| Clone Name | rbaak4p05 |
|---|---|
| Clone Library Name | barley_pub |
>emb|X97917.1|HVBLT142 H.vulgare blt14.2 gene Length = 687 Score = 571 bits (288), Expect = e-160 Identities = 297/300 (99%) Strand = Plus / Minus Query: 12 cggatacaaacgctcattgaggaacgtggacatgagcgaaacgcaggtgtttttcttccg 71 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 627 cggatacaaacgctcattgaggaacgtggacatgagcgaaacgcaggtgtttttcttccg 568 Query: 72 ggcgatgccggctatagaaatctagtaaaacccacaagttcagcttcagcttgtatgtat 131 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 567 ggcgatgccggctatagaaatctagtaaaacccacaagttcagcttcagcttgtatgtat 508 Query: 132 gtatgcaagtcagcacatgcacacaagatgatcatgcatgagtagggaccccaggaatca 191 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 507 gtatgcaagtcagcacatgcacacaagatgatcatgcatgagtaggggccccaggaatca 448 Query: 192 ccaccagcgggccgttaatggtactggtaccggtaccggttcccaccaccggcaagtccg 251 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 447 ccaccagcgggccgttaatggtactggtaccggtaccggttcccaccaccggcaagtccg 388 Query: 252 gcaaccccgaacccgaagaagccttggactcggcgacgccacctccggcgccggcaccac 311 ||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| Sbjct: 387 gcaaccccgaacccgaagaagacttggactcggggacgccacctccggcgccggcaccac 328
>emb|Z23258.1|SCACCPROA S.cereale acclimation protein mRNA, complete CDS Length = 479 Score = 101 bits (51), Expect = 1e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 181 cccaggaatcaccaccagcgggccgttaatggtactggtaccggtaccggttcccaccac 240 ||||||||||||||||||||||||||||||||||||||| |||||| ||| ||||| || Sbjct: 197 cccaggaatcaccaccagcgggccgttaatggtactggttccggtagtggtgcccacgac 138 Query: 241 cggcaagtccggcaa 255 ||||||||| ||||| Sbjct: 137 cggcaagtctggcaa 123 Score = 56.0 bits (28), Expect = 7e-05 Identities = 80/96 (83%), Gaps = 6/96 (6%) Strand = Plus / Minus Query: 35 acgtggacatgagcgaaacgcag--gtgtttttcttccgggcgatgccggctatagaaat 92 ||||||||||||||||||||| | ||||||| |||||||||| ||| | || |||| | Sbjct: 337 acgtggacatgagcgaaacgccggtgtgttttccttccgggcggtgctagttacagaagt 278 Query: 93 ctagtaaaacccacaagttcagcttcagcttgtatg 128 || ||| |||||||||| ||||||||||||||| Sbjct: 277 ct----aaagccacaagttctgcttcagcttgtatg 246
>gb|L28093.1|WHTCOREG Triticum aestivum pTACR7 (tacr7) mRNA, partial cds Length = 292 Score = 79.8 bits (40), Expect = 5e-12 Identities = 55/60 (91%) Strand = Plus / Minus Query: 175 agggaccccaggaatcaccaccagcgggccgttaatggtactggtaccggtaccggttcc 234 ||||| |||||||| |||||||||||||||| ||||||| |||||||||||| ||||||| Sbjct: 277 agggatcccaggaagcaccaccagcgggccggtaatggtgctggtaccggtaacggttcc 218
>gb|AF069331.2|AF069331 Hordeum vulgare clone BLTI-5 low temperature induced protein mRNA, complete cds Length = 546 Score = 79.8 bits (40), Expect = 5e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 158 gatgatcatgcatgagtagggaccccaggaatcaccaccagcgggccgttaatggtactg 217 |||||||||| |||| ||||| |||||||| |||||||| |||||||||| |||| ||| Sbjct: 336 gatgatcatgggtgagcagggatcccaggaagcaccaccaacgggccgttagtggtgctg 277 Query: 218 gtaccggtaccggttcccac 237 ||||||||| | |||||||| Sbjct: 276 gtaccggtaactgttcccac 257
>emb|AJ132439.1|TAE132439 Triticum aestivum mRNA for protein encoded by lt1.1 gene, partial Length = 416 Score = 73.8 bits (37), Expect = 3e-10 Identities = 55/61 (90%) Strand = Plus / Minus Query: 175 agggaccccaggaatcaccaccagcgggccgttaatggtactggtaccggtaccggttcc 234 ||||| |||||||| |||||||||||||||| ||||||| ||||| || ||||||||||| Sbjct: 164 agggatcccaggaagcaccaccagcgggccggtaatggtgctggttcccgtaccggttcc 105 Query: 235 c 235 | Sbjct: 104 c 104
>emb|X57554.1|HVBLT14 H. vulgare BLT14 mRNA Length = 514 Score = 73.8 bits (37), Expect = 3e-10 Identities = 55/61 (90%) Strand = Plus / Minus Query: 175 agggaccccaggaatcaccaccagcgggccgttaatggtactggtaccggtaccggttcc 234 ||||| |||||| |||||||||||||||||| ||||||| || || |||||||||||||| Sbjct: 253 agggatcccagggatcaccaccagcgggccggtaatggtgcttgttccggtaccggttcc 194 Query: 235 c 235 | Sbjct: 193 c 193
>gb|L28091.1|BLYTRA Hordeum vulgare transmembrane protein mRNA fragment Length = 541 Score = 73.8 bits (37), Expect = 3e-10 Identities = 55/61 (90%) Strand = Plus / Minus Query: 175 agggaccccaggaatcaccaccagcgggccgttaatggtactggtaccggtaccggttcc 234 ||||| |||||| |||||||||||||||||| ||||||| || || |||||||||||||| Sbjct: 282 agggatcccagggatcaccaccagcgggccggtaatggtgcttgttccggtaccggttcc 223 Query: 235 c 235 | Sbjct: 222 c 222
>emb|X97916.1|HVBLT141 H.vulgare blt14.1 gene Length = 963 Score = 65.9 bits (33), Expect = 7e-08 Identities = 66/77 (85%) Strand = Plus / Minus Query: 183 caggaatcaccaccagcgggccgttaatggtactggtaccggtaccggttcccaccaccg 242 |||||| |||||||| ||| ||| ||| ||| |||||||||||| |||||||||| | || Sbjct: 646 caggaagcaccaccaccggaccggtaacggtgctggtaccggtaacggttcccacaagcg 587 Query: 243 gcaagtccggcaacccc 259 |||| || ||||||||| Sbjct: 586 gcaactctggcaacccc 570
>gb|L28092.1|BLYTRAA Hordeum vulgare transmembrane protein mRNA fragment Length = 642 Score = 65.9 bits (33), Expect = 7e-08 Identities = 66/77 (85%) Strand = Plus / Minus Query: 183 caggaatcaccaccagcgggccgttaatggtactggtaccggtaccggttcccaccaccg 242 |||||| |||||||| ||| ||| ||| ||| |||||||||||| |||||||||| | || Sbjct: 337 caggaagcaccaccaccggaccggtaacggtgctggtaccggtaacggttcccacaagcg 278 Query: 243 gcaagtccggcaacccc 259 |||| || ||||||||| Sbjct: 277 gcaactctggcaacccc 261
>gb|M60733.1|BLYCLDAB Hordeum vulgare cold-regulated mRNA, partial cds Length = 770 Score = 63.9 bits (32), Expect = 3e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 157 agatgatcatgcatgagtagggaccccaggaatcaccaccagcgggccgttaatggtact 216 |||| |||||| |||| ||||||| | |||| |||||||| ||||||| |||||||||| Sbjct: 579 agataatcatgggtgagcagggaccgccggaagcaccaccaccgggccggtaatggtact 520 Query: 217 ggtaccggtaccggttccca 236 |||||| ||| |||||||| Sbjct: 519 ggtacccgtaatggttccca 500
>emb|Z23257.1|SCRLT141A S.cereale RLT1412 mRNA, complete CDS Length = 525 Score = 50.1 bits (25), Expect = 0.004 Identities = 49/57 (85%) Strand = Plus / Minus Query: 14 gatacaaacgctcattgaggaacgtggacatgagcgaaacgcaggtgtttttcttcc 70 |||||| ||||||||| |||||| || ||||||||||||| ||||||| |||||| Sbjct: 424 gatacagacgctcattaaggaacatgctaatgagcgaaacgccggtgtttatcttcc 368 Score = 40.1 bits (20), Expect = 4.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 103 ccacaagttcagcttcagcttgta 126 ||||||||||||||||| |||||| Sbjct: 336 ccacaagttcagcttcatcttgta 313
>dbj|BA000035.2| Corynebacterium efficiens YS-314 DNA, complete genome Length = 3147090 Score = 44.1 bits (22), Expect = 0.26 Identities = 22/22 (100%) Strand = Plus / Minus Query: 285 cgacgccacctccggcgccggc 306 |||||||||||||||||||||| Sbjct: 952639 cgacgccacctccggcgccggc 952618
>gb|AC164524.5| Mus musculus BAC RP23-438F8 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 180937 Score = 42.1 bits (21), Expect = 1.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 116 ttcagcttgtatgtatgtatg 136 ||||||||||||||||||||| Sbjct: 145342 ttcagcttgtatgtatgtatg 145322
>gb|AC155657.8| Mus musculus 6 BAC RP24-113L15 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 159299 Score = 42.1 bits (21), Expect = 1.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 116 ttcagcttgtatgtatgtatg 136 ||||||||||||||||||||| Sbjct: 141642 ttcagcttgtatgtatgtatg 141662
>gb|AF271260.1|AF271260 Triticum aestivum cold-responsive protein (Wlt10) mRNA, complete cds Length = 548 Score = 42.1 bits (21), Expect = 1.0 Identities = 36/41 (87%) Strand = Plus / Minus Query: 199 cgggccgttaatggtactggtaccggtaccggttcccacca 239 ||||||| |||| ||||||||||||||| || |||||||| Sbjct: 318 cgggccggtaattgtactggtaccggtaatggctcccacca 278 Score = 40.1 bits (20), Expect = 4.1 Identities = 32/36 (88%) Strand = Plus / Minus Query: 31 aggaacgtggacatgagcgaaacgcaggtgtttttc 66 |||||| |||||||||||| ||||| | |||||||| Sbjct: 422 aggaacatggacatgagcgcaacgccgatgtttttc 387
>gb|AC154237.1| Mus musculus BAC clone RP24-162O18 from 17, complete sequence Length = 168481 Score = 42.1 bits (21), Expect = 1.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 116 ttcagcttgtatgtatgtatg 136 ||||||||||||||||||||| Sbjct: 110671 ttcagcttgtatgtatgtatg 110691
>gb|AC164419.3| Mus musculus chromosome 5, clone RP23-309G12, complete sequence Length = 159565 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 123 tgtatgtatgtatgcaagtc 142 |||||||||||||||||||| Sbjct: 94335 tgtatgtatgtatgcaagtc 94316
>gb|AC027133.3| Oryza sativa (japonica cultivar-group) chromosome 12 clone OSJNBb0003F09, complete sequence Length = 159600 Score = 40.1 bits (20), Expect = 4.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 285 cgacgccacctccggcgccggcac 308 |||||||||||||| ||||||||| Sbjct: 144351 cgacgccacctccgccgccggcac 144328
>gb|AC102446.8| Mus musculus chromosome 5, clone RP24-201G17, complete sequence Length = 176748 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 123 tgtatgtatgtatgcaagtc 142 |||||||||||||||||||| Sbjct: 149398 tgtatgtatgtatgcaagtc 149379
>gb|AY568280.1| Halanaerobium congolense putative rhodanese-like protein gene, complete cds Length = 921 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 atgccggctatagaaatcta 95 |||||||||||||||||||| Sbjct: 797 atgccggctatagaaatcta 816
>gb|AC069292.12| Homo sapiens BAC clone RP11-648L18 from 7, complete sequence Length = 159624 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 209 atggtactggtaccggtacc 228 |||||||||||||||||||| Sbjct: 141710 atggtactggtaccggtacc 141691
>emb|AL360157.12| Human DNA sequence from clone RP11-801I18 on chromosome 6q14.2-16.1 Contains part of a novel gene, complete sequence Length = 197431 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 209 atggtactggtaccggtacc 228 |||||||||||||||||||| Sbjct: 72256 atggtactggtaccggtacc 72275
>emb|BX572607.1| Rhodopseudomonas palustris CGA009 complete genome; segment 15/16 Length = 345012 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 293 cctccggcgccggcaccacc 312 |||||||||||||||||||| Sbjct: 342634 cctccggcgccggcaccacc 342615
>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome Length = 7074893 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 accggtaccggttcccacca 239 |||||||||||||||||||| Sbjct: 5903024 accggtaccggttcccacca 5903005
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome Length = 5513844 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 284 gcgacgccacctccggcgcc 303 |||||||||||||||||||| Sbjct: 4249197 gcgacgccacctccggcgcc 4249216
>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome Length = 4712337 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 cgccacctccggcgccggca 307 |||||||||||||||||||| Sbjct: 2108436 cgccacctccggcgccggca 2108417
>emb|BX001031.19| Zebrafish DNA sequence from clone CH211-242A9, complete sequence Length = 192207 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 109 gttcagcttcagcttgtatg 128 |||||||||||||||||||| Sbjct: 44969 gttcagcttcagcttgtatg 44988
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 40.1 bits (20), Expect = 4.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 285 cgacgccacctccggcgccggcac 308 |||||||||||||| ||||||||| Sbjct: 27021965 cgacgccacctccgccgccggcac 27021942
>gb|U85056.1|HSU85056 Homo sapiens FSHD-associated repeat DNA, proximal region Length = 27574 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 116 ttcagcttgtatgtatgtat 135 |||||||||||||||||||| Sbjct: 17552 ttcagcttgtatgtatgtat 17533
>emb|BX897671.5| Zebrafish DNA sequence from clone CH211-214K5 in linkage group 4, complete sequence Length = 201108 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 111 tcagcttcagcttgtatgta 130 |||||||||||||||||||| Sbjct: 161677 tcagcttcagcttgtatgta 161696
>emb|BX005054.7| Zebrafish DNA sequence from clone DKEY-209N16 in linkage group 6, complete sequence Length = 230686 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 109 gttcagcttcagcttgtatg 128 |||||||||||||||||||| Sbjct: 190075 gttcagcttcagcttgtatg 190094
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 40.1 bits (20), Expect = 4.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 285 cgacgccacctccggcgccggcac 308 |||||||||||||| ||||||||| Sbjct: 26947554 cgacgccacctccgccgccggcac 26947531 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,862,721 Number of Sequences: 3902068 Number of extensions: 2862721 Number of successful extensions: 257544 Number of sequences better than 10.0: 32 Number of HSP's better than 10.0 without gapping: 32 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 257179 Number of HSP's gapped (non-prelim): 365 length of query: 312 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 290 effective length of database: 17,147,199,772 effective search space: 4972687933880 effective search space used: 4972687933880 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)