>emb|CR788319.8| Zebrafish DNA sequence from clone DKEY-245H10 in linkage group 12,
             complete sequence
          Length = 188205

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 118   caaggaaaacgagatataaacatg 141
             |||||||||| |||||||||||||
Sbjct: 11543 caaggaaaacaagatataaacatg 11566

>gb|AC145883.2| Pan troglodytes BAC clone RP43-20G17 from 7, complete sequence
          Length = 221255

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 600   gctcggccccatagcagcag 619
             ||||||||||||||||||||
Sbjct: 75919 gctcggccccatagcagcag 75938

>gb|BC013313.2| Homo sapiens gap junction protein, alpha 5, 40kDa (connexin 40), mRNA
            (cDNA clone MGC:11185 IMAGE:3844139), complete cds
          Length = 2181

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 584  tggctgggaactttgagctc 603
            ||||||||||||||||||||
Sbjct: 1625 tggctgggaactttgagctc 1606

>emb|Z96074.4|HS399M14 Human DNA sequence from clone RP3-399M14 on chromosome Xq26.1-26.3,
             complete sequence
          Length = 155661

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 169   catctcatgggcgtttgtcc 188
             ||||||||||||||||||||
Sbjct: 99155 catctcatgggcgtttgtcc 99174

>emb|AL365260.11| Human DNA sequence from clone RP11-433J22 on chromosome 1 Contains the
             GJA5 gene for gap junction protein, alpha 5, 40kDa
             (connexin 40) protein, complete sequence
          Length = 114412

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 584   tggctgggaactttgagctc 603
             ||||||||||||||||||||
Sbjct: 76441 tggctgggaactttgagctc 76460

>emb|BX569689.1| Synechococcus sp. WH8102 complete genome; segment 1/7
          Length = 348764

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 564    cgcaagcaggtggatggcca 583
              ||||||||||||||||||||
Sbjct: 290182 cgcaagcaggtggatggcca 290163

>emb|CR932801.1| Mus musculus chromosome 2, clone RPCI-21-331C08 strain 129/Sv, complete
             sequence
          Length = 107646

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 581   ccatggctgggaactttgag 600
             ||||||||||||||||||||
Sbjct: 72041 ccatggctgggaactttgag 72060

>emb|CR932797.1| Mus musculus chromosome 2, clone RPCI-22-255I01 and RPCI-22-91F12 strain
              129/Sv, complete sequence
          Length = 122877

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 581    ccatggctgggaactttgag 600
              ||||||||||||||||||||
Sbjct: 107347 ccatggctgggaactttgag 107366

>emb|CR592992.1| full-length cDNA clone CS0DI081YE22 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 2502

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 584  tggctgggaactttgagctc 603
            ||||||||||||||||||||
Sbjct: 1924 tggctgggaactttgagctc 1905

>gb|CP000249.1| Frankia sp. CcI3, complete genome
          Length = 5433628

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 95      atcgagttcccacatgtcaa 114
               ||||||||||||||||||||
Sbjct: 4923591 atcgagttcccacatgtcaa 4923610

>ref|NM_181703.1| Homo sapiens gap junction protein, alpha 5, 40kDa (connexin 40)
            (GJA5), transcript variant B, mRNA
          Length = 2566

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 584  tggctgggaactttgagctc 603
            ||||||||||||||||||||
Sbjct: 1625 tggctgggaactttgagctc 1606

>ref|NM_005266.4| Homo sapiens gap junction protein, alpha 5, 40kDa (connexin 40)
            (GJA5), transcript variant A, mRNA
          Length = 2574

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 584  tggctgggaactttgagctc 603
            ||||||||||||||||||||
Sbjct: 1633 tggctgggaactttgagctc 1614

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 556     agcagcagcgcaagcaggtg 575
               ||||||||||||||||||||
Sbjct: 4024222 agcagcagcgcaagcaggtg 4024241

>emb|AL929294.12| Zebrafish DNA sequence from clone CH211-66E19, complete sequence
          Length = 162474

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 56    atttgaggacgtgaaagaaattgt 79
             |||||||| |||||||||||||||
Sbjct: 25356 atttgagggcgtgaaagaaattgt 25379

>emb|AL928572.5| Mouse DNA sequence from clone RP23-333P17 on chromosome 2, complete
             sequence
          Length = 154074

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 581   ccatggctgggaactttgag 600
             ||||||||||||||||||||
Sbjct: 60653 ccatggctgggaactttgag 60672

>dbj|AP005230.2| Homo sapiens genomic DNA, chromosome 18p, clone:RP11-620B7, complete
             sequence
          Length = 176526

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 271   atggaagtatttttacttgt 290
             ||||||||||||||||||||
Sbjct: 13952 atggaagtatttttacttgt 13971


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,077,852
Number of Sequences: 3902068
Number of extensions: 4077852
Number of successful extensions: 68765
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 68684
Number of HSP's gapped (non-prelim): 81
length of query: 625
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 602
effective length of database: 17,143,297,704
effective search space: 10320265217808
effective search space used: 10320265217808
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)