbjct: 768 agggccgggccgaaggagcgtgccgggttcatggacgcgccggtgaagttgccgccggcg 709 Query: 388 aggatgttggcgccgacgatga 409 ||| |||||||||||||||||| Sbjct: 708 aggctgttggcgccgacgatga 687
>emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative tonoplast intrinsic protein (tip1 gene) Length = 1112 Score = 75.8 bits (38), Expect = 1e-10 Identities = 220/278 (79%), Gaps = 2/278 (0%) Strand = Plus / Minus Query: 197 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 256 ||||||| ||||| |||||||| || |||||| || |||||| | ||||| ||||| || Sbjct: 830 agtagtcagtggttgggagctgttcatgggtgtggttgatgaataacagctggtagacga 771 Query: 257 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccact 316 |||||||| | | | |||| || |||||||||||||| | ||| |||| |||| | Sbjct: 770 tgccggcgatggctgcaccgactagtgggccgacccagtagatccagtggttaacccagt 711 Query: 317 cccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaagg 376 |||||| || | ||| || || |||| ||||| ||||||||||| || |||| |||| Sbjct: 710 tccagctcaccaaggcaggtccaaaggccacggcagggttcatggatgcaccggtgaaga 651 Query: 377 cgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgc 436 | || ||||||| ||||||||| | || || | ||||||||||| ||| ||||| |||| Sbjct: 650 ctcctccgacgaagatgttggcagcaacaataaggccgatggcgaggggagcgatagtgc 591 Query: 437 cca-ggctgcccttcttggggtcgacggcggtggcgta 473 | | |||| || ||||||||||||| |||||||||||| Sbjct: 590 cgatggct-cctttcttggggtcgatggcggtggcgta 554
>emb|BX824373.1|CNS0A6WG Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH44ZA10 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 887 Score = 71.9 bits (36), Expect = 2e-09 Identities = 105/128 (82%) Strand = Plus / Minus Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405 ||||| ||||||||||| |||||| ||| || || ||| |||||||||| || || ||| Sbjct: 488 acggctgggttcatggaagcgccgctgaaagctccaccggcgaggatgttcgctccaacg 429 Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465 ||||| || |||||||| || ||||| || || || |||| ||||||||||| ||||| Sbjct: 428 atgaaacctatggcgattggtgcgattgttccgagagtgccgttcttggggtcaacggct 369 Query: 466 gtggcgta 473 |||||||| Sbjct: 368 gtggcgta 361
>dbj|AB012270.1| Aster tripolium mRNA for SAMIPD, partial cds Length = 321 Score = 69.9 bits (35), Expect = 7e-09 Identities = 38/39 (97%) Strand = Plus / Minus Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgc 428 |||||||||||||||||||||||||||||| |||||||| Sbjct: 321 gatgttggcgccgacgatgaagccgatggcaatgggcgc 283
>gb|AF326506.1|AF326506 Zea mays tonoplast membrane integral protein ZmTIP4-2 mRNA, complete cds Length = 1255 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 352 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatga 409 ||||||||||||||||||| |||| ||||||| ||||| ||||||||||||| |||| Sbjct: 743 gggttcatggacgcgccggtgaagttgccgccggcgaggctgttggcgccgactatga 686
>dbj|D84669.1| Raphanus sativus mRNA for VM23, complete sequence Length = 1054 Score = 65.9 bits (33), Expect = 1e-07 Identities = 105/129 (81%) Strand = Plus / Minus Query: 345 gacggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgac 404 |||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || || Sbjct: 679 gacggctgggttcatggaggctccgctgaaagctccaccggcgaggatgttagctccaac 620 Query: 405 gatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggc 464 |||||| || ||||| || || ||||| || || || || || ||||||||||||||||| Sbjct: 619 gatgaaacctatggcaattggtgcgattgttccgagactaccgttcttggggtcgacggc 560 Query: 465 ggtggcgta 473 |||||||| Sbjct: 559 tgtggcgta 551
>dbj|AB012272.1| Aster tripolium mRNA for SAMIPF, partial cds Length = 321 Score = 65.9 bits (33), Expect = 1e-07 Identities = 60/69 (86%) Strand = Plus / Minus Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 449 |||||||||||||||||| ||||||||||| || || || || || ||||| || ||||| Sbjct: 321 gatgttggcgccgacgataaagccgatggcaattggtgcaattgttcccagacttccctt 262 Query: 450 cttggggtc 458 ||||||||| Sbjct: 261 cttggggtc 253
>ref|NM_113559.3| Arabidopsis thaliana TIP2 (TONOPLAST INTRINSIC PROTEIN 2); water channel AT3G26520 (TIP2) mRNA, complete cds Length = 1201 Score = 63.9 bits (32), Expect = 4e-07 Identities = 104/128 (81%) Strand = Plus / Minus Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 720 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 661 Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 660 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 601 Query: 466 gtggcgta 473 |||||||| Sbjct: 600 gtggcgta 593
>emb|AJ289696.1|POC289696 Posidonia oceanica partial mRNA for putative aquaporin (aq1 gene) Length = 428 Score = 63.9 bits (32), Expect = 4e-07 Identities = 151/188 (80%), Gaps = 2/188 (1%) Strand = Plus / Minus Query: 287 cgacccagtacacccactggtacccccactcccagctgacgagggcggggccgaaggaga 346 |||||||||| |||||||||| |||| | |||||| || | ||| || || |||| | Sbjct: 428 cgacccagtaaacccactggttaacccagttccagctcaccaaggcaggtccaaaggcca 369 Query: 347 cggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacga 406 |||| ||||||||||| || |||| |||| | || ||| ||| ||||||||| | || | Sbjct: 368 cggcagggttcatggatgcaccggtgaagactcctccgtcgaagatgttggcagcaacaa 309 Query: 407 tgaagccgatggcgatgggcgcgatggtgccca-ggctgcccttcttggggtcgacggcg 465 | | ||||||||||| ||| ||||| ||||| | |||| || ||||||||||||| |||| Sbjct: 308 taaggccgatggcgaggggagcgatagtgccgatggct-cctttcttggggtcgatggcg 250 Query: 466 gtggcgta 473 |||||||| Sbjct: 249 gtggcgta 242
>gb|AY079114.1| Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds Length = 762 Score = 63.9 bits (32), Expect = 4e-07 Identities = 104/128 (81%) Strand = Plus / Minus Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 608 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 549 Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 548 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 489 Query: 466 gtggcgta 473 |||||||| Sbjct: 488 gtggcgta 481
>gb|AF419613.1|AF419613 Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds Length = 1061 Score = 63.9 bits (32), Expect = 4e-07 Identities = 104/128 (81%) Strand = Plus / Minus Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 670 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 611 Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 610 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 551 Query: 466 gtggcgta 473 |||||||| Sbjct: 550 gtggcgta 543
>gb|AF428341.1|AF428341 Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds Length = 1066 Score = 63.9 bits (32), Expect = 4e-07 Identities = 104/128 (81%) Strand = Plus / Minus Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 675 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 616 Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 615 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 556 Query: 466 gtggcgta 473 |||||||| Sbjct: 555 gtggcgta 548
>gb|AF004393.1|AF004393 Arabidopsis thaliana salt-stress induced tonoplast intrinsic protein mRNA, complete cds Length = 1072 Score = 63.9 bits (32), Expect = 4e-07 Identities = 104/128 (81%) Strand = Plus / Minus Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 682 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 623 Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 622 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 563 Query: 466 gtggcgta 473 |||||||| Sbjct: 562 gtggcgta 555
>emb|BX822807.1|CNS0A75T Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB65ZD08 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1010 Score = 63.9 bits (32), Expect = 4e-07 Identities = 104/128 (81%) Strand = Plus / Minus Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 658 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 599 Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 598 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 539 Query: 466 gtggcgta 473 |||||||| Sbjct: 538 gtggcgta 531
>emb|BX822624.1|CNS0A742 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB53ZH08 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1020 Score = 63.9 bits (32), Expect = 4e-07 Identities = 104/128 (81%) Strand = Plus / Minus Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 656 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 597 Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 596 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 537 Query: 466 gtggcgta 473 |||||||| Sbjct: 536 gtggcgta 529
>emb|BX824073.1|CNS0A6T2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH1ZE06 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1008 Score = 63.9 bits (32), Expect = 4e-07 Identities = 104/128 (81%) Strand = Plus / Minus Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 656 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 597 Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 596 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 537 Query: 466 gtggcgta 473 |||||||| Sbjct: 536 gtggcgta 529
>emb|BX822975.1|CNS0A733 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB78ZD01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1054 Score = 63.9 bits (32), Expect = 4e-07 Identities = 104/128 (81%) Strand = Plus / Minus Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 647 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 588 Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 587 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 528 Query: 466 gtggcgta 473 |||||||| Sbjct: 527 gtggcgta 520
>emb|BX824311.1|CNS0A6PE Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH38ZH05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 995 Score = 63.9 bits (32), Expect = 4e-07 Identities = 104/128 (81%) Strand = Plus / Minus Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 665 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 606 Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 605 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 546 Query: 466 gtggcgta 473 |||||||| Sbjct: 545 gtggcgta 538
>emb|BX823637.1|CNS0A6I3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS5ZE05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 960 Score = 63.9 bits (32), Expect = 4e-07 Identities = 104/128 (81%) Strand = Plus / Minus Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 479 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 420 Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 419 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 360 Query: 466 gtggcgta 473 |||||||| Sbjct: 359 gtggcgta 352
>emb|BX823607.1|CNS0A6MK Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS56ZB09 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1012 Score = 63.9 bits (32), Expect = 4e-07 Identities = 104/128 (81%) Strand = Plus / Minus Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 656 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 597 Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 596 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 537 Query: 466 gtggcgta 473 |||||||| Sbjct: 536 gtggcgta 529
>dbj|AB028611.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MFE16 Length = 82646 Score = 63.9 bits (32), Expect = 4e-07 Identities = 104/128 (81%) Strand = Plus / Plus Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 15518 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 15577 Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 15578 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 15637 Query: 466 gtggcgta 473 |||||||| Sbjct: 15638 gtggcgta 15645
>gb|AY821911.1| Gossypium hirsutum putative tonoplast intrinsic protein mRNA, partial cds Length = 529 Score = 63.9 bits (32), Expect = 4e-07 Identities = 86/104 (82%) Strand = Plus / Minus Query: 193 gcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtag 252 ||||| || |||||||| |||||||||||||||||| | |||||||| | ||||||| Sbjct: 417 gcttaataatcggtggttgggagctgctcgtgggtgttgctgatgaagatgaactcgtag 358 Query: 253 atgacgccggcgaggccgccgccgatgagggggccgacccagta 296 |||| || ||||| || || ||||| ||||| ||||||||||| Sbjct: 357 atgagaccagcgagcccaccaccgataaggggtccgacccagta 314
>gb|AF118381.1|AF118381 Brassica napus tonoplast intrinsic protein (gamma-TIP2) mRNA, complete cds Length = 1020 Score = 63.9 bits (32), Expect = 4e-07 Identities = 104/128 (81%) Strand = Plus / Minus Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 617 acggctgggttcatggaggctccgctgaaagctccaccggcgaggatgttagctccaacg 558 Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 557 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 498 Query: 466 gtggcgta 473 |||||||| Sbjct: 497 gtggcgta 490
>ref|NM_188626.1| Oryza sativa (japonica cultivar-group), Ozsa8229 predicted mRNA Length = 756 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 352 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacga 406 ||||||||||||||||||| || ||||||||| ||| | ||||||||||||||| Sbjct: 590 gggttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 536
>ref|NM_197137.1| Oryza sativa (japonica cultivar-group) putative beta-tonoplast intrinsic protein (OSJNBa0051D19.19), mRNA Length = 1186 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Minus Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 318 |||||||||||| |||||| || |||||||| |||||||||||| |||| || ||| | Sbjct: 855 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 796 Query: 319 cagctgacgagggcggggccgaa 341 |||| |||||| || |||||||| Sbjct: 795 cagccgacgagcgccgggccgaa 773 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 386 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434 |||| ||||||||||||| || |||||||| ||||| ||||||||||| Sbjct: 728 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 680
>ref|NM_189871.1| Oryza sativa (japonica cultivar-group), mRNA Length = 576 Score = 61.9 bits (31), Expect = 2e-06 Identities = 61/71 (85%) Strand = Plus / Minus Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 318 |||||||||||| | ||||||| |||||||| |||||||||||| |||| || ||| | | Sbjct: 512 ccggcgaggccggcaccgatgaaggggccgagccagtacacccagtggtgcctccagtgc 453 Query: 319 cagctgacgag 329 |||| |||||| Sbjct: 452 cagccgacgag 442
>gb|AC023240.9| Oryza sativa chromosome 10 BAC OSJNBa0051D19 genomic sequence, complete sequence Length = 131984 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Plus Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 318 |||||||||||| |||||| || |||||||| |||||||||||| |||| || ||| | Sbjct: 26108 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 26167 Query: 319 cagctgacgagggcggggccgaa 341 |||| |||||| || |||||||| Sbjct: 26168 cagccgacgagcgccgggccgaa 26190 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Plus Query: 386 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434 |||| ||||||||||||| || |||||||| ||||| ||||||||||| Sbjct: 26235 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 26283
>emb|X95650.1|TGTIP1GEN T.gesneriana mRNA for tonoplast intrinsic protein Length = 992 Score = 61.9 bits (31), Expect = 2e-06 Identities = 73/87 (83%) Strand = Plus / Minus Query: 348 ggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgat 407 |||||||||||| ||||| |||| ||| || || || || || |||||||| |||||||| Sbjct: 623 ggcggggttcatcgacgcaccggtgaacgccccaccaaccagaatgttggcaccgacgat 564 Query: 408 gaagccgatggcgatgggcgcgatggt 434 ||| ||||| || ||||| |||||||| Sbjct: 563 gaatccgatcgcaatgggagcgatggt 537 Score = 48.1 bits (24), Expect = 0.026 Identities = 30/32 (93%) Strand = Plus / Minus Query: 271 ccgccgatgagggggccgacccagtacaccca 302 ||||||||||| ||||| |||||||||||||| Sbjct: 703 ccgccgatgagcgggccaacccagtacaccca 672
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Minus Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 318 |||||||||||| |||||| || |||||||| |||||||||||| |||| || ||| | Sbjct: 18187020 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 18186961 Query: 319 cagctgacgagggcggggccgaa 341 |||| |||||| || |||||||| Sbjct: 18186960 cagccgacgagcgccgggccgaa 18186938 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 386 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434 |||| ||||||||||||| || |||||||| ||||| ||||||||||| Sbjct: 18186893 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 18186845
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 61.9 bits (31), Expect = 2e-06 Identities = 61/71 (85%) Strand = Plus / Plus Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 318 |||||||||||| | ||||||| |||||||| |||||||||||| |||| || ||| | | Sbjct: 25641777 ccggcgaggccggcaccgatgaaggggccgagccagtacacccagtggtgcctccagtgc 25641836 Query: 319 cagctgacgag 329 |||| |||||| Sbjct: 25641837 cagccgacgag 25641847
>dbj|AP004380.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0594D10 Length = 143200 Score = 61.9 bits (31), Expect = 2e-06 Identities = 61/71 (85%) Strand = Plus / Plus Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 318 |||||||||||| | ||||||| |||||||| |||||||||||| |||| || ||| | | Sbjct: 95750 ccggcgaggccggcaccgatgaaggggccgagccagtacacccagtggtgcctccagtgc 95809 Query: 319 cagctgacgag 329 |||| |||||| Sbjct: 95810 cagccgacgag 95820
>dbj|AK111931.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-C03, full insert sequence Length = 1200 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Minus Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 318 |||||||||||| |||||| || |||||||| |||||||||||| |||| || ||| | Sbjct: 864 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 805 Query: 319 cagctgacgagggcggggccgaa 341 |||| |||||| || |||||||| Sbjct: 804 cagccgacgagcgccgggccgaa 782 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 386 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434 |||| ||||||||||||| || |||||||| ||||| ||||||||||| Sbjct: 737 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 689
>dbj|AB114828.1| Oryza sativa (japonica cultivar-group) OsTIP3 mRNA for tonoplast intrinsic protein, complete cds Length = 1178 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Minus Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 318 |||||||||||| |||||| || |||||||| |||||||||||| |||| || ||| | Sbjct: 847 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 788 Query: 319 cagctgacgagggcggggccgaa 341 |||| |||||| || |||||||| Sbjct: 787 cagccgacgagcgccgggccgaa 765 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 386 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434 |||| ||||||||||||| || |||||||| ||||| ||||||||||| Sbjct: 720 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 672
>dbj|AK106383.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-102-E03, full insert sequence Length = 1787 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Plus Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 318 |||||||||||| |||||| || |||||||| |||||||||||| |||| || ||| | Sbjct: 139 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 198 Query: 319 cagctgacgagggcggggccgaa 341 |||| |||||| || |||||||| Sbjct: 199 cagccgacgagcgccgggccgaa 221 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Plus Query: 386 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434 |||| ||||||||||||| || |||||||| ||||| ||||||||||| Sbjct: 266 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 314
>dbj|AK099190.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023108H12, full insert sequence Length = 1055 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 352 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacga 406 ||||||||||||||||||| || ||||||||| ||| | ||||||||||||||| Sbjct: 636 gggttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 582
>dbj|AK069592.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023019I12, full insert sequence Length = 1059 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 352 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacga 406 ||||||||||||||||||| || ||||||||| ||| | ||||||||||||||| Sbjct: 639 gggttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 585
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Minus Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 318 |||||||||||| |||||| || |||||||| |||||||||||| |||| || ||| | Sbjct: 18196273 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 18196214 Query: 319 cagctgacgagggcggggccgaa 341 |||| |||||| || |||||||| Sbjct: 18196213 cagccgacgagcgccgggccgaa 18196191 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 386 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434 |||| ||||||||||||| || |||||||| ||||| ||||||||||| Sbjct: 18196146 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 18196098
>dbj|AB012271.1| Aster tripolium mRNA for SAMIPE, partial cds Length = 321 Score = 60.0 bits (30), Expect = 7e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccca 439 |||||||||||||||||| |||||||||||||| || || || ||||||| Sbjct: 321 gatgttggcgccgacgataaagccgatggcgatcggtgcaattgtgccca 272
>ref|NM_124117.2| Arabidopsis thaliana AtTIP2;3; water channel AT5G47450 (AtTIP2;3) mRNA, complete cds Length = 1051 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 386 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434 ||||||||||||| || || ||||||||||||||||| || |||||||| Sbjct: 597 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggt 549
>ref|NM_188505.1| Oryza sativa (japonica cultivar-group), Ozsa8174 predicted mRNA Length = 969 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 307 |||||||||||| ||||||||| ||| |||| |||||||||||| |||| Sbjct: 881 ccggcgaggccggcgccgatgaagggaccgagccagtacacccagtggt 833
>ref|XM_473251.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 798 Score = 58.0 bits (29), Expect = 3e-05 Identities = 125/157 (79%) Strand = Plus / Minus Query: 272 cgccgatgagggggccgacccagtacacccactggtacccccactcccagctgacgaggg 331 |||||||||| || |||| |||||| ||||| |||| | ||| | ||||| |||||| | Sbjct: 697 cgccgatgagcggcccgagccagtaaacccagtggtggcgccagttccagccgacgagcg 638 Query: 332 cggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgagga 391 | |||||||| | | || |||||||||| ||||||| ||| | ||| ||| |||||| Sbjct: 637 ccgggccgaacgcgcgcgccgggttcatggccgcgccgtcgaacgggcccccggcgagga 578 Query: 392 tgttggcgccgacgatgaagccgatggcgatgggcgc 428 |||| ||||| ||| ||||||||||||| |||||| Sbjct: 577 tgttcgcgcccgcgaccaagccgatggcgaggggcgc 541 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 455 ggtcgacggcggtggcgtac 474 |||||||||||||||||||| Sbjct: 517 ggtcgacggcggtggcgtac 498
>gb|BT011663.1| Arabidopsis thaliana At5g47450 mRNA, complete cds Length = 753 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 386 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434 ||||||||||||| || || ||||||||||||||||| || |||||||| Sbjct: 559 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggt 511
>gb|BT011212.1| Arabidopsis thaliana At5g47450 gene, complete cds Length = 853 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 386 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434 ||||||||||||| || || ||||||||||||||||| || |||||||| Sbjct: 587 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggt 539
>gb|AF521135.1| Kandelia candel tonoplast intrinsic protein (TIP) mRNA, complete cds Length = 1099 Score = 58.0 bits (29), Expect = 3e-05 Identities = 35/37 (94%) Strand = Plus / Minus Query: 193 gcttagtagtcggtggtggggagctgctcgtgggtgc 229 ||||||||||| | ||||||||||||||||||||||| Sbjct: 859 gcttagtagtcagcggtggggagctgctcgtgggtgc 823
>emb|AL663019.2|OSJN00221 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0038O10, complete sequence Length = 141545 Score = 58.0 bits (29), Expect = 3e-05 Identities = 125/157 (79%) Strand = Plus / Minus Query: 272 cgccgatgagggggccgacccagtacacccactggtacccccactcccagctgacgaggg 331 |||||||||| || |||| |||||| ||||| |||| | ||| | ||||| |||||| | Sbjct: 131407 cgccgatgagcggcccgagccagtaaacccagtggtggcgccagttccagccgacgagcg 131348 Query: 332 cggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgagga 391 | |||||||| | | || |||||||||| ||||||| ||| | ||| ||| |||||| Sbjct: 131347 ccgggccgaacgcgcgcgccgggttcatggccgcgccgtcgaacgggcccccggcgagga 131288 Query: 392 tgttggcgccgacgatgaagccgatggcgatgggcgc 428 |||| ||||| ||| ||||||||||||| |||||| Sbjct: 131287 tgttcgcgcccgcgaccaagccgatggcgaggggcgc 131251 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 455 ggtcgacggcggtggcgtac 474 |||||||||||||||||||| Sbjct: 131227 ggtcgacggcggtggcgtac 131208
>dbj|AP002094.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0483F08 Length = 148985 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Plus Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 307 |||||||||||| ||||||||| ||| |||| |||||||||||| |||| Sbjct: 125093 ccggcgaggccggcgccgatgaagggaccgagccagtacacccagtggt 125141
>dbj|AB025628.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNJ7 Length = 80117 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Plus Query: 386 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434 ||||||||||||| || || ||||||||||||||||| || |||||||| Sbjct: 8647 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggt 8695
>dbj|AK108116.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-139-C05, full insert sequence Length = 912 Score = 58.0 bits (29), Expect = 3e-05 Identities = 125/157 (79%) Strand = Plus / Minus Query: 272 cgccgatgagggggccgacccagtacacccactggtacccccactcccagctgacgaggg 331 |||||||||| || |||| |||||| ||||| |||| | ||| | ||||| |||||| | Sbjct: 763 cgccgatgagcggcccgagccagtaaacccagtggtggcgccagttccagccgacgagcg 704 Query: 332 cggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgagga 391 | |||||||| | | || |||||||||| ||||||| ||| | ||| ||| |||||| Sbjct: 703 ccgggccgaacgcgcgcgccgggttcatggccgcgccgtcgaacgggcccccggcgagga 644 Query: 392 tgttggcgccgacgatgaagccgatggcgatgggcgc 428 |||| ||||| ||| ||||||||||||| |||||| Sbjct: 643 tgttcgcgcccgcgaccaagccgatggcgaggggcgc 607 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 455 ggtcgacggcggtggcgtac 474 |||||||||||||||||||| Sbjct: 583 ggtcgacggcggtggcgtac 564
>dbj|AB048248.1| Pyrus communis Py-gTIP mRNA for gamma tonoplast intrinsic protein, complete cds Length = 1122 Score = 56.0 bits (28), Expect = 1e-04 Identities = 58/68 (85%) Strand = Plus / Minus Query: 391 atgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttc 450 ||||||||||| |||||||| || || |||||||||||||| || |||| ||| || ||| Sbjct: 631 atgttggcgccaacgatgaaaccaatcgcgatgggcgcgattgtccccacgctcccattc 572 Query: 451 ttggggtc 458 || ||||| Sbjct: 571 ttcgggtc 564
>gb|BT016509.1| Zea mays clone Contig342 mRNA sequence Length = 1237 Score = 54.0 bits (27), Expect = 4e-04 Identities = 54/63 (85%) Strand = Plus / Minus Query: 245 gctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacccact 304 ||||||||| |||||||| ||||||| |||||| | ||| || |||||||||||||| | Sbjct: 880 gctcgtagacgacgccggagaggccggcgccgaccatgggccccacccagtacacccatt 821 Query: 305 ggt 307 ||| Sbjct: 820 ggt 818
>gb|DQ226889.1| Boechera divaricarpa isolate SLW-D-E07 mRNA sequence Length = 980 Score = 54.0 bits (27), Expect = 4e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 197 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 256 ||||||||||||| |||||||| ||||||||| | ||||||| | ||||||||||| Sbjct: 767 agtagtcggtggttgggagctgttcgtgggtggtgttaatgaagaaaacctcgtagatga 708 Query: 257 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 307 ||||||| || ||||||| ||| || ||| ||||||| ||||| |||| Sbjct: 707 gtccggcgattccaccgccgacgagaggtccggcccagtagacccagtggt 657
>emb|X72581.1|ATGTIPMR A.thaliana mRNA for tonoplast intrinsic protein gamma (gamma-TIP) Length = 933 Score = 54.0 bits (27), Expect = 4e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 197 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 256 ||||||||||||| |||||||||||||| ||| | |||||||| | |||||||||| Sbjct: 787 agtagtcggtggttgggagctgctcgtgtgtggtgttgatgaagaaaacttcgtagatga 728 Query: 257 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 307 || |||| || ||||||| ||| || ||| ||||||||||||| |||| Sbjct: 727 gtccagcgattccaccgccgacgagaggtccggcccagtacacccagtggt 677
>emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquaporin (delta-TIP gene) Length = 1017 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 321 gctgacgagggcggggccgaaggagacggcggggttcat 359 |||||||| |||||||||||||||| |||||||||||| Sbjct: 624 gctgacgacggcggggccgaaggagcgggcggggttcat 586
>gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putative aquaporin TIP1 (TIP1) mRNA, complete cds Length = 1057 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 321 gctgacgagggcggggccgaaggagacggcggggttcat 359 |||||||| |||||||||||||||| |||||||||||| Sbjct: 666 gctgacgacggcggggccgaaggagcgggcggggttcat 628
>emb|BX823744.1|CNS0A6NJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS71ZE09 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 573 Score = 52.0 bits (26), Expect = 0.002 Identities = 95/118 (80%) Strand = Plus / Minus Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 183 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 124 Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacgg 463 ||||| || |||||||| || ||||| || || || || || ||||||||||| |||| Sbjct: 123 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacgg 66
>dbj|AB012268.1| Aster tripolium mRNA for SAMIPB, partial cds Length = 321 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 390 gatgttggcgccgacgatgaagccgatggc 419 |||||||||||||||||| ||||||||||| Sbjct: 321 gatgttggcgccgacgataaagccgatggc 292
>gb|AF367456.1| Prunus persica clone gTip1 gamma-tonoplast intrinsic protein mRNA, partial cds Length = 408 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 318 ccagctgacgagggcggggccgaaggagacggcggggttcatgga 362 ||||||||||| ||||| ||||||||||| || ||||||||||| Sbjct: 393 ccagctgacgacagcgggtccgaaggagactgccgggttcatgga 349
>emb|BX842138.1|CNS09YDN Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS54ZD02 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1062 Score = 50.1 bits (25), Expect = 0.007 Identities = 70/85 (82%) Strand = Plus / Minus Query: 389 ggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccct 448 ||||||| || || |||||||| || |||||||| || ||||| || || || || || | Sbjct: 613 ggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactaccgt 554 Query: 449 tcttggggtcgacggcggtggcgta 473 |||||||||| ||||| |||||||| Sbjct: 553 tcttggggtcaacggctgtggcgta 529
>dbj|AB012269.1| Aster tripolium mRNA for SAMIPC, partial cds Length = 321 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 397 gcgccgacgatgaagccgatggcga 421 ||||||||||||||||||||||||| Sbjct: 314 gcgccgacgatgaagccgatggcga 290
>dbj|AB012267.1| Aster tripolium mRNA for SAMIPA, partial cds Length = 321 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 394 ttggcgccgacgatgaagccgatggcgat 422 |||||||||||||| |||||||||||||| Sbjct: 317 ttggcgccgacgataaagccgatggcgat 289
>gb|U92651.2|BOU92651 Brassica oleracea var. botrytis tonoplast intrinsic protein bobTIP26-1 mRNA, complete cds Length = 942 Score = 48.1 bits (24), Expect = 0.026 Identities = 30/32 (93%) Strand = Plus / Minus Query: 197 agtagtcggtggtggggagctgctcgtgggtg 228 ||||||||| |||||||||||| ||||||||| Sbjct: 790 agtagtcggcggtggggagctgttcgtgggtg 759 Score = 48.1 bits (24), Expect = 0.026 Identities = 69/84 (82%) Strand = Plus / Minus Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 449 ||||||||| || || ||||| ||||| |||||||| || || || || || || || || Sbjct: 597 gatgttggcaccaacaatgaaaccgatagcgatgggagctattgttccaagacttccgtt 538 Query: 450 cttggggtcgacggcggtggcgta 473 |||||| || |||||||||||||| Sbjct: 537 cttgggatcaacggcggtggcgta 514
>gb|AF326509.1|AF326509 Zea mays tonoplast membrane integral protein ZmTIP5-1 mRNA, complete cds Length = 1021 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 321 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgcc 368 |||||||| ||| |||||||| ||| ||| ||||||||||||||||| Sbjct: 709 gctgacgacggccgggccgaacgagcgggccgggttcatggacgcgcc 662
>emb|BX822304.1|CNS0A7A0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB27ZF06 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 628 Score = 48.1 bits (24), Expect = 0.026 Identities = 72/88 (81%) Strand = Plus / Minus Query: 386 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgc 445 |||||||||| || || |||||||| || |||||||| || ||||| || || || || | Sbjct: 182 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 123 Query: 446 ccttcttggggtcgacggcggtggcgta 473 | ||||||||||| |||| |||||||| Sbjct: 122 cgttcttggggtctacggttgtggcgta 95
>emb|BX825064.1|CNS0A6TA Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH92ZF07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 931 Score = 48.1 bits (24), Expect = 0.026 Identities = 102/128 (79%) Strand = Plus / Minus Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405 ||||| ||||||||||| ||||| ||| || || ||| |||||||||| || || ||| Sbjct: 644 acggctgggttcatggaagcgcccctgaacgctccaccggcgaggatgttcgctccaacg 585 Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465 ||||| | |||||||| || ||||| |||| || | || ||||||||||| ||||| Sbjct: 584 atgaaacttatggcgattggtgcgattttgccgagaataccgttcttggggtcaacggct 525 Query: 466 gtggcgta 473 |||||||| Sbjct: 524 gtggcgta 517
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome Length = 4751080 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 395 tggcgccgacgatgaagccgatggcgatgggcgcga 430 |||||||||||||||||||| || ||||||| |||| Sbjct: 3239016 tggcgccgacgatgaagccggtgacgatgggggcga 3238981 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 397 gcgccgacgatgaagccgatg 417 ||||||||||||||||||||| Sbjct: 3655270 gcgccgacgatgaagccgatg 3655250
>emb|X53040.1|RNNIP26 R.norvegicus MIP-26 mRNA Length = 336 Score = 46.1 bits (23), Expect = 0.10 Identities = 38/43 (88%) Strand = Plus / Minus Query: 265 aggccgccgccgatgagggggccgacccagtacacccactggt 307 ||||| |||||||||| ||||| |||||||||||||| |||| Sbjct: 301 aggcccccgccgatgattgggcccacccagtacacccagtggt 259
>gb|AF521142.1| Kandelia candel tonoplast intrinsic protein mRNA, partial cds Length = 175 Score = 46.1 bits (23), Expect = 0.10 Identities = 41/47 (87%) Strand = Plus / Minus Query: 393 gttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccca 439 |||||| || || ||||| ||||||||||| |||||||| ||||||| Sbjct: 62 gttggcacccacaatgaaaccgatggcgattggcgcgattgtgccca 16
>emb|X53052.1|RRMIP Rat partial mRNA for main intrinsic protein Length = 936 Score = 46.1 bits (23), Expect = 0.10 Identities = 38/43 (88%) Strand = Plus / Minus Query: 265 aggccgccgccgatgagggggccgacccagtacacccactggt 307 ||||| |||||||||| ||||| |||||||||||||| |||| Sbjct: 635 aggcccccgccgatgattgggcccacccagtacacccagtggt 593
>emb|X12514.1|RNMIP26R Rat mRNA fragment for main intrinsic protein 26 (MIP26) Length = 543 Score = 46.1 bits (23), Expect = 0.10 Identities = 38/43 (88%) Strand = Plus / Minus Query: 265 aggccgccgccgatgagggggccgacccagtacacccactggt 307 ||||| |||||||||| ||||| |||||||||||||| |||| Sbjct: 242 aggcccccgccgatgattgggcccacccagtacacccagtggt 200
>gb|AY130971.1| Brassica oleracea var. botrytis tonoplast intrinsic protein bobTIP26-2 gene, complete cds Length = 1442 Score = 46.1 bits (23), Expect = 0.10 Identities = 89/111 (80%) Strand = Plus / Minus Query: 197 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 256 |||||||||||||||||||||| || || ||| | |||||||| | ||||||||||| Sbjct: 1247 agtagtcggtggtggggagctgttcatgtgtggtgttgatgaagaaaacctcgtagatga 1188 Query: 257 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 307 ||||||| || |||||||| || || || ||||||| ||||| |||| Sbjct: 1187 gtccggcgactccaccgccgataagaggtccagcccagtagacccagtggt 1137
>emb|AJ251652.1|MTR251652 Medicago truncatula mRNA for aquaporin (aqp1 gene) Length = 1120 Score = 46.1 bits (23), Expect = 0.10 Identities = 41/47 (87%) Strand = Plus / Minus Query: 196 tagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagag 242 |||||||| || || ||||||||||||||||||| | ||||||||| Sbjct: 837 tagtagtcagtagttgggagctgctcgtgggtgctgttgatgaagag 791
>gb|U92652.2|BOU92652 Brassica oleracea var. botrytis tonoplast intrinsic protein bobTIP26-2 mRNA, partial cds Length = 599 Score = 46.1 bits (23), Expect = 0.10 Identities = 89/111 (80%) Strand = Plus / Minus Query: 197 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 256 |||||||||||||||||||||| || || ||| | |||||||| | ||||||||||| Sbjct: 526 agtagtcggtggtggggagctgttcatgtgtggtgttgatgaagaaaacctcgtagatga 467 Query: 257 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 307 ||||||| || |||||||| || || || ||||||| ||||| |||| Sbjct: 466 gtccggcgactccaccgccgataagaggtccagcccagtagacccagtggt 416
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 258 gccggcgaggccgccgccgatga 280 ||||||||||||||||||||||| Sbjct: 3111631 gccggcgaggccgccgccgatga 3111609 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 257 cgccggcgaggccgccgccgatga 280 ||||||||||||| |||||||||| Sbjct: 505314 cgccggcgaggccaccgccgatga 505291
>gb|AC020922.9| Homo sapiens chromosome 19 clone CTD-2105E13, complete sequence Length = 134793 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Plus Query: 165 cgggcgggcggggggcaggcggc 187 ||||||||||||||||||||||| Sbjct: 78789 cgggcgggcggggggcaggcggc 78811
>ref|XM_343137.2| PREDICTED: Rattus norvegicus major intrinsic protein of eye lens fiber (Mip), mRNA Length = 2075 Score = 46.1 bits (23), Expect = 0.10 Identities = 38/43 (88%) Strand = Plus / Minus Query: 265 aggccgccgccgatgagggggccgacccagtacacccactggt 307 ||||| |||||||||| ||||| |||||||||||||| |||| Sbjct: 685 aggcccccgccgatgattgggcccacccagtacacccagtggt 643
>gb|AY207429.1| Homo sapiens interleukin 11 (IL11) gene, complete cds Length = 9803 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 165 cgggcgggcggggggcaggcggc 187 ||||||||||||||||||||||| Sbjct: 1449 cgggcgggcggggggcaggcggc 1427
>emb|AJ605573.1| Ricinus communis mRNA for aquaporin (Tip1-1 gene), clone pT4L Length = 1057 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 195 ttagtagtcggtggtggggagctgctcgtgggtgc 229 ||||||||| ||||| ||||||||||| ||||||| Sbjct: 804 ttagtagtcagtggtagggagctgctcatgggtgc 770
>gb|AY112625.1| Zea mays CL46210_1 mRNA sequence Length = 479 Score = 46.1 bits (23), Expect = 0.10 Identities = 53/63 (84%) Strand = Plus / Plus Query: 245 gctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacccact 304 ||||| ||| |||||||| ||||||| |||||| | ||| || |||||||||||||| | Sbjct: 279 gctcgaagacgacgccggagaggccggcgccgaccatgggccccacccagtacacccatt 338 Query: 305 ggt 307 ||| Sbjct: 339 ggt 341
>gb|AF000143.1|HSAF000143 Human putative alternative lens membrane intrinsic protein (PALM) mRNA, partial cds Length = 789 Score = 46.1 bits (23), Expect = 0.10 Identities = 38/43 (88%) Strand = Plus / Minus Query: 265 aggccgccgccgatgagggggccgacccagtacacccactggt 307 ||||| |||||||||| ||||| |||||||||||||| |||| Sbjct: 641 aggcccccgccgatgattgggcccacccagtacacccagtggt 599
>gb|M81890.1|HUMIL11A Human interleukin 11 (IL11) gene, complete mRNA Length = 6870 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 165 cgggcgggcggggggcaggcggc 187 ||||||||||||||||||||||| Sbjct: 688 cgggcgggcggggggcaggcggc 666
>dbj|AB010416.1| Raphanus sativus VIP3 mRNA for delta-VM23, complete cds Length = 911 Score = 46.1 bits (23), Expect = 0.10 Identities = 41/47 (87%) Strand = Plus / Minus Query: 388 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434 ||||||||||| |||||||||| || ||||||| ||| |||||||| Sbjct: 598 aggatgttggcaccgacgatgagaccaatggcgaggggagcgatggt 552
>gb|L12257.1|SOYNODA Glycine max nodulin-26 mRNA, complete cds Length = 1047 Score = 46.1 bits (23), Expect = 0.10 Identities = 68/83 (81%) Strand = Plus / Minus Query: 391 atgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttc 450 ||||| ||||| || ||||| || ||||||||||| || || | |||| |||||||| Sbjct: 665 atgttagcgccaacaatgaaaccaatggcgatgggagcaataattcccaaattgcccttc 606 Query: 451 ttggggtcgacggcggtggcgta 473 |||||||| ||||| |||||||| Sbjct: 605 ttggggtcaacggcagtggcgta 583
>ref|XM_476227.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 756 Score = 44.1 bits (22), Expect = 0.41 Identities = 49/58 (84%) Strand = Plus / Minus Query: 352 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatga 409 |||||||| ||||||||||||||| ||| || ||| | ||||||| |||||||||| Sbjct: 596 gggttcattgacgcgccggagaagttgccaccagcgatggtgttggcaccgacgatga 539
>gb|AC145396.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0042F15, complete sequence Length = 162959 Score = 44.1 bits (22), Expect = 0.41 Identities = 49/58 (84%) Strand = Plus / Minus Query: 352 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatga 409 |||||||| ||||||||||||||| ||| || ||| | ||||||| |||||||||| Sbjct: 86935 gggttcattgacgcgccggagaagttgccaccagcgatggtgttggcaccgacgatga 86878
>emb|AL591787.1|SME591787 Sinorhizobium meliloti 1021 complete chromosome; segment 6/12 Length = 329100 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 259 ccggcgaggccgccgccgatga 280 |||||||||||||||||||||| Sbjct: 213784 ccggcgaggccgccgccgatga 213805
>ref|XM_851400.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 11 (LOC479191), mRNA Length = 4681 Score = 44.1 bits (22), Expect = 0.41 Identities = 31/34 (91%) Strand = Plus / Minus Query: 156 acggacggacgggcgggcggggggcaggcggcgg 189 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>ref|XM_536333.2| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 1 (LOC479191), mRNA Length = 4681 Score = 44.1 bits (22), Expect = 0.41 Identities = 31/34 (91%) Strand = Plus / Minus Query: 156 acggacggacgggcgggcggggggcaggcggcgg 189 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>ref|XM_851314.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 10 (LOC479191), mRNA Length = 4663 Score = 44.1 bits (22), Expect = 0.41 Identities = 31/34 (91%) Strand = Plus / Minus Query: 156 acggacggacgggcgggcggggggcaggcggcgg 189 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>ref|XM_851274.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 9 (LOC479191), mRNA Length = 4438 Score = 44.1 bits (22), Expect = 0.41 Identities = 31/34 (91%) Strand = Plus / Minus Query: 156 acggacggacgggcgggcggggggcaggcggcgg 189 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>ref|XM_851189.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 7 (LOC479191), mRNA Length = 4777 Score = 44.1 bits (22), Expect = 0.41 Identities = 31/34 (91%) Strand = Plus / Minus Query: 156 acggacggacgggcgggcggggggcaggcggcgg 189 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>ref|XM_851152.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 6 (LOC479191), mRNA Length = 4696 Score = 44.1 bits (22), Expect = 0.41 Identities = 31/34 (91%) Strand = Plus / Minus Query: 156 acggacggacgggcgggcggggggcaggcggcgg 189 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>ref|XM_851023.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 3 (LOC479191), mRNA Length = 4681 Score = 44.1 bits (22), Expect = 0.41 Identities = 31/34 (91%) Strand = Plus / Minus Query: 156 acggacggacgggcgggcggggggcaggcggcgg 189 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>emb|X95952.1|HAAP H.annuus mRNA for aquaporin Length = 931 Score = 44.1 bits (22), Expect = 0.41 Identities = 28/30 (93%) Strand = Plus / Minus Query: 444 gcccttcttggggtcgacggcggtggcgta 473 ||||||||||||||| || ||||||||||| Sbjct: 553 gcccttcttggggtcaactgcggtggcgta 524
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 330 ggcggggccgaaggagacggcg 351 |||||||||||||||||||||| Sbjct: 8473737 ggcggggccgaaggagacggcg 8473716 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 330 ggcggggccgaaggagacggcg 351 |||||||||||||||||||||| Sbjct: 8461221 ggcggggccgaaggagacggcg 8461200
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 44.1 bits (22), Expect = 0.41 Identities = 49/58 (84%) Strand = Plus / Minus Query: 352 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatga 409 |||||||| ||||||||||||||| ||| || ||| | ||||||| |||||||||| Sbjct: 7902160 gggttcattgacgcgccggagaagttgccaccagcgatggtgttggcaccgacgatga 7902103
>dbj|AK072531.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023131O04, full insert sequence Length = 1252 Score = 44.1 bits (22), Expect = 0.41 Identities = 49/58 (84%) Strand = Plus / Minus Query: 352 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatga 409 |||||||| ||||||||||||||| ||| || ||| | ||||||| |||||||||| Sbjct: 787 gggttcattgacgcgccggagaagttgccaccagcgatggtgttggcaccgacgatga 730
>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence Length = 2094509 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 402 gacgatgaagccgatggcgatgggcg 427 ||||||| |||||||||||||||||| Sbjct: 1047164 gacgatgtagccgatggcgatgggcg 1047139
>dbj|AK060193.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-001-E07, full insert sequence Length = 1100 Score = 44.1 bits (22), Expect = 0.41 Identities = 49/58 (84%) Strand = Plus / Minus Query: 352 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatga 409 |||||||| ||||||||||||||| ||| || ||| | ||||||| |||||||||| Sbjct: 786 gggttcattgacgcgccggagaagttgccaccagcgatggtgttggcaccgacgatga 729
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 330 ggcggggccgaaggagacggcg 351 |||||||||||||||||||||| Sbjct: 8473620 ggcggggccgaaggagacggcg 8473599 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 330 ggcggggccgaaggagacggcg 351 |||||||||||||||||||||| Sbjct: 8461104 ggcggggccgaaggagacggcg 8461083
>emb|AL928775.2|CNS08CC5 Oryza sativa chromosome 12, . BAC OSJNBa0030N06 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 146444 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 330 ggcggggccgaaggagacggcg 351 |||||||||||||||||||||| Sbjct: 80400 ggcggggccgaaggagacggcg 80379 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 330 ggcggggccgaaggagacggcg 351 |||||||||||||||||||||| Sbjct: 67884 ggcggggccgaaggagacggcg 67863
>gb|AE017351.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 11, complete sequence Length = 1019846 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 302 actggtacccccactcccagc 322 ||||||||||||||||||||| Sbjct: 290624 actggtacccccactcccagc 290604
>gb|AC154709.2| Mus musculus BAC clone RP24-357I4 from chromosome 12, complete sequence Length = 136354 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 156 acggacggacgggcgggcggg 176 ||||||||||||||||||||| Sbjct: 94084 acggacggacgggcgggcggg 94104
>gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome Length = 3814139 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 390 gatgttggcgccgacgatgaagccg 414 ||||||| ||||||||||||||||| Sbjct: 2949085 gatgttgtcgccgacgatgaagccg 2949061
>ref|XM_593064.2| PREDICTED: Bos taurus similar to tumor protein p73 (LOC515105), mRNA Length = 2606 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 267 gccgccgccgatgagggggcc 287 ||||||||||||||||||||| Sbjct: 22 gccgccgccgatgagggggcc 42
>gb|AY581827.1| Cynodon dactylon NOD26-like membrane integral protein-like mRNA, partial sequence Length = 555 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 345 gacggcggggttcatggacgcgccggaga 373 |||||||||||||||| ||||||||||| Sbjct: 425 gacggcggggttcatgtgcgcgccggaga 397
>gb|AF183913.1| Azospirillum brasilense major outer membrane protein OmaA precursor (omaA) gene, complete cds Length = 1435 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 259 ccggcgaggccgccgccgatg 279 ||||||||||||||||||||| Sbjct: 698 ccggcgaggccgccgccgatg 678
>ref|XM_856403.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript variant 2 (LOC607978), mRNA Length = 1082 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 330 ggcggggccgaaggagacggcggggttcatgga 362 |||||||||||||||| ||| ||||||||||| Sbjct: 588 ggcggggccgaaggagcgggccgggttcatgga 556
>ref|XM_845359.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript variant 1 (LOC607978), mRNA Length = 1067 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 330 ggcggggccgaaggagacggcggggttcatgga 362 |||||||||||||||| ||| ||||||||||| Sbjct: 573 ggcggggccgaaggagcgggccgggttcatgga 541
>emb|CT025679.5| Mouse DNA sequence from clone RP24-296K22 on chromosome 14, complete sequence Length = 160805 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 156 acggacggacgggcgggcggg 176 ||||||||||||||||||||| Sbjct: 155955 acggacggacgggcgggcggg 155935
>ref|XM_567655.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein (CNK00920) partial mRNA Length = 2340 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 302 actggtacccccactcccagc 322 ||||||||||||||||||||| Sbjct: 2133 actggtacccccactcccagc 2113
>gb|AC123532.4| Mus musculus chromosome 14 clone RP23-84B6, complete sequence Length = 166421 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 156 acggacggacgggcgggcggg 176 ||||||||||||||||||||| Sbjct: 7846 acggacggacgggcgggcggg 7826
>gb|AC098877.3| Mus musculus BAC clone RP23-2C24 from 14, complete sequence Length = 240151 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 156 acggacggacgggcgggcggg 176 ||||||||||||||||||||| Sbjct: 37973 acggacggacgggcgggcggg 37953
>gb|AC104099.5| Mus musculus BAC clone RP24-372J8 from 3, complete sequence Length = 148259 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 156 acggacggacgggcgggcggg 176 ||||||||||||||||||||| Sbjct: 37509 acggacggacgggcgggcggg 37489 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 153 cacacggacggacgggcgggcggg 176 ||||||||||||||| |||||||| Sbjct: 37516 cacacggacggacggacgggcggg 37493
>gb|BC012214.1| Mus musculus Rab geranylgeranyl transferase, a subunit, mRNA (cDNA clone MGC:19255 IMAGE:3967218), complete cds Length = 2176 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 156 acggacggacgggcgggcggg 176 ||||||||||||||||||||| Sbjct: 23 acggacggacgggcgggcggg 43
>gb|AY258323.1| Rubella virus strain BRD-II, complete genome Length = 9778 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 165 cgggcgggcggggggcaggcggcgg 189 ||||||||| ||||||||||||||| Sbjct: 2327 cgggcgggctgggggcaggcggcgg 2303
>ref|XM_503667.1| Yarrowia lipolytica CLIB122, YALI0E07557g predicted mRNA Length = 2157 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 434 tgcccaggctgcccttcttgg 454 ||||||||||||||||||||| Sbjct: 1060 tgcccaggctgcccttcttgg 1040
>ref|NM_019519.1| Mus musculus Rab geranylgeranyl transferase, a subunit (Rabggta), mRNA Length = 2547 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 156 acggacggacgggcgggcggg 176 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>ref|XM_961391.1| PREDICTED: Tribolium castaneum similar to CG31000-PC, isoform C (LOC654951), mRNA Length = 3244 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 257 cgccggcgaggccgccgccga 277 ||||||||||||||||||||| Sbjct: 1642 cgccggcgaggccgccgccga 1622
>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome Length = 4501104 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 261 ggcgaggccgccgccgatgag 281 ||||||||||||||||||||| Sbjct: 1201038 ggcgaggccgccgccgatgag 1201058
>emb|BX640442.1| Bordetella bronchiseptica strain RB50, complete genome; segment 6/16 Length = 349876 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 390 gatgttggcgccgacgatgaagccg 414 ||||| ||||||||||||||||||| Sbjct: 151437 gatgtcggcgccgacgatgaagccg 151461
>emb|BX640430.1| Bordetella parapertussis strain 12822, complete genome; segment 8/14 Length = 348014 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 390 gatgttggcgccgacgatgaagccg 414 ||||| ||||||||||||||||||| Sbjct: 62418 gatgtcggcgccgacgatgaagccg 62442
>emb|AL390091.1|NCB12F1 Neurospora crassa DNA linkage group II BAC clone B12F1 Length = 68478 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 156 acggacggacgggcgggcggg 176 ||||||||||||||||||||| Sbjct: 42894 acggacggacgggcgggcggg 42914 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 153 cacacggacggacgggcgggcggg 176 ||||||||||||||| |||||||| Sbjct: 42887 cacacggacggacggacgggcggg 42910
>emb|AJ489613.1|CAR489613 Cicer arietinum partial mRNA for tonoplast intrinsic protein (tip gene) Length = 716 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 196 tagtagtcggtggtggggagctgctcgtgggtg 228 |||||||| ||||| ||||| |||||||||||| Sbjct: 428 tagtagtcagtggtagggagttgctcgtgggtg 396 Score = 40.1 bits (20), Expect = 6.4 Identities = 38/44 (86%) Strand = Plus / Minus Query: 334 gggccgaaggagacggcggggttcatggacgcgccggagaaggc 377 |||||||| || ||||| ||||||||||| || |||| |||||| Sbjct: 290 gggccgaatgacacggctgggttcatggatgctccggtgaaggc 247
>emb|AJ243309.1|PSA243309 Pisum sativum mRNA for putative tonoplast intrinsic protein (gene tip1-1) Length = 1104 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 337 ccgaaggagacggcggggttcatggacgcgccggagaaggc 377 ||||| || ||||||||||||||||| || |||| |||||| Sbjct: 686 ccgaatgacacggcggggttcatggatgctccggtgaaggc 646
>emb|BX470185.18| Zebrafish DNA sequence from clone CH211-222D3 in linkage group 3, complete sequence Length = 198900 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 156 acggacggacgggcgggcggg 176 ||||||||||||||||||||| Sbjct: 27616 acggacggacgggcgggcggg 27596
>gb|AC183494.1| Brassica oleracea Contig C, complete sequence Length = 285752 Score = 42.1 bits (21), Expect = 1.6 Identities = 42/49 (85%) Strand = Plus / Minus Query: 386 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434 ||||||||||||| || |||||||| || || ||||| || |||||||| Sbjct: 123743 cgaggatgttggcaccaacgatgaaaccaatagcgattggtgcgatggt 123695
>dbj|AK146917.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched library, clone:I920074L06 product:Rab geranylgeranyl transferase, a subunit, full insert sequence Length = 2422 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 156 acggacggacgggcgggcggg 176 ||||||||||||||||||||| Sbjct: 41 acggacggacgggcgggcggg 61
>gb|U62778.1|GHU62778 Gossypium hirsutum delta-tonoplast intrinsic protein mRNA, complete cds Length = 997 Score = 42.1 bits (21), Expect = 1.6 Identities = 39/45 (86%) Strand = Plus / Minus Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434 ||||||||| || || |||||||||||||| ||||| || ||||| Sbjct: 592 gatgttggcaccaacaatgaagccgatggcaatgggtgcaatggt 548
>gb|AF342810.1|AF342810 Zea mays NOD26-like membrane integral protein ZmNIP2-3 mRNA, complete cds Length = 1300 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 345 gacggcggggttcatggacgcgccggaga 373 |||||||||||||||| ||||||||||| Sbjct: 442 gacggcggggttcatgtgcgcgccggaga 414
>gb|AF326507.1|AF326507 Zea mays tonoplast membrane integral protein ZmTIP4-3 mRNA, complete cds Length = 1045 Score = 42.1 bits (21), Expect = 1.6 Identities = 63/77 (81%) Strand = Plus / Minus Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389 |||||| |||||||| ||| ||||||||||| |||||||| | |||| ||||| ||| Sbjct: 714 ggcgggcccgaaggacctggccgggttcatggaggcgccggacagggcggcgccggcgac 655 Query: 390 gatgttggcgccgacga 406 | |||||| ||||||| Sbjct: 654 ggagttggccccgacga 638
>gb|AF326485.1|AF326485 Zea mays NOD26-like membrane integral protein ZmNIP2-2 mRNA, complete cds Length = 1387 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 345 gacggcggggttcatggacgcgccggaga 373 |||||||||||||||| ||||||||||| Sbjct: 452 gacggcggggttcatgtgcgcgccggaga 424
>emb|BX822791.1|CNS0A7SC Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB64ZD05 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 503 Score = 42.1 bits (21), Expect = 1.6 Identities = 63/77 (81%) Strand = Plus / Minus Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 95 acggctgggttcatggaagcaccgctgaaagctccaccggcgaggatgttagctccaacg 36 Query: 406 atgaagccgatggcgat 422 ||||| || |||||||| Sbjct: 35 atgaaacctatggcgat 19
>emb|BX842211.1|CNS09YE1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL65ZH05 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1014 Score = 42.1 bits (21), Expect = 1.6 Identities = 57/69 (82%) Strand = Plus / Minus Query: 405 gatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggc 464 |||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 589 gatgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggc 530 Query: 465 ggtggcgta 473 |||||||| Sbjct: 529 tgtggcgta 521
>gb|AC135495.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1664B11, complete sequence Length = 126040 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 156 acggacggacgggcgggcggg 176 ||||||||||||||||||||| Sbjct: 56775 acggacggacgggcgggcggg 56755
>ref|NM_214226.1| Sus scrofa inositol(1,3,4,5)tetrakisphosphate receptor (CENTA1), mRNA Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 157 cggacggacgggcgggcggggggca 181 |||||||||||||||||||| |||| Sbjct: 56 cggacggacgggcgggcgggcggca 80
>gb|AE004658.1| Pseudomonas aeruginosa PAO1, section 219 of 529 of the complete genome Length = 11864 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 257 cgccggcgaggccgccgccga 277 ||||||||||||||||||||| Sbjct: 2650 cgccggcgaggccgccgccga 2630
>gb|AF275315.1|AF275315 Lotus japonicus water-selective transport intrinsic membrane protein 1 mRNA, complete cds Length = 1162 Score = 42.1 bits (21), Expect = 1.6 Identities = 39/45 (86%) Strand = Plus / Minus Query: 318 ccagctgacgagggcggggccgaaggagacggcggggttcatgga 362 |||||| |||| ||| || ||||| || ||||||||||||||||| Sbjct: 689 ccagctcacgacggctggtccgaatgacacggcggggttcatgga 645
>gb|AF127662.1|AF127662 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase alpha subunit (Rabggta) mRNA, complete cds, alternatively spliced Length = 2466 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 156 acggacggacgggcgggcggg 176 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127661.1|AF127661 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase alpha subunit (Rabggta) pseudogene, complete sequence Length = 2435 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 156 acggacggacgggcgggcggg 176 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127660.1|AF127660 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha subunit (Rabggta) mRNA, complete cds, alternatively spliced Length = 2492 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 156 acggacggacgggcgggcggg 176 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127659.1|AF127659 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase alpha subunit (Rabggta) mRNA, complete cds, alternatively spliced Length = 2547 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 156 acggacggacgggcgggcggg 176 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127658.1|AF127658 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha subunit (Rabggta) mRNA, complete cds, alternatively spliced Length = 2547 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 156 acggacggacgggcgggcggg 176 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127657.1|AF127657 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase alpha subunit (Rabggta) pseudogene, complete sequence Length = 2338 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 156 acggacggacgggcgggcggg 176 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127656.1|AF127656 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha subunit (Rabggta) mRNA, complete cds, alternatively spliced Length = 2395 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 156 acggacggacgggcgggcggg 176 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127655.1|AF127655 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase alpha subunit (Rabggta) gene, complete cds, alternatively spliced Length = 2685 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 156 acggacggacgggcgggcggg 176 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127654.1|AF127654 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha subunit (Rabggta) gene, complete cds, alternatively spliced Length = 2685 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 156 acggacggacgggcgggcggg 176 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence Length = 3131724 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 257 cgccggcgaggccgccgccga 277 ||||||||||||||||||||| Sbjct: 2570348 cgccggcgaggccgccgccga 2570368 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 257 cgccggcgaggccgccgccgatga 280 ||||||| |||||||||||||||| Sbjct: 2369100 cgccggccaggccgccgccgatga 2369077
>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence Length = 3716413 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 257 cgccggcgaggccgccgccga 277 ||||||||||||||||||||| Sbjct: 1841115 cgccggcgaggccgccgccga 1841095
>gb|AF466200.2| Sorghum bicolor putative protein kinase gene, partial cds; putative Cf-2, fertilization-independent endosperm proteins, hypothetical protein, putative non-LTR retroelement reverse transcriptase, OCL5 protein, tryptophan synthase beta-subunit, hypothetical proteins, putative AP endonuclease, putative RNA polymerase II complex component SRB7, putative beta-1,3-glucanase, hypothetical protein, TNP2-like protein, hypothetical protein, putative phosphate/phosphoenolpyruvate translocator, putative protein, hypothetical proteins, putative galactosyltransferase family, hypothetical protein, putative cytochrome P450 family, putative lipid transfer protein, putative photoreceptor-interacting protein, and hypothetical protein genes, complete cds; and hypothetical protein gene, partial cds Length = 202197 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 363 cgcgccggagaaggcgccgccgacg 387 ||||||||||||||||||| ||||| Sbjct: 146358 cgcgccggagaaggcgccggcgacg 146382
>emb|AL845372.6| Zebrafish DNA sequence from clone DKEYP-113C1 in linkage group 20, complete sequence Length = 80017 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 156 acggacggacgggcgggcggg 176 ||||||||||||||||||||| Sbjct: 44968 acggacggacgggcgggcggg 44988
>gb|AY109651.1| Zea mays CL6730_1 mRNA sequence Length = 899 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 345 gacggcggggttcatggacgcgccggaga 373 |||||||||||||||| ||||||||||| Sbjct: 430 gacggcggggttcatgtgcgcgccggaga 402
>gb|AF009567.1|AF009567 Gossypium hirsutum delta-TIP homolog (MIP) mRNA, partial cds Length = 316 Score = 42.1 bits (21), Expect = 1.6 Identities = 39/45 (86%) Strand = Plus / Minus Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434 ||||||||| || || |||||||||||||| ||||| || ||||| Sbjct: 289 gatgttggcaccaacaatgaagccgatggcaatgggtgcaatggt 245
>emb|CR381567.9| Zebrafish DNA sequence from clone DKEY-115O4 in linkage group 23, complete sequence Length = 142417 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 156 acggacggacgggcgggcggg 176 ||||||||||||||||||||| Sbjct: 45131 acggacggacgggcgggcggg 45151
>gb|AF026470.1|AF026470 Pseudomonas aeruginosa gluconate repressor (gnuR), gluconate kinase (gnuK), and gluconate permease (gnuT) genes, complete cds Length = 3554 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 257 cgccggcgaggccgccgccga 277 ||||||||||||||||||||| Sbjct: 427 cgccggcgaggccgccgccga 407
>gb|AC159324.2| Mus musculus BAC clone RP23-9D1 from chromosome 12, complete sequence Length = 207280 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 156 acggacggacgggcgggcggg 176 ||||||||||||||||||||| Sbjct: 13760 acggacggacgggcgggcggg 13780
>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence Length = 2914771 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 167 ggcgggcggggggcaggcggcggtg 191 ||||||||||||||| ||||||||| Sbjct: 2074504 ggcgggcggggggcatgcggcggtg 2074480
>emb|CR974568.14| Mouse DNA sequence from clone RP23-39N20 on chromosome 12, complete sequence Length = 251037 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 156 acggacggacgggcgggcggg 176 ||||||||||||||||||||| Sbjct: 108741 acggacggacgggcgggcggg 108721
>emb|CR388420.19| Zebrafish DNA sequence from clone DKEY-37H18 in linkage group 13, complete sequence Length = 121689 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 156 acggacggacgggcgggcggg 176 ||||||||||||||||||||| Sbjct: 73151 acggacggacgggcgggcggg 73131
>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica Length = 4224103 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 434 tgcccaggctgcccttcttgg 454 ||||||||||||||||||||| Sbjct: 867021 tgcccaggctgcccttcttgg 867001
>gb|U88368.1|SSU88368 Sus scrofa inositol(1,3,4,5)tetrakisphosphate receptor mRNA, complete cds Length = 1544 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 157 cggacggacgggcgggcggggggca 181 |||||||||||||||||||| |||| Sbjct: 56 cggacggacgggcgggcgggcggca 80
>dbj|AP004479.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT03H13, TM0012b, complete sequence Length = 41820 Score = 42.1 bits (21), Expect = 1.6 Identities = 39/45 (86%) Strand = Plus / Plus Query: 318 ccagctgacgagggcggggccgaaggagacggcggggttcatgga 362 |||||| |||| ||| || ||||| || ||||||||||||||||| Sbjct: 10107 ccagctcacgacggctggtccgaatgacacggcggggttcatgga 10151
>gb|L07320.1|HS5E1A Murine cytomegalovirus e1 protein gene, complete cds Length = 4536 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 156 acggacggacgggcgggcggg 176 ||||||||||||||||||||| Sbjct: 745 acggacggacgggcgggcggg 765
>ref|NM_129238.2| Arabidopsis thaliana GAMMA-TIP; water channel AT2G36830 (GAMMA-TIP) mRNA, complete cds Length = 1058 Score = 40.1 bits (20), Expect = 6.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 197 agtagtcggtggtggggagctgctcgtg 224 ||||||| ||||| |||||||||||||| Sbjct: 818 agtagtctgtggttgggagctgctcgtg 791
>gb|AC164878.2| Mus musculus BAC clone RP23-364G24 from chromosome 13, complete sequence Length = 181893 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 156 acggacggacgggcgggcgg 175 |||||||||||||||||||| Sbjct: 94623 acggacggacgggcgggcgg 94642
>gb|AC162034.6| Mus musculus chromosome 7, clone RP23-285B12, complete sequence Length = 197907 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 165 cgggcgggcggggggcaggc 184 |||||||||||||||||||| Sbjct: 122681 cgggcgggcggggggcaggc 122700
>gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome Length = 2364842 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 270 gccgccgatgagggggccga 289 |||||||||||||||||||| Sbjct: 1305526 gccgccgatgagggggccga 1305507
>gb|DQ215783.1| Taeniopygia guttata clone 0058P0012B09 proteasome alpha 1 subunit variant 1-like mRNA, complete sequence Length = 1190 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 165 cgggcgggcggggggcaggcggcg 188 ||||||||||| |||||||||||| Sbjct: 38 cgggcgggcggcgggcaggcggcg 15
>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence Length = 3587082 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 258 gccggcgaggccgccgccga 277 |||||||||||||||||||| Sbjct: 412353 gccggcgaggccgccgccga 412372
>ref|XM_472326.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 618 Score = 40.1 bits (20), Expect = 6.4 Identities = 26/28 (92%) Strand = Plus / Plus Query: 255 gacgccggcgaggccgccgccgatgagg 282 ||||||| ||||||||||||||| |||| Sbjct: 133 gacgccgacgaggccgccgccgaggagg 160
>gb|AF474373.1| Hordeum vulgare subsp. vulgare BAC 259I16, complete sequence Length = 124050 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 156 acggacggacgggcgggcgg 175 |||||||||||||||||||| Sbjct: 72221 acggacggacgggcgggcgg 72202
>ref|NM_001025266.1| Homo sapiens hypothetical gene supported by AK091454 (LOC285382), mRNA Length = 5901 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 255 gacgccggcgaggccgccgc 274 |||||||||||||||||||| Sbjct: 217 gacgccggcgaggccgccgc 198
>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome Length = 3188609 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 260 cggcgaggccgccgccgatg 279 |||||||||||||||||||| Sbjct: 622954 cggcgaggccgccgccgatg 622973
>gb|AC145321.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0094P07, complete sequence Length = 162311 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 257 cgccggcgaggccgccgccg 276 |||||||||||||||||||| Sbjct: 15954 cgccggcgaggccgccgccg 15935
>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence Length = 3510148 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 258 gccggcgaggccgccgccga 277 |||||||||||||||||||| Sbjct: 1776040 gccggcgaggccgccgccga 1776021
>ref|XM_414866.1| PREDICTED: Gallus gallus similar to Aquaporin 8 (LOC416566), mRNA Length = 1761 Score = 40.1 bits (20), Expect = 6.4 Identities = 32/36 (88%) Strand = Plus / Minus Query: 273 gccgatgagggggccgacccagtacacccactggta 308 |||||| || || ||||||||||||||||| ||||| Sbjct: 1371 gccgatcagaggcccgacccagtacacccagtggta 1336
>ref|XM_426181.1| PREDICTED: Gallus gallus similar to Brix domain containing protein 1 (LOC428624), mRNA Length = 1530 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 257 cgccggcgaggccgccgccg 276 |||||||||||||||||||| Sbjct: 1364 cgccggcgaggccgccgccg 1345
>gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete genome Length = 3696649 Score = 40.1 bits (20), Expect = 6.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 391 atgttggcgccgacgatgaagccgatgg 418 |||| |||||||| |||||||||||||| Sbjct: 3114875 atgtaggcgccgaagatgaagccgatgg 3114848 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 260 cggcgaggccgccgccgatg 279 |||||||||||||||||||| Sbjct: 49687 cggcgaggccgccgccgatg 49668
>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence Length = 4126292 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 258 gccggcgaggccgccgccga 277 |||||||||||||||||||| Sbjct: 3021559 gccggcgaggccgccgccga 3021540
>gb|DQ356948.1| Crocodilepox virus, complete genome Length = 190054 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 257 cgccggcgaggccgccgccg 276 |||||||||||||||||||| Sbjct: 101116 cgccggcgaggccgccgccg 101135
>gb|AY502065.1| Streptomyces mobaraensis transglutaminase gene, complete cds Length = 1224 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 258 gccggcgaggccgccgccga 277 |||||||||||||||||||| Sbjct: 76 gccggcgaggccgccgccga 95
>gb|AF531437.1| Streptomyces mobaraensis IFO13819 transglutaminase precursor, gene, complete cds Length = 1809 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 258 gccggcgaggccgccgccga 277 |||||||||||||||||||| Sbjct: 653 gccggcgaggccgccgccga 672
>emb|AL591789.1|SME591789 Sinorhizobium meliloti 1021 complete chromosome; segment 8/12 Length = 294800 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 411 gccgatggcgatgggcgcga 430 |||||||||||||||||||| Sbjct: 252331 gccgatggcgatgggcgcga 252350
>emb|CR847515.10| Zebrafish DNA sequence from clone DKEYP-60A7 in linkage group 9, complete sequence Length = 153947 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 90 attcattcattcaaagcaaa 109 |||||||||||||||||||| Sbjct: 143356 attcattcattcaaagcaaa 143337 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,390,280 Number of Sequences: 3902068 Number of extensions: 4390280 Number of successful extensions: 110130 Number of sequences better than 10.0: 331 Number of HSP's better than 10.0 without gapping: 332 Number of HSP's successfully gapped in prelim test: 4 Number of HSP's that attempted gapping in prelim test: 105678 Number of HSP's gapped (non-prelim): 4423 length of query: 475 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 453 effective length of database: 17,147,199,772 effective search space: 7767681496716 effective search space used: 7767681496716 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)