ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags20h18 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AF294725.1|AF294725 Oryza sativa reversibly glycosylated polypeptide mRNA, complete cds Length = 1136 Score = 343 bits (173), Expect = 5e-91 Identities = 355/412 (86%), Gaps = 4/412 (0%) Strand = Plus / Minus Query: 277 tcccaggcctcgatccaggtgaccatggcgtcggcgagcttgacgaagtatgggtcgatc 336 ||||||||||||||||||||||||||||| ||||| |||||||||||||| ||||||||| Sbjct: 1070 tcccaggcctcgatccaggtgaccatggcatcggcaagcttgacgaagtaggggtcgatc 1011 Query: 337 ttgccgagcttctccttgacctgctgcgagagcgagatgtagcacttctgcacggtgtcg 396 ||||||||||||||| ||||||||| | ||| |||| |||||||||||| ||||||||| Sbjct: 1010 ttgccgagcttctccctgacctgctcggcgagggagaggtagcacttctggacggtgtcg 951 Query: 397 cactccttggtcagcttcgcggcctggaagaaggggatgatgtcctcctgccagaagatt 456 |||||||||| | | ||| |||||||||||||||||||||||||||||||||||| Sbjct: 950 cactccttggggatggtggcgttctggaagaaggggatgatgtcctcctgccagaagatg 891 Query: 457 cccttgtactccttcttcaggttcacgaacgggttgctggccttgctgtgccagatgtag 516 |||||||| |||||||||| ||||||||| |||||||| |||||||||||||||||||| Sbjct: 890 cccttgtattccttcttcaagttcacgaaggggttgctagccttgctgtgccagatgtac 831 Query: 517 ggcagccccgtcttgactccgagcccaaggtggtcgcagatcaccttaacacaccagccg 576 ||||| || ||||| ||||| || | |||||||| ||||| ||||| | ||||| || Sbjct: 830 ggcagtccagtcttcactcccaggctcaggtggtcacagatgaccttcatgcaccatcca 771 Query: 577 gcccacatgttcgtcgtagcgtccgatgggctggccgtcgcccatgaggcccgaagtaca 636 |||||||||| |||||||||| || || |||||||| || |||||||| || ||||||| Sbjct: 770 gcccacatgt-cgtcgtagcgaccaataggctggccatcacccatgagacca-aagtaca 713 Query: 637 tggccgggccgatgagctcgcggtcgaagggcgaaggttcatgccgcacatg 688 | || || |||||||| |||||||| || | |||||||||||| |||||| Sbjct: 712 ttgcaggaccgatgagatcgcggtcaaaagc--aaggttcatgccacacatg 663
>gb|AY112484.1| Zea mays CL1948_2 mRNA sequence Length = 758 Score = 337 bits (170), Expect = 3e-89 Identities = 337/390 (86%), Gaps = 2/390 (0%) Strand = Plus / Minus Query: 277 tcccaggcctcgatccaggtgaccatggcgtcggcgagcttgacgaagtatgggtcgatc 336 |||||||||||||||||||||||||||||||| |||||||| | ||||| ||||||||| Sbjct: 405 tcccaggcctcgatccaggtgaccatggcgtcaccgagcttggcaaagtaggggtcgatc 346 Query: 337 ttgccgagcttctccttgacctgctgcgagagcgagatgtagcacttctgcacggtgtcg 396 ||||| ||||||||||| ||||| ||||| |||||||||||||||| ||||||||| Sbjct: 345 ttgccaagcttctccttcacctgtccagagaggtagatgtagcacttctggacggtgtcg 286 Query: 397 cactccttggtcagcttcgcggcctggaagaaggggatgatgtcctcctgccagaagatt 456 || ||||||| | || || |||||||||||||||||||||||||||||||||||| Sbjct: 285 caatccttgggaatggtcacgttctggaagaaggggatgatgtcctcctgccagaagatg 226 Query: 457 cccttgtactccttcttcaggttcacgaacgggttgctggccttgctgtgccagatgtag 516 |||||||| |||||||||| ||| ||||| |||||||| |||||||||||||||||||| Sbjct: 225 cccttgtattccttcttcaagttaacgaaggggttgctagccttgctgtgccagatgtat 166 Query: 517 ggcagccccgtcttgactccgagcccaaggtggtcgcagatcaccttaacacaccagccg 576 |||| || ||||||||||| || | | |||||||||||| ||||| |||||||| ||| Sbjct: 165 ggcaagccagtcttgactcccaggctcaagtggtcgcagatgaccttcacacaccatccg 106 Query: 577 gcccacatgttcgtcgtagcgtccgatgggctggccgtcgcccatgaggcccgaagtaca 636 ||||||||| ||||||||||| || ||||||||||| || ||||||| | |||||||||| Sbjct: 105 gcccacatg-tcgtcgtagcgaccaatgggctggccatcacccatga-gaccgaagtaca 48 Query: 637 tggccgggccgatgagctcgcggtcgaagg 666 |||| ||||| ||||| || | |||||||| Sbjct: 47 tggcagggccaatgagatccctgtcgaagg 18
>ref|NM_194076.2| Oryza sativa (japonica cultivar-group), mRNA Length = 1519 Score = 335 bits (169), Expect = 1e-88 Identities = 354/412 (85%), Gaps = 4/412 (0%) Strand = Plus / Minus Query: 277 tcccaggcctcgatccaggtgaccatggcgtcggcgagcttgacgaagtatgggtcgatc 336 ||||||||||||||||||||||||||||| ||||| |||||||||||||| ||||||||| Sbjct: 1135 tcccaggcctcgatccaggtgaccatggcatcggcaagcttgacgaagtaggggtcgatc 1076 Query: 337 ttgccgagcttctccttgacctgctgcgagagcgagatgtagcacttctgcacggtgtcg 396 ||||||||||||||| ||||||||| | ||| |||| |||||||||||| ||||||||| Sbjct: 1075 ttgccgagcttctccctgacctgctcggcgagggagaggtagcacttctggacggtgtcg 1016 Query: 397 cactccttggtcagcttcgcggcctggaagaaggggatgatgtcctcctgccagaagatt 456 |||||||||| | | ||| |||||||||||||||||||||||||||||||||||| Sbjct: 1015 cactccttggggatggtggcgttctggaagaaggggatgatgtcctcctgccagaagatg 956 Query: 457 cccttgtactccttcttcaggttcacgaacgggttgctggccttgctgtgccagatgtag 516 |||||||| |||||||||| ||||||||| |||||||| |||||||||||||||||||| Sbjct: 955 cccttgtattccttcttcaagttcacgaaggggttgctagccttgctgtgccagatgtac 896 Query: 517 ggcagccccgtcttgactccgagcccaaggtggtcgcagatcaccttaacacaccagccg 576 ||||| || ||||| ||||| || | |||||||| ||||| ||||| | ||||| || Sbjct: 895 ggcagtccagtcttcactcccaggctcaggtggtcacagatgaccttcatgcaccatcca 836 Query: 577 gcccacatgttcgtcgtagcgtccgatgggctggccgtcgcccatgaggcccgaagtaca 636 |||||||||| |||||||||| || || |||||||| || |||||||| || ||||||| Sbjct: 835 gcccacatgt-cgtcgtagcgaccaataggctggccatcacccatgagacca-aagtaca 778 Query: 637 tggccgggccgatgagctcgcggtcgaagggcgaaggttcatgccgcacatg 688 | || || |||||||| || ||||| || | |||||||||||| |||||| Sbjct: 777 ttgcaggaccgatgagatcacggtcaaaagc--aaggttcatgccacacatg 728
>emb|Y18624.1|OSA18624 Oryza sativa mRNA for reversibly glycosylated polypeptide Length = 1384 Score = 335 bits (169), Expect = 1e-88 Identities = 354/412 (85%), Gaps = 4/412 (0%) Strand = Plus / Minus Query: 277 tcccaggcctcgatccaggtgaccatggcgtcggcgagcttgacgaagtatgggtcgatc 336 ||||||||||||||||||||||||||||| ||||| |||||||||||||| ||||||||| Sbjct: 1119 tcccaggcctcgatccaggtgaccatggcatcggcaagcttgacgaagtaggggtcgatc 1060 Query: 337 ttgccgagcttctccttgacctgctgcgagagcgagatgtagcacttctgcacggtgtcg 396 ||||||||||||||| ||||||||| | ||| |||| |||||||||||| ||||||||| Sbjct: 1059 ttgccgagcttctccctgacctgctcggcgagggagaggtagcacttctggacggtgtcg 1000 Query: 397 cactccttggtcagcttcgcggcctggaagaaggggatgatgtcctcctgccagaagatt 456 |||||||||| | | ||| |||||||||||||||||||||||||||||||||||| Sbjct: 999 cactccttggggatggtggcgttctggaagaaggggatgatgtcctcctgccagaagatg 940 Query: 457 cccttgtactccttcttcaggttcacgaacgggttgctggccttgctgtgccagatgtag 516 |||||||| |||||||||| ||||||||| |||||||| |||||||||||||||||||| Sbjct: 939 cccttgtattccttcttcaagttcacgaaggggttgctagccttgctgtgccagatgtac 880 Query: 517 ggcagccccgtcttgactccgagcccaaggtggtcgcagatcaccttaacacaccagccg 576 ||||| || ||||| ||||| || | |||||||| ||||| ||||| | ||||| || Sbjct: 879 ggcagtccagtcttcactcccaggctcaggtggtcacagatgaccttcatgcaccatcca 820 Query: 577 gcccacatgttcgtcgtagcgtccgatgggctggccgtcgcccatgaggcccgaagtaca 636 |||||||||| |||||||||| || || |||||||| || |||||||| || ||||||| Sbjct: 819 gcccacatgt-cgtcgtagcgaccaataggctggccatcacccatgagacca-aagtaca 762 Query: 637 tggccgggccgatgagctcgcggtcgaagggcgaaggttcatgccgcacatg 688 | || || |||||||| || ||||| || | |||||||||||| |||||| Sbjct: 761 ttgcaggaccgatgagatcacggtcaaaagc--aaggttcatgccacacatg 712
>dbj|AK098933.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013029G13, full insert sequence Length = 1492 Score = 335 bits (169), Expect = 1e-88 Identities = 354/412 (85%), Gaps = 4/412 (0%) Strand = Plus / Minus Query: 277 tcccaggcctcgatccaggtgaccatggcgtcggcgagcttgacgaagtatgggtcgatc 336 ||||||||||||||||||||||||||||| ||||| |||||||||||||| ||||||||| Sbjct: 1139 tcccaggcctcgatccaggtgaccatggcatcggcaagcttgacgaagtaggggtcgatc 1080 Query: 337 ttgccgagcttctccttgacctgctgcgagagcgagatgtagcacttctgcacggtgtcg 396 ||||||||||||||| ||||||||| | ||| |||| |||||||||||| ||||||||| Sbjct: 1079 ttgccgagcttctccctgacctgctcggcgagggagaggtagcacttctggacggtgtcg 1020 Query: 397 cactccttggtcagcttcgcggcctggaagaaggggatgatgtcctcctgccagaagatt 456 |||||||||| | | ||| |||||||||||||||||||||||||||||||||||| Sbjct: 1019 cactccttggggatggtggcgttctggaagaaggggatgatgtcctcctgccagaagatg 960 Query: 457 cccttgtactccttcttcaggttcacgaacgggttgctggccttgctgtgccagatgtag 516 |||||||| |||||||||| ||||||||| |||||||| |||||||||||||||||||| Sbjct: 959 cccttgtattccttcttcaagttcacgaaggggttgctagccttgctgtgccagatgtac 900 Query: 517 ggcagccccgtcttgactccgagcccaaggtggtcgcagatcaccttaacacaccagccg 576 ||||| || ||||| ||||| || | |||||||| ||||| ||||| | ||||| || Sbjct: 899 ggcagtccagtcttcactcccaggctcaggtggtcacagatgaccttcatgcaccatcca 840 Query: 577 gcccacatgttcgtcgtagcgtccgatgggctggccgtcgcccatgaggcccgaagtaca 636 |||||||||| |||||||||| || || |||||||| || |||||||| || ||||||| Sbjct: 839 gcccacatgt-cgtcgtagcgaccaataggctggccatcacccatgagacca-aagtaca 782 Query: 637 tggccgggccgatgagctcgcggtcgaagggcgaaggttcatgccgcacatg 688 | || || |||||||| || ||||| || | |||||||||||| |||||| Sbjct: 781 ttgcaggaccgatgagatcacggtcaaaagc--aaggttcatgccacacatg 732
>dbj|AK061813.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-B03, full insert sequence Length = 1509 Score = 335 bits (169), Expect = 1e-88 Identities = 354/412 (85%), Gaps = 4/412 (0%) Strand = Plus / Minus Query: 277 tcccaggcctcgatccaggtgaccatggcgtcggcgagcttgacgaagtatgggtcgatc 336 ||||||||||||||||||||||||||||| ||||| |||||||||||||| ||||||||| Sbjct: 1138 tcccaggcctcgatccaggtgaccatggcatcggcaagcttgacgaagtaggggtcgatc 1079 Query: 337 ttgccgagcttctccttgacctgctgcgagagcgagatgtagcacttctgcacggtgtcg 396 ||||||||||||||| ||||||||| | ||| |||| |||||||||||| ||||||||| Sbjct: 1078 ttgccgagcttctccctgacctgctcggcgagggagaggtagcacttctggacggtgtcg 1019 Query: 397 cactccttggtcagcttcgcggcctggaagaaggggatgatgtcctcctgccagaagatt 456 |||||||||| | | ||| |||||||||||||||||||||||||||||||||||| Sbjct: 1018 cactccttggggatggtggcgttctggaagaaggggatgatgtcctcctgccagaagatg 959 Query: 457 cccttgtactccttcttcaggttcacgaacgggttgctggccttgctgtgccagatgtag 516 |||||||| |||||||||| ||||||||| |||||||| |||||||||||||||||||| Sbjct: 958 cccttgtattccttcttcaagttcacgaaggggttgctagccttgctgtgccagatgtac 899 Query: 517 ggcagccccgtcttgactccgagcccaaggtggtcgcagatcaccttaacacaccagccg 576 ||||| || ||||| ||||| || | |||||||| ||||| ||||| | ||||| || Sbjct: 898 ggcagtccagtcttcactcccaggctcaggtggtcacagatgaccttcatgcaccatcca 839 Query: 577 gcccacatgttcgtcgtagcgtccgatgggctggccgtcgcccatgaggcccgaagtaca 636 |||||||||| |||||||||| || || |||||||| || |||||||| || ||||||| Sbjct: 838 gcccacatgt-cgtcgtagcgaccaataggctggccatcacccatgagacca-aagtaca 781 Query: 637 tggccgggccgatgagctcgcggtcgaagggcgaaggttcatgccgcacatg 688 | || || |||||||| || ||||| || | |||||||||||| |||||| Sbjct: 780 ttgcaggaccgatgagatcacggtcaaaagc--aaggttcatgccacacatg 731
>gb|BT017085.1| Zea mays clone EL01N0360E12.c mRNA sequence Length = 1383 Score = 319 bits (161), Expect = 7e-84 Identities = 352/412 (85%), Gaps = 4/412 (0%) Strand = Plus / Minus Query: 277 tcccaggcctcgatccaggtgaccatggcgtcggcgagcttgacgaagtatgggtcgatc 336 |||||||||||||||||||||||||||||||| |||||||||| ||||| ||||| ||| Sbjct: 1120 tcccaggcctcgatccaggtgaccatggcgtcaccgagcttgacaaagtaggggtcaatc 1061 Query: 337 ttgccgagcttctccttgacctgctgcgagagcgagatgtagcacttctgcacggtgtcg 396 |||| ||||||||||| || || ||||| ||||||||||||| || ||||||||| Sbjct: 1060 gtgcccagcttctccttcacttgtccagagaggtagatgtagcacttttggacggtgtcg 1001 Query: 397 cactccttggtcagcttcgcggcctggaagaaggggatgatgtcctcctgccagaagatt 456 || ||||||| | || || |||||||||||||||||||||||||||||||||||| Sbjct: 1000 cagtccttggggatggtcacgttctggaagaaggggatgatgtcctcctgccagaagatg 941 Query: 457 cccttgtactccttcttcaggttcacgaacgggttgctggccttgctgtgccagatgtag 516 |||||||| |||||||||| ||| ||||| |||||||| |||||||||||||||||||| Sbjct: 940 cccttgtattccttcttcaagttaacgaaggggttgctagccttgctgtgccagatgtat 881 Query: 517 ggcagccccgtcttgactccgagcccaaggtggtcgcagatcaccttaacacaccagccg 576 ||||| || ||||||||||| || | |||||||||||||| ||||| |||||||| || Sbjct: 880 ggcaggccagtcttgactcccaggctcaggtggtcgcagatgaccttcacacaccatcct 821 Query: 577 gcccacatgttcgtcgtagcgtccgatgggctggccgtcgcccatgaggcccgaagtaca 636 ||||||||| ||||||||||| |||||||||||||| || ||||||| | || ||||||| Sbjct: 820 gcccacatg-tcgtcgtagcgaccgatgggctggccatcacccatga-gaccaaagtaca 763 Query: 637 tggccgggccgatgagctcgcggtcgaagggcgaaggttcatgccgcacatg 688 | || ||||| ||||| || | |||||||| |||||||||||| |||||| Sbjct: 762 tagcagggccaatgagatccctgtcgaagg--caaggttcatgccacacatg 713
>gb|AY111237.1| Zea mays CL1948_1 mRNA sequence Length = 1481 Score = 319 bits (161), Expect = 7e-84 Identities = 352/412 (85%), Gaps = 4/412 (0%) Strand = Plus / Minus Query: 277 tcccaggcctcgatccaggtgaccatggcgtcggcgagcttgacgaagtatgggtcgatc 336 |||||||||||||||||||||||||||||||| |||||||||| ||||| ||||| ||| Sbjct: 1127 tcccaggcctcgatccaggtgaccatggcgtcaccgagcttgacaaagtaggggtcaatc 1068 Query: 337 ttgccgagcttctccttgacctgctgcgagagcgagatgtagcacttctgcacggtgtcg 396 |||| ||||||||||| || || ||||| ||||||||||||| || ||||||||| Sbjct: 1067 gtgcccagcttctccttcacttgtccagagaggtagatgtagcacttttggacggtgtcg 1008 Query: 397 cactccttggtcagcttcgcggcctggaagaaggggatgatgtcctcctgccagaagatt 456 || ||||||| | || || |||||||||||||||||||||||||||||||||||| Sbjct: 1007 cagtccttggggatggtcacgttctggaagaaggggatgatgtcctcctgccagaagatg 948 Query: 457 cccttgtactccttcttcaggttcacgaacgggttgctggccttgctgtgccagatgtag 516 |||||||| |||||||||| ||| ||||| |||||||| |||||||||||||||||||| Sbjct: 947 cccttgtattccttcttcaagttaacgaaggggttgctagccttgctgtgccagatgtat 888 Query: 517 ggcagccccgtcttgactccgagcccaaggtggtcgcagatcaccttaacacaccagccg 576 ||||| || ||||||||||| || | |||||||||||||| ||||| |||||||| || Sbjct: 887 ggcaggccagtcttgactcccaggctcaggtggtcgcagatgaccttcacacaccatcct 828 Query: 577 gcccacatgttcgtcgtagcgtccgatgggctggccgtcgcccatgaggcccgaagtaca 636 ||||||||| ||||||||||| |||||||||||||| || ||||||| | || ||||||| Sbjct: 827 gcccacatg-tcgtcgtagcgaccgatgggctggccatcacccatga-gaccaaagtaca 770 Query: 637 tggccgggccgatgagctcgcggtcgaagggcgaaggttcatgccgcacatg 688 | || ||||| ||||| || | |||||||| |||||||||||| |||||| Sbjct: 769 tagcagggccaatgagatccctgtcgaagg--caaggttcatgccacacatg 720
>gb|U89897.1|ZMU89897 Zea mays golgi associated protein se-wap41 mRNA, complete cds Length = 1480 Score = 319 bits (161), Expect = 7e-84 Identities = 352/412 (85%), Gaps = 4/412 (0%) Strand = Plus / Minus Query: 277 tcccaggcctcgatccaggtgaccatggcgtcggcgagcttgacgaagtatgggtcgatc 336 |||||||||||||||||||||||||||||||| |||||||||| ||||| ||||| ||| Sbjct: 1156 tcccaggcctcgatccaggtgaccatggcgtcaccgagcttgacaaagtaggggtcaatc 1097 Query: 337 ttgccgagcttctccttgacctgctgcgagagcgagatgtagcacttctgcacggtgtcg 396 |||| ||||||||||| || || ||||| ||||||||||||| || ||||||||| Sbjct: 1096 gtgcccagcttctccttcacttgtccagagaggtagatgtagcacttttggacggtgtcg 1037 Query: 397 cactccttggtcagcttcgcggcctggaagaaggggatgatgtcctcctgccagaagatt 456 || ||||||| | || || |||||||||||||||||||||||||||||||||||| Sbjct: 1036 cagtccttggggatggtcacgttctggaagaaggggatgatgtcctcctgccagaagatg 977 Query: 457 cccttgtactccttcttcaggttcacgaacgggttgctggccttgctgtgccagatgtag 516 |||||||| |||||||||| ||| ||||| |||||||| |||||||||||||||||||| Sbjct: 976 cccttgtattccttcttcaagttaacgaaggggttgctagccttgctgtgccagatgtat 917 Query: 517 ggcagccccgtcttgactccgagcccaaggtggtcgcagatcaccttaacacaccagccg 576 ||||| || ||||||||||| || | |||||||||||||| ||||| |||||||| || Sbjct: 916 ggcaggccagtcttgactcccaggctcaggtggtcgcagatgaccttcacacaccatcct 857 Query: 577 gcccacatgttcgtcgtagcgtccgatgggctggccgtcgcccatgaggcccgaagtaca 636 ||||||||| ||||||||||| |||||||||||||| || ||||||| | || ||||||| Sbjct: 856 gcccacatg-tcgtcgtagcgaccgatgggctggccatcacccatga-gaccaaagtaca 799 Query: 637 tggccgggccgatgagctcgcggtcgaagggcgaaggttcatgccgcacatg 688 | || ||||| ||||| || | |||||||| |||||||||||| |||||| Sbjct: 798 tagcagggccaatgagatccctgtcgaagg--caaggttcatgccacacatg 749
>emb|Y18626.1|TAE18626 Triticum aestivum mRNA for reversibly glycosylated polypeptide Length = 1393 Score = 313 bits (158), Expect = 4e-82 Identities = 352/413 (85%), Gaps = 4/413 (0%) Strand = Plus / Minus Query: 276 gtcccaggcctcgatccaggtgaccatggcgtcggcgagcttgacgaagtatgggtcgat 335 |||||||||||||||||||||||||||||| || || ||||| |||||||| ||||| || Sbjct: 1125 gtcccaggcctcgatccaggtgaccatggcatcagcaagcttcacgaagtaagggtcaat 1066 Query: 336 cttgccgagcttctccttgacctgctgcgagagcgagatgtagcacttctgcacggtgtc 395 |||||| ||||||||||||||||||| |||||| ||||||||||||||||| || ||||| Sbjct: 1065 cttgccaagcttctccttgacctgctccgagagtgagatgtagcacttctggactgtgtc 1006 Query: 396 gcactccttggtcagcttcgcggcctggaagaaggggatgatgtcctcctgccagaagat 455 |||||||||| || ||| |||||||||||||||||||||||||||||||||||| Sbjct: 1005 acactccttggagagggaggcgttctggaagaaggggatgatgtcctcctgccagaagat 946 Query: 456 tcccttgtactccttcttcaggttcacgaacgggttgctggccttgctgtgccagatgta 515 ||||||||||| ||||||| ||||| || |||||||| |||||||||||||| | ||| Sbjct: 945 gcccttgtactctttcttcaagttcagaaatgggttgctagccttgctgtgccacaggta 886 Query: 516 gggcagccccgtcttgactccgagcccaaggtggtcgcagatcaccttaacacaccagcc 575 |||||||| ||||| ||||| || | | |||||||||||| ||||| || ||||| || Sbjct: 885 tggcagcccagtcttcactccaaggctcaagtggtcgcagatgaccttgacgcaccatcc 826 Query: 576 ggcccacatgttcgtcgtagcgtccgatgggctggccgtcgcccatgaggcccgaagtac 635 ||||||||| || |||||||| || || |||||||| || ||||||||| || |||||| Sbjct: 825 agcccacatg-tcatcgtagcgaccaataggctggccatcacccatgagg-ccaaagtac 768 Query: 636 atggccgggccgatgagctcgcggtcgaagggcgaaggttcatgccgcacatg 688 || || ||||| ||||||| ||||| |||| |||||||||||| |||||| Sbjct: 767 attgcagggccaatgagctgacggtcaaagg--caaggttcatgccacacatg 717
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 305 bits (154), Expect = 1e-79 Identities = 253/286 (88%) Strand = Plus / Plus Query: 277 tcccaggcctcgatccaggtgaccatggcgtcggcgagcttgacgaagtatgggtcgatc 336 ||||||||||||||||||||||||||||| ||||| |||||||||||||| ||||||||| Sbjct: 22189585 tcccaggcctcgatccaggtgaccatggcatcggcaagcttgacgaagtaggggtcgatc 22189644 Query: 337 ttgccgagcttctccttgacctgctgcgagagcgagatgtagcacttctgcacggtgtcg 396 ||||||||||||||| ||||||||| | ||| |||| |||||||||||| ||||||||| Sbjct: 22189645 ttgccgagcttctccctgacctgctcggcgagggagaggtagcacttctggacggtgtcg 22189704 Query: 397 cactccttggtcagcttcgcggcctggaagaaggggatgatgtcctcctgccagaagatt 456 |||||||||| | | ||| |||||||||||||||||||||||||||||||||||| Sbjct: 22189705 cactccttggggatggtggcgttctggaagaaggggatgatgtcctcctgccagaagatg 22189764 Query: 457 cccttgtactccttcttcaggttcacgaacgggttgctggccttgctgtgccagatgtag 516 |||||||| |||||||||| ||||||||| |||||||| |||||||||||||||||||| Sbjct: 22189765 cccttgtattccttcttcaagttcacgaaggggttgctagccttgctgtgccagatgtac 22189824 Query: 517 ggcagccccgtcttgactccgagcccaaggtggtcgcagatcacct 562 ||||| || ||||| ||||| || | |||||||| ||||| |||| Sbjct: 22189825 ggcagtccagtcttcactcccaggctcaggtggtcacagatgacct 22189870 Score = 44.1 bits (22), Expect = 0.60 Identities = 99/121 (81%), Gaps = 4/121 (3%) Strand = Plus / Plus Query: 568 caccagccggcccacatgttcgtcgtagcgtccgatgggctggccgtcgcccatgaggcc 627 ||||| || |||||||||| |||||||||| || || |||||||| || |||||||| || Sbjct: 22190003 caccatccagcccacatgt-cgtcgtagcgaccaataggctggccatcacccatgagacc 22190061 Query: 628 cgaagtacatggccgggccgatgagctcgcggtcgaagggcgaaggttcatgccgcacat 687 |||||||| || || |||||||| || ||||| || | |||||||||||| ||||| Sbjct: 22190062 a-aagtacattgcaggaccgatgagatcacggtcaaaagc--aaggttcatgccacacat 22190118 Query: 688 g 688 | Sbjct: 22190119 g 22190119
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 305 bits (154), Expect = 1e-79 Identities = 253/286 (88%) Strand = Plus / Plus Query: 277 tcccaggcctcgatccaggtgaccatggcgtcggcgagcttgacgaagtatgggtcgatc 336 ||||||||||||||||||||||||||||| ||||| |||||||||||||| ||||||||| Sbjct: 22182614 tcccaggcctcgatccaggtgaccatggcatcggcaagcttgacgaagtaggggtcgatc 22182673 Query: 337 ttgccgagcttctccttgacctgctgcgagagcgagatgtagcacttctgcacggtgtcg 396 ||||||||||||||| ||||||||| | ||| |||| |||||||||||| ||||||||| Sbjct: 22182674 ttgccgagcttctccctgacctgctcggcgagggagaggtagcacttctggacggtgtcg 22182733 Query: 397 cactccttggtcagcttcgcggcctggaagaaggggatgatgtcctcctgccagaagatt 456 |||||||||| | | ||| |||||||||||||||||||||||||||||||||||| Sbjct: 22182734 cactccttggggatggtggcgttctggaagaaggggatgatgtcctcctgccagaagatg 22182793 Query: 457 cccttgtactccttcttcaggttcacgaacgggttgctggccttgctgtgccagatgtag 516 |||||||| |||||||||| ||||||||| |||||||| |||||||||||||||||||| Sbjct: 22182794 cccttgtattccttcttcaagttcacgaaggggttgctagccttgctgtgccagatgtac 22182853 Query: 517 ggcagccccgtcttgactccgagcccaaggtggtcgcagatcacct 562 ||||| || ||||| ||||| || | |||||||| ||||| |||| Sbjct: 22182854 ggcagtccagtcttcactcccaggctcaggtggtcacagatgacct 22182899 Score = 44.1 bits (22), Expect = 0.60 Identities = 99/121 (81%), Gaps = 4/121 (3%) Strand = Plus / Plus Query: 568 caccagccggcccacatgttcgtcgtagcgtccgatgggctggccgtcgcccatgaggcc 627 ||||| || |||||||||| |||||||||| || || |||||||| || |||||||| || Sbjct: 22183032 caccatccagcccacatgt-cgtcgtagcgaccaataggctggccatcacccatgagacc 22183090 Query: 628 cgaagtacatggccgggccgatgagctcgcggtcgaagggcgaaggttcatgccgcacat 687 |||||||| || || |||||||| || ||||| || | |||||||||||| ||||| Sbjct: 22183091 a-aagtacattgcaggaccgatgagatcacggtcaaaagc--aaggttcatgccacacat 22183147 Query: 688 g 688 | Sbjct: 22183148 g 22183148
>gb|AC090874.9| Oryza sativa chromosome 3 BAC OJ1523_A02 genomic sequence, complete sequence Length = 132987 Score = 305 bits (154), Expect = 1e-79 Identities = 253/286 (88%) Strand = Plus / Minus Query: 277 tcccaggcctcgatccaggtgaccatggcgtcggcgagcttgacgaagtatgggtcgatc 336 ||||||||||||||||||||||||||||| ||||| |||||||||||||| ||||||||| Sbjct: 35277 tcccaggcctcgatccaggtgaccatggcatcggcaagcttgacgaagtaggggtcgatc 35218 Query: 337 ttgccgagcttctccttgacctgctgcgagagcgagatgtagcacttctgcacggtgtcg 396 ||||||||||||||| ||||||||| | ||| |||| |||||||||||| ||||||||| Sbjct: 35217 ttgccgagcttctccctgacctgctcggcgagggagaggtagcacttctggacggtgtcg 35158 Query: 397 cactccttggtcagcttcgcggcctggaagaaggggatgatgtcctcctgccagaagatt 456 |||||||||| | | ||| |||||||||||||||||||||||||||||||||||| Sbjct: 35157 cactccttggggatggtggcgttctggaagaaggggatgatgtcctcctgccagaagatg 35098 Query: 457 cccttgtactccttcttcaggttcacgaacgggttgctggccttgctgtgccagatgtag 516 |||||||| |||||||||| ||||||||| |||||||| |||||||||||||||||||| Sbjct: 35097 cccttgtattccttcttcaagttcacgaaggggttgctagccttgctgtgccagatgtac 35038 Query: 517 ggcagccccgtcttgactccgagcccaaggtggtcgcagatcacct 562 ||||| || ||||| ||||| || | |||||||| ||||| |||| Sbjct: 35037 ggcagtccagtcttcactcccaggctcaggtggtcacagatgacct 34992 Score = 44.1 bits (22), Expect = 0.60 Identities = 99/121 (81%), Gaps = 4/121 (3%) Strand = Plus / Minus Query: 568 caccagccggcccacatgttcgtcgtagcgtccgatgggctggccgtcgcccatgaggcc 627 ||||| || |||||||||| |||||||||| || || |||||||| || |||||||| || Sbjct: 34859 caccatccagcccacatgt-cgtcgtagcgaccaataggctggccatcacccatgagacc 34801 Query: 628 cgaagtacatggccgggccgatgagctcgcggtcgaagggcgaaggttcatgccgcacat 687 |||||||| || || |||||||| || ||||| || | |||||||||||| ||||| Sbjct: 34800 a-aagtacattgcaggaccgatgagatcacggtcaaaagc--aaggttcatgccacacat 34744 Query: 688 g 688 | Sbjct: 34743 g 34743
>emb|AJ011078.1|OSA011078 Oryza sativa mRNA for RGP1 protein Length = 1310 Score = 276 bits (139), Expect = 9e-71 Identities = 351/414 (84%), Gaps = 7/414 (1%) Strand = Plus / Minus Query: 277 tcccaggcctcgatccaggtgaccatggcgtcggcgagcttgacgaagtatgggtcgatc 336 ||||||||||||||||||||||||||||| ||||| |||||||| || || ||||||||| Sbjct: 1124 tcccaggcctcgatccaggtgaccatggcatcggcaagcttgacaaa-taggggtcgatc 1066 Query: 337 ttgccgagcttctccttgacctgct-gcgagagcgagatgtagcacttct-gcacggtgt 394 ||||||||||||||| ||||||||| | | ||| |||| |||||| || | | ||||||| Sbjct: 1065 ttgccgagcttctccctgacctgctcgggcgagggagaggtagcaatttttggacggtgt 1006 Query: 395 cgcactccttggtcagcttcgcggcctggaagaaggggatgatgtcctcctgccagaaga 454 |||||||||||| | | ||| ||||||||||||||||||||||||||||||||||| Sbjct: 1005 cgcactccttggggatggtggcgttctggaagaaggggatgatgtcctcctgccagaaga 946 Query: 455 ttcccttgtactccttcttcaggttcacgaacgggttgctggccttgctgtgccagatgt 514 | |||||||| |||||||||| ||||||||| |||||||| ||||||||||||||||||| Sbjct: 945 tgcccttgtattccttcttcaagttcacgaaggggttgctagccttgctgtgccagatgt 886 Query: 515 agggcagccccgtcttgactccgagcccaaggtggtcgcagatcaccttaacacaccagc 574 | ||||| || ||||| ||||| || | |||||||| ||||| ||||| | ||||| | Sbjct: 885 acggcagtccagtcttcactcccaggctcaggtggtcacagatgaccttcatgcaccatc 826 Query: 575 cggcccacatgttcgtcgtagcgtccgatgggctggccgtcgcccatgaggcccgaagta 634 | |||||||||| |||||||||| || || |||||||| || |||||||| || ||||| Sbjct: 825 cagcccacatgt-cgtcgtagcgaccaataggctggccatcacccatgagacca-aagta 768 Query: 635 catggccgggccgatgagctcgcggtcgaagggcgaaggttcatgccgcacatg 688 ||| || || |||||||| || ||||| || | |||||||||||| |||||| Sbjct: 767 cattgcaggaccgatgagatcacggtcaaaagc--aaggttcatgccacacatg 716
>ref|NM_111090.2| Arabidopsis thaliana RGP1 (REVERSIBLY GLYCOSYLATED POLYPEPTIDE 1) AT3G02230 (RGP1) mRNA, complete cds Length = 1385 Score = 157 bits (79), Expect = 6e-35 Identities = 207/247 (83%), Gaps = 2/247 (0%) Strand = Plus / Minus Query: 420 ctggaagaaggggatgatgtcctcctgccagaagattcccttgtactccttcttcaggtt 479 ||||||||| || ||||| ||||||||||||||||||||||||||||||||||||| ||| Sbjct: 971 ctggaagaaaggaatgatatcctcctgccagaagattcccttgtactccttcttcaagtt 912 Query: 480 cacgaacgggttgctggccttgctgtgccagatgtagggcagccccgtcttgactccgag 539 ||| |||||||||||||| |||||||| | |||||||||| || ||||| ||||| | Sbjct: 911 cacaaacgggttgctggctttgctgtggtaaatgtagggcaaacctgtcttcactcccaa 852 Query: 540 cccaaggtggtcgcagatcaccttaacacaccagccggcccacatgttcgtcgtagcgtc 599 || | ||||| ||||||||||| | |||||| || |||||||| ||||||||||| | Sbjct: 851 tcccaaatggtcacagatcaccttgatacaccatccagcccacat-atcgtcgtagcgac 793 Query: 600 cgatgggctggccgtcgcccatgaggcccgaagtacatggccgggccgatgagctcgcgg 659 | || ||||| || || ||||||| | || |||||||| ||||| || |||||||| ||| Sbjct: 792 caataggctgaccatcacccatga-gaccaaagtacatagccggaccaatgagctcacgg 734 Query: 660 tcgaagg 666 || |||| Sbjct: 733 tcaaagg 727
>gb|BT008841.1| Arabidopsis thaliana At3g02230 mRNA, complete cds Length = 1074 Score = 157 bits (79), Expect = 6e-35 Identities = 207/247 (83%), Gaps = 2/247 (0%) Strand = Plus / Minus Query: 420 ctggaagaaggggatgatgtcctcctgccagaagattcccttgtactccttcttcaggtt 479 ||||||||| || ||||| ||||||||||||||||||||||||||||||||||||| ||| Sbjct: 903 ctggaagaaaggaatgatatcctcctgccagaagattcccttgtactccttcttcaagtt 844 Query: 480 cacgaacgggttgctggccttgctgtgccagatgtagggcagccccgtcttgactccgag 539 ||| |||||||||||||| |||||||| | |||||||||| || ||||| ||||| | Sbjct: 843 cacaaacgggttgctggctttgctgtggtaaatgtagggcaaacctgtcttcactcccaa 784 Query: 540 cccaaggtggtcgcagatcaccttaacacaccagccggcccacatgttcgtcgtagcgtc 599 || | ||||| ||||||||||| | |||||| || |||||||| ||||||||||| | Sbjct: 783 tcccaaatggtcacagatcaccttgatacaccatccagcccacat-atcgtcgtagcgac 725 Query: 600 cgatgggctggccgtcgcccatgaggcccgaagtacatggccgggccgatgagctcgcgg 659 | || ||||| || || ||||||| | || |||||||| ||||| || |||||||| ||| Sbjct: 724 caataggctgaccatcacccatga-gaccaaagtacatagccggaccaatgagctcacgg 666 Query: 660 tcgaagg 666 || |||| Sbjct: 665 tcaaagg 659
>gb|BT002409.1| Arabidopsis thaliana reversibly glycosylated polypeptide-1 (At3g02230) mRNA, complete cds Length = 1374 Score = 157 bits (79), Expect = 6e-35 Identities = 207/247 (83%), Gaps = 2/247 (0%) Strand = Plus / Minus Query: 420 ctggaagaaggggatgatgtcctcctgccagaagattcccttgtactccttcttcaggtt 479 ||||||||| || ||||| ||||||||||||||||||||||||||||||||||||| ||| Sbjct: 974 ctggaagaaaggaatgatatcctcctgccagaagattcccttgtactccttcttcaagtt 915 Query: 480 cacgaacgggttgctggccttgctgtgccagatgtagggcagccccgtcttgactccgag 539 ||| |||||||||||||| |||||||| | |||||||||| || ||||| ||||| | Sbjct: 914 cacaaacgggttgctggctttgctgtggtaaatgtagggcaaacctgtcttcactcccaa 855 Query: 540 cccaaggtggtcgcagatcaccttaacacaccagccggcccacatgttcgtcgtagcgtc 599 || | ||||| ||||||||||| | |||||| || |||||||| ||||||||||| | Sbjct: 854 tcccaaatggtcacagatcaccttgatacaccatccagcccacat-atcgtcgtagcgac 796 Query: 600 cgatgggctggccgtcgcccatgaggcccgaagtacatggccgggccgatgagctcgcgg 659 | || ||||| || || ||||||| | || |||||||| ||||| || |||||||| ||| Sbjct: 795 caataggctgaccatcacccatga-gaccaaagtacatagccggaccaatgagctcacgg 737 Query: 660 tcgaagg 666 || |||| Sbjct: 736 tcaaagg 730
>gb|AF013627.1|AF013627 Arabidopsis thaliana reversibly glycosylated polypeptide-1 (AtRGP) mRNA, complete cds Length = 1393 Score = 155 bits (78), Expect = 2e-34 Identities = 203/242 (83%), Gaps = 2/242 (0%) Strand = Plus / Minus Query: 420 ctggaagaaggggatgatgtcctcctgccagaagattcccttgtactccttcttcaggtt 479 ||||||||| || ||||| ||||||||||||||||||||||||||||||||||||| ||| Sbjct: 974 ctggaagaaaggaatgatatcctcctgccagaagattcccttgtactccttcttcaagtt 915 Query: 480 cacgaacgggttgctggccttgctgtgccagatgtagggcagccccgtcttgactccgag 539 ||| |||||||||||||| |||||||| | |||||||||| || ||||| ||||| | Sbjct: 914 cacaaacgggttgctggctttgctgtggtaaatgtagggcaaacctgtcttcactcccaa 855 Query: 540 cccaaggtggtcgcagatcaccttaacacaccagccggcccacatgttcgtcgtagcgtc 599 || | ||||| ||||||||||| | |||||| || |||||||| ||||||||||| | Sbjct: 854 tcccaaatggtcacagatcaccttgatacaccatccagcccacat-atcgtcgtagcgac 796 Query: 600 cgatgggctggccgtcgcccatgaggcccgaagtacatggccgggccgatgagctcgcgg 659 | || ||||| || || ||||||| | || |||||||| ||||| || |||||||| ||| Sbjct: 795 caataggctgaccatcacccatga-gaccaaagtacatagccggaccaatgagctcacgg 737 Query: 660 tc 661 || Sbjct: 736 tc 735
>gb|DQ415920.1| Cleome spinosa clone BAC Cs3, complete sequence Length = 141360 Score = 145 bits (73), Expect = 2e-31 Identities = 214/261 (81%) Strand = Plus / Minus Query: 276 gtcccaggcctcgatccaggtgaccatggcgtcggcgagcttgacgaagtatgggtcgat 335 |||||| || |||||||| ||||||||||| || | |||||| ||||||| ||||| || Sbjct: 4606 gtcccaagcttcgatccaagtgaccatggcctctgacagcttgtcgaagtaggggtctat 4547 Query: 336 cttgccgagcttctccttgacctgctgcgagagcgagatgtagcacttctgcacggtgtc 395 ||| ||||||||||| ||| || |||||| ||||||||| | ||| |||||| Sbjct: 4546 ggtgcttagcttctccttcaccaacttggagagctcgatgtagcattgctgaacggtggt 4487 Query: 396 gcactccttggtcagcttcgcggcctggaagaaggggatgatgtcctcctgccagaagat 455 |||||| || | |||||| || ||||||||| |||||||| || ||||||||||| || Sbjct: 4486 gcactctttcggaagcttcacgttctggaagaaagggatgatctcttcctgccagaaaat 4427 Query: 456 tcccttgtactccttcttcaggttcacgaacgggttgctggccttgctgtgccagatgta 515 |||||||| ||||||||||||||||| || || ||||| ||||||||||| ||||||| Sbjct: 4426 gcccttgtattccttcttcaggttcacaaagggattgcttgccttgctgtggtagatgta 4367 Query: 516 gggcagccccgtcttgactcc 536 |||||| |||||||| ||||| Sbjct: 4366 gggcaggcccgtcttcactcc 4346 Score = 67.9 bits (34), Expect = 4e-08 Identities = 90/106 (84%), Gaps = 2/106 (1%) Strand = Plus / Minus Query: 559 accttaacacaccagccggcccacatgttcgtcgtagcgtccgatgggctggccgtcgcc 618 ||||| |||||||| || |||||||| | ||||||||||||| || |||||||| || || Sbjct: 4239 accttgacacaccacccagcccacatat-cgtcgtagcgtccaataggctggccatcacc 4181 Query: 619 catgaggcccgaagtacatggccgggccgatgagctcgcggtcgaa 664 ||||| | || ||||||||||| || ||||| ||||| |||||||| Sbjct: 4180 catga-gaccaaagtacatggctggaccgatcagctcacggtcgaa 4136
>emb|AJ223252.2|SOT223252 Solanum tuberosum mRNA for UDP-glucose:protein transglucosylase (uptg1 gene) Length = 1392 Score = 141 bits (71), Expect = 3e-30 Identities = 174/207 (84%), Gaps = 1/207 (0%) Strand = Plus / Minus Query: 418 gcctggaagaaggggatgatgtcctcctgccagaagattcccttgtactccttcttcagg 477 |||||||||||||||||||| ||||| ||||||||||| || ||||||||||| || ||| Sbjct: 906 gcctggaagaaggggatgatctcctcttgccagaagataccattgtactcctttttgagg 847 Query: 478 ttcacgaacgggttgctggccttgctgtgccagatgtagggcagccccgtcttgactccg 537 || ||||| |||||||| || ||||||||||| ||||||||||| || ||||||| ||| Sbjct: 846 ttaacgaatgggttgctagctttgctgtgccaaatgtagggcagaccagtcttgattcct 787 Query: 538 agcccaaggtggtcgcagatcaccttaacacaccagccggcccacatgttcgtcgtagcg 597 || || | ||||| || || ||||| |||||||||||||||||| |||||||| || Sbjct: 786 agtcccaaatggtcacatatgaccttggtacaccagccggcccacat-atcgtcgtaacg 728 Query: 598 tccgatgggctggccgtcgcccatgag 624 || || ||||| ||||| |||||||| Sbjct: 727 accaattggctgaccgtcacccatgag 701
>gb|AY622990.1| Lycopersicon esculentum UDP-glucose:protein transglucosylase-like protein SlUPTG1 mRNA, complete cds Length = 1398 Score = 137 bits (69), Expect = 5e-29 Identities = 172/205 (83%), Gaps = 1/205 (0%) Strand = Plus / Minus Query: 420 ctggaagaaggggatgatgtcctcctgccagaagattcccttgtactccttcttcaggtt 479 |||||||||||||||||| ||||| ||||||||||| || ||||||||||| || ||||| Sbjct: 910 ctggaagaaggggatgatctcctcttgccagaagataccgttgtactcctttttgaggtt 851 Query: 480 cacgaacgggttgctggccttgctgtgccagatgtagggcagccccgtcttgactccgag 539 ||||| |||||||| || ||||||||||| ||||||||||| || ||||||| ||| || Sbjct: 850 aacgaatgggttgctagctttgctgtgccatatgtagggcagaccagtcttgattcctag 791 Query: 540 cccaaggtggtcgcagatcaccttaacacaccagccggcccacatgttcgtcgtagcgtc 599 || | ||||| || || ||||| |||||||||||||||||| |||||||| || | Sbjct: 790 tcccaaatggtcacatatgaccttggtacaccagccggcccacat-atcgtcgtaacgac 732 Query: 600 cgatgggctggccgtcgcccatgag 624 | || ||||| ||||| |||||||| Sbjct: 731 caattggctgaccgtcacccatgag 707
>gb|BT012716.1| Lycopersicon esculentum clone 113599F, mRNA sequence Length = 1413 Score = 137 bits (69), Expect = 5e-29 Identities = 172/205 (83%), Gaps = 1/205 (0%) Strand = Plus / Minus Query: 420 ctggaagaaggggatgatgtcctcctgccagaagattcccttgtactccttcttcaggtt 479 |||||||||||||||||| ||||| ||||||||||| || ||||||||||| || ||||| Sbjct: 928 ctggaagaaggggatgatctcctcttgccagaagataccgttgtactcctttttgaggtt 869 Query: 480 cacgaacgggttgctggccttgctgtgccagatgtagggcagccccgtcttgactccgag 539 ||||| |||||||| || ||||||||||| ||||||||||| || ||||||| ||| || Sbjct: 868 aacgaatgggttgctagctttgctgtgccatatgtagggcagaccagtcttgattcctag 809 Query: 540 cccaaggtggtcgcagatcaccttaacacaccagccggcccacatgttcgtcgtagcgtc 599 || | ||||| || || ||||| |||||||||||||||||| |||||||| || | Sbjct: 808 tcccaaatggtcacatatgaccttggtacaccagccggcccacat-atcgtcgtaacgac 750 Query: 600 cgatgggctggccgtcgcccatgag 624 | || ||||| ||||| |||||||| Sbjct: 749 caattggctgaccgtcacccatgag 725
>gb|DQ415921.1| Cleome spinosa clone BAC Cs2, complete sequence Length = 132380 Score = 129 bits (65), Expect = 1e-26 Identities = 104/117 (88%) Strand = Plus / Minus Query: 420 ctggaagaaggggatgatgtcctcctgccagaagattcccttgtactccttcttcaggtt 479 |||||||||||||||||| || ||||||||||| || || ||||| |||||||||||||| Sbjct: 27416 ctggaagaaggggatgatctcttcctgccagaaaatgcctttgtattccttcttcaggtt 27357 Query: 480 cacgaacgggttgctggccttgctgtgccagatgtagggcagccccgtcttgactcc 536 |||||| |||||||| ||||||||||| ||||||| ||||| |||||||| ||||| Sbjct: 27356 cacgaatgggttgctcgccttgctgtggtagatgtatggcagacccgtcttcactcc 27300 Score = 61.9 bits (31), Expect = 3e-06 Identities = 78/91 (85%), Gaps = 2/91 (2%) Strand = Plus / Minus Query: 559 accttaacacaccagccggcccacatgttcgtcgtagcgtccgatgggctggccgtcgcc 618 ||||| |||||||| || |||||||| | ||||||||||||| || |||||||| || || Sbjct: 27187 accttgacacaccaaccagcccacatat-cgtcgtagcgtccaataggctggccatcacc 27129 Query: 619 catgaggcccgaagtacatggccgggccgat 649 ||||| | || |||||||||||||| ||||| Sbjct: 27128 catga-gaccaaagtacatggccggaccgat 27099
>gb|AC009755.7|ATAC009755 Arabidopsis thaliana chromosome III BAC F14P3 genomic sequence, complete sequence Length = 94369 Score = 129 bits (65), Expect = 1e-26 Identities = 92/101 (91%) Strand = Plus / Plus Query: 420 ctggaagaaggggatgatgtcctcctgccagaagattcccttgtactccttcttcaggtt 479 ||||||||| || ||||| ||||||||||||||||||||||||||||||||||||| ||| Sbjct: 57748 ctggaagaaaggaatgatatcctcctgccagaagattcccttgtactccttcttcaagtt 57807 Query: 480 cacgaacgggttgctggccttgctgtgccagatgtagggca 520 ||| |||||||||||||| |||||||| | |||||||||| Sbjct: 57808 cacaaacgggttgctggctttgctgtggtaaatgtagggca 57848 Score = 40.1 bits (20), Expect = 9.4 Identities = 66/80 (82%), Gaps = 1/80 (1%) Strand = Plus / Plus Query: 587 tcgtcgtagcgtccgatgggctggccgtcgcccatgaggcccgaagtacatggccgggcc 646 ||||||||||| || || ||||| || || ||||||| | || |||||||| ||||| || Sbjct: 57999 tcgtcgtagcgaccaataggctgaccatcacccatga-gaccaaagtacatagccggacc 58057 Query: 647 gatgagctcgcggtcgaagg 666 |||||||| ||||| |||| Sbjct: 58058 aatgagctcacggtcaaagg 58077
>emb|AJ843986.1| Plantago major partial mRNA for hypothetical protein Length = 877 Score = 129 bits (65), Expect = 1e-26 Identities = 104/117 (88%) Strand = Plus / Minus Query: 420 ctggaagaaggggatgatgtcctcctgccagaagattcccttgtactccttcttcaggtt 479 ||||||||| |||||||| ||||| |||||| |||| |||||||| |||||||||||||| Sbjct: 457 ctggaagaacgggatgatttcctcttgccagtagatgcccttgtattccttcttcaggtt 398 Query: 480 cacgaacgggttgctggccttgctgtgccagatgtagggcagccccgtcttgactcc 536 || || |||||||| |||||||||||||||||||| || ||||| ||||||||||| Sbjct: 397 gacaaatgggttgctagccttgctgtgccagatgtatggtagccctgtcttgactcc 341
>ref|NM_111724.2| Arabidopsis thaliana RGP3 (REVERSIBLY GLYCOSYLATED POLYPEPTIDE 3); alpha-1,4-glucan-protein synthase (UDP-forming) AT3G08900 (RGP3) mRNA, complete cds Length = 1350 Score = 119 bits (60), Expect = 1e-23 Identities = 182/220 (82%), Gaps = 2/220 (0%) Strand = Plus / Minus Query: 442 tcctgccagaagattcccttgtactccttcttcaggttcacgaacgggttgctggccttg 501 |||||||| || ||||| ||||| ||||| |||||||||||||| ||||||||||| ||| Sbjct: 869 tcctgccaaaatattccgttgtattcctttttcaggttcacgaatgggttgctggctttg 810 Query: 502 ctgtgccagatgtagggcagccccgtcttgactccgagcccaaggtggtcgcagatcacc 561 |||||||| ||||| |||| |||||||| ||||| || | |||||| || |||||| Sbjct: 809 ctgtgccatatgtaaggcaaacccgtcttcactccccatcccatgtggtcacatatcacc 750 Query: 562 ttaacacaccagccggcccacatgttcgtcgtagcgtccgatgggctggccgtcgcccat 621 || |||||||| || ||||||||| ||||| |||||||| || ||||| || || ||||| Sbjct: 749 ttgacacaccaaccagcccacatg-tcgtcatagcgtccaattggctgtccatcacccat 691 Query: 622 gaggcccgaagtacatggccgggccgatgagctcgcggtc 661 | |||| |||||||| ||||| || || ||||| ||||| Sbjct: 690 -aagcccaaagtacatagccggaccaatcagctcacggtc 652
>gb|AF034255.2|AF034255 Arabidopsis thaliana reversibly glycosylated polypeptide-3 (RGP) mRNA, complete cds Length = 1374 Score = 119 bits (60), Expect = 1e-23 Identities = 182/220 (82%), Gaps = 2/220 (0%) Strand = Plus / Minus Query: 442 tcctgccagaagattcccttgtactccttcttcaggttcacgaacgggttgctggccttg 501 |||||||| || ||||| ||||| ||||| |||||||||||||| ||||||||||| ||| Sbjct: 893 tcctgccaaaatattccgttgtattcctttttcaggttcacgaatgggttgctggctttg 834 Query: 502 ctgtgccagatgtagggcagccccgtcttgactccgagcccaaggtggtcgcagatcacc 561 |||||||| ||||| |||| |||||||| ||||| || | |||||| || |||||| Sbjct: 833 ctgtgccatatgtaaggcaaacccgtcttcactccccatcccatgtggtcacatatcacc 774 Query: 562 ttaacacaccagccggcccacatgttcgtcgtagcgtccgatgggctggccgtcgcccat 621 || |||||||| || ||||||||| ||||| |||||||| || ||||| || || ||||| Sbjct: 773 ttgacacaccaaccagcccacatg-tcgtcatagcgtccaattggctgtccatcacccat 715 Query: 622 gaggcccgaagtacatggccgggccgatgagctcgcggtc 661 | |||| |||||||| ||||| || || ||||| ||||| Sbjct: 714 -aagcccaaagtacatagccggaccaatcagctcacggtc 676
>dbj|AK118676.1| Arabidopsis thaliana At3g08900 mRNA for putative reversibly glycosylated polypeptide-3 (RGP), complete cds, clone: RAFL19-94-P04 Length = 901 Score = 119 bits (60), Expect = 1e-23 Identities = 182/220 (82%), Gaps = 2/220 (0%) Strand = Plus / Minus Query: 442 tcctgccagaagattcccttgtactccttcttcaggttcacgaacgggttgctggccttg 501 |||||||| || ||||| ||||| ||||| |||||||||||||| ||||||||||| ||| Sbjct: 449 tcctgccaaaatattccgttgtattcctttttcaggttcacgaatgggttgctggctttg 390 Query: 502 ctgtgccagatgtagggcagccccgtcttgactccgagcccaaggtggtcgcagatcacc 561 |||||||| ||||| |||| |||||||| ||||| || | |||||| || |||||| Sbjct: 389 ctgtgccatatgtaaggcaaacccgtcttcactccccatcccatgtggtcacatatcacc 330 Query: 562 ttaacacaccagccggcccacatgttcgtcgtagcgtccgatgggctggccgtcgcccat 621 || |||||||| || ||||||||| ||||| |||||||| || ||||| || || ||||| Sbjct: 329 ttgacacaccaaccagcccacatg-tcgtcatagcgtccaattggctgtccatcacccat 271 Query: 622 gaggcccgaagtacatggccgggccgatgagctcgcggtc 661 | |||| |||||||| ||||| || || ||||| ||||| Sbjct: 270 -aagcccaaagtacatagccggaccaatcagctcacggtc 232
>gb|AF005279.1|AF005279 Vigna unguiculata type IIIa membrane protein cp-wap13 mRNA, complete cds Length = 1275 Score = 103 bits (52), Expect = 8e-19 Identities = 136/164 (82%) Strand = Plus / Minus Query: 421 tggaagaaggggatgatgtcctcctgccagaagattcccttgtactccttcttcaggttc 480 ||||| ||||| ||||| || || ||||||||||| || ||||||||||| ||||| ||| Sbjct: 965 tggaaaaagggaatgatctcttcttgccagaagatgcctttgtactcctttttcagattc 906 Query: 481 acgaacgggttgctggccttgctgtgccagatgtagggcagccccgtcttgactccgagc 540 || || |||||||| || ||||||||||| ||||| || || || ||||| ||||| | | Sbjct: 905 acaaatgggttgcttgctttgctgtgccatatgtatgggagtccagtcttcactcccaac 846 Query: 541 ccaaggtggtcgcagatcaccttaacacaccagccggcccacat 584 || | ||||| ||||| |||||||||||||| || |||||||| Sbjct: 845 cccaaatggtcacagataaccttaacacaccaaccagcccacat 802
>ref|NM_121569.2| Arabidopsis thaliana RGP2; alpha-1,4-glucan-protein synthase (UDP-forming) AT5G15650 (RGP2) mRNA, complete cds Length = 1530 Score = 101 bits (51), Expect = 3e-18 Identities = 78/87 (89%) Strand = Plus / Minus Query: 420 ctggaagaaggggatgatgtcctcctgccagaagattcccttgtactccttcttcaggtt 479 ||||||||| || ||||| |||||||||||||||||||||||||| |||||||||||||| Sbjct: 949 ctggaagaacggaatgatctcctcctgccagaagattcccttgtattccttcttcaggtt 890 Query: 480 cacgaacgggttgctggccttgctgtg 506 || || |||||||| || |||||||| Sbjct: 889 aacaaaagggttgctcgctttgctgtg 863
>ref|XM_479089.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1407 Score = 101 bits (51), Expect = 3e-18 Identities = 87/99 (87%) Strand = Plus / Minus Query: 420 ctggaagaaggggatgatgtcctcctgccagaagattcccttgtactccttcttcaggtt 479 ||||||||||||||| | |||||||||||||| || || ||||| |||||||| ||||| Sbjct: 947 ctggaagaaggggatcagctcctcctgccagaatatgccgttgtattccttcttgaggtt 888 Query: 480 cacgaacgggttgctggccttgctgtgccagatgtaggg 518 ||| || |||||||| || |||||||||||||||||||| Sbjct: 887 cacaaaggggttgctcgctttgctgtgccagatgtaggg 849 Score = 60.0 bits (30), Expect = 1e-05 Identities = 39/42 (92%) Strand = Plus / Minus Query: 277 tcccaggcctcgatccaggtgaccatggcgtcggcgagcttg 318 ||||||||||| ||||| |||||||||| ||||||||||||| Sbjct: 1090 tcccaggcctcaatccatgtgaccatggagtcggcgagcttg 1049
>emb|AL391144.1|ATF14F8 Arabidopsis thaliana DNA chromosome 5, BAC clone F14F8 (ESSA project) Length = 96892 Score = 101 bits (51), Expect = 3e-18 Identities = 78/87 (89%) Strand = Plus / Minus Query: 420 ctggaagaaggggatgatgtcctcctgccagaagattcccttgtactccttcttcaggtt 479 ||||||||| || ||||| |||||||||||||||||||||||||| |||||||||||||| Sbjct: 9515 ctggaagaacggaatgatctcctcctgccagaagattcccttgtattccttcttcaggtt 9456 Query: 480 cacgaacgggttgctggccttgctgtg 506 || || |||||||| || |||||||| Sbjct: 9455 aacaaaagggttgctcgctttgctgtg 9429
>gb|AY120691.1| Arabidopsis thaliana AT5g15650/F14F8_30 mRNA, complete cds Length = 1083 Score = 101 bits (51), Expect = 3e-18 Identities = 78/87 (89%) Strand = Plus / Minus Query: 420 ctggaagaaggggatgatgtcctcctgccagaagattcccttgtactccttcttcaggtt 479 ||||||||| || ||||| |||||||||||||||||||||||||| |||||||||||||| Sbjct: 903 ctggaagaacggaatgatctcctcctgccagaagattcccttgtattccttcttcaggtt 844 Query: 480 cacgaacgggttgctggccttgctgtg 506 || || |||||||| || |||||||| Sbjct: 843 aacaaaagggttgctcgctttgctgtg 817
>gb|AY039846.1| Arabidopsis thaliana AT5g15650/F14F8_30 mRNA, complete cds Length = 1411 Score = 101 bits (51), Expect = 3e-18 Identities = 78/87 (89%) Strand = Plus / Minus Query: 420 ctggaagaaggggatgatgtcctcctgccagaagattcccttgtactccttcttcaggtt 479 ||||||||| || ||||| |||||||||||||||||||||||||| |||||||||||||| Sbjct: 950 ctggaagaacggaatgatctcctcctgccagaagattcccttgtattccttcttcaggtt 891 Query: 480 cacgaacgggttgctggccttgctgtg 506 || || |||||||| || |||||||| Sbjct: 890 aacaaaagggttgctcgctttgctgtg 864
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 101 bits (51), Expect = 3e-18 Identities = 87/99 (87%) Strand = Plus / Minus Query: 420 ctggaagaaggggatgatgtcctcctgccagaagattcccttgtactccttcttcaggtt 479 ||||||||||||||| | |||||||||||||| || || ||||| |||||||| ||||| Sbjct: 24722479 ctggaagaaggggatcagctcctcctgccagaatatgccgttgtattccttcttgaggtt 24722420 Query: 480 cacgaacgggttgctggccttgctgtgccagatgtaggg 518 ||| || |||||||| || |||||||||||||||||||| Sbjct: 24722419 cacaaaggggttgctcgctttgctgtgccagatgtaggg 24722381 Score = 60.0 bits (30), Expect = 1e-05 Identities = 39/42 (92%) Strand = Plus / Minus Query: 277 tcccaggcctcgatccaggtgaccatggcgtcggcgagcttg 318 ||||||||||| ||||| |||||||||| ||||||||||||| Sbjct: 24722622 tcccaggcctcaatccatgtgaccatggagtcggcgagcttg 24722581
>emb|BX830946.1|CNS09YLX Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS40ZH01 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1351 Score = 101 bits (51), Expect = 3e-18 Identities = 78/87 (89%) Strand = Plus / Minus Query: 420 ctggaagaaggggatgatgtcctcctgccagaagattcccttgtactccttcttcaggtt 479 ||||||||| || ||||| |||||||||||||||||||||||||| |||||||||||||| Sbjct: 933 ctggaagaacggaatgatctcctcctgccagaagattcccttgtattccttcttcaggtt 874 Query: 480 cacgaacgggttgctggccttgctgtg 506 || || |||||||| || |||||||| Sbjct: 873 aacaaaagggttgctcgctttgctgtg 847
>gb|AY087476.1| Arabidopsis thaliana clone 35863 mRNA, complete sequence Length = 1396 Score = 101 bits (51), Expect = 3e-18 Identities = 78/87 (89%) Strand = Plus / Minus Query: 420 ctggaagaaggggatgatgtcctcctgccagaagattcccttgtactccttcttcaggtt 479 ||||||||| || ||||| |||||||||||||||||||||||||| |||||||||||||| Sbjct: 951 ctggaagaacggaatgatctcctcctgccagaagattcccttgtattccttcttcaggtt 892 Query: 480 cacgaacgggttgctggccttgctgtg 506 || || |||||||| || |||||||| Sbjct: 891 aacaaaagggttgctcgctttgctgtg 865
>dbj|AP005175.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBb0040H10 Length = 132919 Score = 101 bits (51), Expect = 3e-18 Identities = 87/99 (87%) Strand = Plus / Minus Query: 420 ctggaagaaggggatgatgtcctcctgccagaagattcccttgtactccttcttcaggtt 479 ||||||||||||||| | |||||||||||||| || || ||||| |||||||| ||||| Sbjct: 78416 ctggaagaaggggatcagctcctcctgccagaatatgccgttgtattccttcttgaggtt 78357 Query: 480 cacgaacgggttgctggccttgctgtgccagatgtaggg 518 ||| || |||||||| || |||||||||||||||||||| Sbjct: 78356 cacaaaggggttgctcgctttgctgtgccagatgtaggg 78318 Score = 60.0 bits (30), Expect = 1e-05 Identities = 39/42 (92%) Strand = Plus / Minus Query: 277 tcccaggcctcgatccaggtgaccatggcgtcggcgagcttg 318 ||||||||||| ||||| |||||||||| ||||||||||||| Sbjct: 78559 tcccaggcctcaatccatgtgaccatggagtcggcgagcttg 78518
>dbj|AK061294.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-D01, full insert sequence Length = 1407 Score = 101 bits (51), Expect = 3e-18 Identities = 87/99 (87%) Strand = Plus / Minus Query: 420 ctggaagaaggggatgatgtcctcctgccagaagattcccttgtactccttcttcaggtt 479 ||||||||||||||| | |||||||||||||| || || ||||| |||||||| ||||| Sbjct: 947 ctggaagaaggggatcagctcctcctgccagaatatgccgttgtattccttcttgaggtt 888 Query: 480 cacgaacgggttgctggccttgctgtgccagatgtaggg 518 ||| || |||||||| || |||||||||||||||||||| Sbjct: 887 cacaaaggggttgctcgctttgctgtgccagatgtaggg 849 Score = 60.0 bits (30), Expect = 1e-05 Identities = 39/42 (92%) Strand = Plus / Minus Query: 277 tcccaggcctcgatccaggtgaccatggcgtcggcgagcttg 318 ||||||||||| ||||| |||||||||| ||||||||||||| Sbjct: 1090 tcccaggcctcaatccatgtgaccatggagtcggcgagcttg 1049
>gb|AF013628.1|AF013628 Arabidopsis thaliana reversibly glycosylated polypeptide-2 (AtRGP) mRNA, complete cds Length = 1401 Score = 101 bits (51), Expect = 3e-18 Identities = 78/87 (89%) Strand = Plus / Minus Query: 420 ctggaagaaggggatgatgtcctcctgccagaagattcccttgtactccttcttcaggtt 479 ||||||||| || ||||| |||||||||||||||||||||||||| |||||||||||||| Sbjct: 924 ctggaagaacggaatgatctcctcctgccagaagattcccttgtattccttcttcaggtt 865 Query: 480 cacgaacgggttgctggccttgctgtg 506 || || |||||||| || |||||||| Sbjct: 864 aacaaaagggttgctcgctttgctgtg 838
>gb|DQ207853.1| Solanum tuberosum clone 075G08 UDP-glucose:protein transglucosylase-like mRNA, complete cds Length = 1244 Score = 97.6 bits (49), Expect = 5e-17 Identities = 198/245 (80%), Gaps = 2/245 (0%) Strand = Plus / Minus Query: 420 ctggaagaaggggatgatgtcctcctgccagaagattcccttgtactccttcttcaggtt 479 |||||| || || ||||| ||||| |||||| |||| || ||||||||||| || ||||| Sbjct: 908 ctggaaaaatggaatgatctcctcttgccagtagatgcctttgtactcctttttaaggtt 849 Query: 480 cacgaacgggttgctggccttgctgtgccagatgtagggcagccccgtcttgactccgag 539 || || |||||||| || ||||||||||| |||||||| | || |||||||| ||||| Sbjct: 848 aacaaaggggttgcttgctttgctgtgccatatgtagggtaaaccagtcttgacaccgag 789 Query: 540 cccaaggtggtcgcagatcaccttaacacaccagccggcccacatgttcgtcgtagcgtc 599 || | |||||||| |||||||| | |||||| || |||||||| |||||||| || | Sbjct: 788 tcccaaatggtcgcatatcaccttgatacaccaaccagcccacat-atcgtcgtatcgac 730 Query: 600 cgatgggctggccgtcgcccatgaggcccgaagtacatggccgggccgatgagctcgcgg 659 | || ||||| || || ||||||||| || |||||||| || || || || ||||| ||| Sbjct: 729 caattggctgaccatcacccatgagg-ccaaagtacattgcaggtccaatcagctcacgg 671 Query: 660 tcgaa 664 ||||| Sbjct: 670 tcgaa 666
>ref|NM_180213.1| Arabidopsis thaliana unknown protein AT3G08890 transcript variant AT3G08890.2 mRNA, complete cds Length = 966 Score = 93.7 bits (47), Expect = 7e-16 Identities = 83/95 (87%) Strand = Plus / Plus Query: 442 tcctgccagaagattcccttgtactccttcttcaggttcacgaacgggttgctggccttg 501 |||||||| || ||||| ||||| ||||| |||||||||||||| ||||||||||| ||| Sbjct: 786 tcctgccaaaatattccgttgtattcctttttcaggttcacgaatgggttgctggctttg 845 Query: 502 ctgtgccagatgtagggcagccccgtcttgactcc 536 |||||||| ||||| |||| |||||||| ||||| Sbjct: 846 ctgtgccatatgtaaggcaaacccgtcttcactcc 880
>gb|DQ415922.1| Cleome spinosa clone BAC Cs1, complete sequence Length = 146078 Score = 93.7 bits (47), Expect = 7e-16 Identities = 119/143 (83%) Strand = Plus / Minus Query: 420 ctggaagaaggggatgatgtcctcctgccagaagattcccttgtactccttcttcaggtt 479 ||||||||| ||||| || || || |||||||| || || ||||| |||||||||||||| Sbjct: 22443 ctggaagaatgggattatctcttcttgccagaaaatgcctttgtattccttcttcaggtt 22384 Query: 480 cacgaacgggttgctggccttgctgtgccagatgtagggcagccccgtcttgactccgag 539 ||| ||||||||||| ||||||||||| | |||||||||| || ||||| || || | Sbjct: 22383 cacaaacgggttgctcgccttgctgtggtaaatgtagggcaagcctgtcttcacacccat 22324 Query: 540 cccaaggtggtcgcagatcacct 562 || |||||||| |||||||||| Sbjct: 22323 gcccaggtggtcacagatcacct 22301 Score = 63.9 bits (32), Expect = 6e-07 Identities = 76/88 (86%), Gaps = 2/88 (2%) Strand = Plus / Minus Query: 559 accttaacacaccagccggcccacatgttcgtcgtagcgtccgatgggctggccgtcgcc 618 |||||||| ||||| || |||||||| | ||||||||||||| || |||||||| || || Sbjct: 22197 accttaacgcaccaaccagcccacatat-cgtcgtagcgtccaataggctggccatcacc 22139 Query: 619 catgaggcccgaagtacatggccgggcc 646 ||||| | || ||||||||||||||||| Sbjct: 22138 catga-gaccaaagtacatggccgggcc 22112
>gb|AC010871.7|ATAC010871 Arabidopsis thaliana chromosome III BAC T16O11 genomic sequence, complete sequence Length = 80381 Score = 93.7 bits (47), Expect = 7e-16 Identities = 83/95 (87%) Strand = Plus / Minus Query: 442 tcctgccagaagattcccttgtactccttcttcaggttcacgaacgggttgctggccttg 501 |||||||| || ||||| ||||| ||||| |||||||||||||| ||||||||||| ||| Sbjct: 47977 tcctgccaaaatattccgttgtattcctttttcaggttcacgaatgggttgctggctttg 47918 Query: 502 ctgtgccagatgtagggcagccccgtcttgactcc 536 |||||||| ||||| |||| |||||||| ||||| Sbjct: 47917 ctgtgccatatgtaaggcaaacccgtcttcactcc 47883
>emb|BX831174.1|CNS09ZDG Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS64ZH06 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1341 Score = 93.7 bits (47), Expect = 7e-16 Identities = 77/87 (88%) Strand = Plus / Minus Query: 420 ctggaagaaggggatgatgtcctcctgccagaagattcccttgtactccttcttcaggtt 479 ||||||||| || ||||| ||||||||| |||||||||||||||| |||||||||||||| Sbjct: 937 ctggaagaacggaatgatctcctcctgcgagaagattcccttgtattccttcttcaggtt 878 Query: 480 cacgaacgggttgctggccttgctgtg 506 || || |||||||| || |||||||| Sbjct: 877 aacaaaagggttgctcgctttgctgtg 851
>emb|BX830856.1|CNS09ZF4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS31ZC08 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1348 Score = 93.7 bits (47), Expect = 7e-16 Identities = 77/87 (88%) Strand = Plus / Minus Query: 420 ctggaagaaggggatgatgtcctcctgccagaagattcccttgtactccttcttcaggtt 479 ||||||||| || ||||| |||||||||||||||||||||||||| |||||||||||||| Sbjct: 927 ctggaagaacggaatgatctcctcctgccagaagattcccttgtattccttcttcaggtt 868 Query: 480 cacgaacgggttgctggccttgctgtg 506 || || |||| ||| || |||||||| Sbjct: 867 aacaaaagggtcgctcgctttgctgtg 841
>dbj|AB154534.1| Cucumis melo 8C01 mRNA for hypothetical protein, partial cds Length = 395 Score = 91.7 bits (46), Expect = 3e-15 Identities = 136/162 (83%), Gaps = 3/162 (1%) Strand = Plus / Minus Query: 464 actccttcttcaggttcacgaacgggttgctggccttgctgtgccagatgtagggcagcc 523 ||||||| || ||||||||||| ||||||||||| ||||||||||| |||||||| |||| Sbjct: 395 actcctttttgaggttcacgaatgggttgctggctttgctgtgccatatgtagggaagcc 336 Query: 524 ccgtcttgact-ccgagcccaaggtggtcgcagatcaccttaacacaccagccggcccac 582 | || || ||| || | ||||| ||||| || || |||||||||||||| ||||||||| Sbjct: 335 ctgttttcactccccatcccaa-atggtcacaaattaccttaacacaccaaccggcccac 277 Query: 583 atgttcgtcgtagcgtccgatgggctggccgtcgcccatgag 624 ||| || ||||| | ||| || |||||||| || |||||||| Sbjct: 276 atg-tcatcgtatcttccaattggctggccatcacccatgag 236
>emb|AJ310910.1|STU310910 Solanum tuberosum mRNA for UDP-Glucose:protein transglucosylase (uptg2 gene) Length = 1303 Score = 87.7 bits (44), Expect = 4e-14 Identities = 187/232 (80%), Gaps = 2/232 (0%) Strand = Plus / Minus Query: 433 atgatgtcctcctgccagaagattcccttgtactccttcttcaggttcacgaacgggttg 492 ||||| ||||| |||||| |||| || ||||||||||| || ||||| || || |||||| Sbjct: 906 atgatctcctcttgccagtagatgcctttgtactcctttttaaggttaacaaaggggttg 847 Query: 493 ctggccttgctgtgccagatgtagggcagccccgtcttgactccgagcccaaggtggtcg 552 || || ||||||||||| |||||||| | || |||||||| ||||| || | |||||| Sbjct: 846 cttgctttgctgtgccatatgtagggtaaaccagtcttgacaccgagtcccaaatggtcg 787 Query: 553 cagatcaccttaacacaccagccggcccacatgttcgtcgtagcgtccgatgggctggcc 612 || || ||||| | |||||| || |||||||| |||||||| || || || ||||| || Sbjct: 786 catatgaccttgatacaccaaccagcccacat-atcgtcgtatcgaccaattggctgacc 728 Query: 613 gtcgcccatgaggcccgaagtacatggccgggccgatgagctcgcggtcgaa 664 || ||||||||| || |||||||| || || || || ||||| |||||||| Sbjct: 727 atcacccatgagg-ccaaagtacattgcaggtccaatcagctcacggtcgaa 677
>gb|AF005278.1|AF005278 Vigna unguiculata type IIIa membrane protein cp-wap11 mRNA, complete cds Length = 1461 Score = 81.8 bits (41), Expect = 3e-12 Identities = 165/205 (80%), Gaps = 1/205 (0%) Strand = Plus / Minus Query: 420 ctggaagaaggggatgatgtcctcctgccagaagattcccttgtactccttcttcaggtt 479 |||||| || ||||| ||||| || |||||||| || || |||||||| ||| ||||||| Sbjct: 957 ctggaaaaatgggataatgtcttcttgccagaatatgcctttgtactctttcctcaggtt 898 Query: 480 cacgaacgggttgctggccttgctgtgccagatgtagggcagccccgtcttgactccgag 539 ||| || |||||||||||||||||||| |||| || |||| || ||||||| ||| | Sbjct: 897 cacaaatgggttgctggccttgctgtgatagatataaggcaaaccagtcttgattcccaa 838 Query: 540 cccaaggtggtcgcagatcaccttaacacaccagccggcccacatgttcgtcgtagcgtc 599 || | ||| || ||||| ||||| ||||| || ||||||||| || |||||||||| Sbjct: 837 tcccaagtgatcacagattaccttgcagcaccaaccagcccacatg-tcatcgtagcgtc 779 Query: 600 cgatgggctggccgtcgcccatgag 624 | || |||||||| || |||||||| Sbjct: 778 caataggctggccatcacccatgag 754
>gb|AY341443.1| Phaseolus vulgaris cultivar Sprite BAC 78L17, partial sequence Length = 106592 Score = 77.8 bits (39), Expect = 4e-11 Identities = 75/87 (86%) Strand = Plus / Plus Query: 420 ctggaagaaggggatgatgtcctcctgccagaagattcccttgtactccttcttcaggtt 479 ||||||||| ||||| ||||| || |||||||| || || |||||||| ||| ||||||| Sbjct: 48231 ctggaagaatgggataatgtcttcttgccagaatatgcctttgtactctttcctcaggtt 48290 Query: 480 cacgaacgggttgctggccttgctgtg 506 || || |||||||||||||||||||| Sbjct: 48291 tacaaatgggttgctggccttgctgtg 48317 Score = 42.1 bits (21), Expect = 2.4 Identities = 49/57 (85%), Gaps = 1/57 (1%) Strand = Plus / Plus Query: 568 caccagccggcccacatgttcgtcgtagcgtccgatgggctggccgtcgcccatgag 624 |||||||| |||||||||| | ||||||||||| || ||||| || || |||||||| Sbjct: 48486 caccagccagcccacatgt-catcgtagcgtccaataggctgaccatcacccatgag 48541
>emb|AJ292078.1|GHI292078 Gossypium hirsutum mRNA for reversibly glycosylated polypeptide (rgp1 gene) Length = 1331 Score = 71.9 bits (36), Expect = 3e-09 Identities = 78/92 (84%) Strand = Plus / Minus Query: 445 tgccagaagattcccttgtactccttcttcaggttcacgaacgggttgctggccttgctg 504 |||||| | ||||| ||||| || ||||| |||||||| ||||||||||| || |||||| Sbjct: 904 tgccagtaaattcctttgtattctttcttaaggttcacaaacgggttgctcgctttgctg 845 Query: 505 tgccagatgtagggcagccccgtcttgactcc 536 ||||| |||||||| || || ||||| ||||| Sbjct: 844 tgccaaatgtagggaagtccggtcttcactcc 813
>gb|U31565.1|PSU31565 Pisum sativum reversibly glycosylatable polypeptide (RGP1) mRNA, complete cds Length = 1298 Score = 61.9 bits (31), Expect = 3e-06 Identities = 61/71 (85%) Strand = Plus / Minus Query: 445 tgccagaagattcccttgtactccttcttcaggttcacgaacgggttgctggccttgctg 504 ||||||||||| || ||||||||||| ||||| || || || |||||||| || |||||| Sbjct: 878 tgccagaagatacctttgtactcctttttcagattaacaaatgggttgcttgctttgctg 819 Query: 505 tgccagatgta 515 ||||| ||||| Sbjct: 818 tgccaaatgta 808
>ref|NM_124453.2| Arabidopsis thaliana RGP4 (reversibly glycosylated polypeptide 4); alpha-1,4-glucan-protein synthase (UDP-forming) AT5G50750 (RGP4) mRNA, complete cds Length = 1359 Score = 60.0 bits (30), Expect = 1e-05 Identities = 48/54 (88%) Strand = Plus / Minus Query: 456 tcccttgtactccttcttcaggttcacgaacgggttgctggccttgctgtgcca 509 |||||| | ||| ||||||||||||||||| ||||| ||||| ||||||||||| Sbjct: 929 tcccttatgctctttcttcaggttcacgaatgggttactggctttgctgtgcca 876
>gb|AF329280.1|AF329280 Arabidopsis thaliana reversibly glycosylated polypeptide RGP-4 (RGP4) mRNA, complete cds Length = 1251 Score = 60.0 bits (30), Expect = 1e-05 Identities = 48/54 (88%) Strand = Plus / Minus Query: 456 tcccttgtactccttcttcaggttcacgaacgggttgctggccttgctgtgcca 509 |||||| | ||| ||||||||||||||||| ||||| ||||| ||||||||||| Sbjct: 867 tcccttatgctctttcttcaggttcacgaatgggttactggctttgctgtgcca 814
>gb|BT005194.1| Arabidopsis thaliana clone U20586 putative UDP-glucose (At5g50750) mRNA, complete cds Length = 1126 Score = 60.0 bits (30), Expect = 1e-05 Identities = 48/54 (88%) Strand = Plus / Minus Query: 456 tcccttgtactccttcttcaggttcacgaacgggttgctggccttgctgtgcca 509 |||||| | ||| ||||||||||||||||| ||||| ||||| ||||||||||| Sbjct: 855 tcccttatgctctttcttcaggttcacgaatgggttactggctttgctgtgcca 802
>gb|BT004025.1| Arabidopsis thaliana clone RAFL15-21-J03 (R20586) putative UDP-glucose:protein transglucosylase (At5g50750) mRNA, complete cds Length = 1317 Score = 60.0 bits (30), Expect = 1e-05 Identities = 48/54 (88%) Strand = Plus / Minus Query: 456 tcccttgtactccttcttcaggttcacgaacgggttgctggccttgctgtgcca 509 |||||| | ||| ||||||||||||||||| ||||| ||||| ||||||||||| Sbjct: 893 tcccttatgctctttcttcaggttcacgaatgggttactggctttgctgtgcca 840
>dbj|AB023037.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MFB16 Length = 66087 Score = 60.0 bits (30), Expect = 1e-05 Identities = 48/54 (88%) Strand = Plus / Minus Query: 456 tcccttgtactccttcttcaggttcacgaacgggttgctggccttgctgtgcca 509 |||||| | ||| ||||||||||||||||| ||||| ||||| ||||||||||| Sbjct: 46377 tcccttatgctctttcttcaggttcacgaatgggttactggctttgctgtgcca 46324
>emb|BX833063.1|CNS09Z8Z Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL32ZC09 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1228 Score = 50.1 bits (25), Expect = 0.010 Identities = 34/37 (91%) Strand = Plus / Minus Query: 469 ttcttcaggttcacgaacgggttgctggccttgctgt 505 ||||||||||||||||| ||||| ||||| ||||||| Sbjct: 857 ttcttcaggttcacgaatgggttactggctttgctgt 821
>gb|AY389569.1| Hyacinthus orientalis reversibly glycosylated polypeptide (RGP) mRNA, partial cds Length = 642 Score = 48.1 bits (24), Expect = 0.039 Identities = 67/80 (83%), Gaps = 1/80 (1%) Strand = Plus / Minus Query: 587 tcgtcgtagcgtccgatgggctggccgtcgcccatgaggcccgaagtacatggccgggcc 646 ||||||||||| || || ||||| || || ||||||| |||| |||||||| || ||||| Sbjct: 571 tcgtcgtagcggccaataggctgcccatcacccatga-gcccaaagtacattgcagggcc 513 Query: 647 gatgagctcgcggtcgaagg 666 || ||||| |||||||||| Sbjct: 512 aataagctctcggtcgaagg 493
>ref|XM_951880.1| Neurospora crassa OR74A hypothetical protein (NCU01524.1) partial mRNA Length = 978 Score = 46.1 bits (23), Expect = 0.15 Identities = 29/31 (93%) Strand = Plus / Minus Query: 331 tcgatcttgccgagcttctccttgacctgct 361 |||| |||||||||| ||||||||||||||| Sbjct: 914 tcgagcttgccgagcctctccttgacctgct 884
>ref|XM_327962.1| Neurospora crassa OR74A hypothetical protein (NCU01524.1) partial mRNA Length = 978 Score = 46.1 bits (23), Expect = 0.15 Identities = 29/31 (93%) Strand = Plus / Minus Query: 331 tcgatcttgccgagcttctccttgacctgct 361 |||| |||||||||| ||||||||||||||| Sbjct: 914 tcgagcttgccgagcctctccttgacctgct 884
>emb|AL670003.1|NCB9G16 Neurospora crassa DNA linkage group II BAC clone B9G16 Length = 69187 Score = 46.1 bits (23), Expect = 0.15 Identities = 29/31 (93%) Strand = Plus / Minus Query: 331 tcgatcttgccgagcttctccttgacctgct 361 |||| |||||||||| ||||||||||||||| Sbjct: 34156 tcgagcttgccgagcctctccttgacctgct 34126
>gb|AY183095.1| Trifolium repens clone ca876 microsatellite sequence Length = 533 Score = 44.1 bits (22), Expect = 0.60 Identities = 81/98 (82%), Gaps = 2/98 (2%) Strand = Plus / Minus Query: 567 acaccagccggcccacatgttcgtcgtagcgtccgatgggctggccgtcgcccatgaggc 626 ||||||||| |||||||||| | ||||||||||| || ||||| || || ||||| || | Sbjct: 276 acaccagccagcccacatgt-catcgtagcgtccaataggctgaccatcacccataagac 218 Query: 627 ccgaagtacatggccgggccgatgagctcgcggtcgaa 664 | |||||||| || || ||||||||||| || ||||| Sbjct: 217 ca-aagtacattgcgggtccgatgagctcacgatcgaa 181
>ref|XM_001002588.1| PREDICTED: Mus musculus thyroid hormone receptor associated protein 1 (Thrap1), mRNA Length = 11787 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 250 tccttggagtccttggagttg 270 ||||||||||||||||||||| Sbjct: 3046 tccttggagtccttggagttg 3026
>ref|XM_914330.2| PREDICTED: Mus musculus thyroid hormone receptor associated protein 1, transcript variant 6 (Thrap1), mRNA Length = 11727 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 250 tccttggagtccttggagttg 270 ||||||||||||||||||||| Sbjct: 2986 tccttggagtccttggagttg 2966
>ref|XM_109726.8| PREDICTED: Mus musculus thyroid hormone receptor associated protein 1, transcript variant 1 (Thrap1), mRNA Length = 11787 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 250 tccttggagtccttggagttg 270 ||||||||||||||||||||| Sbjct: 3046 tccttggagtccttggagttg 3026
>gb|AY225142.1| Feldmannia irregularis virus a strain FirrV-1 contig J, partial sequence Length = 1702 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 250 tccttggagtccttggagttg 270 ||||||||||||||||||||| Sbjct: 488 tccttggagtccttggagttg 468
>emb|BX640450.1| Bordetella bronchiseptica strain RB50, complete genome; segment 14/16 Length = 346287 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 300 catggcgtcggcgagcttgacgaag 324 |||||||||||||| |||||||||| Sbjct: 307938 catggcgtcggcgaccttgacgaag 307914
>emb|BX640435.1| Bordetella parapertussis strain 12822, complete genome; segment 13/14 Length = 346259 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 300 catggcgtcggcgagcttgacgaag 324 |||||||||||||| |||||||||| Sbjct: 226822 catggcgtcggcgaccttgacgaag 226798
>emb|BX640412.1| Bordetella pertussis strain Tohama I, complete genome; segment 2/12 Length = 348171 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 300 catggcgtcggcgagcttgacgaag 324 |||||||||||||| |||||||||| Sbjct: 21850 catggcgtcggcgaccttgacgaag 21874
>emb|AL592065.7| Mouse DNA sequence from clone RP23-50E4 on chromosome 11 Contains the 3' end of a novel gene, two novel genes, the 5' end of the Brip1 gene for BRCA1 interacting protein C-terminal helicase 1 and a mitochondrial F0 complex H+ transporting ATP synthase subunit g (Atp5l) pseudogene, complete sequence Length = 200624 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 250 tccttggagtccttggagttg 270 ||||||||||||||||||||| Sbjct: 16000 tccttggagtccttggagttg 15980
>gb|AC018628.13| Homo sapiens chromosome 17, clone RP11-342K2, complete sequence Length = 104030 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 250 tccttggagtccttggagttg 270 ||||||||||||||||||||| Sbjct: 58265 tccttggagtccttggagttg 58245
>gb|AC060798.10| Homo sapiens chromosome 17, clone RP11-615P24, complete sequence Length = 171994 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 tccttggagtccttggagttg 270 ||||||||||||||||||||| Sbjct: 168564 tccttggagtccttggagttg 168584
>gb|AC112249.4| Homo sapiens BAC clone RP11-688H10 from 4, complete sequence Length = 146551 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 4 atgaaattaaagaaggggaaa 24 ||||||||||||||||||||| Sbjct: 9860 atgaaattaaagaaggggaaa 9880
>dbj|AK037303.1| Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A130004J07 product:thyroid hormone receptor associated protein 1, full insert sequence Length = 3958 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 250 tccttggagtccttggagttg 270 ||||||||||||||||||||| Sbjct: 256 tccttggagtccttggagttg 236
>emb|AL929031.3| Zebrafish DNA sequence from clone CH211-255L18 in linkage group 17, complete sequence Length = 187548 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 508 cagatgtagggcagccccgtc 528 ||||||||||||||||||||| Sbjct: 116745 cagatgtagggcagccccgtc 116725
>dbj|AB011165.2| Homo sapiens mRNA for KIAA0593 protein, partial cds Length = 8099 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 250 tccttggagtccttggagttg 270 ||||||||||||||||||||| Sbjct: 2544 tccttggagtccttggagttg 2524
>gb|AF117754.1|AF117754 Homo sapiens thyroid hormone receptor-associated protein complex component TRAP240 mRNA, complete cds Length = 7389 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 250 tccttggagtccttggagttg 270 ||||||||||||||||||||| Sbjct: 3126 tccttggagtccttggagttg 3106
>ref|NM_005121.1| Homo sapiens thyroid hormone receptor associated protein 1 (THRAP1), mRNA Length = 7389 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 250 tccttggagtccttggagttg 270 ||||||||||||||||||||| Sbjct: 3126 tccttggagtccttggagttg 3106
>ref|XM_515469.1| PREDICTED: Pan troglodytes LOC459225 (LOC459225), mRNA Length = 986 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 356 cctgctgcgagagcgagatg 375 |||||||||||||||||||| Sbjct: 143 cctgctgcgagagcgagatg 162
>ref|NM_004801.2| Homo sapiens neurexin 1 (NRXN1), transcript variant alpha, mRNA Length = 6202 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 356 cctgctgcgagagcgagatg 375 |||||||||||||||||||| Sbjct: 335 cctgctgcgagagcgagatg 354
>ref|XM_472724.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 582 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 608 tggccgtcgcccatgaggcc 627 |||||||||||||||||||| Sbjct: 278 tggccgtcgcccatgaggcc 259
>gb|AE008393.1| Streptococcus pneumoniae R6 section 9 of 184 of the complete genome Length = 11734 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 455 ttcccttgtactccttcttc 474 |||||||||||||||||||| Sbjct: 2431 ttcccttgtactccttcttc 2412
>ref|NM_174404.2| Bos taurus neurexin 1 (NRXN1), mRNA Length = 6349 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 356 cctgctgcgagagcgagatg 375 |||||||||||||||||||| Sbjct: 1435 cctgctgcgagagcgagatg 1454
>gb|AC108504.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1654_B10, complete sequence Length = 140282 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 609 ggccgtcgcccatgaggccc 628 |||||||||||||||||||| Sbjct: 19054 ggccgtcgcccatgaggccc 19035
>ref|XM_865667.1| PREDICTED: Bos taurus similar to neurexin 1 isoform alpha precursor (LOC614246), partial mRNA Length = 913 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 356 cctgctgcgagagcgagatg 375 |||||||||||||||||||| Sbjct: 284 cctgctgcgagagcgagatg 303
>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome Length = 2584158 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 644 gccgatgagctcgcggtcga 663 |||||||||||||||||||| Sbjct: 1694836 gccgatgagctcgcggtcga 1694855
>gb|BC046631.1| Homo sapiens neurexin 1, mRNA (cDNA clone IMAGE:4815048), complete cds Length = 5169 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 356 cctgctgcgagagcgagatg 375 |||||||||||||||||||| Sbjct: 1206 cctgctgcgagagcgagatg 1225
>ref|XM_847010.1| PREDICTED: Canis familiaris similar to neurexin 1 isoform alpha precursor, transcript variant 2 (LOC474589), mRNA Length = 5663 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 356 cctgctgcgagagcgagatg 375 |||||||||||||||||||| Sbjct: 143 cctgctgcgagagcgagatg 162
>ref|XM_859895.1| PREDICTED: Canis familiaris similar to neurexin 1 isoform alpha precursor, transcript variant 5 (LOC474589), mRNA Length = 5615 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 356 cctgctgcgagagcgagatg 375 |||||||||||||||||||| Sbjct: 143 cctgctgcgagagcgagatg 162
>ref|XM_531818.2| PREDICTED: Canis familiaris similar to neurexin 1 isoform alpha precursor, transcript variant 1 (LOC474589), mRNA Length = 5504 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 356 cctgctgcgagagcgagatg 375 |||||||||||||||||||| Sbjct: 143 cctgctgcgagagcgagatg 162
>gb|AC118248.11| Mus musculus chromosome 8, clone RP23-379H17, complete sequence Length = 182510 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 529 ttgactccgagcccaaggtg 548 |||||||||||||||||||| Sbjct: 11394 ttgactccgagcccaaggtg 11413
>gb|AC121966.2| Mus musculus BAC clone RP24-267N15 from 12, complete sequence Length = 163521 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 286 tcgatccaggtgaccatggc 305 |||||||||||||||||||| Sbjct: 66303 tcgatccaggtgaccatggc 66322
>gb|AC142349.1| Pan troglodytes BAC clone RP43-9F6 from 7, complete sequence Length = 192143 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 186 aatgcaaaaaaggttctctc 205 |||||||||||||||||||| Sbjct: 170353 aatgcaaaaaaggttctctc 170334
>emb|AL451081.5| Human DNA sequence from clone RP11-302I18 on chromosome 1 Contains a thyroid autoantigen 70kDa (Ku antigen) (G22P1) pseudogene, a ribosomal protein, large, P0 (RPLP0) pseudogene and a novel gene, complete sequence Length = 76193 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 7 aaattaaagaaggggaaaat 26 |||||||||||||||||||| Sbjct: 38508 aaattaaagaaggggaaaat 38527
>ref|XM_964572.1| PREDICTED: Tribolium castaneum similar to CG1212-PA, isoform A (LOC658163), mRNA Length = 2158 Score = 40.1 bits (20), Expect = 9.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 238 ttggcgtcggcctccttggagtcc 261 |||||| ||||||||||||||||| Sbjct: 1456 ttggcgacggcctccttggagtcc 1433
>emb|AL731584.3|OSJN00224 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0006M15, complete sequence Length = 143109 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 608 tggccgtcgcccatgaggcc 627 |||||||||||||||||||| Sbjct: 141629 tggccgtcgcccatgaggcc 141610
>emb|AL606636.4|OSJN00075 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0036B21, complete sequence Length = 138969 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 608 tggccgtcgcccatgaggcc 627 |||||||||||||||||||| Sbjct: 13208 tggccgtcgcccatgaggcc 13189
>emb|AJ719696.1| Gallus gallus mRNA for hypothetical protein, clone 5g4 Length = 1896 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 attaaagaaggggaaaatta 28 |||||||||||||||||||| Sbjct: 1715 attaaagaaggggaaaatta 1734
>ref|NM_001006185.1| Gallus gallus DEAD (Asp-Glu-Ala-Asp) box polypeptide 55 (DDX55), mRNA Length = 1896 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 attaaagaaggggaaaatta 28 |||||||||||||||||||| Sbjct: 1715 attaaagaaggggaaaatta 1734
>dbj|AK124726.1| Homo sapiens cDNA FLJ42736 fis, clone BRAWH2015866, highly similar to Homo sapiens mRNA for neurexin I-alpha protein Length = 2543 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 356 cctgctgcgagagcgagatg 375 |||||||||||||||||||| Sbjct: 1620 cctgctgcgagagcgagatg 1639
>ref|XM_688508.1| PREDICTED: Danio rerio similar to talin 2 (LOC565220), partial mRNA Length = 1186 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 589 gtcgtagcgtccgatgggct 608 |||||||||||||||||||| Sbjct: 234 gtcgtagcgtccgatgggct 215
>gb|AC020687.6| Homo sapiens chromosome 15, clone RP11-648K4, complete sequence Length = 169571 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 cctccttggagtccttggag 267 |||||||||||||||||||| Sbjct: 160724 cctccttggagtccttggag 160743
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 608 tggccgtcgcccatgaggcc 627 |||||||||||||||||||| Sbjct: 22804433 tggccgtcgcccatgaggcc 22804414
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 40.1 bits (20), Expect = 9.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 421 tggaagaaggggatgatgtcctcc 444 ||||||||||||||||||| |||| Sbjct: 12959926 tggaagaaggggatgatgttctcc 12959903
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 609 ggccgtcgcccatgaggccc 628 |||||||||||||||||||| Sbjct: 746612 ggccgtcgcccatgaggccc 746593
>gb|AC007682.3| Homo sapiens BAC clone RP11-391D19 from 2, complete sequence Length = 189968 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 356 cctgctgcgagagcgagatg 375 |||||||||||||||||||| Sbjct: 159072 cctgctgcgagagcgagatg 159053
>ref|XM_220813.3| PREDICTED: Rattus norvegicus thyroid hormone receptor associated protein 1 (predicted) (Thrap1_predicted), mRNA Length = 9511 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 250 tccttggagtccttggagtt 269 |||||||||||||||||||| Sbjct: 4009 tccttggagtccttggagtt 3990
>gb|CP000252.1| Syntrophus aciditrophicus SB, complete genome Length = 3179300 Score = 40.1 bits (20), Expect = 9.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 431 ggatgatgtcctcctgccagaaga 454 |||||||||||||| ||||||||| Sbjct: 1997582 ggatgatgtcctccagccagaaga 1997559
>dbj|AP003619.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0577H07 Length = 126757 Score = 40.1 bits (20), Expect = 9.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 421 tggaagaaggggatgatgtcctcc 444 ||||||||||||||||||| |||| Sbjct: 42303 tggaagaaggggatgatgttctcc 42280
>emb|AL935324.8| Zebrafish DNA sequence from clone CH211-197B6 in linkage group 10, complete sequence Length = 197730 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 6 gaaattaaagaaggggaaaa 25 |||||||||||||||||||| Sbjct: 135260 gaaattaaagaaggggaaaa 135279
>dbj|AK065178.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002D12, full insert sequence Length = 895 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 608 tggccgtcgcccatgaggcc 627 |||||||||||||||||||| Sbjct: 376 tggccgtcgcccatgaggcc 357
>emb|CR855192.10| Zebrafish DNA sequence from clone DKEY-202P3 in linkage group 10, complete sequence Length = 85127 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 6 gaaattaaagaaggggaaaa 25 |||||||||||||||||||| Sbjct: 75606 gaaattaaagaaggggaaaa 75625
>gb|AC140250.3| Mus musculus BAC clone RP24-288J3 from 1, complete sequence Length = 163490 Score = 40.1 bits (20), Expect = 9.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 262 ttggagttgagcatgtcccaggcc 285 |||||||||||| ||||||||||| Sbjct: 56795 ttggagttgagcctgtcccaggcc 56818
>gb|L14855.1|BOVNEURXIA Bos taurus neurexin I-alpha mRNA, complete cds Length = 6349 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 356 cctgctgcgagagcgagatg 375 |||||||||||||||||||| Sbjct: 1435 cctgctgcgagagcgagatg 1454
>gb|AC093921.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0041A22, complete sequence Length = 117919 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 609 ggccgtcgcccatgaggccc 628 |||||||||||||||||||| Sbjct: 91793 ggccgtcgcccatgaggccc 91774
>dbj|AB035356.1| Homo sapiens mRNA for neurexin I-alpha protein, complete cds Length = 6206 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 356 cctgctgcgagagcgagatg 375 |||||||||||||||||||| Sbjct: 335 cctgctgcgagagcgagatg 354
>dbj|AB011150.2| Homo sapiens mRNA for KIAA0578 protein, partial cds Length = 8114 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 356 cctgctgcgagagcgagatg 375 |||||||||||||||||||| Sbjct: 326 cctgctgcgagagcgagatg 345 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,778,794 Number of Sequences: 3902068 Number of extensions: 4778794 Number of successful extensions: 106710 Number of sequences better than 10.0: 118 Number of HSP's better than 10.0 without gapping: 116 Number of HSP's successfully gapped in prelim test: 2 Number of HSP's that attempted gapping in prelim test: 106132 Number of HSP's gapped (non-prelim): 545 length of query: 688 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 665 effective length of database: 17,143,297,704 effective search space: 11400292973160 effective search space used: 11400292973160 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
