| Clone Name | rbags20l03 |
|---|---|
| Clone Library Name | barley_pub |
>emb|AL603924.18| Mouse DNA sequence from clone RP23-188C13 on chromosome 11 Contains the 3' end of a novel gene, a pygopus 2 (Pygo2) pseudogene, the Sec61g gene for SEC61, gamma subunit (S. cerevisiae), a thymoma viral proto-oncogene 2 (Akt2) pseudogene and a CpG island, complete sequence Length = 219989 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 485 tctcttcctcttagtgatggattgg 509 ||||||||||||||||||| ||||| Sbjct: 152281 tctcttcctcttagtgatgcattgg 152305
>emb|AL627098.30| Mouse DNA sequence from clone RP23-108K17 on chromosome 4, complete sequence Length = 208131 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 114 ttaggtatctcaagaattctt 134 ||||||||||||||||||||| Sbjct: 77089 ttaggtatctcaagaattctt 77069
>gb|AC125179.4| Mus musculus BAC clone RP23-321N8 from chromosome 16, complete sequence Length = 193474 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 473 tgcctccctcaatctcttcc 492 |||||||||||||||||||| Sbjct: 144236 tgcctccctcaatctcttcc 144217
>emb|CR352210.11| Zebrafish DNA sequence from clone DKEY-166N8 in linkage group 23, complete sequence Length = 180924 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 484 atctcttcctcttagtgatg 503 |||||||||||||||||||| Sbjct: 84297 atctcttcctcttagtgatg 84278
>emb|AL138692.26| Human DNA sequence from clone RP11-321B6 on chromosome 13 Contains part of a novel gene (CG003, 13CDNA73), complete sequence Length = 115566 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 137 tcaaagttgcaatgactaaa 156 |||||||||||||||||||| Sbjct: 63665 tcaaagttgcaatgactaaa 63646
>gb|AC164097.2| Mus musculus BAC clone RP23-141F18 from chromosome 16, complete sequence Length = 217725 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 473 tgcctccctcaatctcttcc 492 |||||||||||||||||||| Sbjct: 5256 tgcctccctcaatctcttcc 5237
>emb|AL645726.22| Mouse DNA sequence from clone RP23-45M23 on chromosome 1, complete sequence Length = 231347 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 471 agtgcctccctcaatctctt 490 |||||||||||||||||||| Sbjct: 9109 agtgcctccctcaatctctt 9090
>gb|AC097366.6| Genomic sequence for Mus musculus, clone RP23-81M23, from chromosome 17, complete sequence Length = 183518 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 195 agtttaacaaggtggttttg 214 |||||||||||||||||||| Sbjct: 167306 agtttaacaaggtggttttg 167325
>gb|AC096641.2| Homo sapiens chromosome 1 clone RP11-361K17, complete sequence Length = 185148 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 479 cctcaatctcttcctcttag 498 |||||||||||||||||||| Sbjct: 80577 cctcaatctcttcctcttag 80596
>ref|XM_690131.1| PREDICTED: Danio rerio similar to zinc finger protein, subfamily 1A, 4 (LOC566844), mRNA Length = 1464 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 484 atctcttcctcttagtgatg 503 |||||||||||||||||||| Sbjct: 877 atctcttcctcttagtgatg 858
>gb|AC159000.2| Mus musculus BAC clone RP24-207K16 from chromosome 9, complete sequence Length = 152872 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 492 ctcttagtgatggattggccacca 515 ||||||| |||||||||||||||| Sbjct: 77195 ctcttagagatggattggccacca 77172
>gb|AC009492.4| Homo sapiens BAC clone RP11-423F9 from 2, complete sequence Length = 212549 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 238 ctccgccttcctgtgaagct 257 |||||||||||||||||||| Sbjct: 151536 ctccgccttcctgtgaagct 151517
>emb|CR388075.14| Zebrafish DNA sequence from clone DKEY-223L3 in linkage group 4, complete sequence Length = 116492 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 accaacaacaacacaaggag 70 |||||||||||||||||||| Sbjct: 36321 accaacaacaacacaaggag 36340
>gb|AF166434.1|AF166434 HIV-1 isolate 133 clone c15.5 from France envelope glycoprotein (env) gene, partial cds Length = 225 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 52 ccaacaacaacacaaggagt 71 |||||||||||||||||||| Sbjct: 65 ccaacaacaacacaaggagt 84
>gb|AC002483.1|AC002483 Homo sapiens PAC clone 248O15 from 13q12-q13, complete sequence Length = 102846 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 137 tcaaagttgcaatgactaaa 156 |||||||||||||||||||| Sbjct: 22020 tcaaagttgcaatgactaaa 22001
>emb|CT486004.9| Mouse DNA sequence from clone RP23-424K3 on chromosome 9, complete sequence Length = 212874 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 492 ctcttagtgatggattggccacca 515 ||||||| |||||||||||||||| Sbjct: 44594 ctcttagagatggattggccacca 44571
>dbj|AB037245.1| Asparagus officinalis ASPI-2 mRNA for cytochrome P450, complete cds Length = 1506 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 tccctcaatctcttcctctt 496 |||||||||||||||||||| Sbjct: 474 tccctcaatctcttcctctt 455
>dbj|AB037244.1| Asparagus officinalis ASPI-1 mRNA for cytochrome P450, complete cds Length = 1506 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 tccctcaatctcttcctctt 496 |||||||||||||||||||| Sbjct: 474 tccctcaatctcttcctctt 455 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,986,717 Number of Sequences: 3902068 Number of extensions: 4986717 Number of successful extensions: 87886 Number of sequences better than 10.0: 18 Number of HSP's better than 10.0 without gapping: 18 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 87851 Number of HSP's gapped (non-prelim): 35 length of query: 558 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 535 effective length of database: 17,143,297,704 effective search space: 9171664271640 effective search space used: 9171664271640 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)