ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags20k23
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AF527606.1| Hordeum vulgare iron/ascorbate-dependent oxidored... 410 e-111
2dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 68 3e-08
3dbj|AP005398.3| Oryza sativa (japonica cultivar-group) genomic D... 68 3e-08
4dbj|AK065581.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 3e-08
5ref|NM_185692.1| Oryza sativa (japonica cultivar-group), Ozsa804... 66 1e-07
6ref|XM_476309.1| Oryza sativa (japonica cultivar-group), predic... 66 1e-07
7dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 66 1e-07
8dbj|AP003019.1| Oryza sativa (japonica cultivar-group) genomic D... 66 1e-07
9dbj|AP002069.2| Oryza sativa (japonica cultivar-group) genomic D... 66 1e-07
10emb|AL157711.12| Human DNA sequence from clone RP11-21M8 on chro... 44 0.45
11emb|BX248323.8| Zebrafish DNA sequence from clone CH211-199J6, c... 44 0.45
12gb|AY596171.1| Populus tomentosa gibberellin 20-oxidase gene, co... 42 1.8
13gb|AY479975.1| Populus tomentosa gibberellin 20-oxidase mRNA, co... 42 1.8
14emb|AJ843665.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
15emb|AJ843664.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
16emb|AJ843663.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
17emb|AJ843662.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
18emb|AJ843661.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
19emb|AJ843660.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
20emb|AJ843658.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
21emb|AJ843657.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
22emb|AJ843656.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
23emb|AJ843655.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
24emb|AJ843654.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
25emb|AJ843653.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
26emb|AJ843652.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
27emb|AJ843651.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
28emb|AJ843650.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
29emb|AJ843649.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
30emb|AJ843648.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
31emb|AJ843647.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
32emb|AJ843646.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
33emb|AJ843645.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
34emb|AJ843644.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
35emb|AJ843643.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
36emb|AJ843642.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
37emb|AJ843641.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
38emb|AJ843640.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
39emb|AJ843639.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
40emb|AJ843638.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
41emb|AJ843637.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
42emb|AJ843636.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
43emb|AJ843635.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
44emb|AJ843634.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
45emb|AJ843633.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
46emb|AJ843631.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
47emb|AJ843630.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
48emb|AJ843629.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
49emb|AJ843628.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
50emb|AJ843627.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
51emb|AJ843626.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
52emb|AJ843625.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
53emb|AJ843624.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.8
54emb|CR376855.11| Zebrafish DNA sequence from clone DKEY-56N2 in ... 42 1.8
55emb|BX248386.35| Zebrafish DNA sequence from clone CH211-231M12,... 42 1.8
56emb|AL139085.13| Human DNA sequence from clone RP11-431O22 on ch... 42 1.8
57emb|AJ001326.2|PTXPTGIBB Populus tremula x Populus tremuloides m... 42 1.8
58emb|BX293556.14| Zebrafish DNA sequence from clone DKEY-21N20 in... 42 1.8
59emb|BX005349.6| Zebrafish DNA sequence from clone DKEY-111D8 in ... 42 1.8
60dbj|AB090241.1| Populus alba PaGA20ox1b gene for gibberellin 20-... 42 1.8
61dbj|AB090240.1| Populus alba PaGA20ox1b mRNA for gibberellin 20-... 42 1.8
62dbj|AB090239.1| Populus alba PaGA20ox1a gene for gibberellin 20-... 42 1.8
63dbj|AB090238.1| Populus alba PaGA20ox1a mRNA for gibberellin 20-... 42 1.8
64dbj|AB089676.1| Populus nigra PnGA20ox1 gene for gibberellin 20-... 42 1.8
65dbj|AB089675.1| Populus nigra PnGA20ox1 mRNA for gibberellin 20-... 42 1.8
66emb|BX571961.11| Zebrafish DNA sequence from clone DKEY-205O12 i... 42 1.8
67dbj|AB021290.1| Homo sapiens gene for chondromodulin-1, promoter... 42 1.8
68ref|NM_124779.1| Arabidopsis thaliana oxidoreductase, acting on ... 40 7.0
69ref|NM_185701.1| Oryza sativa (japonica cultivar-group), Ozsa805... 40 7.0
70ref|NM_185691.1| Oryza sativa (japonica cultivar-group), Ozsa804... 40 7.0
71gb|BT016483.1| Zea mays clone Contig316 mRNA sequence 40 7.0
72gb|BT018033.1| Zea mays clone EL01N0530E08.c mRNA sequence 40 7.0
73ref|XM_952897.1| Neurospora crassa OR74A hypothetical protein (N... 40 7.0
74gb|AC125448.16| Mus musculus chromosome 10, clone RP23-122D10, c... 40 7.0
75ref|XM_327647.1| Neurospora crassa OR74A hypothetical protein (N... 40 7.0
76ref|XM_753922.1| Ustilago maydis 521 hypothetical protein (UM028... 40 7.0
77gb|AC132448.3| Mus musculus BAC clone RP23-180B23 from chromosom... 40 7.0
78gb|AC125168.4| Mus musculus BAC clone RP24-449N2 from chromosome... 40 7.0
79emb|CR450787.6| Zebrafish DNA sequence from clone CH211-222O17 i... 40 7.0
80gb|AC099414.4| Mus musculus BAC clone RP23-122C18 from 3, comple... 40 7.0
81emb|CR956383.8| Pig DNA sequence from clone CH242-271L5 on chrom... 40 7.0
82emb|AJ312712.1|BTE312712 Bombus terrestris repetitive sequence m... 40 7.0
83gb|AC159819.2| Mus musculus BAC clone RP23-180C14 from chromosom... 40 7.0
84gb|DQ056720.1| Arabidopsis thaliana oxidoreductase (At5g54000) m... 40 7.0
85gb|AC068408.9| Homo sapiens chromosome 18, clone RP11-612A1, com... 40 7.0
86gb|AC023426.29| Homo sapiens 12 BAC RP11-396L8 (Roswell Park Can... 40 7.0
87gb|AF222718.1| Chrysodidymus synuroideus mitochondrion, complete... 40 7.0
88gb|AC019106.3| Homo sapiens BAC clone RP11-479L11 from 2, comple... 40 7.0
89dbj|AB007644.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 7.0
90emb|CR954297.15| Zebrafish DNA sequence from clone DKEY-69M3 in ... 40 7.0
91gb|AE000657.1| Aquifex aeolicus VF5, complete genome 40 7.0
92gb|AC129222.4| Mus musculus BAC clone RP24-532L14 from 14, compl... 40 7.0
93emb|AL713894.12| Mouse DNA sequence from clone RP23-48J18 on chr... 40 7.0
94gb|L10501.1|CSZMTRNPAC Chrysops vittatus (clone Deer.fly.9.3) ma... 40 7.0 
>gb|AF527606.1| Hordeum vulgare iron/ascorbate-dependent oxidoreductase (Hcp1) mRNA,
            complete cds
          Length = 1360

 Score =  410 bits (207), Expect = e-111
 Identities = 417/486 (85%), Gaps = 1/486 (0%)
 Strand = Plus / Minus

                                                                        
Query: 36   gggtgttgatgaatctcttcccttgacgaaaatgttcgaagancccagccacaaagtcct 95
            |||||| ||||||||||||||||||| | |||||||| ||||  ||  | || || ||||
Sbjct: 1072 gggtgtcgatgaatctcttcccttgaaggaaatgttcaaagagtccgactacgaaatcct 1013

                                                                        
Query: 96   tggccaatattttcctatatcttggcggtcgcttgccatccagcaaaccgggcgccggtt 155
            ||||||  ||||||||||||||||| ||||||||  ||||||||||||||||||| || |
Sbjct: 1012 tggccatcattttcctatatcttggtggtcgcttctcatccagcaaaccgggcgctggct 953

                                                                        
Query: 156  ctagcatcgtttccgcatccacggcgtaaaacatagccagggaaagcctatccttcttga 215
            | |||| ||||||  |||||||||| || ||||  ||||| |||||||| |||||||   
Sbjct: 952  ccagcaccgtttcttcatccacggcatagaacacggccagcgaaagcctctccttctcag 893

                                                                        
Query: 216  agttcgtcaccactctgtgaaatgggctcctaaagattccattgttcattatttctaggc 275
             ||||||||||||||||||||  ||||||||||||||||||||||||||||| || ||||
Sbjct: 892  tgttcgtcaccactctgtgaaccgggctcctaaagattccattgttcattatctccaggc 833

                                                                        
Query: 276  agtctgctaggttaaccagcaatgtgtgcggcttggctggaacattgtaccatctcccat 335
            ||||||||| ||| | || ||  ||||| |||||||||||||||||||||||| ||||||
Sbjct: 832  agtctgctaagttgatcaccagcgtgtgaggcttggctggaacattgtaccatttcccat 773

                                                                        
Query: 336  ctctctgaacttgcaagccaccgacggtgtcatcgttgagaaggatggtaaggagaccac 395
            |||||||||||||||||||||| ||   ||| |||   | |||||||||||||||    |
Sbjct: 772  ctctctgaacttgcaagccaccaacatcgtcgtcgacaaaaaggatggtaaggaggttgc 713

                                                                        
Query: 396  cgtcggtgtgaggcctgaggcccaaaactaagtcaggcctcgggcatggagggtagtagt 455
            | || | ||||||| ||||||||||||||| |||||| ||||| || |||||||||||||
Sbjct: 712  catcagagtgaggcgtgaggcccaaaactaggtcaggtctcggacacggagggtagtagt 653

                                                                        
Query: 456  tgaatctagcaaacccggaagccttgtttgatattctggttgacgaagtagtcctcgtca 515
              ||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||
Sbjct: 652  acaatctagcaaacccggaagccttgtttgata-tctggttgacgaagtaatcctcgtca 594

                  
Query: 516  atctcc 521
            ||||||
Sbjct: 593  atctcc 588
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                            
Query: 395      ccgtcggtgtgaggcctgaggcccaaaactaagtcaggcctcgggcatggagggtagtag 454
                ||||||| ||||||||||| ||| || || | ||||||||| || || ||||||||||||
Sbjct: 10388357 ccgtcggagtgaggcctgatgccgaacacaaggtcaggccttggacagggagggtagtag 10388298

                              
Query: 455      ttgaatctagcaaa 468
                |||||||| |||||
Sbjct: 10388297 ttgaatcttgcaaa 10388284
to top
>dbj|AP005398.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0669G10
          Length = 133372

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                         
Query: 395   ccgtcggtgtgaggcctgaggcccaaaactaagtcaggcctcgggcatggagggtagtag 454
             ||||||| ||||||||||| ||| || || | ||||||||| || || ||||||||||||
Sbjct: 30779 ccgtcggagtgaggcctgatgccgaacacaaggtcaggccttggacagggagggtagtag 30720

                           
Query: 455   ttgaatctagcaaa 468
             |||||||| |||||
Sbjct: 30719 ttgaatcttgcaaa 30706
to top
>dbj|AK065581.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013034J09, full
            insert sequence
          Length = 1729

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                        
Query: 395  ccgtcggtgtgaggcctgaggcccaaaactaagtcaggcctcgggcatggagggtagtag 454
            ||||||| ||||||||||| ||| || || | ||||||||| || || ||||||||||||
Sbjct: 1032 ccgtcggagtgaggcctgatgccgaacacaaggtcaggccttggacagggagggtagtag 973

                          
Query: 455  ttgaatctagcaaa 468
            |||||||| |||||
Sbjct: 972  ttgaatcttgcaaa 959
to top
>ref|NM_185692.1| Oryza sativa (japonica cultivar-group), Ozsa8043 predicted mRNA
          Length = 1164

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 123/153 (80%)
 Strand = Plus / Minus

                                                                       
Query: 315 gaacattgtaccatctcccatctctctgaacttgcaagccaccgacggtgtcatcgttga 374
           |||||||||||||  | ||||| ||||||| ||||| |||||||||    || |||  ||
Sbjct: 763 gaacattgtaccacttgccatccctctgaatttgcaggccaccgacatcttcgtcgacga 704

                                                                       
Query: 375 gaaggatggtaaggagaccaccgtcggtgtgaggcctgaggcccaaaactaagtcaggcc 434
           |||| || |||| |||    ||||||| ||||||||||| ||| || || | ||||||||
Sbjct: 703 gaagaatcgtaaagagggagccgtcggagtgaggcctgacgccgaacacaaggtcaggcc 644

                                            
Query: 435 tcgggcatggagggtagtagttgaatctagcaa 467
           | || || |||||||||||||||||||| ||||
Sbjct: 643 ttggacagggagggtagtagttgaatcttgcaa 611
to top
>ref|XM_476309.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1053

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 123/153 (80%)
 Strand = Plus / Minus

                                                                       
Query: 315 gaacattgtaccatctcccatctctctgaacttgcaagccaccgacggtgtcatcgttga 374
           |||||||||||||  | ||||| ||||||| ||||| |||||||||    || |||  ||
Sbjct: 763 gaacattgtaccacttgccatccctctgaatttgcaggccaccgacatcttcgtcgacga 704

                                                                       
Query: 375 gaaggatggtaaggagaccaccgtcggtgtgaggcctgaggcccaaaactaagtcaggcc 434
           |||| || |||| |||    ||||||| ||||||||||| ||| || || | ||||||||
Sbjct: 703 gaagaatcgtaaagagggagccgtcggagtgaggcctgacgccgaacacaaggtcaggcc 644

                                            
Query: 435 tcgggcatggagggtagtagttgaatctagcaa 467
           | || || |||||||||||||||||||| ||||
Sbjct: 643 ttggacagggagggtagtagttgaatcttgcaa 611
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 123/153 (80%)
 Strand = Plus / Minus

                                                                           
Query: 315     gaacattgtaccatctcccatctctctgaacttgcaagccaccgacggtgtcatcgttga 374
               |||||||||||||  | ||||| ||||||| ||||| |||||||||    || |||  ||
Sbjct: 3905561 gaacattgtaccacttgccatccctctgaatttgcaggccaccgacatcttcgtcgacga 3905502

                                                                           
Query: 375     gaaggatggtaaggagaccaccgtcggtgtgaggcctgaggcccaaaactaagtcaggcc 434
               |||| || |||| |||    ||||||| ||||||||||| ||| || || | ||||||||
Sbjct: 3905501 gaagaatcgtaaagagggagccgtcggagtgaggcctgacgccgaacacaaggtcaggcc 3905442

                                                
Query: 435     tcgggcatggagggtagtagttgaatctagcaa 467
               | || || |||||||||||||||||||| ||||
Sbjct: 3905441 ttggacagggagggtagtagttgaatcttgcaa 3905409



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 123/153 (80%)
 Strand = Plus / Minus

                                                                           
Query: 315     gaacattgtaccatctcccatctctctgaacttgcaagccaccgacggtgtcatcgttga 374
               |||||||||||||  | ||||| ||||||| ||||| |||||||||    || |||  ||
Sbjct: 3893670 gaacattgtaccacttgccatccctctgaatttgcaggccaccgacatcttcgtcgacga 3893611

                                                                           
Query: 375     gaaggatggtaaggagaccaccgtcggtgtgaggcctgaggcccaaaactaagtcaggcc 434
               |||| || |||| |||    ||||||| ||||||||||| ||| || || | ||||||||
Sbjct: 3893610 gaagaatcgtaaagagggagccgtcggagtgaggcctgacgccgaacacaaggtcaggcc 3893551

                                                
Query: 435     tcgggcatggagggtagtagttgaatctagcaa 467
               | || || |||||||||||||||||||| ||||
Sbjct: 3893550 ttggacagggagggtagtagttgaatcttgcaa 3893518



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 123/153 (80%)
 Strand = Plus / Minus

                                                                           
Query: 315     gaacattgtaccatctcccatctctctgaacttgcaagccaccgacggtgtcatcgttga 374
               |||||||||||||  | ||||| ||||||| ||||| |||||||||    || |||  ||
Sbjct: 3855682 gaacattgtaccacttgccatccctctgaatttgcaggccaccgacatcttcgtcgacga 3855623

                                                                           
Query: 375     gaaggatggtaaggagaccaccgtcggtgtgaggcctgaggcccaaaactaagtcaggcc 434
               |||| || |||| |||    ||||||| ||||||||||| ||| || || | ||||||||
Sbjct: 3855622 gaagaatcgtaaagagggagccgtcggagtgaggcctgacgccgaacacaaggtcaggcc 3855563

                                                
Query: 435     tcgggcatggagggtagtagttgaatctagcaa 467
               | || || |||||||||||||||||||| ||||
Sbjct: 3855562 ttggacagggagggtagtagttgaatcttgcaa 3855530



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 444     gagggtagtagttgaatctagcaa 467
               |||||||||||||||||| |||||
Sbjct: 3900941 gagggtagtagttgaatcgagcaa 3900918



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 444     gagggtagtagttgaatctagcaa 467
               |||||||||||||||||| |||||
Sbjct: 3889118 gagggtagtagttgaatcgagcaa 3889095



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 444     gagggtagtagttgaatctagcaa 467
               |||||||||||||||||| |||||
Sbjct: 3851062 gagggtagtagttgaatcgagcaa 3851039
to top
>dbj|AP003019.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0035I03
          Length = 153749

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 123/153 (80%)
 Strand = Plus / Minus

                                                                         
Query: 315   gaacattgtaccatctcccatctctctgaacttgcaagccaccgacggtgtcatcgttga 374
             |||||||||||||  | ||||| ||||||| ||||| |||||||||    || |||  ||
Sbjct: 11437 gaacattgtaccacttgccatccctctgaatttgcaggccaccgacatcttcgtcgacga 11378

                                                                         
Query: 375   gaaggatggtaaggagaccaccgtcggtgtgaggcctgaggcccaaaactaagtcaggcc 434
             |||| || |||| |||    ||||||| ||||||||||| ||| || || | ||||||||
Sbjct: 11377 gaagaatcgtaaagagggagccgtcggagtgaggcctgacgccgaacacaaggtcaggcc 11318

                                              
Query: 435   tcgggcatggagggtagtagttgaatctagcaa 467
             | || || |||||||||||||||||||| ||||
Sbjct: 11317 ttggacagggagggtagtagttgaatcttgcaa 11285



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 444  gagggtagtagttgaatctagcaa 467
            |||||||||||||||||| |||||
Sbjct: 6817 gagggtagtagttgaatcgagcaa 6794
to top
>dbj|AP002069.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0015E04
          Length = 152046

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 123/153 (80%)
 Strand = Plus / Minus

                                                                          
Query: 315    gaacattgtaccatctcccatctctctgaacttgcaagccaccgacggtgtcatcgttga 374
              |||||||||||||  | ||||| ||||||| ||||| |||||||||    || |||  ||
Sbjct: 151692 gaacattgtaccacttgccatccctctgaatttgcaggccaccgacatcttcgtcgacga 151633

                                                                          
Query: 375    gaaggatggtaaggagaccaccgtcggtgtgaggcctgaggcccaaaactaagtcaggcc 434
              |||| || |||| |||    ||||||| ||||||||||| ||| || || | ||||||||
Sbjct: 151632 gaagaatcgtaaagagggagccgtcggagtgaggcctgacgccgaacacaaggtcaggcc 151573

                                               
Query: 435    tcgggcatggagggtagtagttgaatctagcaa 467
              | || || |||||||||||||||||||| ||||
Sbjct: 151572 ttggacagggagggtagtagttgaatcttgcaa 151540



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 123/153 (80%)
 Strand = Plus / Minus

                                                                          
Query: 315    gaacattgtaccatctcccatctctctgaacttgcaagccaccgacggtgtcatcgttga 374
              |||||||||||||  | ||||| ||||||| ||||| |||||||||    || |||  ||
Sbjct: 113636 gaacattgtaccacttgccatccctctgaatttgcaggccaccgacatcttcgtcgacga 113577

                                                                          
Query: 375    gaaggatggtaaggagaccaccgtcggtgtgaggcctgaggcccaaaactaagtcaggcc 434
              |||| || |||| |||    ||||||| ||||||||||| ||| || || | ||||||||
Sbjct: 113576 gaagaatcgtaaagagggagccgtcggagtgaggcctgacgccgaacacaaggtcaggcc 113517

                                               
Query: 435    tcgggcatggagggtagtagttgaatctagcaa 467
              | || || |||||||||||||||||||| ||||
Sbjct: 113516 ttggacagggagggtagtagttgaatcttgcaa 113484



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 444    gagggtagtagttgaatctagcaa 467
              |||||||||||||||||| |||||
Sbjct: 147072 gagggtagtagttgaatcgagcaa 147049



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 444    gagggtagtagttgaatctagcaa 467
              |||||||||||||||||| |||||
Sbjct: 109016 gagggtagtagttgaatcgagcaa 108993
to top
>emb|AL157711.12| Human DNA sequence from clone RP11-21M8 on chromosome 10 Contains part
             of the DOCK1 gene for dedicator of cyto-kinesis 1,
             complete sequence
          Length = 154818

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 328   tctcccatctctctgaacttgc 349
             ||||||||||||||||||||||
Sbjct: 76243 tctcccatctctctgaacttgc 76264
to top
>emb|BX248323.8| Zebrafish DNA sequence from clone CH211-199J6, complete sequence
          Length = 177714

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 170    gcatccacggcgtaaaacatag 191
              ||||||||||||||||||||||
Sbjct: 121066 gcatccacggcgtaaaacatag 121087
to top
>gb|AY596171.1| Populus tomentosa gibberellin 20-oxidase gene, complete cds
          Length = 1362

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 884 ggcatggagggtagtagttga 864
to top
>gb|AY479975.1| Populus tomentosa gibberellin 20-oxidase mRNA, complete cds
          Length = 1158

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 724 ggcatggagggtagtagttga 704
to top
>emb|AJ843665.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 98_2
          Length = 1689

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 987 ggcatggagggtagtagttga 967
to top
>emb|AJ843664.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 98_1
          Length = 1689

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 987 ggcatggagggtagtagttga 967
to top
>emb|AJ843663.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
            isolate 94_2
          Length = 1709

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 438  ggcatggagggtagtagttga 458
            |||||||||||||||||||||
Sbjct: 1007 ggcatggagggtagtagttga 987
to top
>emb|AJ843662.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
            isolate 94_1
          Length = 1709

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 438  ggcatggagggtagtagttga 458
            |||||||||||||||||||||
Sbjct: 1007 ggcatggagggtagtagttga 987
to top
>emb|AJ843661.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
            isolate 92_2
          Length = 1710

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 438  ggcatggagggtagtagttga 458
            |||||||||||||||||||||
Sbjct: 1008 ggcatggagggtagtagttga 988
to top
>emb|AJ843660.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 92_1
          Length = 1689

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 987 ggcatggagggtagtagttga 967
to top
>emb|AJ843658.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 87_1
          Length = 1689

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 987 ggcatggagggtagtagttga 967
to top
>emb|AJ843657.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 70_2
          Length = 1687

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 985 ggcatggagggtagtagttga 965
to top
>emb|AJ843656.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 70_1
          Length = 1687

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 985 ggcatggagggtagtagttga 965
to top
>emb|AJ843655.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
            isolate 67_2
          Length = 1711

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 438  ggcatggagggtagtagttga 458
            |||||||||||||||||||||
Sbjct: 1009 ggcatggagggtagtagttga 989
to top
>emb|AJ843654.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 67_1
          Length = 1691

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 989 ggcatggagggtagtagttga 969
to top
>emb|AJ843653.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 65_2
          Length = 1691

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 989 ggcatggagggtagtagttga 969
to top
>emb|AJ843652.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 65_1
          Length = 1695

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 993 ggcatggagggtagtagttga 973
to top
>emb|AJ843651.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 58_2
          Length = 1691

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 989 ggcatggagggtagtagttga 969
to top
>emb|AJ843650.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 58_1
          Length = 1691

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 989 ggcatggagggtagtagttga 969
to top
>emb|AJ843649.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 24_2
          Length = 1685

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 983 ggcatggagggtagtagttga 963
to top
>emb|AJ843648.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 24_1
          Length = 1691

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 989 ggcatggagggtagtagttga 969
to top
>emb|AJ843647.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 22_2
          Length = 1693

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 991 ggcatggagggtagtagttga 971
to top
>emb|AJ843646.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 22_1
          Length = 1693

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 991 ggcatggagggtagtagttga 971
to top
>emb|AJ843645.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
            isolate 17_2
          Length = 1711

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 438  ggcatggagggtagtagttga 458
            |||||||||||||||||||||
Sbjct: 1009 ggcatggagggtagtagttga 989
to top
>emb|AJ843644.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
            isolate 17_1
          Length = 1712

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 438  ggcatggagggtagtagttga 458
            |||||||||||||||||||||
Sbjct: 1010 ggcatggagggtagtagttga 990
to top
>emb|AJ843643.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 13_2
          Length = 1691

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 989 ggcatggagggtagtagttga 969
to top
>emb|AJ843642.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 13_1
          Length = 1691

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 989 ggcatggagggtagtagttga 969
to top
>emb|AJ843641.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 114_2
          Length = 1691

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 989 ggcatggagggtagtagttga 969
to top
>emb|AJ843640.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 114_1
          Length = 1691

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 989 ggcatggagggtagtagttga 969
to top
>emb|AJ843639.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
            isolate 112_2
          Length = 1712

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 438  ggcatggagggtagtagttga 458
            |||||||||||||||||||||
Sbjct: 1010 ggcatggagggtagtagttga 990
to top
>emb|AJ843638.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
            isolate 112_1
          Length = 1712

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 438  ggcatggagggtagtagttga 458
            |||||||||||||||||||||
Sbjct: 1010 ggcatggagggtagtagttga 990
to top
>emb|AJ843637.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
            isolate 111_2
          Length = 1711

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 438  ggcatggagggtagtagttga 458
            |||||||||||||||||||||
Sbjct: 1009 ggcatggagggtagtagttga 989
to top
>emb|AJ843636.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 111_1
          Length = 1692

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 990 ggcatggagggtagtagttga 970
to top
>emb|AJ843635.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 10_2
          Length = 1687

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 985 ggcatggagggtagtagttga 965
to top
>emb|AJ843634.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 10_1
          Length = 1691

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 989 ggcatggagggtagtagttga 969
to top
>emb|AJ843633.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 109_2
          Length = 1691

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 989 ggcatggagggtagtagttga 969
to top
>emb|AJ843631.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 108_2
          Length = 1691

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 989 ggcatggagggtagtagttga 969
to top
>emb|AJ843630.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 108_1
          Length = 1689

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 987 ggcatggagggtagtagttga 967
to top
>emb|AJ843629.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 107_2
          Length = 1689

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 987 ggcatggagggtagtagttga 967
to top
>emb|AJ843628.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
            isolate 107_1
          Length = 1711

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 438  ggcatggagggtagtagttga 458
            |||||||||||||||||||||
Sbjct: 1009 ggcatggagggtagtagttga 989
to top
>emb|AJ843627.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
            isolate 104_2
          Length = 1709

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 438  ggcatggagggtagtagttga 458
            |||||||||||||||||||||
Sbjct: 1007 ggcatggagggtagtagttga 987
to top
>emb|AJ843626.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
            isolate 104_1
          Length = 1709

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 438  ggcatggagggtagtagttga 458
            |||||||||||||||||||||
Sbjct: 1007 ggcatggagggtagtagttga 987
to top
>emb|AJ843625.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 102_1
          Length = 1689

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 987 ggcatggagggtagtagttga 967
to top
>emb|AJ843624.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 102_2
          Length = 1689

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 987 ggcatggagggtagtagttga 967
to top
>emb|CR376855.11| Zebrafish DNA sequence from clone DKEY-56N2 in linkage group 25, complete
              sequence
          Length = 219164

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 170    gcatccacggcgtaaaacata 190
              |||||||||||||||||||||
Sbjct: 152114 gcatccacggcgtaaaacata 152134
to top
>emb|BX248386.35| Zebrafish DNA sequence from clone CH211-231M12, complete sequence
          Length = 148681

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 170    gcatccacggcgtaaaacata 190
              |||||||||||||||||||||
Sbjct: 123942 gcatccacggcgtaaaacata 123922
to top
>emb|AL139085.13| Human DNA sequence from clone RP11-431O22 on chromosome 13 Contains the
             5' end of the gene for chondromodulin I precursor (CHM-I),
             a novel gene, the PCDH8 gene for protocadherin 8 and 4 CpG
             islands, complete sequence
          Length = 173292

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 319   attgtaccatctcccatctctctga 343
             |||||||||||||||| ||||||||
Sbjct: 29810 attgtaccatctcccacctctctga 29786
to top
>emb|AJ001326.2|PTXPTGIBB Populus tremula x Populus tremuloides mRNA for gibberellin 20-oxidase
          Length = 1857

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 438  ggcatggagggtagtagttga 458
            |||||||||||||||||||||
Sbjct: 1002 ggcatggagggtagtagttga 982
to top
>emb|BX293556.14| Zebrafish DNA sequence from clone DKEY-21N20 in linkage group 11,
              complete sequence
          Length = 212880

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 170    gcatccacggcgtaaaacata 190
              |||||||||||||||||||||
Sbjct: 207644 gcatccacggcgtaaaacata 207624
to top
>emb|BX005349.6| Zebrafish DNA sequence from clone DKEY-111D8 in linkage group 10,
             complete sequence
          Length = 103469

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 170   gcatccacggcgtaaaacata 190
             |||||||||||||||||||||
Sbjct: 10940 gcatccacggcgtaaaacata 10920
to top
>dbj|AB090241.1| Populus alba PaGA20ox1b gene for gibberellin 20-oxidase, complete
           cds
          Length = 1440

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 835 ggcatggagggtagtagttga 815
to top
>dbj|AB090240.1| Populus alba PaGA20ox1b mRNA for gibberellin 20-oxidase, complete
           cds
          Length = 1158

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 724 ggcatggagggtagtagttga 704
to top
>dbj|AB090239.1| Populus alba PaGA20ox1a gene for gibberellin 20-oxidase, complete
           cds
          Length = 1440

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 835 ggcatggagggtagtagttga 815
to top
>dbj|AB090238.1| Populus alba PaGA20ox1a mRNA for gibberellin 20-oxidase, complete
           cds
          Length = 1158

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 724 ggcatggagggtagtagttga 704
to top
>dbj|AB089676.1| Populus nigra PnGA20ox1 gene for gibberellin 20-oxidase, complete
           cds
          Length = 1449

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 835 ggcatggagggtagtagttga 815
to top
>dbj|AB089675.1| Populus nigra PnGA20ox1 mRNA for gibberellin 20-oxidase, complete
           cds
          Length = 1158

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 438 ggcatggagggtagtagttga 458
           |||||||||||||||||||||
Sbjct: 724 ggcatggagggtagtagttga 704
to top
>emb|BX571961.11| Zebrafish DNA sequence from clone DKEY-205O12 in linkage group 22,
             complete sequence
          Length = 149478

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 170   gcatccacggcgtaaaacata 190
             |||||||||||||||||||||
Sbjct: 98344 gcatccacggcgtaaaacata 98364
to top
>dbj|AB021290.1| Homo sapiens gene for chondromodulin-1, promoter and partial cds
          Length = 2982

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 319  attgtaccatctcccatctctctga 343
            |||||||||||||||| ||||||||
Sbjct: 1330 attgtaccatctcccacctctctga 1354
to top
>ref|NM_124779.1| Arabidopsis thaliana oxidoreductase, acting on paired donors, with
           incorporation or reduction of molecular oxygen,
           2-oxoglutarate as one donor, and > AT5G54000 mRNA,
           complete cds
          Length = 1050

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 431 ggcctcgggcatggagggtagtagttgaatct 462
           |||||||| ||||||||||||  |||||||||
Sbjct: 650 ggcctcggacatggagggtagatgttgaatct 619
to top
>ref|NM_185701.1| Oryza sativa (japonica cultivar-group), Ozsa8052 predicted mRNA
          Length = 1050

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 444 gagggtagtagttgaatctagcaa 467
           |||||||||||||||||| |||||
Sbjct: 631 gagggtagtagttgaatcgagcaa 608
to top
>ref|NM_185691.1| Oryza sativa (japonica cultivar-group), Ozsa8042 predicted mRNA
          Length = 1050

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 444 gagggtagtagttgaatctagcaa 467
           |||||||||||||||||| |||||
Sbjct: 631 gagggtagtagttgaatcgagcaa 608
to top
>gb|BT016483.1| Zea mays clone Contig316 mRNA sequence
          Length = 1124

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 ggagggtagtagttgaatct 462
           ||||||||||||||||||||
Sbjct: 611 ggagggtagtagttgaatct 592
to top
>gb|BT018033.1| Zea mays clone EL01N0530E08.c mRNA sequence
          Length = 1095

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 ggagggtagtagttgaatct 462
           ||||||||||||||||||||
Sbjct: 556 ggagggtagtagttgaatct 537
to top
>ref|XM_952897.1| Neurospora crassa OR74A hypothetical protein (NCU07362.1) partial
            mRNA
          Length = 1563

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 31   ttttcgggtgttgatgaatc 50
            ||||||||||||||||||||
Sbjct: 1488 ttttcgggtgttgatgaatc 1469
to top
>gb|AC125448.16| Mus musculus chromosome 10, clone RP23-122D10, complete sequence
          Length = 188948

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 157    tagcatcgtttccgcatcca 176
              ||||||||||||||||||||
Sbjct: 166593 tagcatcgtttccgcatcca 166612
to top
>ref|XM_327647.1| Neurospora crassa OR74A hypothetical protein (NCU07362.1) partial
            mRNA
          Length = 1563

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 31   ttttcgggtgttgatgaatc 50
            ||||||||||||||||||||
Sbjct: 1488 ttttcgggtgttgatgaatc 1469
to top
>ref|XM_753922.1| Ustilago maydis 521 hypothetical protein (UM02868.1) partial mRNA
          Length = 2991

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 84   ccacaaagtccttggccaat 103
            ||||||||||||||||||||
Sbjct: 2887 ccacaaagtccttggccaat 2868
to top
>gb|AC132448.3| Mus musculus BAC clone RP23-180B23 from chromosome 8, complete sequence
          Length = 211388

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 100    caatattttcctatatcttg 119
              ||||||||||||||||||||
Sbjct: 141678 caatattttcctatatcttg 141697
to top
>gb|AC125168.4| Mus musculus BAC clone RP24-449N2 from chromosome 3, complete sequence
          Length = 166604

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 252   ttccattgttcattatttct 271
             ||||||||||||||||||||
Sbjct: 80071 ttccattgttcattatttct 80052
to top
>emb|CR450787.6| Zebrafish DNA sequence from clone CH211-222O17 in linkage group 12,
              complete sequence
          Length = 212974

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 170    gcatccacggcgtaaaacat 189
              ||||||||||||||||||||
Sbjct: 117154 gcatccacggcgtaaaacat 117135
to top
>gb|AC099414.4| Mus musculus BAC clone RP23-122C18 from 3, complete sequence
          Length = 203057

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 252  ttccattgttcattatttct 271
            ||||||||||||||||||||
Sbjct: 9450 ttccattgttcattatttct 9469
to top
>emb|CR956383.8| Pig DNA sequence from clone CH242-271L5 on chromosome 17, complete
              sequence
          Length = 163007

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 11     taataaacgcccaacctata 30
              ||||||||||||||||||||
Sbjct: 118910 taataaacgcccaacctata 118929
to top
>emb|AJ312712.1|BTE312712 Bombus terrestris repetitive sequence mariner-like element
           Botmar1-1
          Length = 1285

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 476 gccttgtttgatattctggt 495
           ||||||||||||||||||||
Sbjct: 891 gccttgtttgatattctggt 872
to top
>gb|AC159819.2| Mus musculus BAC clone RP23-180C14 from chromosome 9, complete sequence
          Length = 211119

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 229    tctgtgaaatgggctcctaa 248
              ||||||||||||||||||||
Sbjct: 153685 tctgtgaaatgggctcctaa 153704
to top
>gb|DQ056720.1| Arabidopsis thaliana oxidoreductase (At5g54000) mRNA, complete cds
          Length = 1050

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 431 ggcctcgggcatggagggtagtagttgaatct 462
           |||||||| ||||||||||||  |||||||||
Sbjct: 650 ggcctcggacatggagggtagatgttgaatct 619
to top
>gb|AC068408.9| Homo sapiens chromosome 18, clone RP11-612A1, complete sequence
          Length = 183583

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 373   gagaaggatggtaaggagac 392
             ||||||||||||||||||||
Sbjct: 88314 gagaaggatggtaaggagac 88333
to top
>gb|AC023426.29| Homo sapiens 12 BAC RP11-396L8 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 148610

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 266    atttctaggcagtctgctag 285
              ||||||||||||||||||||
Sbjct: 122632 atttctaggcagtctgctag 122613
to top
>gb|AF222718.1| Chrysodidymus synuroideus mitochondrion, complete genome
          Length = 34119

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 90    agtccttggccaatattttc 109
             ||||||||||||||||||||
Sbjct: 32595 agtccttggccaatattttc 32614
to top
>gb|AC019106.3| Homo sapiens BAC clone RP11-479L11 from 2, complete sequence
          Length = 198540

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 249   agattccattgttcattatt 268
             ||||||||||||||||||||
Sbjct: 51899 agattccattgttcattatt 51918
to top
>dbj|AB007644.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19P17
          Length = 73840

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 431   ggcctcgggcatggagggtagtagttgaatct 462
             |||||||| ||||||||||||  |||||||||
Sbjct: 57998 ggcctcggacatggagggtagatgttgaatct 58029
to top
>emb|CR954297.15| Zebrafish DNA sequence from clone DKEY-69M3 in linkage group 8,
             complete sequence
          Length = 232837

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 170   gcatccacggcgtaaaacat 189
             ||||||||||||||||||||
Sbjct: 85062 gcatccacggcgtaaaacat 85081
to top
>gb|AE000657.1| Aquifex aeolicus VF5, complete genome
          Length = 1551335

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 49      tctcttcccttgacgaaaat 68
               ||||||||||||||||||||
Sbjct: 1096031 tctcttcccttgacgaaaat 1096012
to top
>gb|AC129222.4| Mus musculus BAC clone RP24-532L14 from 14, complete sequence
          Length = 181469

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 333    catctctctgaacttgcaag 352
              ||||||||||||||||||||
Sbjct: 124280 catctctctgaacttgcaag 124261
to top
>emb|AL713894.12| Mouse DNA sequence from clone RP23-48J18 on chromosome X, complete
              sequence
          Length = 264395

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 194    agggaaagcctatccttcttgaag 217
              ||||||| ||||||||||||||||
Sbjct: 197778 agggaaatcctatccttcttgaag 197755
to top
>gb|L10501.1|CSZMTRNPAC Chrysops vittatus (clone Deer.fly.9.3) mariner transposase
           pseudogene, partial cds
          Length = 431

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 475 agccttgtttgatattctgg 494
           ||||||||||||||||||||
Sbjct: 328 agccttgtttgatattctgg 309


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,588,991
Number of Sequences: 3902068
Number of extensions: 3588991
Number of successful extensions: 68986
Number of sequences better than 10.0: 94
Number of HSP's better than 10.0 without gapping: 94
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 68782
Number of HSP's gapped (non-prelim): 201
length of query: 521
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 498
effective length of database: 17,143,297,704
effective search space: 8537362256592
effective search space used: 8537362256592
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top