ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags20m13
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein 940 0.0
2gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intr... 511 e-142
3gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, c... 436 e-119
4gb|BT016300.1| Zea mays clone Contig133 mRNA sequence 428 e-117
5gb|AY104464.1| Zea mays PCO114899 mRNA sequence 420 e-114
6gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmT... 420 e-114
7gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 406 e-110
8gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nippon... 406 e-110
9dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 406 e-110
10dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, com... 406 e-110
11dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clon... 406 e-110
12dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clon... 406 e-110
13dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clon... 406 e-110
14dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clon... 406 e-110
15ref|XM_470213.1| Oryza sativa (japonica cultivar-group), predic... 389 e-105
16emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative... 283 3e-73
17dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clon... 260 4e-66
18gb|AF326500.1|AF326500 Zea mays tonoplast membrane integral prot... 190 3e-45
19ref|NM_189497.1| Oryza sativa (japonica cultivar-group), predic... 182 7e-43
20dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 182 7e-43
21dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic D... 182 7e-43
22dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clon... 182 7e-43
23dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clon... 182 7e-43
24dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mR... 182 7e-43
25dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 178 1e-41
26dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic D... 178 1e-41
27dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic D... 178 1e-41
28dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clon... 178 1e-41
29dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clon... 178 1e-41
30dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clon... 178 1e-41
31dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clon... 178 1e-41
32dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clon... 178 1e-41
33dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clon... 178 1e-41
34dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clon... 178 1e-41
35gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic prote... 176 4e-41
36gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic prote... 176 4e-41
37gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic prote... 176 4e-41
38dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clon... 170 3e-39
39gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral prot... 168 1e-38
40gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral prot... 161 3e-36
41gb|AY105015.1| Zea mays PCO137646 mRNA sequence 161 3e-36
42gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intr... 161 3e-36
43gb|AY112388.1| Zea mays CL24208_1 mRNA sequence 157 4e-35
44dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clon... 155 2e-34
45gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds 145 2e-31
46gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral prot... 145 2e-31
47gb|AY106931.1| Zea mays PCO140073 mRNA sequence 145 2e-31
48gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRN... 145 2e-31
49gb|AY389618.1| Hyacinthus orientalis mitochondrial tonoplast int... 125 1e-25
50ref|XM_467137.1| Oryza sativa (japonica cultivar-group), mRNA 111 2e-21
51dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 111 2e-21
52gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic prote... 111 2e-21
53dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic D... 111 2e-21
54dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic D... 111 2e-21
55dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mR... 111 2e-21
56dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clon... 111 2e-21
57emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chro... 111 2e-21
58emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein 103 5e-19
59ref|NM_188624.1| Oryza sativa (japonica cultivar-group), Ozsa822... 92 2e-15
60gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral prot... 92 2e-15
61dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic D... 92 2e-15
62dbj|AK069192.1| Oryza sativa (japonica cultivar-group) cDNA clon... 92 2e-15
63dbj|AB206104.1| Mimosa pudica tip1;1 mRNA for tonoplast intrinsi... 90 8e-15
64gb|U43291.1|MCU43291 Mesembryanthemum crystallinum tonoplast int... 90 8e-15
65ref|XM_473424.1| Oryza sativa (japonica cultivar-group), predic... 86 1e-13
66emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4,... 86 1e-13
67dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 86 1e-13
68gb|AF326505.1|AF326505 Zea mays tonoplast membrane integral prot... 84 5e-13
69emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative to... 76 1e-10
70emb|BX824373.1|CNS0A6WG Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
71dbj|AB012270.1| Aster tripolium mRNA for SAMIPD, partial cds 70 7e-09
72gb|AF326506.1|AF326506 Zea mays tonoplast membrane integral prot... 68 3e-08
73dbj|D84669.1| Raphanus sativus mRNA for VM23, complete sequence 66 1e-07
74dbj|AB012272.1| Aster tripolium mRNA for SAMIPF, partial cds 66 1e-07
75ref|NM_113559.3| Arabidopsis thaliana TIP2 (TONOPLAST INTRINSIC ... 64 4e-07
76emb|AJ289696.1|POC289696 Posidonia oceanica partial mRNA for put... 64 4e-07
77gb|AY079114.1| Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, comp... 64 4e-07
78gb|AF419613.1|AF419613 Arabidopsis thaliana AT3g26520/MFE16_3 mR... 64 4e-07
79gb|AF428341.1|AF428341 Arabidopsis thaliana AT3g26520/MFE16_3 mR... 64 4e-07
80gb|AF004393.1|AF004393 Arabidopsis thaliana salt-stress induced ... 64 4e-07
81emb|BX822807.1|CNS0A75T Arabidopsis thaliana Full-length cDNA Co... 64 4e-07
82emb|BX822624.1|CNS0A742 Arabidopsis thaliana Full-length cDNA Co... 64 4e-07
83emb|BX824073.1|CNS0A6T2 Arabidopsis thaliana Full-length cDNA Co... 64 4e-07
84emb|BX822975.1|CNS0A733 Arabidopsis thaliana Full-length cDNA Co... 64 4e-07
85emb|BX824311.1|CNS0A6PE Arabidopsis thaliana Full-length cDNA Co... 64 4e-07
86emb|BX823637.1|CNS0A6I3 Arabidopsis thaliana Full-length cDNA Co... 64 4e-07
87emb|BX823607.1|CNS0A6MK Arabidopsis thaliana Full-length cDNA Co... 64 4e-07
88dbj|AB028611.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 64 4e-07
89gb|AY821911.1| Gossypium hirsutum putative tonoplast intrinsic p... 64 4e-07
90gb|AF118381.1|AF118381 Brassica napus tonoplast intrinsic protei... 64 4e-07
91ref|NM_188626.1| Oryza sativa (japonica cultivar-group), Ozsa822... 62 2e-06
92ref|NM_197137.1| Oryza sativa (japonica cultivar-group) putative... 62 2e-06
93ref|NM_189871.1| Oryza sativa (japonica cultivar-group), mRNA 62 2e-06
94gb|AC023240.9| Oryza sativa chromosome 10 BAC OSJNBa0051D19 geno... 62 2e-06
95emb|X95650.1|TGTIP1GEN T.gesneriana mRNA for tonoplast intrinsic... 62 2e-06
96dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 62 2e-06
97dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 62 2e-06
98dbj|AP004380.2| Oryza sativa (japonica cultivar-group) genomic D... 62 2e-06
99dbj|AK111931.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 2e-06
100dbj|AB114828.1| Oryza sativa (japonica cultivar-group) OsTIP3 mR... 62 2e-06
101dbj|AK106383.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 2e-06
102dbj|AK099190.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 2e-06
103dbj|AK069592.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 2e-06
104gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 62 2e-06
105dbj|AB012271.1| Aster tripolium mRNA for SAMIPE, partial cds 60 7e-06
106ref|NM_124117.2| Arabidopsis thaliana AtTIP2;3; water channel AT... 58 3e-05
107ref|NM_188505.1| Oryza sativa (japonica cultivar-group), Ozsa817... 58 3e-05
108ref|XM_473251.1| Oryza sativa (japonica cultivar-group), predic... 58 3e-05
109gb|BT011663.1| Arabidopsis thaliana At5g47450 mRNA, complete cds 58 3e-05
110gb|BT011212.1| Arabidopsis thaliana At5g47450 gene, complete cds 58 3e-05
111gb|AF521135.1| Kandelia candel tonoplast intrinsic protein (TIP)... 58 3e-05
112emb|AL663019.2|OSJN00221 Oryza sativa genomic DNA, chromosome 4,... 58 3e-05
113dbj|AP002094.1| Oryza sativa (japonica cultivar-group) genomic D... 58 3e-05
114dbj|AB025628.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 58 3e-05
115dbj|AK108116.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
116dbj|AB048248.1| Pyrus communis Py-gTIP mRNA for gamma tonoplast ... 56 1e-04
117gb|BT016509.1| Zea mays clone Contig342 mRNA sequence 54 4e-04
118gb|DQ226889.1| Boechera divaricarpa isolate SLW-D-E07 mRNA sequence 54 4e-04
119emb|X72581.1|ATGTIPMR A.thaliana mRNA for tonoplast intrinsic pr... 54 4e-04
120emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquapo... 54 4e-04
121gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putat... 54 4e-04
122emb|BX823744.1|CNS0A6NJ Arabidopsis thaliana Full-length cDNA Co... 52 0.002
123dbj|AB012268.1| Aster tripolium mRNA for SAMIPB, partial cds 52 0.002
124gb|AF367456.1| Prunus persica clone gTip1 gamma-tonoplast intrin... 50 0.007
125emb|BX842138.1|CNS09YDN Arabidopsis thaliana Full-length cDNA Co... 50 0.007
126dbj|AB012269.1| Aster tripolium mRNA for SAMIPC, partial cds 50 0.007
127dbj|AB012267.1| Aster tripolium mRNA for SAMIPA, partial cds 50 0.007
128gb|U92651.2|BOU92651 Brassica oleracea var. botrytis tonoplast i... 48 0.026
129gb|AF326509.1|AF326509 Zea mays tonoplast membrane integral prot... 48 0.026
130emb|BX822304.1|CNS0A7A0 Arabidopsis thaliana Full-length cDNA Co... 48 0.026
131emb|BX825064.1|CNS0A6TA Arabidopsis thaliana Full-length cDNA Co... 48 0.026
132gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge... 48 0.026
133emb|X53040.1|RNNIP26 R.norvegicus MIP-26 mRNA 46 0.10
134gb|AF521142.1| Kandelia candel tonoplast intrinsic protein mRNA,... 46 0.10
135emb|X53052.1|RRMIP Rat partial mRNA for main intrinsic protein 46 0.10
136emb|X12514.1|RNMIP26R Rat mRNA fragment for main intrinsic prote... 46 0.10
137gb|AY130971.1| Brassica oleracea var. botrytis tonoplast intrins... 46 0.10
138emb|AJ251652.1|MTR251652 Medicago truncatula mRNA for aquaporin ... 46 0.10
139gb|U92652.2|BOU92652 Brassica oleracea var. botrytis tonoplast i... 46 0.10
140gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 46 0.10
141gb|AC020922.9| Homo sapiens chromosome 19 clone CTD-2105E13, com... 46 0.10
142ref|XM_343137.2| PREDICTED: Rattus norvegicus major intrinsic pr... 46 0.10
143gb|AY207429.1| Homo sapiens interleukin 11 (IL11) gene, complete... 46 0.10
144emb|AJ605573.1| Ricinus communis mRNA for aquaporin (Tip1-1 gene... 46 0.10
145gb|AY112625.1| Zea mays CL46210_1 mRNA sequence 46 0.10
146gb|AF000143.1|HSAF000143 Human putative alternative lens membran... 46 0.10
147gb|M81890.1|HUMIL11A Human interleukin 11 (IL11) gene, complete ... 46 0.10
148dbj|AB010416.1| Raphanus sativus VIP3 mRNA for delta-VM23, compl... 46 0.10
149gb|L12257.1|SOYNODA Glycine max nodulin-26 mRNA, complete cds 46 0.10
150ref|XM_476227.1| Oryza sativa (japonica cultivar-group), predic... 44 0.41
151gb|AC145396.3| Oryza sativa (japonica cultivar-group) chromosome... 44 0.41
152emb|AL591787.1|SME591787 Sinorhizobium meliloti 1021 complete ch... 44 0.41
153ref|XM_851400.1| PREDICTED: Canis familiaris similar to actinin,... 44 0.41
154ref|XM_536333.2| PREDICTED: Canis familiaris similar to actinin,... 44 0.41
155ref|XM_851314.1| PREDICTED: Canis familiaris similar to actinin,... 44 0.41
156ref|XM_851274.1| PREDICTED: Canis familiaris similar to actinin,... 44 0.41
157ref|XM_851189.1| PREDICTED: Canis familiaris similar to actinin,... 44 0.41
158ref|XM_851152.1| PREDICTED: Canis familiaris similar to actinin,... 44 0.41
159ref|XM_851023.1| PREDICTED: Canis familiaris similar to actinin,... 44 0.41
160emb|X95952.1|HAAP H.annuus mRNA for aquaporin 44 0.41
161dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.41
162dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.41
163dbj|AK072531.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.41
164emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid compl... 44 0.41
165dbj|AK060193.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.41
166gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 44 0.41
167emb|AL928775.2|CNS08CC5 Oryza sativa chromosome 12, . BAC OSJNBa... 44 0.41
168gb|AE017351.1| Cryptococcus neoformans var. neoformans JEC21 chr... 42 1.6
169gb|AC154709.2| Mus musculus BAC clone RP24-357I4 from chromosome... 42 1.6
170gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome 42 1.6
171ref|XM_593064.2| PREDICTED: Bos taurus similar to tumor protein ... 42 1.6
172gb|AY581827.1| Cynodon dactylon NOD26-like membrane integral pro... 42 1.6
173gb|AF183913.1| Azospirillum brasilense major outer membrane prot... 42 1.6
174ref|XM_856403.1| PREDICTED: Canis familiaris similar to aquapori... 42 1.6
175ref|XM_845359.1| PREDICTED: Canis familiaris similar to aquapori... 42 1.6
176emb|CT025679.5| Mouse DNA sequence from clone RP24-296K22 on chr... 42 1.6
177ref|XM_567655.1| Cryptococcus neoformans var. neoformans JEC21 h... 42 1.6
178gb|AC123532.4| Mus musculus chromosome 14 clone RP23-84B6, compl... 42 1.6
179gb|AC098877.3| Mus musculus BAC clone RP23-2C24 from 14, complet... 42 1.6
180gb|AC104099.5| Mus musculus BAC clone RP24-372J8 from 3, complet... 42 1.6
181gb|BC012214.1| Mus musculus Rab geranylgeranyl transferase, a su... 42 1.6
182gb|AY258323.1| Rubella virus strain BRD-II, complete genome 42 1.6
183ref|XM_503667.1| Yarrowia lipolytica CLIB122, YALI0E07557g predi... 42 1.6
184ref|NM_019519.1| Mus musculus Rab geranylgeranyl transferase, a ... 42 1.6
185ref|XM_961391.1| PREDICTED: Tribolium castaneum similar to CG310... 42 1.6
186gb|CP000089.1| Dechloromonas aromatica RCB, complete genome 42 1.6
187emb|BX640442.1| Bordetella bronchiseptica strain RB50, complete ... 42 1.6
188emb|BX640430.1| Bordetella parapertussis strain 12822, complete ... 42 1.6
189emb|AL390091.1|NCB12F1 Neurospora crassa DNA linkage group II BA... 42 1.6
190emb|AJ489613.1|CAR489613 Cicer arietinum partial mRNA for tonopl... 42 1.6
191emb|AJ243309.1|PSA243309 Pisum sativum mRNA for putative tonopla... 42 1.6
192emb|BX470185.18| Zebrafish DNA sequence from clone CH211-222D3 i... 42 1.6
193gb|AC183494.1| Brassica oleracea Contig C, complete sequence 42 1.6
194dbj|AK146917.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f... 42 1.6
195gb|U62778.1|GHU62778 Gossypium hirsutum delta-tonoplast intrinsi... 42 1.6
196gb|AF342810.1|AF342810 Zea mays NOD26-like membrane integral pro... 42 1.6
197gb|AF326507.1|AF326507 Zea mays tonoplast membrane integral prot... 42 1.6
198gb|AF326485.1|AF326485 Zea mays NOD26-like membrane integral pro... 42 1.6
199emb|BX822791.1|CNS0A7SC Arabidopsis thaliana Full-length cDNA Co... 42 1.6
200emb|BX842211.1|CNS09YE1 Arabidopsis thaliana Full-length cDNA Co... 42 1.6
201gb|AC135495.2| Oryza sativa (japonica cultivar-group) chromosome... 42 1.6
202ref|NM_214226.1| Sus scrofa inositol(1,3,4,5)tetrakisphosphate r... 42 1.6
203gb|AE004658.1| Pseudomonas aeruginosa PAO1, section 219 of 529 o... 42 1.6
204gb|AF275315.1|AF275315 Lotus japonicus water-selective transport... 42 1.6
205gb|AF127662.1|AF127662 Mus musculus strain C57BL/6J-gm/gm RAB ge... 42 1.6
206gb|AF127661.1|AF127661 Mus musculus strain C57BL/6J-gm/gm RAB ge... 42 1.6
207gb|AF127660.1|AF127660 Mus musculus strain C57BL/6J RAB geranylg... 42 1.6
208gb|AF127659.1|AF127659 Mus musculus strain C57BL/6J-gm/gm RAB ge... 42 1.6
209gb|AF127658.1|AF127658 Mus musculus strain C57BL/6J RAB geranylg... 42 1.6
210gb|AF127657.1|AF127657 Mus musculus strain C57BL/6J-gm/gm RAB ge... 42 1.6
211gb|AF127656.1|AF127656 Mus musculus strain C57BL/6J RAB geranylg... 42 1.6
212gb|AF127655.1|AF127655 Mus musculus strain C57BL/6J-gm/gm RAB ge... 42 1.6
213gb|AF127654.1|AF127654 Mus musculus strain C57BL/6J RAB geranylg... 42 1.6
214gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, c... 42 1.6
215emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple... 42 1.6
216gb|AF466200.2| Sorghum bicolor putative protein kinase gene, par... 42 1.6
217emb|AL845372.6| Zebrafish DNA sequence from clone DKEYP-113C1 in... 42 1.6
218gb|AY109651.1| Zea mays CL6730_1 mRNA sequence 42 1.6
219gb|AF009567.1|AF009567 Gossypium hirsutum delta-TIP homolog (MIP... 42 1.6
220emb|CR381567.9| Zebrafish DNA sequence from clone DKEY-115O4 in ... 42 1.6
221gb|AF026470.1|AF026470 Pseudomonas aeruginosa gluconate represso... 42 1.6
222gb|AC159324.2| Mus musculus BAC clone RP23-9D1 from chromosome 1... 42 1.6
223gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, co... 42 1.6
224emb|CR974568.14| Mouse DNA sequence from clone RP23-39N20 on chr... 42 1.6
225emb|CR388420.19| Zebrafish DNA sequence from clone DKEY-37H18 in... 42 1.6
226emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ... 42 1.6
227gb|U88368.1|SSU88368 Sus scrofa inositol(1,3,4,5)tetrakisphospha... 42 1.6
228dbj|AP004479.1| Lotus japonicus genomic DNA, chromosome 1, clone... 42 1.6
229gb|L07320.1|HS5E1A Murine cytomegalovirus e1 protein gene, compl... 42 1.6
230ref|NM_129238.2| Arabidopsis thaliana GAMMA-TIP; water channel A... 40 6.4
231gb|AC164878.2| Mus musculus BAC clone RP23-364G24 from chromosom... 40 6.4
232gb|AC162034.6| Mus musculus chromosome 7, clone RP23-285B12, com... 40 6.4
233gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome 40 6.4
234gb|DQ215783.1| Taeniopygia guttata clone 0058P0012B09 proteasome... 40 6.4
235gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence 40 6.4
236ref|XM_472326.1| Oryza sativa (japonica cultivar-group), predic... 40 6.4
237gb|AF474373.1| Hordeum vulgare subsp. vulgare BAC 259I16, comple... 40 6.4
238ref|NM_001025266.1| Homo sapiens hypothetical gene supported by ... 40 6.4
239gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl... 40 6.4
240gb|AC145321.3| Oryza sativa (japonica cultivar-group) chromosome... 40 6.4
241gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp... 40 6.4
242ref|XM_414866.1| PREDICTED: Gallus gallus similar to Aquaporin 8... 40 6.4
243ref|XM_426181.1| PREDICTED: Gallus gallus similar to Brix domain... 40 6.4
244gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete ge... 40 6.4
245gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 40 6.4
246gb|DQ356948.1| Crocodilepox virus, complete genome 40 6.4
247gb|AY502065.1| Streptomyces mobaraensis transglutaminase gene, c... 40 6.4
248gb|AF531437.1| Streptomyces mobaraensis IFO13819 transglutaminas... 40 6.4
249emb|AL591789.1|SME591789 Sinorhizobium meliloti 1021 complete ch... 40 6.4
250emb|CR847515.10| Zebrafish DNA sequence from clone DKEYP-60A7 in... 40 6.4
251gb|AC012596.4| Homo sapiens BAC clone CTD-2523K17 from 7, comple... 40 6.4
252gb|AY225468.1| Mus musculus interleukin 11 gene, promoter region... 40 6.4
253emb|AL161740.16| Human DNA sequence from clone RP6-239D12 on chr... 40 6.4
254gb|AC123518.2| Oryza sativa (japonica cultivar-group) chromosome... 40 6.4
255emb|X63552.1|ATGTIPARA A.thaliana gene for tonoplast intrinsic p... 40 6.4
256gb|AY059134.1| Arabidopsis thaliana putative aquaporin (At2g3683... 40 6.4
257gb|AF370172.1| Arabidopsis thaliana putative tonoplast intrinsic... 40 6.4
258gb|AF486513.1| Hordeum vulgare cultivar Yon M Kei GBSSI gene, pr... 40 6.4
259gb|AF486512.1| Hordeum vulgare cultivar CDC Alamo GBSSI gene, pr... 40 6.4
260gb|AF486508.1| Hordeum vulgare cultivar Oderbrucker GBSSI gene, ... 40 6.4
261emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos... 40 6.4
262emb|BX897736.7| Zebrafish DNA sequence from clone CH211-181B15 i... 40 6.4
263gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 40 6.4
264gb|AE005901.1| Caulobacter crescentus CB15 section 227 of 359 of... 40 6.4
265gb|AC023310.4| Homo sapiens chromosome 15, clone RP11-336L20, co... 40 6.4
266dbj|AK091454.1| Homo sapiens cDNA FLJ34135 fis, clone FCBBF3010695 40 6.4
267tpg|BK001890.1| TPA: TPA_inf: Drosophila melanogaster HDC08154 (... 40 6.4
268gb|CP000133.1| Rhizobium etli CFN 42, complete genome 40 6.4
269gb|CP000136.1| Rhizobium etli CFN 42 plasmid p42c, complete sequ... 40 6.4
270dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 40 6.4
271gb|AC006922.7| Arabidopsis thaliana chromosome 2 clone T1J8 map ... 40 6.4
272dbj|AB118808.1| Hordeum vulgare subsp. spontaneum GBSSI gene for... 40 6.4
273dbj|AB089162.1| Hordeum vulgare subsp. vulgare GBSSI gene for gr... 40 6.4
274dbj|AB088761.1| Hordeum vulgare subsp. vulgare GBSSI gene for gr... 40 6.4
275gb|AC100757.2| Homo sapiens chromosome 15, clone RP11-566K19, co... 40 6.4
276gb|AC107487.1| Drosophila melanogaster 3L BAC RP98-10D20 (Roswel... 40 6.4
277gb|DQ317109.1| Drosophila pseudoobscura Dscam gene, exons 3 thro... 40 6.4
278emb|BX548249.13| Zebrafish DNA sequence from clone CH211-93A2 in... 40 6.4
279emb|BX119977.10| Zebrafish DNA sequence from clone CH211-198A3 i... 40 6.4
280dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.4
281dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.4
282emb|AL662997.3|OSJN00205 Oryza sativa genomic DNA, chromosome 4,... 40 6.4
283emb|BX819301.1|CNS0AA93 Arabidopsis thaliana Full-length cDNA Co... 40 6.4
284emb|BX819122.1|CNS0AA8S Arabidopsis thaliana Full-length cDNA Co... 40 6.4
285emb|BX819066.1|CNS0AA99 Arabidopsis thaliana Full-length cDNA Co... 40 6.4
286emb|BX818765.1|CNS0AA8G Arabidopsis thaliana Full-length cDNA Co... 40 6.4
287emb|BX819619.1|CNS0A8TV Arabidopsis thaliana Full-length cDNA Co... 40 6.4
288emb|BX819585.1|CNS0A8ZS Arabidopsis thaliana Full-length cDNA Co... 40 6.4
289emb|BX819242.1|CNS0A8YI Arabidopsis thaliana Full-length cDNA Co... 40 6.4
290emb|BX818836.1|CNS0A8V6 Arabidopsis thaliana Full-length cDNA Co... 40 6.4
291emb|BX818785.1|CNS0A8WQ Arabidopsis thaliana Full-length cDNA Co... 40 6.4
292emb|BX820166.1|CNS0A8IR Arabidopsis thaliana Full-length cDNA Co... 40 6.4
293gb|AY779624.1| Myxococcus xanthus strain DK1622 rod locus, compl... 40 6.4
294emb|BX842163.1|CNS09YDT Arabidopsis thaliana Full-length cDNA Co... 40 6.4
295gb|AE004695.1| Pseudomonas aeruginosa PAO1, section 256 of 529 o... 40 6.4
296gb|AY087558.1| Arabidopsis thaliana clone 36633 mRNA, complete s... 40 6.4
297gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome 40 6.4
298gb|AC136687.6| Homo sapiens chromosome 15, clone RP11-439M15, co... 40 6.4
299gb|AC134393.6| Homo sapiens chromosome 15, clone CTC-803A3, comp... 40 6.4
300gb|AC131280.9| Homo sapiens chromosome 15, clone RP11-467L19, co... 40 6.4
301gb|AF133532.1|AF133532 Mesembryanthemum crystallinum water chann... 40 6.4
302dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 6.4
303dbj|AP006149.2| Oryza sativa (japonica cultivar-group) genomic D... 40 6.4
304dbj|AP003712.4| Oryza sativa (japonica cultivar-group) genomic D... 40 6.4
305dbj|AB154356.1| Hordeum vulgare subsp. spontaneum GBSSI gene for... 40 6.4
306dbj|AB118809.1| Hordeum vulgare subsp. spontaneum GBSSI gene for... 40 6.4
307dbj|AK112006.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.4
308dbj|AK111927.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.4
309emb|X07932.1|HVWAXYR Barley mRNA pcwx27 for waxy locus 40 6.4
310emb|X07931.1|HVWAXYG Barley DNA for waxy locus encoding starch s... 40 6.4
311dbj|AK109762.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.4
312gb|AC007934.7|AC007934 Homo sapiens, clone RP11-29A1, complete s... 40 6.4
313dbj|AK100873.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.4
314dbj|AK069688.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.4
315emb|AL929340.4| Zebrafish DNA sequence from clone CH211-248N16 i... 40 6.4
316emb|AL442007.3| Oryza sativa genomic DNA, chromosome 4, BAC clon... 40 6.4
317gb|AC006947.2|AC006947 Homo sapiens chromosome 17, clone hRPK.11... 40 6.4
318gb|AE003476.3| Drosophila melanogaster chromosome 3L, section 10... 40 6.4
319gb|U68299.1|MCU68299 Mouse cytomegalovirus 1 complete genomic se... 40 6.4
320emb|CR388150.14| Zebrafish DNA sequence from clone DKEY-115A2 in... 40 6.4
321gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 40 6.4
322gb|AY885250.2| Dermacentor variabilis vitellogenin (Vg) mRNA, co... 40 6.4
323emb|AL929067.8| Mouse DNA sequence from clone RP24-69A20 on chro... 40 6.4
324gb|DQ202710.1| Olea europaea tonoplast intrinsic protein (tip) m... 40 6.4
325gb|AF317103.1| Dumontia alaskana specimen-voucher GWS000917 (UNB... 40 6.4
326gb|AF317102.1| Dumontia alaskana specimen-voucher GWS000916 (UNB... 40 6.4
327gb|AF317101.1| Dumontia alaskana specimen-voucher G0221 (UNB) sm... 40 6.4
328gb|M84344.1|ATHGTIP Arabidopsis thaliana tonoplast intrinsic pro... 40 6.4
329dbj|AB054056.1| Hordeum vulgare waxy gene, partial sequence, cul... 40 6.4
330dbj|AB054055.2| Hordeum vulgare waxy gene, partial sequence, cul... 40 6.4
331emb|AL772162.4| Mouse DNA sequence from clone RP23-175J8 on chro... 40 6.4

>emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein
          Length = 1020

 Score =  940 bits (474), Expect = 0.0
 Identities = 474/474 (100%)
 Strand = Plus / Minus

                                                                        
Query: 1    gttttacacaagcaaattgacagggtcgatcgtcacaggtttcacagcaccacaaactga 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1010 gttttacacaagcaaattgacagggtcgatcgtcacaggtttcacagcaccacaaactga 951

                                                                        
Query: 61   tggaccgatcgaccctgggaatgggatggattcattcattcaaagcaaacttaaacgact 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 950  tggaccgatcgaccctgggaatgggatggattcattcattcaaagcaaacttaaacgact 891

                                                                        
Query: 121  catgactggaagcaaggggagacgcgatcgaccacacggacggacgggcgggcggggggc 180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 890  catgactggaagcaaggggagacgcgatcgaccacacggacggacgggcgggcggggggc 831

                                                                        
Query: 181  aggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaag 240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 830  aggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaag 771

                                                                        
Query: 241  agcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacc 300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 770  agcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacc 711

                                                                        
Query: 301  cactggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatg 360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 710  cactggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatg 651

                                                                        
Query: 361  gacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcg 420
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 650  gacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcg 591

                                                                  
Query: 421  atgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtac 474
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 590  atgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtac 537



to top

>gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intrinsic protein mRNA,
           complete cds
          Length = 1133

 Score =  511 bits (258), Expect = e-142
 Identities = 273/278 (98%)
 Strand = Plus / Minus

                                                                       
Query: 197 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 256
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 845 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 786

                                                                       
Query: 257 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccact 316
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 785 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccact 726

                                                                       
Query: 317 cccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaagg 376
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 725 cccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaagg 666

                                                                       
Query: 377 cgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgc 436
           ||||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 665 cgccgcccaccaggatgttggcgcccacgatgaagccgatggcgatgggcgcgatggtgc 606

                                                 
Query: 437 ccaggctgcccttcttggggtcgacggcggtggcgtac 474
           |||||||||||||||||||||| ||||| |||||||||
Sbjct: 605 ccaggctgcccttcttggggtccacggccgtggcgtac 568



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 103 aagcaaacttaaacgactcatg 124
           ||||||||||||||||||||||
Sbjct: 977 aagcaaacttaaacgactcatg 956



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 1    gttttacacaagcaaattgacagggtcg 28
            |||||||| |||||||||||||| ||||
Sbjct: 1054 gttttacagaagcaaattgacagtgtcg 1027



to top

>gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, complete cds
          Length = 1039

 Score =  436 bits (220), Expect = e-119
 Identities = 265/280 (94%)
 Strand = Plus / Minus

                                                                       
Query: 195 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 254
           |||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 754 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 695

                                                                       
Query: 255 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 314
           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 694 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtagcccca 635

                                                                       
Query: 315 ctcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaa 374
           |||||||||||||||||||||||||||||| ||||||||||||||||||||||||  |||
Sbjct: 634 ctcccagctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaa 575

                                                                       
Query: 375 ggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434
           ||||||||| || ||||||||||| || ||||||||||||||||||||||| ||||||||
Sbjct: 574 ggcgccgcccaccaggatgttggcccccacgatgaagccgatggcgatgggggcgatggt 515

                                                   
Query: 435 gcccaggctgcccttcttggggtcgacggcggtggcgtac 474
           |||||||||||||||||| ||||| || || |||||||||
Sbjct: 514 gcccaggctgcccttcttcgggtccaccgccgtggcgtac 475



to top

>gb|BT016300.1| Zea mays clone Contig133 mRNA sequence
          Length = 1112

 Score =  428 bits (216), Expect = e-117
 Identities = 252/264 (95%)
 Strand = Plus / Minus

                                                                       
Query: 195 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 254
           |||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 850 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 791

                                                                       
Query: 255 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 314
           |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 790 gacgccggcgaggccgccgccgatgaggggcccgacccagtacacccactggtagcccca 731

                                                                       
Query: 315 ctcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaa 374
           |||||||||||||||||||||||||||||| ||||||||||||||||||||||||  |||
Sbjct: 730 ctcccagctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaa 671

                                                                       
Query: 375 ggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434
           ||||||||| || |||||||||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 670 ggcgccgcccaccaggatgttggcgcccacgatgaagccgatggcgatgggggcgatggt 611

                                   
Query: 435 gcccaggctgcccttcttggggtc 458
           |||||||||||||||||| |||||
Sbjct: 610 gcccaggctgcccttcttcgggtc 587



to top

>gb|AY104464.1| Zea mays PCO114899 mRNA sequence
          Length = 1167

 Score =  420 bits (212), Expect = e-114
 Identities = 251/264 (95%)
 Strand = Plus / Minus

                                                                       
Query: 195 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 254
           |||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 849 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 790

                                                                       
Query: 255 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 314
           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 789 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtagcccca 730

                                                                       
Query: 315 ctcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaa 374
           |||||||||||||||||||||||||||||| ||||||||||||||||||||||||  |||
Sbjct: 729 ctcccagctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaa 670

                                                                       
Query: 375 ggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434
           ||||||||| || ||||||||||| || ||||||||||||||||| ||||| ||||||||
Sbjct: 669 ggcgccgcccaccaggatgttggcccccacgatgaagccgatggcaatgggggcgatggt 610

                                   
Query: 435 gcccaggctgcccttcttggggtc 458
           |||||||||||||||||| |||||
Sbjct: 609 gcccaggctgcccttcttcgggtc 586



to top

>gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmTIP1) mRNA, complete cds
          Length = 1097

 Score =  420 bits (212), Expect = e-114
 Identities = 263/280 (93%)
 Strand = Plus / Minus

                                                                       
Query: 195 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 254
           |||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 846 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 787

                                                                       
Query: 255 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 314
           |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 786 gacgccggcgaggccgccgccgatgaggggcccgacccagtacacccactggtagcccca 727

                                                                       
Query: 315 ctcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaa 374
           |||||||||||||||||||||||||||||| ||||||||||||||||||||||||  |||
Sbjct: 726 ctcccagctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaa 667

                                                                       
Query: 375 ggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434
           ||||||||| || ||||||||||| || ||||||||||||||||| ||||| ||||||||
Sbjct: 666 ggcgccgcccaccaggatgttggcccccacgatgaagccgatggcaatgggggcgatggt 607

                                                   
Query: 435 gcccaggctgcccttcttggggtcgacggcggtggcgtac 474
           |||||||||||||||||| ||||| || || |||||||||
Sbjct: 606 gcccaggctgcccttcttcgggtccaccgccgtggcgtac 567



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  406 bits (205), Expect = e-110
 Identities = 271/293 (92%)
 Strand = Plus / Plus

                                                                           
Query: 182     ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 241
               ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 2544716 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 2544775

                                                                           
Query: 242     gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 301
               | | |||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 2544776 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 2544835

                                                                           
Query: 302     actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 361
               ||||| || ||||   ||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 2544836 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 2544895

                                                                           
Query: 362     acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 421
               | ||||||  ||| |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 2544896 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 2544955

                                                                    
Query: 422     tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtac 474
               |||| ||||||||||| |||||||||||||||||||| |||||||||||||||
Sbjct: 2544956 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtac 2545008



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 156     acggacggacgggcgggcggg 176
               |||||||||||||||||||||
Sbjct: 8319519 acggacggacgggcgggcggg 8319499



to top

>gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0067N01, from chromosome 3, complete sequence
          Length = 159636

 Score =  406 bits (205), Expect = e-110
 Identities = 271/293 (92%)
 Strand = Plus / Minus

                                                                          
Query: 182    ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 241
              ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 125378 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 125319

                                                                          
Query: 242    gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 301
              | | |||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 125318 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 125259

                                                                          
Query: 302    actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 361
              ||||| || ||||   ||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 125258 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 125199

                                                                          
Query: 362    acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 421
              | ||||||  ||| |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 125198 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 125139

                                                                   
Query: 422    tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtac 474
              |||| ||||||||||| |||||||||||||||||||| |||||||||||||||
Sbjct: 125138 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtac 125086



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  406 bits (205), Expect = e-110
 Identities = 271/293 (92%)
 Strand = Plus / Plus

                                                                           
Query: 182     ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 241
               ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 2544826 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 2544885

                                                                           
Query: 242     gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 301
               | | |||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 2544886 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 2544945

                                                                           
Query: 302     actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 361
               ||||| || ||||   ||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 2544946 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 2545005

                                                                           
Query: 362     acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 421
               | ||||||  ||| |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 2545006 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 2545065

                                                                    
Query: 422     tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtac 474
               |||| ||||||||||| |||||||||||||||||||| |||||||||||||||
Sbjct: 2545066 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtac 2545118



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 156     acggacggacgggcgggcggg 176
               |||||||||||||||||||||
Sbjct: 8317354 acggacggacgggcgggcggg 8317334



to top

>dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, complete cds
          Length = 1080

 Score =  406 bits (205), Expect = e-110
 Identities = 271/293 (92%)
 Strand = Plus / Minus

                                                                       
Query: 182 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 241
           ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 844 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 785

                                                                       
Query: 242 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 301
           | | |||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 784 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 725

                                                                       
Query: 302 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 361
           ||||| || ||||   ||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 724 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 665

                                                                       
Query: 362 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 421
           | ||||||  ||| |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 664 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 605

                                                                
Query: 422 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtac 474
           |||| ||||||||||| |||||||||||||||||||| |||||||||||||||
Sbjct: 604 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtac 552



to top

>dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-C12, full
           insert sequence
          Length = 1034

 Score =  406 bits (205), Expect = e-110
 Identities = 271/293 (92%)
 Strand = Plus / Minus

                                                                       
Query: 182 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 241
           ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 853 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 794

                                                                       
Query: 242 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 301
           | | |||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 793 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 734

                                                                       
Query: 302 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 361
           ||||| || ||||   ||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 733 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 674

                                                                       
Query: 362 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 421
           | ||||||  ||| |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 673 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 614

                                                                
Query: 422 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtac 474
           |||| ||||||||||| |||||||||||||||||||| |||||||||||||||
Sbjct: 613 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtac 561



to top

>dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003E16, full
           insert sequence
          Length = 1082

 Score =  406 bits (205), Expect = e-110
 Identities = 271/293 (92%)
 Strand = Plus / Minus

                                                                       
Query: 182 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 241
           ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 855 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 796

                                                                       
Query: 242 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 301
           | | |||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 795 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 736

                                                                       
Query: 302 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 361
           ||||| || ||||   ||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 735 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 676

                                                                       
Query: 362 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 421
           | ||||||  ||| |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 675 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 616

                                                                
Query: 422 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtac 474
           |||| ||||||||||| |||||||||||||||||||| |||||||||||||||
Sbjct: 615 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtac 563



to top

>dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-G11, full
           insert sequence
          Length = 551

 Score =  406 bits (205), Expect = e-110
 Identities = 271/293 (92%)
 Strand = Plus / Minus

                                                                       
Query: 182 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 241
           ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 379 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 320

                                                                       
Query: 242 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 301
           | | |||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 319 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 260

                                                                       
Query: 302 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 361
           ||||| || ||||   ||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 259 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 200

                                                                       
Query: 362 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 421
           | ||||||  ||| |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 199 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 140

                                                                
Query: 422 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtac 474
           |||| ||||||||||| |||||||||||||||||||| |||||||||||||||
Sbjct: 139 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtac 87



to top

>dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B06, full
           insert sequence
          Length = 1055

 Score =  406 bits (205), Expect = e-110
 Identities = 271/293 (92%)
 Strand = Plus / Minus

                                                                       
Query: 182 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 241
           ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 851 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 792

                                                                       
Query: 242 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 301
           | | |||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 791 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 732

                                                                       
Query: 302 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 361
           ||||| || ||||   ||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 731 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 672

                                                                       
Query: 362 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 421
           | ||||||  ||| |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 671 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 612

                                                                
Query: 422 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtac 474
           |||| ||||||||||| |||||||||||||||||||| |||||||||||||||
Sbjct: 611 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtac 559



to top

>ref|XM_470213.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 753

 Score =  389 bits (196), Expect = e-105
 Identities = 259/280 (92%)
 Strand = Plus / Minus

                                                                       
Query: 195 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 254
           |||||||||||||||||||||||||||||||||| ||||||||||||| | |||||||||
Sbjct: 753 ttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaagaggacctcgtagat 694

                                                                       
Query: 255 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 314
           ||||||||||||||| ||||||||||| ||||| |||||||||||||||||| || ||||
Sbjct: 693 gacgccggcgaggccaccgccgatgagtgggccaacccagtacacccactgggactccca 634

                                                                       
Query: 315 ctcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaa 374
              ||||||||||||||| ||||||||||||||||| ||||||||||| ||||||  |||
Sbjct: 633 ggaccagctgacgagggccgggccgaaggagacggccgggttcatggaggcgccgtcgaa 574

                                                                       
Query: 375 ggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434
            |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 573 cgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcgatgggggcgatggt 514

                                                   
Query: 435 gcccaggctgcccttcttggggtcgacggcggtggcgtac 474
           ||| |||||||||||||||||||| |||||||||||||||
Sbjct: 513 gccgaggctgcccttcttggggtcaacggcggtggcgtac 474



to top

>emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative gamma tonoplast intrinsic
           protein (TIP)
          Length = 1146

 Score =  283 bits (143), Expect = 3e-73
 Identities = 250/285 (87%), Gaps = 3/285 (1%)
 Strand = Plus / Minus

                                                                       
Query: 193 gcttagtagtcggtggtggggagctgctcgtgggtgcgggag---atgaagagcagctcg 249
           |||||||||||||||||||||||||||||||||||| |||||   ||||||||||  |||
Sbjct: 837 gcttagtagtcggtggtggggagctgctcgtgggtgtgggaggagatgaagagcatgtcg 778

                                                                       
Query: 250 tagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtac 309
           || || |   | |||||  |  | |||||||  |||||||||||||||||||| ||||  
Sbjct: 777 tatataagtgcagcgagtgcagcaccgatgaacgggccgacccagtacacccagtggttg 718

                                                                       
Query: 310 ccccactcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccg 369
             |||   |||||||||||| | |||||||||||| ||||||||||||||||||||||||
Sbjct: 717 ttccaggaccagctgacgagcgaggggccgaaggacacggcggggttcatggacgcgccg 658

                                                                       
Query: 370 gagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcg 429
             |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||
Sbjct: 657 tcgaaggcgccgccgacgaggatgttggcgcccacgatgaagccgatggcgatgggggcg 598

                                                        
Query: 430 atggtgcccaggctgcccttcttggggtcgacggcggtggcgtac 474
           |||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 597 atggtgcccaggctgcccttcttggggtcgaccgcggtggcgtac 553



to top

>dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-170-E06, full
           insert sequence
          Length = 1024

 Score =  260 bits (131), Expect = 4e-66
 Identities = 182/199 (91%)
 Strand = Plus / Plus

                                                                       
Query: 276 gatgagggggccgacccagtacacccactggtacccccactcccagctgacgagggcggg 335
           |||||| ||||| |||||||||||||||||| || ||||   ||||||||||||||| ||
Sbjct: 219 gatgagtgggccaacccagtacacccactgggactcccaggaccagctgacgagggccgg 278

                                                                       
Query: 336 gccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgtt 395
           ||||||||||||||| ||||||||||| ||||||  ||| ||||||||||||||||||||
Sbjct: 279 gccgaaggagacggccgggttcatggaggcgccgtcgaacgcgccgccgacgaggatgtt 338

                                                                       
Query: 396 ggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggg 455
            ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||
Sbjct: 339 cgcgccgacgatgaagccgatggcgatgggggcgatggtgccgaggctgcccttcttggg 398

                              
Query: 456 gtcgacggcggtggcgtac 474
           ||| |||||||||||||||
Sbjct: 399 gtcaacggcggtggcgtac 417



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 55/57 (96%)
 Strand = Plus / Plus

                                                                    
Query: 182 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatga 238
           ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 167 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatga 223



to top

>gb|AF326500.1|AF326500 Zea mays tonoplast membrane integral protein ZmTIP1-2 mRNA,
           complete cds
          Length = 1021

 Score =  190 bits (96), Expect = 3e-45
 Identities = 168/192 (87%)
 Strand = Plus / Minus

                                                                       
Query: 283 gggccgacccagtacacccactggtacccccactcccagctgacgagggcggggccgaag 342
           |||||||||||||||||||| |||| | ||||  | | | |||||| ||| |||||||||
Sbjct: 682 gggccgacccagtacacccagtggttctcccagacgccggtgacgacggccgggccgaag 623

                                                                       
Query: 343 gagacggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccg 402
           |||||||||||||||||||| ||||||  ||||||||| ||  | |||||||||||||||
Sbjct: 622 gagacggcggggttcatggaggcgccgtcgaaggcgccccccgccaggatgttggcgccg 563

                                                                       
Query: 403 acgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacg 462
           ||||||||||||||||||||||||||||||  ||| |||  ||||||||||||||| |||
Sbjct: 562 acgatgaagccgatggcgatgggcgcgatgacgccgaggtcgcccttcttggggtccacg 503

                       
Query: 463 gcggtggcgtac 474
           || |||||||||
Sbjct: 502 gccgtggcgtac 491



to top

>ref|NM_189497.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 759

 Score =  182 bits (92), Expect = 7e-43
 Identities = 137/152 (90%)
 Strand = Plus / Minus

                                                                       
Query: 323 tgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgc 382
           |||||| ||||||||||||||||||||||||||||||||| ||||||  |||||||||||
Sbjct: 628 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 569

                                                                       
Query: 383 cgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggc 442
           || |||||||||||||||||||||||||||||||||||||||| ||||||   || ||| 
Sbjct: 568 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 509

                                           
Query: 443 tgcccttcttggggtcgacggcggtggcgtac 474
            |||||||||||| || || ||||||||||||
Sbjct: 508 cgcccttcttgggatccaccgcggtggcgtac 477



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  182 bits (92), Expect = 7e-43
 Identities = 137/152 (90%)
 Strand = Plus / Plus

                                                                            
Query: 323      tgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgc 382
                |||||| ||||||||||||||||||||||||||||||||| ||||||  |||||||||||
Sbjct: 43108799 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 43108858

                                                                            
Query: 383      cgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggc 442
                || |||||||||||||||||||||||||||||||||||||||| ||||||   || ||| 
Sbjct: 43108859 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 43108918

                                                
Query: 443      tgcccttcttggggtcgacggcggtggcgtac 474
                 |||||||||||| || || ||||||||||||
Sbjct: 43108919 cgcccttcttgggatccaccgcggtggcgtac 43108950



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 79/90 (87%)
 Strand = Plus / Minus

                                                                           
Query: 326     cgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccga 385
               ||||||| ||||||||||||  ||| ||||||||||| ||||||||| |||  |||||| 
Sbjct: 7297479 cgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccgg 7297420

                                             
Query: 386     cgaggatgttggcgccgacgatgaagccga 415
               ||||||||||||||||||||| || |||||
Sbjct: 7297419 cgaggatgttggcgccgacgacgaggccga 7297390



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                      
Query: 352     gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacga 406
               ||||||||||||||||||| ||  ||||||||| ||| | |||||||||||||||
Sbjct: 7302352 gggttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 7302298



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                                
Query: 259     ccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 307
               |||||||||||| ||||||||| ||| |||| |||||||||||| ||||
Sbjct: 6644922 ccggcgaggccggcgccgatgaagggaccgagccagtacacccagtggt 6644970



to top

>dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0459B04
          Length = 142475

 Score =  182 bits (92), Expect = 7e-43
 Identities = 137/152 (90%)
 Strand = Plus / Plus

                                                                          
Query: 323    tgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgc 382
              |||||| ||||||||||||||||||||||||||||||||| ||||||  |||||||||||
Sbjct: 105828 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 105887

                                                                          
Query: 383    cgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggc 442
              || |||||||||||||||||||||||||||||||||||||||| ||||||   || ||| 
Sbjct: 105888 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 105947

                                              
Query: 443    tgcccttcttggggtcgacggcggtggcgtac 474
               |||||||||||| || || ||||||||||||
Sbjct: 105948 cgcccttcttgggatccaccgcggtggcgtac 105979



to top

>dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023066H10, full
           insert sequence
          Length = 1346

 Score =  182 bits (92), Expect = 7e-43
 Identities = 137/152 (90%)
 Strand = Plus / Minus

                                                                       
Query: 323 tgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgc 382
           |||||| ||||||||||||||||||||||||||||||||| ||||||  |||||||||||
Sbjct: 652 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 593

                                                                       
Query: 383 cgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggc 442
           || |||||||||||||||||||||||||||||||||||||||| ||||||   || ||| 
Sbjct: 592 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 533

                                           
Query: 443 tgcccttcttggggtcgacggcggtggcgtac 474
            |||||||||||| || || ||||||||||||
Sbjct: 532 cgcccttcttgggatccaccgcggtggcgtac 501



to top

>dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023050B20, full
           insert sequence
          Length = 1149

 Score =  182 bits (92), Expect = 7e-43
 Identities = 137/152 (90%)
 Strand = Plus / Minus

                                                                       
Query: 323 tgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgc 382
           |||||| ||||||||||||||||||||||||||||||||| ||||||  |||||||||||
Sbjct: 701 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 642

                                                                       
Query: 383 cgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggc 442
           || |||||||||||||||||||||||||||||||||||||||| ||||||   || ||| 
Sbjct: 641 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 582

                                           
Query: 443 tgcccttcttggggtcgacggcggtggcgtac 474
            |||||||||||| || || ||||||||||||
Sbjct: 581 cgcccttcttgggatccaccgcggtggcgtac 550



to top

>dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 970

 Score =  182 bits (92), Expect = 7e-43
 Identities = 137/152 (90%)
 Strand = Plus / Minus

                                                                       
Query: 323 tgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgc 382
           |||||| ||||||||||||||||||||||||||||||||| ||||||  |||||||||||
Sbjct: 638 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 579

                                                                       
Query: 383 cgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggc 442
           || |||||||||||||||||||||||||||||||||||||||| ||||||   || ||| 
Sbjct: 578 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 519

                                           
Query: 443 tgcccttcttggggtcgacggcggtggcgtac 474
            |||||||||||| || || ||||||||||||
Sbjct: 518 cgcccttcttgggatccaccgcggtggcgtac 487



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  178 bits (90), Expect = 1e-41
 Identities = 138/154 (89%)
 Strand = Plus / Minus

                                                                            
Query: 321      gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 380
                |||| ||| ||||||||||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 13251010 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 13250951

                                                                            
Query: 381      gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 440
                | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 13250950 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 13250891

                                                  
Query: 441      gctgcccttcttggggtcgacggcggtggcgtac 474
                    ||||||||||||||| ||||||||||||||
Sbjct: 13250890 cgaccccttcttggggtcggcggcggtggcgtac 13250857



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                                
Query: 249      gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 296
                ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 13251082 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 13251035



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 399      gccgacgatgaagccgatggcgat 422
                ||||| ||||||||||||||||||
Sbjct: 26574317 gccgaggatgaagccgatggcgat 26574294



to top

>dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0427E01
          Length = 146395

 Score =  178 bits (90), Expect = 1e-41
 Identities = 138/154 (89%)
 Strand = Plus / Minus

                                                                         
Query: 321   gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 380
             |||| ||| ||||||||||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 12820 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 12761

                                                                         
Query: 381   gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 440
             | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 12760 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 12701

                                               
Query: 441   gctgcccttcttggggtcgacggcggtggcgtac 474
                 ||||||||||||||| ||||||||||||||
Sbjct: 12700 cgaccccttcttggggtcggcggcggtggcgtac 12667



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                             
Query: 249   gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 296
             ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 12892 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 12845



to top

>dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0012F14
          Length = 168629

 Score =  178 bits (90), Expect = 1e-41
 Identities = 138/154 (89%)
 Strand = Plus / Minus

                                                                          
Query: 321    gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 380
              |||| ||| ||||||||||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 168198 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 168139

                                                                          
Query: 381    gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 440
              | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 168138 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 168079

                                                
Query: 441    gctgcccttcttggggtcgacggcggtggcgtac 474
                  ||||||||||||||| ||||||||||||||
Sbjct: 168078 cgaccccttcttggggtcggcggcggtggcgtac 168045



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                              
Query: 249    gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 296
              ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 168270 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 168223



to top

>dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C06, full
           insert sequence
          Length = 1194

 Score =  178 bits (90), Expect = 1e-41
 Identities = 138/154 (89%)
 Strand = Plus / Minus

                                                                       
Query: 321 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 380
           |||| ||| ||||||||||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 710 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 651

                                                                       
Query: 381 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 440
           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 650 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 591

                                             
Query: 441 gctgcccttcttggggtcgacggcggtggcgtac 474
               ||||||||||||||| ||||||||||||||
Sbjct: 590 cgaccccttcttggggtcggcggcggtggcgtac 557



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 249 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 296
           ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 782 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 735



to top

>dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-F03, full
           insert sequence
          Length = 1214

 Score =  178 bits (90), Expect = 1e-41
 Identities = 138/154 (89%)
 Strand = Plus / Minus

                                                                       
Query: 321 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 380
           |||| ||| ||||||||||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 712 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 653

                                                                       
Query: 381 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 440
           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 652 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 593

                                             
Query: 441 gctgcccttcttggggtcgacggcggtggcgtac 474
               ||||||||||||||| ||||||||||||||
Sbjct: 592 cgaccccttcttggggtcggcggcggtggcgtac 559



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 249 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 296
           ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 784 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 737



to top

>dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023036J06, full
           insert sequence
          Length = 1074

 Score =  178 bits (90), Expect = 1e-41
 Identities = 138/154 (89%)
 Strand = Plus / Minus

                                                                       
Query: 321 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 380
           |||| ||| ||||||||||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 590 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 531

                                                                       
Query: 381 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 440
           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 530 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 471

                                             
Query: 441 gctgcccttcttggggtcgacggcggtggcgtac 474
               ||||||||||||||| ||||||||||||||
Sbjct: 470 cgaccccttcttggggtcggcggcggtggcgtac 437



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 249 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 296
           ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 662 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 615



to top

>dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013050J20, full
           insert sequence
          Length = 1197

 Score =  178 bits (90), Expect = 1e-41
 Identities = 138/154 (89%)
 Strand = Plus / Minus

                                                                       
Query: 321 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 380
           |||| ||| ||||||||||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 713 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 654

                                                                       
Query: 381 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 440
           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 653 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 594

                                             
Query: 441 gctgcccttcttggggtcgacggcggtggcgtac 474
               ||||||||||||||| ||||||||||||||
Sbjct: 593 cgaccccttcttggggtcggcggcggtggcgtac 560



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 249 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 296
           ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 785 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 738



to top

>dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023055A02, full
           insert sequence
          Length = 1195

 Score =  178 bits (90), Expect = 1e-41
 Identities = 138/154 (89%)
 Strand = Plus / Minus

                                                                       
Query: 321 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 380
           |||| ||| ||||||||||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 711 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 652

                                                                       
Query: 381 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 440
           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 651 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 592

                                             
Query: 441 gctgcccttcttggggtcgacggcggtggcgtac 474
               ||||||||||||||| ||||||||||||||
Sbjct: 591 cgaccccttcttggggtcggcggcggtggcgtac 558



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 249 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 296
           ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 783 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 736



to top

>dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116H02, full
           insert sequence
          Length = 1202

 Score =  178 bits (90), Expect = 1e-41
 Identities = 138/154 (89%)
 Strand = Plus / Minus

                                                                       
Query: 321 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 380
           |||| ||| ||||||||||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 713 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 654

                                                                       
Query: 381 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 440
           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 653 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 594

                                             
Query: 441 gctgcccttcttggggtcgacggcggtggcgtac 474
               ||||||||||||||| ||||||||||||||
Sbjct: 593 cgaccccttcttggggtcggcggcggtggcgtac 560



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 249 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 296
           ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 785 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 738



to top

>dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044F19, full
           insert sequence
          Length = 1220

 Score =  178 bits (90), Expect = 1e-41
 Identities = 138/154 (89%)
 Strand = Plus / Minus

                                                                       
Query: 321 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 380
           |||| ||| ||||||||||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 711 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 652

                                                                       
Query: 381 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 440
           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 651 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 592

                                             
Query: 441 gctgcccttcttggggtcgacggcggtggcgtac 474
               ||||||||||||||| ||||||||||||||
Sbjct: 591 cgaccccttcttggggtcggcggcggtggcgtac 558



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 249 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 296
           ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 783 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 736



to top

>gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;3 mRNA,
           complete cds
          Length = 829

 Score =  176 bits (89), Expect = 4e-41
 Identities = 131/145 (90%)
 Strand = Plus / Minus

                                                                       
Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389
           ||||||||||||||||   || |||||||||||| |||||||||||| |||| |||||||
Sbjct: 663 ggcggggccgaaggagcgtgcagggttcatggacccgccggagaaggggccggcgacgag 604

                                                                       
Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 449
           ||||||||||||||||||||||||||||||||| || ||||||||||| |||   |||||
Sbjct: 603 gatgttggcgccgacgatgaagccgatggcgattggagcgatggtgccgagggacccctt 544

                                    
Query: 450 cttggggtcgacggcggtggcgtac 474
           |||||||||| ||||||||||||||
Sbjct: 543 cttggggtcggcggcggtggcgtac 519



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 249 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 296
           ||||| ||||||||||||||| ||||||||||| |||||| |||||||
Sbjct: 744 gtagacgacgccggcgaggccaccgccgatgagcgggccggcccagta 697



to top

>gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;2 mRNA,
           complete cds
          Length = 853

 Score =  176 bits (89), Expect = 4e-41
 Identities = 131/145 (90%)
 Strand = Plus / Minus

                                                                       
Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389
           ||||||||||||||||   || |||||||||||| |||||||||||| |||| | |||||
Sbjct: 666 ggcggggccgaaggagcgtgcagggttcatggacccgccggagaaggggccggcaacgag 607

                                                                       
Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 449
           |||||||||||||||||||||||||||||||||||| ||||||||||| |||   |||||
Sbjct: 606 gatgttggcgccgacgatgaagccgatggcgatgggggcgatggtgccgagggaaccctt 547

                                    
Query: 450 cttggggtcgacggcggtggcgtac 474
           |||||||||| ||||||||||||||
Sbjct: 546 cttggggtcggcggcggtggcgtac 522



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 249 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 296
           ||||| ||||||||||||||| ||||||||||| |||||| |||||||
Sbjct: 747 gtagacgacgccggcgaggccaccgccgatgagcgggccggcccagta 700



to top

>gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;1 mRNA,
           complete cds
          Length = 817

 Score =  176 bits (89), Expect = 4e-41
 Identities = 131/145 (90%)
 Strand = Plus / Minus

                                                                       
Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389
           ||||||||||||||||   || |||||||||||| |||||||||||| |||| | |||||
Sbjct: 667 ggcggggccgaaggagcgtgcagggttcatggacccgccggagaaggggccggccacgag 608

                                                                       
Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 449
           |||||||||||||||||||||||||||||||||||| ||||||||||| |||   |||||
Sbjct: 607 gatgttggcgccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 548

                                    
Query: 450 cttggggtcgacggcggtggcgtac 474
           |||||||||| ||||||||||||||
Sbjct: 547 cttggggtcggcggcggtggcgtac 523



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                 
Query: 249 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 302
           ||||| ||||||||||||||| ||||||||||| |||||| ||||||| |||||
Sbjct: 748 gtagacgacgccggcgaggccaccgccgatgagcgggccggcccagtagaccca 695



to top

>dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-G09, full
           insert sequence
          Length = 1196

 Score =  170 bits (86), Expect = 3e-39
 Identities = 137/154 (88%)
 Strand = Plus / Minus

                                                                       
Query: 321 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 380
           |||| ||| |||||| |||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 712 gctggcgacggcgggaccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 653

                                                                       
Query: 381 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 440
           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 652 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 593

                                             
Query: 441 gctgcccttcttggggtcgacggcggtggcgtac 474
               ||||||||||||||| ||||||||||||||
Sbjct: 592 cgaccccttcttggggtcggcggcggtggcgtac 559



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 249 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 296
           ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 784 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 737



to top

>gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral protein ZmTIP2-2 mRNA,
           complete cds
          Length = 1073

 Score =  168 bits (85), Expect = 1e-38
 Identities = 130/145 (89%)
 Strand = Plus / Minus

                                                                       
Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389
           ||||||||||||||||  |||||||||||||||  |||||  |||||  ||  || ||||
Sbjct: 682 ggcggggccgaaggagcgggcggggttcatggagccgccgctgaagggccccgcggcgag 623

                                                                       
Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 449
           |||||||||||||||||||||||||||||||||||||||||||||||| |||  ||||||
Sbjct: 622 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagggagccctt 563

                                    
Query: 450 cttggggtcgacggcggtggcgtac 474
           |||||||||| ||||||||||||||
Sbjct: 562 cttggggtcggcggcggtggcgtac 538



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 248 cgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 302
           |||||| || ||| ||||| |||||||||||||| |||||||||||||| |||||
Sbjct: 764 cgtagacgaggccagcgagtccgccgccgatgagcgggccgacccagtagaccca 710



to top

>gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral protein ZmTIP2-1 mRNA,
           complete cds
          Length = 1110

 Score =  161 bits (81), Expect = 3e-36
 Identities = 129/145 (88%)
 Strand = Plus / Minus

                                                                       
Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389
           ||||||||||||||||  |||||||||||||||  |||||  |||||  ||  || ||||
Sbjct: 839 ggcggggccgaaggagcgggcggggttcatggagccgccgctgaagggccccgcggcgag 780

                                                                       
Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 449
           |||||||||||||||||||||||||||||||||||||||||||||||| ||   ||||||
Sbjct: 779 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgagccctt 720

                                    
Query: 450 cttggggtcgacggcggtggcgtac 474
           |||||||||| ||||||||||||||
Sbjct: 719 cttggggtcggcggcggtggcgtac 695



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 248 cgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 302
           |||||| || ||| |||||||||||||||| ||| |||||||||||||| |||||
Sbjct: 921 cgtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagaccca 867



to top

>gb|AY105015.1| Zea mays PCO137646 mRNA sequence
          Length = 1238

 Score =  161 bits (81), Expect = 3e-36
 Identities = 129/145 (88%)
 Strand = Plus / Minus

                                                                       
Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389
           ||||||||||||||||  |||||||||||||||  |||||  |||||  ||  || ||||
Sbjct: 838 ggcggggccgaaggagcgggcggggttcatggagccgccgctgaagggccccgcggcgag 779

                                                                       
Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 449
           |||||||||||||||||||||||||||||||||||||||||||||||| ||   ||||||
Sbjct: 778 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgagccctt 719

                                    
Query: 450 cttggggtcgacggcggtggcgtac 474
           |||||||||| ||||||||||||||
Sbjct: 718 cttggggtcggcggcggtggcgtac 694



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 248 cgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 302
           |||||| || ||| |||||||||||||||| ||| |||||||||||||| |||||
Sbjct: 920 cgtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagaccca 866



to top

>gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intrinsic protein mRNA,
           complete cds
          Length = 1067

 Score =  161 bits (81), Expect = 3e-36
 Identities = 129/145 (88%)
 Strand = Plus / Minus

                                                                       
Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389
           ||||||||||||||||   || |||||||||||| ||||||| |||| |||| | |||||
Sbjct: 669 ggcggggccgaaggagcgtgcagggttcatggacccgccggaaaaggggccggccacgag 610

                                                                       
Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 449
           ||||||||||||||| |||||||||||||||||||| ||||||||||| |||   |||||
Sbjct: 609 gatgttggcgccgacaatgaagccgatggcgatgggggcgatggtgccgagggatccctt 550

                                    
Query: 450 cttggggtcgacggcggtggcgtac 474
           |||||||||| ||||||||||||||
Sbjct: 549 cttggggtcggcggcggtggcgtac 525



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 255 gacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 302
           ||||||||||||||| ||||||||||| |||||| ||||||| |||||
Sbjct: 744 gacgccggcgaggccaccgccgatgagcgggccggcccagtaaaccca 697



to top

>gb|AY112388.1| Zea mays CL24208_1 mRNA sequence
          Length = 833

 Score =  157 bits (79), Expect = 4e-35
 Identities = 162/192 (84%)
 Strand = Plus / Plus

                                                                       
Query: 283 gggccgacccagtacacccactggtacccccactcccagctgacgagggcggggccgaag 342
           |||||||||||||||||||| |||| | ||||  | | | ||||||  || |||||||||
Sbjct: 329 gggccgacccagtacacccagtggttctcccagacgccggtgacgacagccgggccgaag 388

                                                                       
Query: 343 gagacggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccg 402
           |||||||||| ||||||||| ||||||  |||||||       | |||||||||||||||
Sbjct: 389 gagacggcggngttcatggaggcgccgtcgaaggcgnnnnnngccaggatgttggcgccg 448

                                                                       
Query: 403 acgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacg 462
           ||||||||||||||||||||||||||||||  ||| |||  ||||||||||||||| |||
Sbjct: 449 acgatgaagccgatggcgatgggcgcgatgacgccgaggtcgcccttcttggggtccacg 508

                       
Query: 463 gcggtggcgtac 474
           || |||||||||
Sbjct: 509 gccgtggcgtac 520



to top

>dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-E02, full
           insert sequence
          Length = 870

 Score =  155 bits (78), Expect = 2e-34
 Identities = 93/98 (94%)
 Strand = Plus / Minus

                                                                       
Query: 182 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 241
           ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 689 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 630

                                                 
Query: 242 gcagctcgtagatgacgccggcgaggccgccgccgatg 279
           | | |||||||||||||||||||||||| |||||||||
Sbjct: 629 ggacctcgtagatgacgccggcgaggccaccgccgatg 592



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                             
Query: 441 gctgcccttcttggggtcgacggcggtggcgtac 474
           |||||||||||||||||| |||||||||||||||
Sbjct: 592 gctgcccttcttggggtcaacggcggtggcgtac 559



to top

>gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds
          Length = 968

 Score =  145 bits (73), Expect = 2e-31
 Identities = 127/145 (87%)
 Strand = Plus / Minus

                                                                       
Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389
           ||||||||||||||||  ||| |||||||||||  |||||  ||||| |||| || | ||
Sbjct: 615 ggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccag 556

                                                                       
Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 449
           |||||||||||||||||||||||||||||| |||||||||||||||||||||   |||||
Sbjct: 555 gatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggacccctt 496

                                    
Query: 450 cttggggtcgacggcggtggcgtac 474
           ||| |||||| | ||||||||||||
Sbjct: 495 cttcgggtcggccgcggtggcgtac 471



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 265 aggccgccgccgatgagggggccgacccagtacaccca 302
           ||||| ||||||| ||||||||||||||||||||||||
Sbjct: 680 aggccaccgccgacgagggggccgacccagtacaccca 643



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 330 ggcggggccgaaggagacggcggggttca 358
           |||| ||||||||| ||||||||||||||
Sbjct: 276 ggcgaggccgaaggtgacggcggggttca 248



to top

>gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral protein ZmTIP2-3 mRNA,
           complete cds
          Length = 1042

 Score =  145 bits (73), Expect = 2e-31
 Identities = 127/145 (87%)
 Strand = Plus / Minus

                                                                       
Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389
           ||||||||||||||||  ||| |||||||||||  |||||  ||||| |||| || | ||
Sbjct: 683 ggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccag 624

                                                                       
Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 449
           |||||||||||||||||||||||||||||| |||||||||||||||||||||   |||||
Sbjct: 623 gatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggacccctt 564

                                    
Query: 450 cttggggtcgacggcggtggcgtac 474
           ||| |||||| | ||||||||||||
Sbjct: 563 cttcgggtcggccgcggtggcgtac 539



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 265 aggccgccgccgatgagggggccgacccagtacaccca 302
           ||||| ||||||| ||||||||||||||||||||||||
Sbjct: 748 aggccaccgccgacgagggggccgacccagtacaccca 711



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 330 ggcggggccgaaggagacggcggggttca 358
           |||| ||||||||| ||||||||||||||
Sbjct: 344 ggcgaggccgaaggtgacggcggggttca 316



to top

>gb|AY106931.1| Zea mays PCO140073 mRNA sequence
          Length = 1069

 Score =  145 bits (73), Expect = 2e-31
 Identities = 127/145 (87%)
 Strand = Plus / Minus

                                                                       
Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389
           ||||||||||||||||  ||| |||||||||||  |||||  ||||| |||| || | ||
Sbjct: 692 ggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccag 633

                                                                       
Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 449
           |||||||||||||||||||||||||||||| |||||||||||||||||||||   |||||
Sbjct: 632 gatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggacccctt 573

                                    
Query: 450 cttggggtcgacggcggtggcgtac 474
           ||| |||||| | ||||||||||||
Sbjct: 572 cttcgggtcggccgcggtggcgtac 548



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 265 aggccgccgccgatgagggggccgacccagtacaccca 302
           ||||| ||||||| ||||||||||||||||||||||||
Sbjct: 757 aggccaccgccgacgagggggccgacccagtacaccca 720



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 330 ggcggggccgaaggagacggcggggttca 358
           |||| ||||||||| ||||||||||||||
Sbjct: 353 ggcgaggccgaaggtgacggcggggttca 325



to top

>gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRNA, complete cds
          Length = 1060

 Score =  145 bits (73), Expect = 2e-31
 Identities = 127/145 (87%)
 Strand = Plus / Minus

                                                                       
Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389
           ||||||||||||||||  ||| |||||||||||  |||||  ||||| |||| || | ||
Sbjct: 674 ggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccag 615

                                                                       
Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 449
           |||||||||||||||||||||||||||||| |||||||||||||||||||||   |||||
Sbjct: 614 gatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggacccctt 555

                                    
Query: 450 cttggggtcgacggcggtggcgtac 474
           ||| |||||| | ||||||||||||
Sbjct: 554 cttcgggtcggccgcggtggcgtac 530



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 265 aggccgccgccgatgagggggccgacccagtacaccca 302
           ||||| ||||||| ||||||||||||||||||||||||
Sbjct: 739 aggccaccgccgacgagggggccgacccagtacaccca 702



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 330 ggcggggccgaaggagacggcggggttca 358
           |||| ||||||||| ||||||||||||||
Sbjct: 335 ggcgaggccgaaggtgacggcggggttca 307



to top

>gb|AY389618.1| Hyacinthus orientalis mitochondrial tonoplast intrinsic protein
           (TIP1) mRNA, partial cds
          Length = 662

 Score =  125 bits (63), Expect = 1e-25
 Identities = 138/163 (84%)
 Strand = Plus / Minus

                                                                       
Query: 312 ccactcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccgga 371
           |||||||||||| || || |  || |||||||| || || |||||||| ||||| |||  
Sbjct: 632 ccactcccagctcaccagcggcggcccgaaggacaccgccgggttcatcgacgccccgtc 573

                                                                       
Query: 372 gaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 431
           |||||| |||||| | ||||||||||| || |||||||||||||| ||||||||||||||
Sbjct: 572 gaaggccccgccggccaggatgttggcccccacgatgaagccgatcgcgatgggcgcgat 513

                                                      
Query: 432 ggtgcccaggctgcccttcttggggtcgacggcggtggcgtac 474
            || |||||||| |||||||| ||||| | |||||||||||||
Sbjct: 512 cgtccccaggctccccttcttcgggtcaatggcggtggcgtac 470



to top

>ref|XM_467137.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 747

 Score =  111 bits (56), Expect = 2e-21
 Identities = 95/108 (87%)
 Strand = Plus / Minus

                                                                       
Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389
           ||||||||||||||||   || |||||||||||  |||||  ||| | |||| || ||||
Sbjct: 612 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 553

                                                           
Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 437
           ||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 552 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgcc 505



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 302
           |||||||||||||||||||| || |||||||||||||| |||||
Sbjct: 683 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 640



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  111 bits (56), Expect = 2e-21
 Identities = 95/108 (87%)
 Strand = Plus / Plus

                                                                            
Query: 330      ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389
                ||||||||||||||||   || |||||||||||  |||||  ||| | |||| || ||||
Sbjct: 26627254 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 26627313

                                                                
Query: 390      gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 437
                ||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 26627314 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgcc 26627361



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                            
Query: 259      ccggcgaggccgccgccgatgagggggccgacccagtacaccca 302
                |||||||||||||||||||| || |||||||||||||| |||||
Sbjct: 26627183 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 26627226



to top

>gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic protein 1 (TIP1), tonoplast
             intrinsic protein 2 (TIP2), and Rar1 (Rar1) genes,
             complete cds
          Length = 65979

 Score =  111 bits (56), Expect = 2e-21
 Identities = 95/108 (87%)
 Strand = Plus / Minus

                                                                         
Query: 352   gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaag 411
             |||||||||||  |||||  |||||  ||| || ||||||||||||||||||||||||||
Sbjct: 44819 gggttcatggagccgccgctgaagggcccggcggcgaggatgttggcgccgacgatgaag 44760

                                                             
Query: 412   ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcg 459
             ||||| || ||||||||||||||||| |||  ||||||||||||||||
Sbjct: 44759 ccgatcgccatgggcgcgatggtgccgagggagcccttcttggggtcg 44712



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                         
Query: 259   ccggcgaggccgccgccgatgagggggccgacccagtacaccca 302
             |||||||||||||| || ||||| || |||||||||||||||||
Sbjct: 44912 ccggcgaggccgccaccaatgagtggcccgacccagtacaccca 44869



to top

>dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0519E06
          Length = 170634

 Score =  111 bits (56), Expect = 2e-21
 Identities = 95/108 (87%)
 Strand = Plus / Plus

                                                                          
Query: 330    ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389
              ||||||||||||||||   || |||||||||||  |||||  ||| | |||| || ||||
Sbjct: 169635 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 169694

                                                              
Query: 390    gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 437
              ||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 169695 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgcc 169742



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                          
Query: 259    ccggcgaggccgccgccgatgagggggccgacccagtacaccca 302
              |||||||||||||||||||| || |||||||||||||| |||||
Sbjct: 169564 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 169607



to top

>dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1112_F09
          Length = 139371

 Score =  111 bits (56), Expect = 2e-21
 Identities = 95/108 (87%)
 Strand = Plus / Plus

                                                                         
Query: 330   ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389
             ||||||||||||||||   || |||||||||||  |||||  ||| | |||| || ||||
Sbjct: 61415 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 61474

                                                             
Query: 390   gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 437
             ||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 61475 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgcc 61522



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                         
Query: 259   ccggcgaggccgccgccgatgagggggccgacccagtacaccca 302
             |||||||||||||||||||| || |||||||||||||| |||||
Sbjct: 61344 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 61387



to top

>dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 1013

 Score =  111 bits (56), Expect = 2e-21
 Identities = 95/108 (87%)
 Strand = Plus / Minus

                                                                       
Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389
           ||||||||||||||||   || |||||||||||  |||||  ||| | |||| || ||||
Sbjct: 685 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 626

                                                           
Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 437
           ||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 625 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgcc 578



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 302
           |||||||||||||||||||| || |||||||||||||| |||||
Sbjct: 756 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 713



to top

>dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-120-A10, full
           insert sequence
          Length = 873

 Score =  111 bits (56), Expect = 2e-21
 Identities = 95/108 (87%)
 Strand = Plus / Minus

                                                                       
Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389
           ||||||||||||||||   || |||||||||||  |||||  ||| | |||| || ||||
Sbjct: 487 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 428

                                                           
Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 437
           ||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 427 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgcc 380



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 302
           |||||||||||||||||||| || |||||||||||||| |||||
Sbjct: 558 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 515



to top

>emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chromosome 2
          Length = 339972

 Score =  111 bits (56), Expect = 2e-21
 Identities = 95/108 (87%)
 Strand = Plus / Minus

                                                                          
Query: 330    ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389
              ||||||||||||||||   || |||||||||||  |||||  ||| | |||| || ||||
Sbjct: 250580 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 250521

                                                              
Query: 390    gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 437
              ||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 250520 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgcc 250473



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 51/52 (98%)
 Strand = Plus / Plus

                                                                  
Query: 386    cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 437
              ||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 332124 cgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgcc 332175



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                          
Query: 259    ccggcgaggccgccgccgatgagggggccgacccagtacaccca 302
              |||||||||||||||||||| || |||||||||||||| |||||
Sbjct: 250651 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 250608



to top

>emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein
          Length = 1007

 Score =  103 bits (52), Expect = 5e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 338 cgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttgg 397
           ||||||||  |||||||||||||||  |||| ||||||| |||  || | | ||||||||
Sbjct: 684 cgaaggagcgggcggggttcatggagccgccagagaaggggcccgcggccaagatgttgg 625

                                                                       
Query: 398 cgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggt 457
           |||| ||||||||||| || || ||||| |||||||||||||||  ||||||||| ||||
Sbjct: 624 cgcccacgatgaagccaatagcaatgggagcgatggtgcccaggtcgcccttcttcgggt 565

                           
Query: 458 cgacggcggtggcgta 473
           || | |||||||||||
Sbjct: 564 cggctgcggtggcgta 549



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 42/44 (95%)
 Strand = Plus / Minus

                                                       
Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 302
           ||||| |||||||| |||||||||||||||||||||||||||||
Sbjct: 763 ccggcaaggccgcctccgatgagggggccgacccagtacaccca 720



to top

>ref|NM_188624.1| Oryza sativa (japonica cultivar-group), Ozsa8227 predicted mRNA
          Length = 756

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 79/90 (87%)
 Strand = Plus / Minus

                                                                       
Query: 326 cgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccga 385
           ||||||| ||||||||||||  ||| ||||||||||| ||||||||| |||  |||||| 
Sbjct: 616 cgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccgg 557

                                         
Query: 386 cgaggatgttggcgccgacgatgaagccga 415
           ||||||||||||||||||||| || |||||
Sbjct: 556 cgaggatgttggcgccgacgacgaggccga 527



to top

>gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral protein ZmTIP4-4 mRNA,
           complete cds
          Length = 955

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 73/82 (89%)
 Strand = Plus / Minus

                                                                       
Query: 325 acgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccg 384
           ||||| |||||||||||||||   ||||||||||||||||||||||||||||  ||||||
Sbjct: 714 acgagcgcggggccgaaggagcgcgcggggttcatggacgcgccggagaagggcccgccg 655

                                 
Query: 385 acgaggatgttggcgccgacga 406
            |||| | ||||||||||||||
Sbjct: 654 gcgagcacgttggcgccgacga 633



to top

>dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0431F01
          Length = 143209

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 79/90 (87%)
 Strand = Plus / Minus

                                                                         
Query: 326   cgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccga 385
             ||||||| ||||||||||||  ||| ||||||||||| ||||||||| |||  |||||| 
Sbjct: 98909 cgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccgg 98850

                                           
Query: 386   cgaggatgttggcgccgacgatgaagccga 415
             ||||||||||||||||||||| || |||||
Sbjct: 98849 cgaggatgttggcgccgacgacgaggccga 98820



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                     
Query: 352    gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacga 406
              ||||||||||||||||||| ||  ||||||||| ||| | |||||||||||||||
Sbjct: 103782 gggttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 103728



to top

>dbj|AK069192.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023007E01, full
           insert sequence
          Length = 1112

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 79/90 (87%)
 Strand = Plus / Minus

                                                                       
Query: 326 cgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccga 385
           ||||||| ||||||||||||  ||| ||||||||||| ||||||||| |||  |||||| 
Sbjct: 619 cgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccgg 560

                                         
Query: 386 cgaggatgttggcgccgacgatgaagccga 415
           ||||||||||||||||||||| || |||||
Sbjct: 559 cgaggatgttggcgccgacgacgaggccga 530



to top

>dbj|AB206104.1| Mimosa pudica tip1;1 mRNA for tonoplast intrinsic protein 1;1,
           complete cds
          Length = 1067

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 96/113 (84%)
 Strand = Plus / Minus

                                                                       
Query: 195 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 254
           |||||| ||||||||||||||||||||||||||| ||||||||||||  |  || |||||
Sbjct: 826 ttagtaatcggtggtggggagctgctcgtgggtgtgggagatgaagataacttcatagat 767

                                                                
Query: 255 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 307
           ||| || || ||||| || || || || |||||||||||||| ||||| ||||
Sbjct: 766 gaccccagcaaggccacctccaataagtgggccgacccagtagacccagtggt 714



to top

>gb|U43291.1|MCU43291 Mesembryanthemum crystallinum tonoplast intrinsic protein (TIP)
           mRNA, complete cds
          Length = 1235

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 180/225 (80%)
 Strand = Plus / Minus

                                                                       
Query: 250 tagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtac 309
           |||||||| |||||||| || || |||||||| |||||||||||||| ||||| ||||  
Sbjct: 752 tagatgactccggcgagccctcctccgatgagtgggccgacccagtagacccagtggttg 693

                                                                       
Query: 310 ccccactcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccg 369
             |||   ||| ||||| ||||| || ||||| || ||||| ||||||||||| || |||
Sbjct: 692 ttccaggtccaactgactagggctggaccgaatgacacggccgggttcatggatgcaccg 633

                                                                       
Query: 370 gagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcg 429
           | |||||| || ||||| | ||||||||| || |||||||| || ||||| || || || 
Sbjct: 632 gtgaaggctcctccgaccaagatgttggctccaacgatgaaaccaatggcaattggggca 573

                                                        
Query: 430 atggtgcccaggctgcccttcttggggtcgacggcggtggcgtac 474
           ||| | || ||| ||||  ||||| |||||| ||| |||||||||
Sbjct: 572 atgattccgaggttgcctctcttgtggtcgatggccgtggcgtac 528



to top

>ref|XM_473424.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2307

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 388 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccc 447
           ||||||||||| |||||||||||||||||||| |||||||||| |||||| |||   |||
Sbjct: 557 aggatgttggcaccgacgatgaagccgatggccatgggcgcgacggtgccgagggaaccc 498

                                      
Query: 448 ttcttggggtcgacggcggtggcgtac 474
           ||||| |||||| | || |||||||||
Sbjct: 497 ttcttcgggtcggccgccgtggcgtac 471



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 302
           ||||| ||||| || ||||| || ||||||||||||||||||||
Sbjct: 686 ccggccaggccaccaccgatcagtgggccgacccagtacaccca 643



to top

>emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0034G17,
             complete sequence
          Length = 127259

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 76/87 (87%)
 Strand = Plus / Plus

                                                                         
Query: 388   aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccc 447
             ||||||||||| |||||||||||||||||||| |||||||||| |||||| |||   |||
Sbjct: 92622 aggatgttggcaccgacgatgaagccgatggccatgggcgcgacggtgccgagggaaccc 92681

                                        
Query: 448   ttcttggggtcgacggcggtggcgtac 474
             ||||| |||||| | || |||||||||
Sbjct: 92682 ttcttcgggtcggccgccgtggcgtac 92708



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                         
Query: 259   ccggcgaggccgccgccgatgagggggccgacccagtacaccca 302
             ||||| ||||| || ||||| || ||||||||||||||||||||
Sbjct: 92493 ccggccaggccaccaccgatcagtgggccgacccagtacaccca 92536



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 76/87 (87%)
 Strand = Plus / Plus

                                                                            
Query: 388      aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccc 447
                ||||||||||| |||||||||||||||||||| |||||||||| |||||| |||   |||
Sbjct: 27568646 aggatgttggcaccgacgatgaagccgatggccatgggcgcgacggtgccgagggaaccc 27568705

                                           
Query: 448      ttcttggggtcgacggcggtggcgtac 474
                ||||| |||||| | || |||||||||
Sbjct: 27568706 ttcttcgggtcggccgccgtggcgtac 27568732



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 125/157 (79%)
 Strand = Plus / Minus

                                                                            
Query: 272      cgccgatgagggggccgacccagtacacccactggtacccccactcccagctgacgaggg 331
                |||||||||| || |||| |||||| ||||| ||||  | ||| | ||||| |||||| |
Sbjct: 26354830 cgccgatgagcggcccgagccagtaaacccagtggtggcgccagttccagccgacgagcg 26354771

                                                                            
Query: 332      cggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgagga 391
                | |||||||| | |   || |||||||||| |||||||  ||| | ||| ||| ||||||
Sbjct: 26354770 ccgggccgaacgcgcgcgccgggttcatggccgcgccgtcgaacgggcccccggcgagga 26354711

                                                     
Query: 392      tgttggcgccgacgatgaagccgatggcgatgggcgc 428
                |||| |||||  |||  ||||||||||||| ||||||
Sbjct: 26354710 tgttcgcgcccgcgaccaagccgatggcgaggggcgc 26354674



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                            
Query: 259      ccggcgaggccgccgccgatgagggggccgacccagtacaccca 302
                ||||| ||||| || ||||| || ||||||||||||||||||||
Sbjct: 27568517 ccggccaggccaccaccgatcagtgggccgacccagtacaccca 27568560



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 455      ggtcgacggcggtggcgtac 474
                ||||||||||||||||||||
Sbjct: 26354650 ggtcgacggcggtggcgtac 26354631



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 255      gacgccggcgaggccgccgccgatgagg 282
                ||||||| ||||||||||||||| ||||
Sbjct: 19492802 gacgccgacgaggccgccgccgaggagg 19492775



to top

>gb|AF326505.1|AF326505 Zea mays tonoplast membrane integral protein ZmTIP4-1 mRNA,
           complete cds
          Length = 1125

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 72/82 (87%)
 Strand = Plus / Minus

                                                                       
Query: 328 agggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacg 387
           ||||| ||||||||||||   || ||||||||||||||||||| ||||  ||||||| ||
Sbjct: 768 agggccgggccgaaggagcgtgccgggttcatggacgcgccggtgaagttgccgccggcg 709

                                 
Query: 388 aggatgttggcgccgacgatga 409
           ||| ||||||||||||||||||
Sbjct: 708 aggctgttggcgccgacgatga 687



to top

>emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative tonoplast intrinsic protein
           (tip1 gene)
          Length = 1112

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 220/278 (79%), Gaps = 2/278 (0%)
 Strand = Plus / Minus

                                                                       
Query: 197 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 256
           ||||||| ||||| |||||||| || |||||| ||  |||||| | ||||| ||||| ||
Sbjct: 830 agtagtcagtggttgggagctgttcatgggtgtggttgatgaataacagctggtagacga 771

                                                                       
Query: 257 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccact 316
            |||||||| | |  | ||||  || |||||||||||||| | ||| ||||   |||| |
Sbjct: 770 tgccggcgatggctgcaccgactagtgggccgacccagtagatccagtggttaacccagt 711

                                                                       
Query: 317 cccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaagg 376
            |||||| || | ||| || || ||||  ||||| ||||||||||| || |||| |||| 
Sbjct: 710 tccagctcaccaaggcaggtccaaaggccacggcagggttcatggatgcaccggtgaaga 651

                                                                       
Query: 377 cgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgc 436
           | || ||||||| |||||||||  | || || | ||||||||||| ||| ||||| ||||
Sbjct: 650 ctcctccgacgaagatgttggcagcaacaataaggccgatggcgaggggagcgatagtgc 591

                                                 
Query: 437 cca-ggctgcccttcttggggtcgacggcggtggcgta 473
           | | |||| || ||||||||||||| ||||||||||||
Sbjct: 590 cgatggct-cctttcttggggtcgatggcggtggcgta 554



to top

>emb|BX824373.1|CNS0A6WG Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH44ZA10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 887

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Minus

                                                                       
Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405
           ||||| ||||||||||| ||||||  ||| || || ||| |||||||||| || || |||
Sbjct: 488 acggctgggttcatggaagcgccgctgaaagctccaccggcgaggatgttcgctccaacg 429

                                                                       
Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465
           ||||| || |||||||| || ||||| || || ||  |||| ||||||||||| ||||| 
Sbjct: 428 atgaaacctatggcgattggtgcgattgttccgagagtgccgttcttggggtcaacggct 369

                   
Query: 466 gtggcgta 473
           ||||||||
Sbjct: 368 gtggcgta 361



to top

>dbj|AB012270.1| Aster tripolium mRNA for SAMIPD, partial cds
          Length = 321

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 38/39 (97%)
 Strand = Plus / Minus

                                                  
Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgc 428
           |||||||||||||||||||||||||||||| ||||||||
Sbjct: 321 gatgttggcgccgacgatgaagccgatggcaatgggcgc 283



to top

>gb|AF326506.1|AF326506 Zea mays tonoplast membrane integral protein ZmTIP4-2 mRNA,
           complete cds
          Length = 1255

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 352 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatga 409
           ||||||||||||||||||| ||||  ||||||| ||||| ||||||||||||| ||||
Sbjct: 743 gggttcatggacgcgccggtgaagttgccgccggcgaggctgttggcgccgactatga 686



to top

>dbj|D84669.1| Raphanus sativus mRNA for VM23, complete sequence
          Length = 1054

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 105/129 (81%)
 Strand = Plus / Minus

                                                                       
Query: 345 gacggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgac 404
           |||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || ||
Sbjct: 679 gacggctgggttcatggaggctccgctgaaagctccaccggcgaggatgttagctccaac 620

                                                                       
Query: 405 gatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggc 464
           |||||| || ||||| || || ||||| || || || || || |||||||||||||||||
Sbjct: 619 gatgaaacctatggcaattggtgcgattgttccgagactaccgttcttggggtcgacggc 560

                    
Query: 465 ggtggcgta 473
            ||||||||
Sbjct: 559 tgtggcgta 551



to top

>dbj|AB012272.1| Aster tripolium mRNA for SAMIPF, partial cds
          Length = 321

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 60/69 (86%)
 Strand = Plus / Minus

                                                                       
Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 449
           |||||||||||||||||| ||||||||||| || || || || || ||||| || |||||
Sbjct: 321 gatgttggcgccgacgataaagccgatggcaattggtgcaattgttcccagacttccctt 262

                    
Query: 450 cttggggtc 458
           |||||||||
Sbjct: 261 cttggggtc 253



to top

>ref|NM_113559.3| Arabidopsis thaliana TIP2 (TONOPLAST INTRINSIC PROTEIN 2); water
           channel AT3G26520 (TIP2) mRNA, complete cds
          Length = 1201

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405
           ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 720 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 661

                                                                       
Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 660 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 601

                   
Query: 466 gtggcgta 473
           ||||||||
Sbjct: 600 gtggcgta 593



to top

>emb|AJ289696.1|POC289696 Posidonia oceanica partial mRNA for putative aquaporin (aq1 gene)
          Length = 428

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 151/188 (80%), Gaps = 2/188 (1%)
 Strand = Plus / Minus

                                                                       
Query: 287 cgacccagtacacccactggtacccccactcccagctgacgagggcggggccgaaggaga 346
           |||||||||| ||||||||||   |||| | |||||| || | ||| || || ||||  |
Sbjct: 428 cgacccagtaaacccactggttaacccagttccagctcaccaaggcaggtccaaaggcca 369

                                                                       
Query: 347 cggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacga 406
           |||| ||||||||||| || |||| |||| | || ||| ||| |||||||||  | || |
Sbjct: 368 cggcagggttcatggatgcaccggtgaagactcctccgtcgaagatgttggcagcaacaa 309

                                                                       
Query: 407 tgaagccgatggcgatgggcgcgatggtgccca-ggctgcccttcttggggtcgacggcg 465
           | | ||||||||||| ||| ||||| ||||| | |||| || ||||||||||||| ||||
Sbjct: 308 taaggccgatggcgaggggagcgatagtgccgatggct-cctttcttggggtcgatggcg 250

                   
Query: 466 gtggcgta 473
           ||||||||
Sbjct: 249 gtggcgta 242



to top

>gb|AY079114.1| Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds
          Length = 762

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405
           ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 608 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 549

                                                                       
Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 548 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 489

                   
Query: 466 gtggcgta 473
           ||||||||
Sbjct: 488 gtggcgta 481



to top

>gb|AF419613.1|AF419613 Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds
          Length = 1061

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405
           ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 670 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 611

                                                                       
Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 610 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 551

                   
Query: 466 gtggcgta 473
           ||||||||
Sbjct: 550 gtggcgta 543



to top

>gb|AF428341.1|AF428341 Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds
          Length = 1066

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405
           ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 675 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 616

                                                                       
Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 615 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 556

                   
Query: 466 gtggcgta 473
           ||||||||
Sbjct: 555 gtggcgta 548



to top

>gb|AF004393.1|AF004393 Arabidopsis thaliana salt-stress induced tonoplast intrinsic
           protein mRNA, complete cds
          Length = 1072

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405
           ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 682 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 623

                                                                       
Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 622 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 563

                   
Query: 466 gtggcgta 473
           ||||||||
Sbjct: 562 gtggcgta 555



to top

>emb|BX822807.1|CNS0A75T Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB65ZD08 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1010

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405
           ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 658 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 599

                                                                       
Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 598 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 539

                   
Query: 466 gtggcgta 473
           ||||||||
Sbjct: 538 gtggcgta 531



to top

>emb|BX822624.1|CNS0A742 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB53ZH08 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1020

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405
           ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 656 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 597

                                                                       
Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 596 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 537

                   
Query: 466 gtggcgta 473
           ||||||||
Sbjct: 536 gtggcgta 529



to top

>emb|BX824073.1|CNS0A6T2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH1ZE06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1008

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405
           ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 656 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 597

                                                                       
Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 596 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 537

                   
Query: 466 gtggcgta 473
           ||||||||
Sbjct: 536 gtggcgta 529



to top

>emb|BX822975.1|CNS0A733 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB78ZD01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1054

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405
           ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 647 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 588

                                                                       
Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 587 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 528

                   
Query: 466 gtggcgta 473
           ||||||||
Sbjct: 527 gtggcgta 520



to top

>emb|BX824311.1|CNS0A6PE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH38ZH05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 995

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405
           ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 665 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 606

                                                                       
Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 605 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 546

                   
Query: 466 gtggcgta 473
           ||||||||
Sbjct: 545 gtggcgta 538



to top

>emb|BX823637.1|CNS0A6I3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS5ZE05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 960

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405
           ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 479 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 420

                                                                       
Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 419 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 360

                   
Query: 466 gtggcgta 473
           ||||||||
Sbjct: 359 gtggcgta 352



to top

>emb|BX823607.1|CNS0A6MK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS56ZB09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1012

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405
           ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 656 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 597

                                                                       
Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 596 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 537

                   
Query: 466 gtggcgta 473
           ||||||||
Sbjct: 536 gtggcgta 529



to top

>dbj|AB028611.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MFE16
          Length = 82646

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 104/128 (81%)
 Strand = Plus / Plus

                                                                         
Query: 346   acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405
             ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 15518 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 15577

                                                                         
Query: 406   atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465
             ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 15578 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 15637

                     
Query: 466   gtggcgta 473
             ||||||||
Sbjct: 15638 gtggcgta 15645



to top

>gb|AY821911.1| Gossypium hirsutum putative tonoplast intrinsic protein mRNA,
           partial cds
          Length = 529

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 86/104 (82%)
 Strand = Plus / Minus

                                                                       
Query: 193 gcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtag 252
           ||||| || |||||||| ||||||||||||||||||  |  ||||||||  | |||||||
Sbjct: 417 gcttaataatcggtggttgggagctgctcgtgggtgttgctgatgaagatgaactcgtag 358

                                                       
Query: 253 atgacgccggcgaggccgccgccgatgagggggccgacccagta 296
           ||||  || ||||| || || ||||| ||||| |||||||||||
Sbjct: 357 atgagaccagcgagcccaccaccgataaggggtccgacccagta 314



to top

>gb|AF118381.1|AF118381 Brassica napus tonoplast intrinsic protein (gamma-TIP2) mRNA,
           complete cds
          Length = 1020

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405
           ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 617 acggctgggttcatggaggctccgctgaaagctccaccggcgaggatgttagctccaacg 558

                                                                       
Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 557 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 498

                   
Query: 466 gtggcgta 473
           ||||||||
Sbjct: 497 gtggcgta 490



to top

>ref|NM_188626.1| Oryza sativa (japonica cultivar-group), Ozsa8229 predicted mRNA
          Length = 756

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 352 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacga 406
           ||||||||||||||||||| ||  ||||||||| ||| | |||||||||||||||
Sbjct: 590 gggttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 536



to top

>ref|NM_197137.1| Oryza sativa (japonica cultivar-group) putative beta-tonoplast
           intrinsic protein (OSJNBa0051D19.19), mRNA
          Length = 1186

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 318
           |||||||||||| |||||| || |||||||| |||||||||||| |||| || |||   |
Sbjct: 855 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 796

                                  
Query: 319 cagctgacgagggcggggccgaa 341
           |||| |||||| || ||||||||
Sbjct: 795 cagccgacgagcgccgggccgaa 773



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 386 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434
           |||| ||||||||||||| || |||||||| |||||  |||||||||||
Sbjct: 728 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 680



to top

>ref|NM_189871.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 576

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 318
           |||||||||||| | ||||||| |||||||| |||||||||||| |||| || ||| | |
Sbjct: 512 ccggcgaggccggcaccgatgaaggggccgagccagtacacccagtggtgcctccagtgc 453

                      
Query: 319 cagctgacgag 329
           |||| ||||||
Sbjct: 452 cagccgacgag 442



to top

>gb|AC023240.9| Oryza sativa chromosome 10 BAC OSJNBa0051D19 genomic sequence, complete
             sequence
          Length = 131984

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                         
Query: 259   ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 318
             |||||||||||| |||||| || |||||||| |||||||||||| |||| || |||   |
Sbjct: 26108 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 26167

                                    
Query: 319   cagctgacgagggcggggccgaa 341
             |||| |||||| || ||||||||
Sbjct: 26168 cagccgacgagcgccgggccgaa 26190



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                              
Query: 386   cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434
             |||| ||||||||||||| || |||||||| |||||  |||||||||||
Sbjct: 26235 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 26283



to top

>emb|X95650.1|TGTIP1GEN T.gesneriana mRNA for tonoplast intrinsic protein
          Length = 992

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 73/87 (83%)
 Strand = Plus / Minus

                                                                       
Query: 348 ggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgat 407
           |||||||||||| ||||| |||| ||| || || || || || |||||||| ||||||||
Sbjct: 623 ggcggggttcatcgacgcaccggtgaacgccccaccaaccagaatgttggcaccgacgat 564

                                      
Query: 408 gaagccgatggcgatgggcgcgatggt 434
           ||| ||||| || ||||| ||||||||
Sbjct: 563 gaatccgatcgcaatgggagcgatggt 537



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 271 ccgccgatgagggggccgacccagtacaccca 302
           ||||||||||| ||||| ||||||||||||||
Sbjct: 703 ccgccgatgagcgggccaacccagtacaccca 672



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                            
Query: 259      ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 318
                |||||||||||| |||||| || |||||||| |||||||||||| |||| || |||   |
Sbjct: 18187020 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 18186961

                                       
Query: 319      cagctgacgagggcggggccgaa 341
                |||| |||||| || ||||||||
Sbjct: 18186960 cagccgacgagcgccgggccgaa 18186938



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                                 
Query: 386      cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434
                |||| ||||||||||||| || |||||||| |||||  |||||||||||
Sbjct: 18186893 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 18186845



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                            
Query: 259      ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 318
                |||||||||||| | ||||||| |||||||| |||||||||||| |||| || ||| | |
Sbjct: 25641777 ccggcgaggccggcaccgatgaaggggccgagccagtacacccagtggtgcctccagtgc 25641836

                           
Query: 319      cagctgacgag 329
                |||| ||||||
Sbjct: 25641837 cagccgacgag 25641847



to top

>dbj|AP004380.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0594D10
          Length = 143200

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                         
Query: 259   ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 318
             |||||||||||| | ||||||| |||||||| |||||||||||| |||| || ||| | |
Sbjct: 95750 ccggcgaggccggcaccgatgaaggggccgagccagtacacccagtggtgcctccagtgc 95809

                        
Query: 319   cagctgacgag 329
             |||| ||||||
Sbjct: 95810 cagccgacgag 95820



to top

>dbj|AK111931.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-C03, full
           insert sequence
          Length = 1200

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 318
           |||||||||||| |||||| || |||||||| |||||||||||| |||| || |||   |
Sbjct: 864 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 805

                                  
Query: 319 cagctgacgagggcggggccgaa 341
           |||| |||||| || ||||||||
Sbjct: 804 cagccgacgagcgccgggccgaa 782



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 386 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434
           |||| ||||||||||||| || |||||||| |||||  |||||||||||
Sbjct: 737 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 689



to top

>dbj|AB114828.1| Oryza sativa (japonica cultivar-group) OsTIP3 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 1178

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 318
           |||||||||||| |||||| || |||||||| |||||||||||| |||| || |||   |
Sbjct: 847 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 788

                                  
Query: 319 cagctgacgagggcggggccgaa 341
           |||| |||||| || ||||||||
Sbjct: 787 cagccgacgagcgccgggccgaa 765



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 386 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434
           |||| ||||||||||||| || |||||||| |||||  |||||||||||
Sbjct: 720 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 672



to top

>dbj|AK106383.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-102-E03, full
           insert sequence
          Length = 1787

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 318
           |||||||||||| |||||| || |||||||| |||||||||||| |||| || |||   |
Sbjct: 139 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 198

                                  
Query: 319 cagctgacgagggcggggccgaa 341
           |||| |||||| || ||||||||
Sbjct: 199 cagccgacgagcgccgggccgaa 221



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 386 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434
           |||| ||||||||||||| || |||||||| |||||  |||||||||||
Sbjct: 266 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 314



to top

>dbj|AK099190.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023108H12, full
           insert sequence
          Length = 1055

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 352 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacga 406
           ||||||||||||||||||| ||  ||||||||| ||| | |||||||||||||||
Sbjct: 636 gggttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 582



to top

>dbj|AK069592.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023019I12, full
           insert sequence
          Length = 1059

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 352 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacga 406
           ||||||||||||||||||| ||  ||||||||| ||| | |||||||||||||||
Sbjct: 639 gggttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 585



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                            
Query: 259      ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 318
                |||||||||||| |||||| || |||||||| |||||||||||| |||| || |||   |
Sbjct: 18196273 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 18196214

                                       
Query: 319      cagctgacgagggcggggccgaa 341
                |||| |||||| || ||||||||
Sbjct: 18196213 cagccgacgagcgccgggccgaa 18196191



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                                 
Query: 386      cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434
                |||| ||||||||||||| || |||||||| |||||  |||||||||||
Sbjct: 18196146 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 18196098



to top

>dbj|AB012271.1| Aster tripolium mRNA for SAMIPE, partial cds
          Length = 321

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccca 439
           |||||||||||||||||| |||||||||||||| || || || |||||||
Sbjct: 321 gatgttggcgccgacgataaagccgatggcgatcggtgcaattgtgccca 272



to top

>ref|NM_124117.2| Arabidopsis thaliana AtTIP2;3; water channel AT5G47450 (AtTIP2;3)
           mRNA, complete cds
          Length = 1051

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 386 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434
           ||||||||||||| || || ||||||||||||||||| || ||||||||
Sbjct: 597 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggt 549



to top

>ref|NM_188505.1| Oryza sativa (japonica cultivar-group), Ozsa8174 predicted mRNA
          Length = 969

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 259 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 307
           |||||||||||| ||||||||| ||| |||| |||||||||||| ||||
Sbjct: 881 ccggcgaggccggcgccgatgaagggaccgagccagtacacccagtggt 833



to top

>ref|XM_473251.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 125/157 (79%)
 Strand = Plus / Minus

                                                                       
Query: 272 cgccgatgagggggccgacccagtacacccactggtacccccactcccagctgacgaggg 331
           |||||||||| || |||| |||||| ||||| ||||  | ||| | ||||| |||||| |
Sbjct: 697 cgccgatgagcggcccgagccagtaaacccagtggtggcgccagttccagccgacgagcg 638

                                                                       
Query: 332 cggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgagga 391
           | |||||||| | |   || |||||||||| |||||||  ||| | ||| ||| ||||||
Sbjct: 637 ccgggccgaacgcgcgcgccgggttcatggccgcgccgtcgaacgggcccccggcgagga 578

                                                
Query: 392 tgttggcgccgacgatgaagccgatggcgatgggcgc 428
           |||| |||||  |||  ||||||||||||| ||||||
Sbjct: 577 tgttcgcgcccgcgaccaagccgatggcgaggggcgc 541



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 455 ggtcgacggcggtggcgtac 474
           ||||||||||||||||||||
Sbjct: 517 ggtcgacggcggtggcgtac 498



to top

>gb|BT011663.1| Arabidopsis thaliana At5g47450 mRNA, complete cds
          Length = 753

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 386 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434
           ||||||||||||| || || ||||||||||||||||| || ||||||||
Sbjct: 559 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggt 511



to top

>gb|BT011212.1| Arabidopsis thaliana At5g47450 gene, complete cds
          Length = 853

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 386 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434
           ||||||||||||| || || ||||||||||||||||| || ||||||||
Sbjct: 587 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggt 539



to top

>gb|AF521135.1| Kandelia candel tonoplast intrinsic protein (TIP) mRNA, complete
           cds
          Length = 1099

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                
Query: 193 gcttagtagtcggtggtggggagctgctcgtgggtgc 229
           ||||||||||| | |||||||||||||||||||||||
Sbjct: 859 gcttagtagtcagcggtggggagctgctcgtgggtgc 823



to top

>emb|AL663019.2|OSJN00221 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0038O10,
              complete sequence
          Length = 141545

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 125/157 (79%)
 Strand = Plus / Minus

                                                                          
Query: 272    cgccgatgagggggccgacccagtacacccactggtacccccactcccagctgacgaggg 331
              |||||||||| || |||| |||||| ||||| ||||  | ||| | ||||| |||||| |
Sbjct: 131407 cgccgatgagcggcccgagccagtaaacccagtggtggcgccagttccagccgacgagcg 131348

                                                                          
Query: 332    cggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgagga 391
              | |||||||| | |   || |||||||||| |||||||  ||| | ||| ||| ||||||
Sbjct: 131347 ccgggccgaacgcgcgcgccgggttcatggccgcgccgtcgaacgggcccccggcgagga 131288

                                                   
Query: 392    tgttggcgccgacgatgaagccgatggcgatgggcgc 428
              |||| |||||  |||  ||||||||||||| ||||||
Sbjct: 131287 tgttcgcgcccgcgaccaagccgatggcgaggggcgc 131251



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 455    ggtcgacggcggtggcgtac 474
              ||||||||||||||||||||
Sbjct: 131227 ggtcgacggcggtggcgtac 131208



to top

>dbj|AP002094.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0483F08
          Length = 148985

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                               
Query: 259    ccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 307
              |||||||||||| ||||||||| ||| |||| |||||||||||| ||||
Sbjct: 125093 ccggcgaggccggcgccgatgaagggaccgagccagtacacccagtggt 125141



to top

>dbj|AB025628.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNJ7
          Length = 80117

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                             
Query: 386  cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434
            ||||||||||||| || || ||||||||||||||||| || ||||||||
Sbjct: 8647 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggt 8695



to top

>dbj|AK108116.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-139-C05, full
           insert sequence
          Length = 912

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 125/157 (79%)
 Strand = Plus / Minus

                                                                       
Query: 272 cgccgatgagggggccgacccagtacacccactggtacccccactcccagctgacgaggg 331
           |||||||||| || |||| |||||| ||||| ||||  | ||| | ||||| |||||| |
Sbjct: 763 cgccgatgagcggcccgagccagtaaacccagtggtggcgccagttccagccgacgagcg 704

                                                                       
Query: 332 cggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgagga 391
           | |||||||| | |   || |||||||||| |||||||  ||| | ||| ||| ||||||
Sbjct: 703 ccgggccgaacgcgcgcgccgggttcatggccgcgccgtcgaacgggcccccggcgagga 644

                                                
Query: 392 tgttggcgccgacgatgaagccgatggcgatgggcgc 428
           |||| |||||  |||  ||||||||||||| ||||||
Sbjct: 643 tgttcgcgcccgcgaccaagccgatggcgaggggcgc 607



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 455 ggtcgacggcggtggcgtac 474
           ||||||||||||||||||||
Sbjct: 583 ggtcgacggcggtggcgtac 564



to top

>dbj|AB048248.1| Pyrus communis Py-gTIP mRNA for gamma tonoplast intrinsic protein,
           complete cds
          Length = 1122

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 391 atgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttc 450
           ||||||||||| |||||||| || || |||||||||||||| || |||| ||| || |||
Sbjct: 631 atgttggcgccaacgatgaaaccaatcgcgatgggcgcgattgtccccacgctcccattc 572

                   
Query: 451 ttggggtc 458
           || |||||
Sbjct: 571 ttcgggtc 564



to top

>gb|BT016509.1| Zea mays clone Contig342 mRNA sequence
          Length = 1237

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 54/63 (85%)
 Strand = Plus / Minus

                                                                       
Query: 245 gctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacccact 304
           ||||||||| |||||||| ||||||| ||||||  | ||| || |||||||||||||| |
Sbjct: 880 gctcgtagacgacgccggagaggccggcgccgaccatgggccccacccagtacacccatt 821

              
Query: 305 ggt 307
           |||
Sbjct: 820 ggt 818



to top

>gb|DQ226889.1| Boechera divaricarpa isolate SLW-D-E07 mRNA sequence
          Length = 980

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 197 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 256
           ||||||||||||| |||||||| |||||||||  |   |||||||  | |||||||||||
Sbjct: 767 agtagtcggtggttgggagctgttcgtgggtggtgttaatgaagaaaacctcgtagatga 708

                                                              
Query: 257 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 307
             |||||||  || ||||||| ||| || ||| ||||||| ||||| ||||
Sbjct: 707 gtccggcgattccaccgccgacgagaggtccggcccagtagacccagtggt 657



to top

>emb|X72581.1|ATGTIPMR A.thaliana mRNA for tonoplast intrinsic protein gamma (gamma-TIP)
          Length = 933

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 197 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 256
           ||||||||||||| |||||||||||||| |||  |  ||||||||  |  ||||||||||
Sbjct: 787 agtagtcggtggttgggagctgctcgtgtgtggtgttgatgaagaaaacttcgtagatga 728

                                                              
Query: 257 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 307
             || ||||  || ||||||| ||| || ||| ||||||||||||| ||||
Sbjct: 727 gtccagcgattccaccgccgacgagaggtccggcccagtacacccagtggt 677



to top

>emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquaporin (delta-TIP gene)
          Length = 1017

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 321 gctgacgagggcggggccgaaggagacggcggggttcat 359
           |||||||| ||||||||||||||||  ||||||||||||
Sbjct: 624 gctgacgacggcggggccgaaggagcgggcggggttcat 586



to top

>gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putative aquaporin TIP1 (TIP1)
           mRNA, complete cds
          Length = 1057

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 321 gctgacgagggcggggccgaaggagacggcggggttcat 359
           |||||||| ||||||||||||||||  ||||||||||||
Sbjct: 666 gctgacgacggcggggccgaaggagcgggcggggttcat 628



to top

>emb|BX823744.1|CNS0A6NJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS71ZE09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 573

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 95/118 (80%)
 Strand = Plus / Minus

                                                                       
Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405
           ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 183 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 124

                                                                     
Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacgg 463
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||
Sbjct: 123 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacgg 66



to top

>dbj|AB012268.1| Aster tripolium mRNA for SAMIPB, partial cds
          Length = 321

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 390 gatgttggcgccgacgatgaagccgatggc 419
           |||||||||||||||||| |||||||||||
Sbjct: 321 gatgttggcgccgacgataaagccgatggc 292



to top

>gb|AF367456.1| Prunus persica clone gTip1 gamma-tonoplast intrinsic protein mRNA,
           partial cds
          Length = 408

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 318 ccagctgacgagggcggggccgaaggagacggcggggttcatgga 362
           |||||||||||  ||||| ||||||||||| || |||||||||||
Sbjct: 393 ccagctgacgacagcgggtccgaaggagactgccgggttcatgga 349



to top

>emb|BX842138.1|CNS09YDN Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS54ZD02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1062

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                       
Query: 389 ggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccct 448
           ||||||| || || |||||||| || |||||||| || ||||| || || || || || |
Sbjct: 613 ggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactaccgt 554

                                    
Query: 449 tcttggggtcgacggcggtggcgta 473
           |||||||||| ||||| ||||||||
Sbjct: 553 tcttggggtcaacggctgtggcgta 529



to top

>dbj|AB012269.1| Aster tripolium mRNA for SAMIPC, partial cds
          Length = 321

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 397 gcgccgacgatgaagccgatggcga 421
           |||||||||||||||||||||||||
Sbjct: 314 gcgccgacgatgaagccgatggcga 290



to top

>dbj|AB012267.1| Aster tripolium mRNA for SAMIPA, partial cds
          Length = 321

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 394 ttggcgccgacgatgaagccgatggcgat 422
           |||||||||||||| ||||||||||||||
Sbjct: 317 ttggcgccgacgataaagccgatggcgat 289



to top

>gb|U92651.2|BOU92651 Brassica oleracea var. botrytis tonoplast intrinsic protein
           bobTIP26-1 mRNA, complete cds
          Length = 942

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 197 agtagtcggtggtggggagctgctcgtgggtg 228
           ||||||||| |||||||||||| |||||||||
Sbjct: 790 agtagtcggcggtggggagctgttcgtgggtg 759



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 69/84 (82%)
 Strand = Plus / Minus

                                                                       
Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 449
           ||||||||| || || ||||| ||||| |||||||| || || || || || || || ||
Sbjct: 597 gatgttggcaccaacaatgaaaccgatagcgatgggagctattgttccaagacttccgtt 538

                                   
Query: 450 cttggggtcgacggcggtggcgta 473
           |||||| || ||||||||||||||
Sbjct: 537 cttgggatcaacggcggtggcgta 514



to top

>gb|AF326509.1|AF326509 Zea mays tonoplast membrane integral protein ZmTIP5-1 mRNA,
           complete cds
          Length = 1021

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 321 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgcc 368
           |||||||| ||| |||||||| |||  ||| |||||||||||||||||
Sbjct: 709 gctgacgacggccgggccgaacgagcgggccgggttcatggacgcgcc 662



to top

>emb|BX822304.1|CNS0A7A0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB27ZF06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 628

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 72/88 (81%)
 Strand = Plus / Minus

                                                                       
Query: 386 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgc 445
           |||||||||| || || |||||||| || |||||||| || ||||| || || || || |
Sbjct: 182 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 123

                                       
Query: 446 ccttcttggggtcgacggcggtggcgta 473
           | ||||||||||| ||||  ||||||||
Sbjct: 122 cgttcttggggtctacggttgtggcgta 95



to top

>emb|BX825064.1|CNS0A6TA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH92ZF07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 931

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 102/128 (79%)
 Strand = Plus / Minus

                                                                       
Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405
           ||||| ||||||||||| |||||   ||| || || ||| |||||||||| || || |||
Sbjct: 644 acggctgggttcatggaagcgcccctgaacgctccaccggcgaggatgttcgctccaacg 585

                                                                       
Query: 406 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 465
           ||||| |  |||||||| || |||||  |||| ||  | || ||||||||||| ||||| 
Sbjct: 584 atgaaacttatggcgattggtgcgattttgccgagaataccgttcttggggtcaacggct 525

                   
Query: 466 gtggcgta 473
           ||||||||
Sbjct: 524 gtggcgta 517



to top

>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                   
Query: 395     tggcgccgacgatgaagccgatggcgatgggcgcga 430
               |||||||||||||||||||| || ||||||| ||||
Sbjct: 3239016 tggcgccgacgatgaagccggtgacgatgggggcga 3238981



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 397     gcgccgacgatgaagccgatg 417
               |||||||||||||||||||||
Sbjct: 3655270 gcgccgacgatgaagccgatg 3655250



to top

>emb|X53040.1|RNNIP26 R.norvegicus MIP-26 mRNA
          Length = 336

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 265 aggccgccgccgatgagggggccgacccagtacacccactggt 307
           ||||| ||||||||||  ||||| |||||||||||||| ||||
Sbjct: 301 aggcccccgccgatgattgggcccacccagtacacccagtggt 259



to top

>gb|AF521142.1| Kandelia candel tonoplast intrinsic protein mRNA, partial cds
          Length = 175

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 393 gttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccca 439
           |||||| || || ||||| ||||||||||| |||||||| |||||||
Sbjct: 62  gttggcacccacaatgaaaccgatggcgattggcgcgattgtgccca 16



to top

>emb|X53052.1|RRMIP Rat partial mRNA for main intrinsic protein
          Length = 936

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 265 aggccgccgccgatgagggggccgacccagtacacccactggt 307
           ||||| ||||||||||  ||||| |||||||||||||| ||||
Sbjct: 635 aggcccccgccgatgattgggcccacccagtacacccagtggt 593



to top

>emb|X12514.1|RNMIP26R Rat mRNA fragment for main intrinsic protein 26 (MIP26)
          Length = 543

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 265 aggccgccgccgatgagggggccgacccagtacacccactggt 307
           ||||| ||||||||||  ||||| |||||||||||||| ||||
Sbjct: 242 aggcccccgccgatgattgggcccacccagtacacccagtggt 200



to top

>gb|AY130971.1| Brassica oleracea var. botrytis tonoplast intrinsic protein
            bobTIP26-2 gene, complete cds
          Length = 1442

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 89/111 (80%)
 Strand = Plus / Minus

                                                                        
Query: 197  agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 256
            |||||||||||||||||||||| || || |||  |  ||||||||  | |||||||||||
Sbjct: 1247 agtagtcggtggtggggagctgttcatgtgtggtgttgatgaagaaaacctcgtagatga 1188

                                                               
Query: 257  cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 307
              |||||||  || |||||||| || || ||  ||||||| ||||| ||||
Sbjct: 1187 gtccggcgactccaccgccgataagaggtccagcccagtagacccagtggt 1137



to top

>emb|AJ251652.1|MTR251652 Medicago truncatula mRNA for aquaporin (aqp1 gene)
          Length = 1120

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 196 tagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagag 242
           |||||||| || || ||||||||||||||||||| |  |||||||||
Sbjct: 837 tagtagtcagtagttgggagctgctcgtgggtgctgttgatgaagag 791



to top

>gb|U92652.2|BOU92652 Brassica oleracea var. botrytis tonoplast intrinsic protein
           bobTIP26-2 mRNA, partial cds
          Length = 599

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 89/111 (80%)
 Strand = Plus / Minus

                                                                       
Query: 197 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 256
           |||||||||||||||||||||| || || |||  |  ||||||||  | |||||||||||
Sbjct: 526 agtagtcggtggtggggagctgttcatgtgtggtgttgatgaagaaaacctcgtagatga 467

                                                              
Query: 257 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 307
             |||||||  || |||||||| || || ||  ||||||| ||||| ||||
Sbjct: 466 gtccggcgactccaccgccgataagaggtccagcccagtagacccagtggt 416



to top

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 258     gccggcgaggccgccgccgatga 280
               |||||||||||||||||||||||
Sbjct: 3111631 gccggcgaggccgccgccgatga 3111609



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 257    cgccggcgaggccgccgccgatga 280
              ||||||||||||| ||||||||||
Sbjct: 505314 cgccggcgaggccaccgccgatga 505291



to top

>gb|AC020922.9| Homo sapiens chromosome 19 clone CTD-2105E13, complete sequence
          Length = 134793

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 165   cgggcgggcggggggcaggcggc 187
             |||||||||||||||||||||||
Sbjct: 78789 cgggcgggcggggggcaggcggc 78811



to top

>ref|XM_343137.2| PREDICTED: Rattus norvegicus major intrinsic protein of eye lens
           fiber (Mip), mRNA
          Length = 2075

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 265 aggccgccgccgatgagggggccgacccagtacacccactggt 307
           ||||| ||||||||||  ||||| |||||||||||||| ||||
Sbjct: 685 aggcccccgccgatgattgggcccacccagtacacccagtggt 643



to top

>gb|AY207429.1| Homo sapiens interleukin 11 (IL11) gene, complete cds
          Length = 9803

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 165  cgggcgggcggggggcaggcggc 187
            |||||||||||||||||||||||
Sbjct: 1449 cgggcgggcggggggcaggcggc 1427



to top

>emb|AJ605573.1| Ricinus communis mRNA for aquaporin (Tip1-1 gene), clone pT4L
          Length = 1057

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 195 ttagtagtcggtggtggggagctgctcgtgggtgc 229
           ||||||||| ||||| ||||||||||| |||||||
Sbjct: 804 ttagtagtcagtggtagggagctgctcatgggtgc 770



to top

>gb|AY112625.1| Zea mays CL46210_1 mRNA sequence
          Length = 479

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 245 gctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacccact 304
           ||||| ||| |||||||| ||||||| ||||||  | ||| || |||||||||||||| |
Sbjct: 279 gctcgaagacgacgccggagaggccggcgccgaccatgggccccacccagtacacccatt 338

              
Query: 305 ggt 307
           |||
Sbjct: 339 ggt 341



to top

>gb|AF000143.1|HSAF000143 Human putative alternative lens membrane intrinsic protein (PALM)
           mRNA, partial cds
          Length = 789

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 265 aggccgccgccgatgagggggccgacccagtacacccactggt 307
           ||||| ||||||||||  ||||| |||||||||||||| ||||
Sbjct: 641 aggcccccgccgatgattgggcccacccagtacacccagtggt 599



to top

>gb|M81890.1|HUMIL11A Human interleukin 11 (IL11) gene, complete mRNA
          Length = 6870

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 165 cgggcgggcggggggcaggcggc 187
           |||||||||||||||||||||||
Sbjct: 688 cgggcgggcggggggcaggcggc 666



to top

>dbj|AB010416.1| Raphanus sativus VIP3 mRNA for delta-VM23, complete cds
          Length = 911

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 388 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434
           ||||||||||| ||||||||||  || ||||||| ||| ||||||||
Sbjct: 598 aggatgttggcaccgacgatgagaccaatggcgaggggagcgatggt 552



to top

>gb|L12257.1|SOYNODA Glycine max nodulin-26 mRNA, complete cds
          Length = 1047

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                       
Query: 391 atgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttc 450
           ||||| ||||| || ||||| || ||||||||||| || ||  | ||||   ||||||||
Sbjct: 665 atgttagcgccaacaatgaaaccaatggcgatgggagcaataattcccaaattgcccttc 606

                                  
Query: 451 ttggggtcgacggcggtggcgta 473
           |||||||| ||||| ||||||||
Sbjct: 605 ttggggtcaacggcagtggcgta 583



to top

>ref|XM_476227.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 352 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatga 409
           |||||||| |||||||||||||||  ||| ||  ||| | ||||||| ||||||||||
Sbjct: 596 gggttcattgacgcgccggagaagttgccaccagcgatggtgttggcaccgacgatga 539



to top

>gb|AC145396.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0042F15, complete sequence
          Length = 162959

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352   gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatga 409
             |||||||| |||||||||||||||  ||| ||  ||| | ||||||| ||||||||||
Sbjct: 86935 gggttcattgacgcgccggagaagttgccaccagcgatggtgttggcaccgacgatga 86878



to top

>emb|AL591787.1|SME591787 Sinorhizobium meliloti 1021 complete chromosome; segment 6/12
          Length = 329100

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 259    ccggcgaggccgccgccgatga 280
              ||||||||||||||||||||||
Sbjct: 213784 ccggcgaggccgccgccgatga 213805



to top

>ref|XM_851400.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 11 (LOC479191), mRNA
          Length = 4681

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 156 acggacggacgggcgggcggggggcaggcggcgg 189
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91



to top

>ref|XM_536333.2| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 1 (LOC479191), mRNA
          Length = 4681

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 156 acggacggacgggcgggcggggggcaggcggcgg 189
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91



to top

>ref|XM_851314.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 10 (LOC479191), mRNA
          Length = 4663

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 156 acggacggacgggcgggcggggggcaggcggcgg 189
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91



to top

>ref|XM_851274.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 9 (LOC479191), mRNA
          Length = 4438

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 156 acggacggacgggcgggcggggggcaggcggcgg 189
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91



to top

>ref|XM_851189.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 7 (LOC479191), mRNA
          Length = 4777

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 156 acggacggacgggcgggcggggggcaggcggcgg 189
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91



to top

>ref|XM_851152.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 6 (LOC479191), mRNA
          Length = 4696

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 156 acggacggacgggcgggcggggggcaggcggcgg 189
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91



to top

>ref|XM_851023.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 3 (LOC479191), mRNA
          Length = 4681

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 156 acggacggacgggcgggcggggggcaggcggcgg 189
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91



to top

>emb|X95952.1|HAAP H.annuus mRNA for aquaporin
          Length = 931

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 444 gcccttcttggggtcgacggcggtggcgta 473
           ||||||||||||||| || |||||||||||
Sbjct: 553 gcccttcttggggtcaactgcggtggcgta 524



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 330     ggcggggccgaaggagacggcg 351
               ||||||||||||||||||||||
Sbjct: 8473737 ggcggggccgaaggagacggcg 8473716



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 330     ggcggggccgaaggagacggcg 351
               ||||||||||||||||||||||
Sbjct: 8461221 ggcggggccgaaggagacggcg 8461200



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                         
Query: 352     gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatga 409
               |||||||| |||||||||||||||  ||| ||  ||| | ||||||| ||||||||||
Sbjct: 7902160 gggttcattgacgcgccggagaagttgccaccagcgatggtgttggcaccgacgatga 7902103



to top

>dbj|AK072531.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023131O04, full
           insert sequence
          Length = 1252

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 352 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatga 409
           |||||||| |||||||||||||||  ||| ||  ||| | ||||||| ||||||||||
Sbjct: 787 gggttcattgacgcgccggagaagttgccaccagcgatggtgttggcaccgacgatga 730



to top

>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence
          Length = 2094509

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 402     gacgatgaagccgatggcgatgggcg 427
               ||||||| ||||||||||||||||||
Sbjct: 1047164 gacgatgtagccgatggcgatgggcg 1047139



to top

>dbj|AK060193.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-001-E07, full
           insert sequence
          Length = 1100

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 352 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatga 409
           |||||||| |||||||||||||||  ||| ||  ||| | ||||||| ||||||||||
Sbjct: 786 gggttcattgacgcgccggagaagttgccaccagcgatggtgttggcaccgacgatga 729



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 330     ggcggggccgaaggagacggcg 351
               ||||||||||||||||||||||
Sbjct: 8473620 ggcggggccgaaggagacggcg 8473599



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 330     ggcggggccgaaggagacggcg 351
               ||||||||||||||||||||||
Sbjct: 8461104 ggcggggccgaaggagacggcg 8461083



to top

>emb|AL928775.2|CNS08CC5 Oryza sativa chromosome 12, . BAC OSJNBa0030N06 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 146444

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 330   ggcggggccgaaggagacggcg 351
             ||||||||||||||||||||||
Sbjct: 80400 ggcggggccgaaggagacggcg 80379



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 330   ggcggggccgaaggagacggcg 351
             ||||||||||||||||||||||
Sbjct: 67884 ggcggggccgaaggagacggcg 67863



to top

>gb|AE017351.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 11, complete
              sequence
          Length = 1019846

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 302    actggtacccccactcccagc 322
              |||||||||||||||||||||
Sbjct: 290624 actggtacccccactcccagc 290604



to top

>gb|AC154709.2| Mus musculus BAC clone RP24-357I4 from chromosome 12, complete sequence
          Length = 136354

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 156   acggacggacgggcgggcggg 176
             |||||||||||||||||||||
Sbjct: 94084 acggacggacgggcgggcggg 94104



to top

>gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome
          Length = 3814139

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 390     gatgttggcgccgacgatgaagccg 414
               ||||||| |||||||||||||||||
Sbjct: 2949085 gatgttgtcgccgacgatgaagccg 2949061



to top

>ref|XM_593064.2| PREDICTED: Bos taurus similar to tumor protein p73 (LOC515105),
           mRNA
          Length = 2606

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 267 gccgccgccgatgagggggcc 287
           |||||||||||||||||||||
Sbjct: 22  gccgccgccgatgagggggcc 42



to top

>gb|AY581827.1| Cynodon dactylon NOD26-like membrane integral protein-like mRNA,
           partial sequence
          Length = 555

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 345 gacggcggggttcatggacgcgccggaga 373
           ||||||||||||||||  |||||||||||
Sbjct: 425 gacggcggggttcatgtgcgcgccggaga 397



to top

>gb|AF183913.1| Azospirillum brasilense major outer membrane protein OmaA precursor
           (omaA) gene, complete cds
          Length = 1435

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 259 ccggcgaggccgccgccgatg 279
           |||||||||||||||||||||
Sbjct: 698 ccggcgaggccgccgccgatg 678



to top

>ref|XM_856403.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript
           variant 2 (LOC607978), mRNA
          Length = 1082

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 330 ggcggggccgaaggagacggcggggttcatgga 362
           ||||||||||||||||  ||| |||||||||||
Sbjct: 588 ggcggggccgaaggagcgggccgggttcatgga 556



to top

>ref|XM_845359.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript
           variant 1 (LOC607978), mRNA
          Length = 1067

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 330 ggcggggccgaaggagacggcggggttcatgga 362
           ||||||||||||||||  ||| |||||||||||
Sbjct: 573 ggcggggccgaaggagcgggccgggttcatgga 541



to top

>emb|CT025679.5| Mouse DNA sequence from clone RP24-296K22 on chromosome 14, complete
              sequence
          Length = 160805

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 156    acggacggacgggcgggcggg 176
              |||||||||||||||||||||
Sbjct: 155955 acggacggacgggcgggcggg 155935



to top

>ref|XM_567655.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein
            (CNK00920) partial mRNA
          Length = 2340

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 302  actggtacccccactcccagc 322
            |||||||||||||||||||||
Sbjct: 2133 actggtacccccactcccagc 2113



to top

>gb|AC123532.4| Mus musculus chromosome 14 clone RP23-84B6, complete sequence
          Length = 166421

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 156  acggacggacgggcgggcggg 176
            |||||||||||||||||||||
Sbjct: 7846 acggacggacgggcgggcggg 7826



to top

>gb|AC098877.3| Mus musculus BAC clone RP23-2C24 from 14, complete sequence
          Length = 240151

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 156   acggacggacgggcgggcggg 176
             |||||||||||||||||||||
Sbjct: 37973 acggacggacgggcgggcggg 37953



to top

>gb|AC104099.5| Mus musculus BAC clone RP24-372J8 from 3, complete sequence
          Length = 148259

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 156   acggacggacgggcgggcggg 176
             |||||||||||||||||||||
Sbjct: 37509 acggacggacgggcgggcggg 37489



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 153   cacacggacggacgggcgggcggg 176
             ||||||||||||||| ||||||||
Sbjct: 37516 cacacggacggacggacgggcggg 37493



to top

>gb|BC012214.1| Mus musculus Rab geranylgeranyl transferase, a subunit, mRNA (cDNA
           clone MGC:19255 IMAGE:3967218), complete cds
          Length = 2176

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 156 acggacggacgggcgggcggg 176
           |||||||||||||||||||||
Sbjct: 23  acggacggacgggcgggcggg 43



to top

>gb|AY258323.1| Rubella virus strain BRD-II, complete genome
          Length = 9778

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 165  cgggcgggcggggggcaggcggcgg 189
            ||||||||| |||||||||||||||
Sbjct: 2327 cgggcgggctgggggcaggcggcgg 2303



to top

>ref|XM_503667.1| Yarrowia lipolytica CLIB122, YALI0E07557g predicted mRNA
          Length = 2157

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 434  tgcccaggctgcccttcttgg 454
            |||||||||||||||||||||
Sbjct: 1060 tgcccaggctgcccttcttgg 1040



to top

>ref|NM_019519.1| Mus musculus Rab geranylgeranyl transferase, a subunit (Rabggta),
           mRNA
          Length = 2547

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 156 acggacggacgggcgggcggg 176
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>ref|XM_961391.1| PREDICTED: Tribolium castaneum similar to CG31000-PC, isoform C
            (LOC654951), mRNA
          Length = 3244

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 257  cgccggcgaggccgccgccga 277
            |||||||||||||||||||||
Sbjct: 1642 cgccggcgaggccgccgccga 1622



to top

>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome
          Length = 4501104

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 261     ggcgaggccgccgccgatgag 281
               |||||||||||||||||||||
Sbjct: 1201038 ggcgaggccgccgccgatgag 1201058



to top

>emb|BX640442.1| Bordetella bronchiseptica strain RB50, complete genome; segment 6/16
          Length = 349876

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 390    gatgttggcgccgacgatgaagccg 414
              ||||| |||||||||||||||||||
Sbjct: 151437 gatgtcggcgccgacgatgaagccg 151461



to top

>emb|BX640430.1| Bordetella parapertussis strain 12822, complete genome; segment 8/14
          Length = 348014

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 390   gatgttggcgccgacgatgaagccg 414
             ||||| |||||||||||||||||||
Sbjct: 62418 gatgtcggcgccgacgatgaagccg 62442



to top

>emb|AL390091.1|NCB12F1 Neurospora crassa DNA linkage group II BAC clone B12F1
          Length = 68478

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 156   acggacggacgggcgggcggg 176
             |||||||||||||||||||||
Sbjct: 42894 acggacggacgggcgggcggg 42914



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 153   cacacggacggacgggcgggcggg 176
             ||||||||||||||| ||||||||
Sbjct: 42887 cacacggacggacggacgggcggg 42910



to top

>emb|AJ489613.1|CAR489613 Cicer arietinum partial mRNA for tonoplast intrinsic protein (tip
           gene)
          Length = 716

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 196 tagtagtcggtggtggggagctgctcgtgggtg 228
           |||||||| ||||| ||||| ||||||||||||
Sbjct: 428 tagtagtcagtggtagggagttgctcgtgggtg 396



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 334 gggccgaaggagacggcggggttcatggacgcgccggagaaggc 377
           |||||||| || ||||| ||||||||||| || |||| ||||||
Sbjct: 290 gggccgaatgacacggctgggttcatggatgctccggtgaaggc 247



to top

>emb|AJ243309.1|PSA243309 Pisum sativum mRNA for putative tonoplast intrinsic protein (gene
           tip1-1)
          Length = 1104

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 337 ccgaaggagacggcggggttcatggacgcgccggagaaggc 377
           ||||| || ||||||||||||||||| || |||| ||||||
Sbjct: 686 ccgaatgacacggcggggttcatggatgctccggtgaaggc 646



to top

>emb|BX470185.18| Zebrafish DNA sequence from clone CH211-222D3 in linkage group 3,
             complete sequence
          Length = 198900

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 156   acggacggacgggcgggcggg 176
             |||||||||||||||||||||
Sbjct: 27616 acggacggacgggcgggcggg 27596



to top

>gb|AC183494.1| Brassica oleracea Contig C, complete sequence
          Length = 285752

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                               
Query: 386    cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434
              ||||||||||||| || |||||||| || || ||||| || ||||||||
Sbjct: 123743 cgaggatgttggcaccaacgatgaaaccaatagcgattggtgcgatggt 123695



to top

>dbj|AK146917.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched
           library, clone:I920074L06 product:Rab geranylgeranyl
           transferase, a subunit, full insert sequence
          Length = 2422

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 156 acggacggacgggcgggcggg 176
           |||||||||||||||||||||
Sbjct: 41  acggacggacgggcgggcggg 61



to top

>gb|U62778.1|GHU62778 Gossypium hirsutum delta-tonoplast intrinsic protein mRNA, complete
           cds
          Length = 997

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434
           ||||||||| || || |||||||||||||| ||||| || |||||
Sbjct: 592 gatgttggcaccaacaatgaagccgatggcaatgggtgcaatggt 548



to top

>gb|AF342810.1|AF342810 Zea mays NOD26-like membrane integral protein ZmNIP2-3 mRNA,
           complete cds
          Length = 1300

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 345 gacggcggggttcatggacgcgccggaga 373
           ||||||||||||||||  |||||||||||
Sbjct: 442 gacggcggggttcatgtgcgcgccggaga 414



to top

>gb|AF326507.1|AF326507 Zea mays tonoplast membrane integral protein ZmTIP4-3 mRNA,
           complete cds
          Length = 1045

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 63/77 (81%)
 Strand = Plus / Minus

                                                                       
Query: 330 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 389
           |||||| ||||||||   ||| ||||||||||| |||||||| | |||| ||||| ||| 
Sbjct: 714 ggcgggcccgaaggacctggccgggttcatggaggcgccggacagggcggcgccggcgac 655

                            
Query: 390 gatgttggcgccgacga 406
           |  |||||| |||||||
Sbjct: 654 ggagttggccccgacga 638



to top

>gb|AF326485.1|AF326485 Zea mays NOD26-like membrane integral protein ZmNIP2-2 mRNA,
           complete cds
          Length = 1387

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 345 gacggcggggttcatggacgcgccggaga 373
           ||||||||||||||||  |||||||||||
Sbjct: 452 gacggcggggttcatgtgcgcgccggaga 424



to top

>emb|BX822791.1|CNS0A7SC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB64ZD05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 503

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 63/77 (81%)
 Strand = Plus / Minus

                                                                       
Query: 346 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 405
           ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 95  acggctgggttcatggaagcaccgctgaaagctccaccggcgaggatgttagctccaacg 36

                            
Query: 406 atgaagccgatggcgat 422
           ||||| || ||||||||
Sbjct: 35  atgaaacctatggcgat 19



to top

>emb|BX842211.1|CNS09YE1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL65ZH05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 1014

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 57/69 (82%)
 Strand = Plus / Minus

                                                                       
Query: 405 gatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggc 464
           |||||| || |||||||| || ||||| || || || || || ||||||||||| |||||
Sbjct: 589 gatgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggc 530

                    
Query: 465 ggtggcgta 473
            ||||||||
Sbjct: 529 tgtggcgta 521



to top

>gb|AC135495.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1664B11,
             complete sequence
          Length = 126040

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 156   acggacggacgggcgggcggg 176
             |||||||||||||||||||||
Sbjct: 56775 acggacggacgggcgggcggg 56755



to top

>ref|NM_214226.1| Sus scrofa inositol(1,3,4,5)tetrakisphosphate receptor (CENTA1),
           mRNA
          Length = 1544

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 157 cggacggacgggcgggcggggggca 181
           |||||||||||||||||||| ||||
Sbjct: 56  cggacggacgggcgggcgggcggca 80



to top

>gb|AE004658.1| Pseudomonas aeruginosa PAO1, section 219 of 529 of the complete
            genome
          Length = 11864

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 257  cgccggcgaggccgccgccga 277
            |||||||||||||||||||||
Sbjct: 2650 cgccggcgaggccgccgccga 2630



to top

>gb|AF275315.1|AF275315 Lotus japonicus water-selective transport intrinsic membrane
           protein 1 mRNA, complete cds
          Length = 1162

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 318 ccagctgacgagggcggggccgaaggagacggcggggttcatgga 362
           |||||| |||| ||| || ||||| || |||||||||||||||||
Sbjct: 689 ccagctcacgacggctggtccgaatgacacggcggggttcatgga 645



to top

>gb|AF127662.1|AF127662 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase
           alpha subunit (Rabggta) mRNA, complete cds,
           alternatively spliced
          Length = 2466

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 156 acggacggacgggcgggcggg 176
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127661.1|AF127661 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase
           alpha subunit (Rabggta) pseudogene, complete sequence
          Length = 2435

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 156 acggacggacgggcgggcggg 176
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127660.1|AF127660 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha
           subunit (Rabggta) mRNA, complete cds, alternatively
           spliced
          Length = 2492

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 156 acggacggacgggcgggcggg 176
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127659.1|AF127659 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase
           alpha subunit (Rabggta) mRNA, complete cds,
           alternatively spliced
          Length = 2547

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 156 acggacggacgggcgggcggg 176
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127658.1|AF127658 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha
           subunit (Rabggta) mRNA, complete cds, alternatively
           spliced
          Length = 2547

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 156 acggacggacgggcgggcggg 176
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127657.1|AF127657 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase
           alpha subunit (Rabggta) pseudogene, complete sequence
          Length = 2338

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 156 acggacggacgggcgggcggg 176
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127656.1|AF127656 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha
           subunit (Rabggta) mRNA, complete cds, alternatively
           spliced
          Length = 2395

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 156 acggacggacgggcgggcggg 176
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127655.1|AF127655 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase
           alpha subunit (Rabggta) gene, complete cds,
           alternatively spliced
          Length = 2685

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 156 acggacggacgggcgggcggg 176
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127654.1|AF127654 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha
           subunit (Rabggta) gene, complete cds, alternatively
           spliced
          Length = 2685

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 156 acggacggacgggcgggcggg 176
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence
          Length = 3131724

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 257     cgccggcgaggccgccgccga 277
               |||||||||||||||||||||
Sbjct: 2570348 cgccggcgaggccgccgccga 2570368



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 257     cgccggcgaggccgccgccgatga 280
               ||||||| ||||||||||||||||
Sbjct: 2369100 cgccggccaggccgccgccgatga 2369077



to top

>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence
          Length = 3716413

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 257     cgccggcgaggccgccgccga 277
               |||||||||||||||||||||
Sbjct: 1841115 cgccggcgaggccgccgccga 1841095



to top

>gb|AF466200.2| Sorghum bicolor putative protein kinase gene, partial cds; putative Cf-2,
              fertilization-independent endosperm proteins, hypothetical
              protein, putative non-LTR retroelement reverse
              transcriptase, OCL5 protein, tryptophan synthase
              beta-subunit, hypothetical proteins, putative AP
              endonuclease, putative RNA polymerase II complex component
              SRB7, putative beta-1,3-glucanase, hypothetical protein,
              TNP2-like protein, hypothetical protein, putative
              phosphate/phosphoenolpyruvate translocator, putative
              protein, hypothetical proteins, putative
              galactosyltransferase family, hypothetical protein,
              putative cytochrome P450 family, putative lipid transfer
              protein, putative photoreceptor-interacting protein, and
              hypothetical protein genes, complete cds; and hypothetical
              protein gene, partial cds
          Length = 202197

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 363    cgcgccggagaaggcgccgccgacg 387
              ||||||||||||||||||| |||||
Sbjct: 146358 cgcgccggagaaggcgccggcgacg 146382



to top

>emb|AL845372.6| Zebrafish DNA sequence from clone DKEYP-113C1 in linkage group 20,
             complete sequence
          Length = 80017

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 156   acggacggacgggcgggcggg 176
             |||||||||||||||||||||
Sbjct: 44968 acggacggacgggcgggcggg 44988



to top

>gb|AY109651.1| Zea mays CL6730_1 mRNA sequence
          Length = 899

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 345 gacggcggggttcatggacgcgccggaga 373
           ||||||||||||||||  |||||||||||
Sbjct: 430 gacggcggggttcatgtgcgcgccggaga 402



to top

>gb|AF009567.1|AF009567 Gossypium hirsutum delta-TIP homolog (MIP) mRNA, partial cds
          Length = 316

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 390 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 434
           ||||||||| || || |||||||||||||| ||||| || |||||
Sbjct: 289 gatgttggcaccaacaatgaagccgatggcaatgggtgcaatggt 245



to top

>emb|CR381567.9| Zebrafish DNA sequence from clone DKEY-115O4 in linkage group 23,
             complete sequence
          Length = 142417

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 156   acggacggacgggcgggcggg 176
             |||||||||||||||||||||
Sbjct: 45131 acggacggacgggcgggcggg 45151



to top

>gb|AF026470.1|AF026470 Pseudomonas aeruginosa gluconate repressor (gnuR), gluconate kinase
           (gnuK), and gluconate permease (gnuT) genes, complete
           cds
          Length = 3554

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 257 cgccggcgaggccgccgccga 277
           |||||||||||||||||||||
Sbjct: 427 cgccggcgaggccgccgccga 407



to top

>gb|AC159324.2| Mus musculus BAC clone RP23-9D1 from chromosome 12, complete sequence
          Length = 207280

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 156   acggacggacgggcgggcggg 176
             |||||||||||||||||||||
Sbjct: 13760 acggacggacgggcgggcggg 13780



to top

>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence
          Length = 2914771

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 167     ggcgggcggggggcaggcggcggtg 191
               ||||||||||||||| |||||||||
Sbjct: 2074504 ggcgggcggggggcatgcggcggtg 2074480



to top

>emb|CR974568.14| Mouse DNA sequence from clone RP23-39N20 on chromosome 12, complete
              sequence
          Length = 251037

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 156    acggacggacgggcgggcggg 176
              |||||||||||||||||||||
Sbjct: 108741 acggacggacgggcgggcggg 108721



to top

>emb|CR388420.19| Zebrafish DNA sequence from clone DKEY-37H18 in linkage group 13,
             complete sequence
          Length = 121689

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 156   acggacggacgggcgggcggg 176
             |||||||||||||||||||||
Sbjct: 73151 acggacggacgggcgggcggg 73131



to top

>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia
              lipolytica
          Length = 4224103

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 434    tgcccaggctgcccttcttgg 454
              |||||||||||||||||||||
Sbjct: 867021 tgcccaggctgcccttcttgg 867001



to top

>gb|U88368.1|SSU88368 Sus scrofa inositol(1,3,4,5)tetrakisphosphate receptor mRNA,
           complete cds
          Length = 1544

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 157 cggacggacgggcgggcggggggca 181
           |||||||||||||||||||| ||||
Sbjct: 56  cggacggacgggcgggcgggcggca 80



to top

>dbj|AP004479.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT03H13, TM0012b,
             complete sequence
          Length = 41820

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                          
Query: 318   ccagctgacgagggcggggccgaaggagacggcggggttcatgga 362
             |||||| |||| ||| || ||||| || |||||||||||||||||
Sbjct: 10107 ccagctcacgacggctggtccgaatgacacggcggggttcatgga 10151



to top

>gb|L07320.1|HS5E1A Murine cytomegalovirus e1 protein gene, complete cds
          Length = 4536

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 156 acggacggacgggcgggcggg 176
           |||||||||||||||||||||
Sbjct: 745 acggacggacgggcgggcggg 765



to top

>ref|NM_129238.2| Arabidopsis thaliana GAMMA-TIP; water channel AT2G36830 (GAMMA-TIP)
           mRNA, complete cds
          Length = 1058

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 197 agtagtcggtggtggggagctgctcgtg 224
           ||||||| ||||| ||||||||||||||
Sbjct: 818 agtagtctgtggttgggagctgctcgtg 791



to top

>gb|AC164878.2| Mus musculus BAC clone RP23-364G24 from chromosome 13, complete
             sequence
          Length = 181893

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   acggacggacgggcgggcgg 175
             ||||||||||||||||||||
Sbjct: 94623 acggacggacgggcgggcgg 94642



to top

>gb|AC162034.6| Mus musculus chromosome 7, clone RP23-285B12, complete sequence
          Length = 197907

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 165    cgggcgggcggggggcaggc 184
              ||||||||||||||||||||
Sbjct: 122681 cgggcgggcggggggcaggc 122700



to top

>gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome
          Length = 2364842

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 270     gccgccgatgagggggccga 289
               ||||||||||||||||||||
Sbjct: 1305526 gccgccgatgagggggccga 1305507



to top

>gb|DQ215783.1| Taeniopygia guttata clone 0058P0012B09 proteasome alpha 1 subunit
           variant 1-like mRNA, complete sequence
          Length = 1190

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 165 cgggcgggcggggggcaggcggcg 188
           ||||||||||| ||||||||||||
Sbjct: 38  cgggcgggcggcgggcaggcggcg 15



to top

>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence
          Length = 3587082

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 258    gccggcgaggccgccgccga 277
              ||||||||||||||||||||
Sbjct: 412353 gccggcgaggccgccgccga 412372



to top

>ref|XM_472326.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 618

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 255 gacgccggcgaggccgccgccgatgagg 282
           ||||||| ||||||||||||||| ||||
Sbjct: 133 gacgccgacgaggccgccgccgaggagg 160



to top

>gb|AF474373.1| Hordeum vulgare subsp. vulgare BAC 259I16, complete sequence
          Length = 124050

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 156   acggacggacgggcgggcgg 175
             ||||||||||||||||||||
Sbjct: 72221 acggacggacgggcgggcgg 72202



to top

>ref|NM_001025266.1| Homo sapiens hypothetical gene supported by AK091454 (LOC285382),
           mRNA
          Length = 5901

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 255 gacgccggcgaggccgccgc 274
           ||||||||||||||||||||
Sbjct: 217 gacgccggcgaggccgccgc 198



to top

>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
          Length = 3188609

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 260    cggcgaggccgccgccgatg 279
              ||||||||||||||||||||
Sbjct: 622954 cggcgaggccgccgccgatg 622973



to top

>gb|AC145321.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0094P07, complete sequence
          Length = 162311

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 257   cgccggcgaggccgccgccg 276
             ||||||||||||||||||||
Sbjct: 15954 cgccggcgaggccgccgccg 15935



to top

>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
          Length = 3510148

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 258     gccggcgaggccgccgccga 277
               ||||||||||||||||||||
Sbjct: 1776040 gccggcgaggccgccgccga 1776021



to top

>ref|XM_414866.1| PREDICTED: Gallus gallus similar to Aquaporin 8 (LOC416566), mRNA
          Length = 1761

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 273  gccgatgagggggccgacccagtacacccactggta 308
            |||||| || || ||||||||||||||||| |||||
Sbjct: 1371 gccgatcagaggcccgacccagtacacccagtggta 1336



to top

>ref|XM_426181.1| PREDICTED: Gallus gallus similar to Brix domain containing protein 1
            (LOC428624), mRNA
          Length = 1530

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 257  cgccggcgaggccgccgccg 276
            ||||||||||||||||||||
Sbjct: 1364 cgccggcgaggccgccgccg 1345



to top

>gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete genome
          Length = 3696649

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 391     atgttggcgccgacgatgaagccgatgg 418
               |||| |||||||| ||||||||||||||
Sbjct: 3114875 atgtaggcgccgaagatgaagccgatgg 3114848



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 260   cggcgaggccgccgccgatg 279
             ||||||||||||||||||||
Sbjct: 49687 cggcgaggccgccgccgatg 49668



to top

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 258     gccggcgaggccgccgccga 277
               ||||||||||||||||||||
Sbjct: 3021559 gccggcgaggccgccgccga 3021540



to top

>gb|DQ356948.1| Crocodilepox virus, complete genome
          Length = 190054

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 257    cgccggcgaggccgccgccg 276
              ||||||||||||||||||||
Sbjct: 101116 cgccggcgaggccgccgccg 101135



to top

>gb|AY502065.1| Streptomyces mobaraensis transglutaminase gene, complete cds
          Length = 1224

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 258 gccggcgaggccgccgccga 277
           ||||||||||||||||||||
Sbjct: 76  gccggcgaggccgccgccga 95



to top

>gb|AF531437.1| Streptomyces mobaraensis IFO13819 transglutaminase precursor, gene,
           complete cds
          Length = 1809

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 258 gccggcgaggccgccgccga 277
           ||||||||||||||||||||
Sbjct: 653 gccggcgaggccgccgccga 672



to top

>emb|AL591789.1|SME591789 Sinorhizobium meliloti 1021 complete chromosome; segment 8/12
          Length = 294800

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 411    gccgatggcgatgggcgcga 430
              ||||||||||||||||||||
Sbjct: 252331 gccgatggcgatgggcgcga 252350



to top

>emb|CR847515.10| Zebrafish DNA sequence from clone DKEYP-60A7 in linkage group 9, complete
              sequence
          Length = 153947

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 90     attcattcattcaaagcaaa 109
              ||||||||||||||||||||
Sbjct: 143356 attcattcattcaaagcaaa 143337


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,390,280
Number of Sequences: 3902068
Number of extensions: 4390280
Number of successful extensions: 110130
Number of sequences better than 10.0: 331
Number of HSP's better than 10.0 without gapping: 332
Number of HSP's successfully gapped in prelim test: 4
Number of HSP's that attempted gapping in prelim test: 105678
Number of HSP's gapped (non-prelim): 4423
length of query: 475
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 453
effective length of database: 17,147,199,772
effective search space: 7767681496716
effective search space used: 7767681496716
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top